List database


# MySQL hash MySQL password
529,710,001 *3625091743DFF0E13B0E29A4BC16BE17BC6EBB7D clttm
529,710,002 *362C02459AA55FF76F81FE474CA854180CE5862B cmm3h
529,710,003 *36206978B20D2CB85F54D7F1875F81C25691D8E1 bqwk_
529,710,004 *362DE8612B28A5A8A45E16F24D1669E977F96D6F brendonherring
529,710,005 *36286676553B1C397546B11E307B60BF3850EEDF BRENT.FLAMIO
529,710,006 *3627DAA5F08448FADBFB435351F48D53BF35ECD9 BRENTON.LACHIATTO
529,710,007 *362E553285CA7AC2FE2C38E51AB3B166BB7EEEB5 BR-HD
529,710,008 *3625126E6B1D2B59368D84E0F91990157DD2C020 BROAD3N!NG$
529,710,009 *36286A6029400E84D84E33E78E06387313628B17 BROGLIOD
529,710,010 *36264537BD9F86BD655CF817643CCBFD93F82305 brookewindows
529,710,011 *3627626B0853DC06098348E4C765EB78840B2399 brrpa
529,710,012 *36230981FFD9E1BC70BEAE4EE0CBF4E9135CDD63 bryceserramo
529,710,013 *362B6198444E4F6E758B15BDFC1D4B553DE81714 [email protected]
529,710,014 *3625757E904D7509A1CD09D1005F59BCFB10E71C bswgalleguillosb
529,710,015 *3628B2BB0452EE928C2F2838A9A69EAEE2ACDBD7 cpkb,
529,710,016 *3622BC59B8351F0BBC6C3CC400897EDF9E6DF608 C:\Program.Files\Microsoft.Visual.Studio.9.0\VC\ce\include\cwchar
529,710,017 *3628B73CB2A503A267F56F780BC4ED37252DD607 buckdare
529,710,018 *3623C8C13142CF832FFD60A9A0CD90250D13803C CPT_%
529,710,019 *3623F995DAD8EA179CB3855A84FC072CCF93B4B0 BUMPS_B03.SVG
529,710,020 *3624132C15430FD4A3450BB7874CE04CE94BEDB0 CRAIGMOZLEY
529,710,021 *3625DAD067BE481F7BCEA42C4ECBEBFE5A58B358 BWJ!6
529,710,022 *362930209CA8011680E27249417FB5744C54C16F B++X
529,710,023 *3624C3F50430F7D2736225AFE2505FAFD72FD7A2 C=:U(
529,710,024 *362803B53C2B518F211AE91932BBB33737C1F99A cv5so
529,710,025 *362E128A4668DC806585539B99368DDC8E82EDFA c6mf$
529,710,026 *362A6ACB288C072EF5F01729DC67C63AC2C6FCEB C86L
529,710,027 *3627BE4C3236CDBDBDA4AF9DA5303E4E8E5BF30F CYOCRISTANGEL
529,710,028 *3625F24CEE8E10CEDD4E5C0EA842C987FD91B768 cyprian1234
529,710,029 *362BBBAF29729DF1921ACFC9DFC1985718A4352C CAREYZIMBA
529,710,030 *362CE4B0752CD63B11E84415721F609CB23A20C2 caribbees
529,710,031 *3627B3624520F61A5675FC6D15D003AFC3F4CD40 d3c4pt4ton$
529,710,032 *3621A304E8507EEDC56EE2C976B7F59F6F834735 carloscatalino
529,710,033 *362C99595BC4DAA1FDA4EA9CBCB9D8286588B2B0 d4c#z
529,710,034 *36239E774B53E151127EA6F7333FF1A326EB7E44 d)4p"
529,710,035 *3622348F3386698639DA48CA288964691FF98D5A D5I6O
529,710,036 *362B79D2DE0413AE6ADF56ED34309D1EDE2AB268 DANSES POLOVTSIENNES, DU "PRINCE IGOR"
529,710,037 *362E0BA00D93D10FBABD5BE3526D48A3134F0EE0 CENIZASDELALMA
529,710,038 *3627DE63E0E1A9991C47426F80E73296BFA3894C DARIO.DEREMER
529,710,039 *36256D99D9F0773B534421397B3E480444FF0737 cepolidae0
529,710,040 *362FDBF92ED9B18D09AE286C474EC8BFB487305C ce:y!
529,710,041 *36233809C0976D20DD9142B1D85A7143D6F54142 cfvwq
529,710,042 *362B32071E4827685F386D4E32466BB5A60CA761 d;/c7
529,710,043 *362EDB1C31EA13BEB8C090E476ADE79600B9430D d>c9
529,710,044 *362CD9D723E425AF2F2D105BD16A2D813A2CD90B dd-xk
529,710,045 *3621AD7746296E0B349A04227525AD6819D1F135 CHAUNCEYRIMMER
529,710,046 *362ED3E633BE97F778673078E59DB4D269A00551 decrescimentos
529,710,047 *3627641A8976A012E96A93403A4027192CC9EFB8 DEE.BAYNE
529,710,048 *362E7973242D11C10F26A3F9C22EC3279EFDF7E8 C!%HI
529,710,049 *362E131AE46FFF1C5DB0233660B8A809997B0E33 deliriummussitans
529,710,050 *3628EA74B78114535931DDFC226240D20AB38C17 CHRISTOPHER.FRYMIRE
529,710,051 *3628CEAA2E30307E390330E60AA06246E78DB926 [email protected]
529,710,052 *362FE32C755AC5A6773095867F7B28374516B7C8 DENGUTA0
529,710,053 *362432272E8CEC4DFF1CE970D06B54D83E494203 DENNIS.WAIDELICH
529,710,054 *362E8718B09B6EFE2CFB5C924A60EE5ABA42E757 chronolog!s7
529,710,055 *36272FFCA61D3070C2F6E4692A67DC3089E4A151 cimotaxeh1
529,710,056 *3626308A86531865D4780E5303C97298FEEA1A5E C-IP%
529,710,057 *362ED1642DE82CD05F779A9B26B0F8FEDCA81DF1 DESMOND.FOOS
529,710,058 *362292574E7EE62689CEA59AC9626DCEA01C2FFD citinret0
529,710,059 *362495E961224534211826AD79DE64E1EA220C8E DET4ILER5
529,710,060 *362F8B9F8C0D0FF872735F28E155BDB53371ABD9 D-(/F
529,710,061 *36289D5924F607420521F78A1679F38929D96003 CLAY.BISAILLON
529,710,062 *36250619C026E01657133CBC2A29BFD793DF60EA DHCSH
529,710,063 *362D4052B6243BE297189AC46A5E7E500BCDCCD3 CNS,R
529,710,064 *3620106225611169D844C2F292036F884AE546DF DIOSCINS3
529,710,065 *362DA57322EF78313F6BAFD1179CEBA4615108F2 directive14525320
529,710,066 *362E41B6286A416A317B7FA42EE562D487D7D6BC C;O7
529,710,067 *36240E97F2C577E32D5281C6969F9CAC0427081E cobramoroni
529,710,068 *362C63177CFF4C353866FBA383F1E5AE59325DF1 DIVINEMACK
529,710,069 *362CB45A4750152630280892F236E991C11DAB4D [email protected]
529,710,070 *3629CB4F9993F6149255158E17E1EA44986136BB DKQ)3
529,710,071 *362AF1B6A773D9B7FAE738DE3DD3BEDFAD9FF410 DMC:T
529,710,072 *362DD67492F3C97440D4110C44344B0EDD403ECC correspondrez7
529,710,073 *3620948034B4DAF50B3294958D266676CEBE6D80 doceer6
529,710,074 *36283F463470DB31CDB38B0162BA74370406057E c=p+7
529,710,075 *362998871DCBA1610E86FF0695A1FA86F9BFAF0C CP&EL
529,710,076 *362F25C1AC51CFF63FC6DF642A007097836C8877 DONALDNDHLOVU
529,710,077 *362A5B41723098B900660DA30C06546F2BD3334D [email protected]
529,710,078 *362BA503F67A8B40204BC6DC7EF22366F78C678F DON'TCHEAT
529,710,079 *362B9A17CBED1B6E2201510E10E587879ECE118F DORIAN.UMBRIGHT
529,710,080 *362CD61DD9FECCDB1D69412A0A9C515439755012 cre4m1est
529,710,081 *36202BF95F77C247F871E9B6B615BC51A2F5E80E c_s$-
529,710,082 *362E44C3FCE3B9F0234B70335A3E734134C76C09 ctn0a
529,710,083 *362DF27F52A0EB2B8A3F31D0C54249BEFDE87200 cultore9
529,710,084 *362416C568FCDBEBCAE06D720F9A378D558CA56D DSK#V
529,710,085 *362EBA16D94CF8946D83C6912BF4E282F43000E2 CYRIL.MCROBBIE
529,710,086 *3628C5F9B06B651933449801C4DFEDEBF37537AE cy#ud
529,710,087 *36268F294A50CF12905629F7F7E54E5E76A12061 d&?)$
529,710,088 *3620F27CD2BD15DFB6043968160926460A5DF1F6 DUSTINCUTRONE
529,710,089 *3620D4FB32DA6F832798DE40B2F9F58D825173E8 DU!W
529,710,090 *362FC9D401CD1F98FBF3D33E3FC1D40811DF847A |d3b
529,710,091 *3627DED37A2F13ABEF0C7865BD3F686AD0508E96 DW;T"
529,710,092 *36251AE092DCBF8F3A07C6A2DC7E5FDF81906F97 DYNASTIEK.
529,710,093 *362BAF109B4DA4D42D82E6951C0703F49F0DA2E9 d5ma
529,710,094 *3624FD5AB6D4589F95F05F5BAD20DEFCD872C725 damiontade
529,710,095 *362E61FC8F84E0D74D1DBF7F8F33E3316858467D DAMON.MICHELETTI
529,710,096 *3626782CE55F85E223610FFE100FEF8C80A72EFB DANA.GUNNING
529,710,097 *362F5AF54BEF2B2C0FB470498110499426A225C0 DARRYL.SWOBODA
529,710,098 *362409AE5EAE2E5E7CEF1E65C0439C4FDA635C19 DATR3
529,710,099 *362C006CAEC18FC96B7A21DB6E70CF4AF4646C4F ELEVENTH ST.
529,710,100 *3622FED7E967E428F39E9125D8AA8CF48A3A9675 deandrehotchkin
529,710,101 *362483ECFB54B6CB09011744E3F776AE4C77F9B8 deandresilton
529,710,102 *362206D4E88781D5A4ACBAC16A1C7508C79309D2 ELVIS.BOSQUET
529,710,103 *36236960351E4BD0C29DA3773AA94CAB67EFA48E debh;
529,710,104 *36232A3C31AE901168455E7AE6463D796C9D8F53 DEFENSE)とは、自衛に徹する
529,710,105 *362B32F8147D4A1D4C94407EB49EFB5156F04F3D emerysouchet
529,710,106 *36239956ED6E7192C3B2A855F8018B3E84D68618 DÉFILIALISEREZ
529,710,107 *36211FA844C2014EB84FB5E186823A34A680AEE7 emilio995
529,710,108 *3629D1E4BB589EBB0B82B5913F60C8B3ED868481 ENRIQUE.LANG
529,710,109 *362885B6DACF79DD8E04B4F6B0DA2CE2984DAFE6 DESCABERSLHO1234
529,710,110 *3623BD76E5569FB92B3394D119309DDADE1022DB DESMONDGUARIGLIO
529,710,111 *362D43DA53C9453DB093C4E86725E58A65CE3722 devenyis
529,710,112 *362E4CD7B4F660C81D7F05EBC85C92E940F7F3D3 deweyarent
529,710,113 *3624ADEF01970A312B0346E59ACCF53EB23EBFDF er16q
529,710,114 *362B236FA0A5375C4687948932E1E98969EF6968 dfoi,
529,710,115 *3629DC9F92883E62444B9A9CD65D95683BE94975 D&H;
529,710,116 *36245D5F3AF6BDF9D04A93C3C52A0F189C0CCCDF essatouq
529,710,117 *3624D40B37E84CF7504E52A9548AB0FE90937AC8 et_g+
529,710,118 *36275D4EE6C8BC65CAFA3EA7C24D787E48511C15 dinosummers
529,710,119 *362984D14A8327D84E6012EB84F9573A55573328 dintru
529,710,120 *3625252602D1E70B8C9600189F8CD7510665EA92 everettenick
529,710,121 *3620AA4A3CAF63EF52590F2FB5A094008734AAF9 d-_la
529,710,122 *362822B1A45084F2E08D1D6A9814D94314AA4453 DMR_
529,710,123 *362F74B0537DB41AB0870305BE6B0C0D80641AE2 fblo
529,710,124 *36226FD1377AE0D232585894E5EA8A98FD01DBCD DOMINIQUE.DIGMANN
529,710,125 *36223392D315D80EA1D66BA98B6CFAB259D79629 FERMINMATTHIAS
529,710,126 *362F9644ECF815B6C4D9BCC07D521652AD0A85BC FERNABSATZGESCHÄFT
529,710,127 *362E65F5D90F46C5ED890F4C647C765A2114969F DONGMOON3
529,710,128 *3621EFD05070A2EA0B21D42530F7794D275A5BBC fichtali
529,710,129 *362D048A669559A5DE22CEAB4E66877845822711 FILIBERTO.TOLSTON
529,710,130 *36207DD8A860C3D348C338404015C2AB40007C00 DORSEYLAFRATE
529,710,131 *3628B705F664C213E26DBE9F180F7884D9CA28DD doru.valean
529,710,132 *3626B8B8C483148D898267A172DB54F94D65A3A2 DOUCEMENT.L
529,710,133 *362F4C2DBA677E3C540763E4B92AEACC57872B3A Firechaser
529,710,134 *362E41F4590687B949D4F290B9019E65F5452028 DQ1SQ
529,710,135 *362E2AFC67E8C869CD6DEE17E581FC10C7E24E7D D!U-
529,710,136 *36298EEA917CB00047FC32FBD540331A9CC668E8 FRITZ.LUNDGREEN
529,710,137 *3622F075BA8AC906E5AB95CE6479C23FA4A2C413 DUNCAN.OSTASIEWICZ
529,710,138 *3624C6ED0D645C81E5FD3BB6EC04AAEF07EBBB9F FSZ*
529,710,139 *362CFC91FA47CF774CCEB52F40BBECC5A1F65E18 FULLY-DEVELOPED
529,710,140 *362366E2A916480534AE923874A3F7D557D22545 DvS+
529,710,141 *362F84740BAC8A3CB5DF4D98950F9A7B138F5D30 dxa&z
529,710,142 *362236982E63031A69113023D3963B2B943F33C9 dy'v
529,710,143 *36264E4A8F1A555879D981122C9DA67A1044F1DC E308VID
529,710,144 *3622D53631379DF9FFC6DD61B92FA1C48532FE5E GARDENOFLIFETEMPLECOMGARDENOFLIFETEMPLE
529,710,145 *362187AD05FB9F4D5FACCA859CFC756C2F5BD53B GARFIELDPOLUMBO
529,710,146 *362CF9230CDE6F50C25D777DFA29B902FB1ADCF8 EA#R.
529,710,147 *36299DBE762FCF34A2A2BA1B1F4D479A1E2677D5 GARRETBURCHINAL
529,710,148 *36286F81B8E5A9C8A3D3F4410C9BEB5C7CF3DC7A earnestmclaine
529,710,149 *362B9803A870226151E8034E54D0CC370A23DF45 GARRETKULON
529,710,150 *3621D0C714A8E1E39346048F7A823D9627BA2DF4 EASTFRONT8
529,710,151 *362A30CF12F3E11238C767DF5FCC9A3C9E3913DA EAUB&
529,710,152 *3626EF9549B5C5565AAB115F8BFF5EEAF2A8EA2E EBRARHEL
529,710,153 *362E323B2DFB9CB106FBCBE554CDE2AC5856D458 eclx;
529,710,154 *362E7DEBA83BA10B35DF76CA817A3318DA7B2AFC [email protected]
529,710,155 *3627A97778F85B710F1C6C82BCF637FEC5A64181 EDLE.SCHNITTCHEN
529,710,156 *362DEDAD870519F098F63B78EB2D1D095DCA5F23 GENAROBROERMAN
529,710,157 *362252CB2A75EF3051DC2E3E846DE39E17C256EE GENERALTED
529,710,158 *3621398C874E62546DEA34F9A7C122549A2060C4 GEORGE.KETTERING
529,710,159 *362CD1AF6B3261C0CF1626CEDDF3A6BE80C54116 EDSARSON
529,710,160 *362983212B333EA758BBB69C159E689A93EF7D83 edsq
529,710,161 *3627A2FA3B1EE036B30938C6F6F28C9B2412758B gerardoklavetter
529,710,162 *362199955831D74418947568341B3FA5F5920398 GGI9
529,710,163 *362569D80A51EAF9DF2158327CD894DA2D7AD5A3 EFO
529,710,164 *362EEBAF1571AB0B64369D60E91B8658659A117A EGJRLIGING
529,710,165 *36278A1791F866F37BB54CBF6153E28CA82DF820 eglh#
529,710,166 *3623070B6DECECC519D6B969CA9A144C0EE86B12 EILIDH DUFF
529,710,167 *362E4244460B54B3D8F2C5818A06559825FF2F4E ejbmsxrv91
529,710,168 *362A2264824AC9408BE784077A3D6A897C5DBAF2 G_LZ
529,710,169 *36252F0CDCADD3FDDC44E1958823982AFECB2246 ELGEANA1
529,710,170 *362C935BC97A80D4FB2FE9BDCB320FF5A5D3941A ELI.FOUCHER
529,710,171 *362E69BDB1C776B1C1B7EDF3CFF4014F225C271A GOOLEYS3
529,710,172 *362B990DCFEADFB6C861EFA78D50337F3E7A9C53 elleram3
529,710,173 *362197D06493861B2291DBC0DC5DA7BBA04942AA eltonbolebruch
529,710,174 *36296AA03CAE6B675E4E3CEB76B65C133C2E1F4E ELVIN.ADEBISI
529,710,175 *362D51BAE140EB32E85AB88119A6DD619A847215 ELVIS.BARRY
529,710,176 *36220FE364B45A368EC6586613E79F026A6B1F87 ELWOODVASKE
529,710,177 *362702B9FF4346801DDEB67A381C45BF1A3083EF graphneting
529,710,178 *36292841397959590AE43F55075AE8E0A4AB7A4F GREGILDA
529,710,179 *3628928BC215B18A6444820CB7C5C9AC776D1274 EMMANUEL.SAHM
529,710,180 *3629FFC97C76D7679D59C70213400C239553071F emma-rawlinson
529,710,181 *3626701156424AEEB4D00434C675D35F045395C8 GU4RD-BO4
529,710,182 *362AAB3BE105575306AF3805D074756A72A174B2 [email protected]
529,710,183 *36220B3BAAA67B5C7F439731A80F127A0B8FF2C3 [email protected]
529,710,184 *36294BB9BDA0725834BE43F0EADEA5B75FA6692D ene=$
529,710,185 *3624F69A09D49CF7B68E5B844A7D01F3B8941C72 GURURLANACAĞIM
529,710,186 *36269C396DA3BC23B689055F7C9AF26FB8D94EA2 entrollt6
529,710,187 *362FE364CB5B6A73C44104DBB5F74F42D5509BC0 eo7q)
529,710,188 *362A0998923010B317A181B7F9C6A41CDE3CCB58 EOOEK
529,710,189 *36299E1796EDC4074811225EA65BF54518320CDE HALFBASTION
529,710,190 *3627E4DBDC36AE3B72F0E2D5D9CEDD768D1A0CE1 [email protected]
529,710,191 *362A0C9531A4DD38C58B8BCBDE9A194CAC16DE3A happy.verbs
529,710,192 *362F541C685D470B177BB7CC5F637F31F6C89AE3 hare-hare-yukai-~ver-kyon-no-imouto~
529,710,193 *36242241198DFDC6563E06539A78E0E7E960B84F ericmolinary
529,710,194 *36254E451A7DA0DBC2D4E46375FFC52CA7C323C5 eridanea
529,710,195 *3620CEC7397FDE00316B2E7AF996317A39FDA9FC HARLAND.JACARUSO
529,710,196 *36271F2DFE0E8CC6642EFF85B22B2034B0B85B8C harlandnantanapibul
529,710,197 *36270E36053D22519BA92A13A747FE9EE35927F8 HARLAN.SLEETER
529,710,198 *362E618E89BD44B99872E21381235986209AAF7B hartmann12
529,710,199 *3626E1003300822E366E7EF486ABD74CAD0CDE58 esemtempodevalsa
529,710,200 *362F56AEADB1E45E5F4476FB3642DB45F30EF517 essorents2
529,710,201 *36238E6FA2600F81125D781F6110845FE69E688E ESTEBANDELSIGNORE
529,710,202 *3627A0338687174A3360C578F97FFAB6310A5DA8 hc.x
529,710,203 *362E6B72DAE88D67D9145C05B6DF889818A8B6B0 ETAVORP2
529,710,204 *362901E6BADB36C5312FB3CB60E4B3DA164AE3CE ETSNERABBING
529,710,205 *3628F3A76C8E65F4B4DBD97F2E47D191A30069EB Helicopter-Bell-212:-Interior:-Idle
529,710,206 *3629EDD704B63B164557142566149993D289D916 [email protected]
529,710,207 *362A44710E8BFA9759169F42356F28E12F324FA3 EUGENEDEAN
529,710,208 *3623389243EBBFB37F552E92C6785BCEA18F9C47 HERIBERTO.HENREY
529,710,209 *362C1062D2B71C24EFC180D310C15A48EF89ECBF Everlasting-EP
529,710,210 *36251D09E4FCEB132A3C4C8932A2CDABCE95E0DB ewazaworska
529,710,211 *362BDA5F56CC978059DCD1BF23FDB9E8C1FFA26D heterotrich
529,710,212 *36237DA1EF14B001A51AA275B0A0B59FC0BD3933 hfg>
529,710,213 *362CB0EFC9912B6A976BBCC246E2D997246141D6 HIMNODEARTILLER
529,710,214 *362C7760EF4BA05BF1F942C094AC77DC38A01531 hit.me.off.["g".formulated.mix]
529,710,215 *3625AB47053EE6A9F799F18D43213F9F01F44E30 ho
529,710,216 *36255059844E63608DC30E98C111FA349FEDD18F fascination
529,710,217 *3625D57E45D7F316BA9B9C3C2FD9554CF87D55E5 f*;d
529,710,218 *362D84FFC5E8FCAFAEE1AC5311342F7262D2DA51 hp=}
529,710,219 *36226F492F44F67388E58BC34FEBE279AC3BABDA f>j7
529,710,220 *362C9BB8EEF03B55C999260436AC9F5CA3884F72 fletchermoorcroft
529,710,221 *362571727C3075D21E1A29F6F0E130A558FB46D8 huurdeur
529,710,222 *362BA4B2E64E831E082C8A2BE434A1288D8BF728 [email protected]
529,710,223 *362C82C41377FEA012AF43E445AFF321A79451D7 IDOLAR
529,710,224 *3624924DE7721C9EC851044A08B0AA6D20C1F3E2 IDTKA
529,710,225 *36238A87B34569F40FAC87ABC1025F6864DFB314 if.my.complaints
529,710,226 *36268EF34F9362AA2FFDB86E4F7ED76463B5F8A8 IHUOYIHS
529,710,227 *3626BC911C08F8EEA18E0A666ABBBAFECF95424C FSARMAD
529,710,228 *362390B058EC457FB5E32A8E8E89A6C94AFD2873 FSL5T0SDMKRWU5X
529,710,229 *36236ACE8663033FAA21468B3CF6DC162A796B6B ILOVEDISNEY69
529,710,230 *362814C981839B9A5A0D8A08CFAE966A46B72513 FXY12B
529,710,231 *362A17BE83F658EAC726EE7DA4F4BBFA0558E1F4 GAILQUIRIN
529,710,232 *3625CB725334882270D1050C4A41C09E9C306B57 GARNELL3
529,710,233 *362FA949B028AFD1468169AEAEBF7B461334C9D3 garretballuch
529,710,234 *36266CA4EF131ADE64353196079C3FB4FFBD9976 GARRETT-GONZALEZ
529,710,235 *362FA35E1160F66737E4E84E75D7887F992E106B IMRAN-MAKANI
529,710,236 *36218022BBFF11610C61B1517C722813105DDC11 INCHINASTI1
529,710,237 *362AFF984EADD2BED907B8F64B635308F48DE8C8 GEORGEYARDLEY
529,710,238 *362979AF46718AAD1ACB4FF495828E51A4B72080 intheeveningbythemoonlight,dearlouise
529,710,239 *362DD6D9E2840EB045D58EF53D5DF1961CB88743 GESPRINKEL1
529,710,240 *362897B8B4F03D13CE02135EAE8C37534EBB2714 INTOYOU(FEATHI-D)
529,710,241 *362C02211BAEB95DF7D68BB09E8023ABEDEC26D6 GETUITEN.
529,710,242 *36229BA63988CC83025524EA82C8CFFD261DC4B2 iscontradictora
529,710,243 *362E88BA47CA2C78499F2AD7AE5445004839BD0D GLAIKETNING
529,710,244 *36206AA9BAC3A5DBA26B79E45918E18DF00B1330 GOEGOOZ5
529,710,245 *362CA9A1B23ABD5BB90333826D2A45E433D10A45 _IVAAA
529,710,246 *362E3538E77266044527EF8F1BB2B13951E5D676 GOUKQ
529,710,247 *3624F01D2B5630AF94153B3D64B16449E83BC38B [email protected]
529,710,248 *3624E06F8C4132219F5C7DA7480DD054F0CA8E5C jachthooed
529,710,249 *362062B2CE2B9D912EF92C9169072B9F095947C6 JAKE.DUNSCOMB
529,710,250 *362FAB114F60CAC8C38153B9897DC9F4858E0815 jaklinsarkis
529,710,251 *362AFD93E905D82A2304A4EE3DDC24A26082D126 [email protected]
529,710,252 *3622EC47476194C1EC007902C6CF0D6A4BBD7394 jarodcalley
529,710,253 *362964D8C555A71597BCCEA3F0734829B63B4A3A GUIDING_EYES_FOR_THE
529,710,254 *3622088360400000BFC6A4F4A19817C3A02761AB GUILLERMOALONSO
529,710,255 *362178ADF92001F52151715D91D3F166A70E6E33 GUILLERMOSLOCOMB
529,710,256 *362CC0B2E778C0B42F7676C6A6BBCD4E6D1F8ED7 guillermovillicana
529,710,257 *3622F59899B1D71AAFA2BC3E727D853320984EDA JARROD.HOLLOWELL
529,710,258 *362BE899651A9538651E73E94C4B746E4C2D42F2 JAVIER.SWEENEY
529,710,259 *362FA95BBF86D9E8E2FFBA8833CB120FDF095054 jawad-hammoud
529,710,260 *3620D3FD92E046E68C23B31789B9B7EBC0BCC390 jaycanders
529,710,261 *362D765A561FDDA89E3A4DC8B50B2A20E1642FDB g{vw
529,710,262 *362B4A5963EA77159D53B1EC1D347F6819F434E2 jedrichey
529,710,263 *3626CBCE59F32877AEFB9ACC550FA20B44300AC0 JEFFREY.M.TEAMKIN
529,710,264 *362CC62AAFB08E6C20E014E24674A5EF1151CCC6 jelenias4
529,710,265 *3621E8788B9A6668DB9D95460C28A59C786AD82C HALDESALVATORE
529,710,266 *36289A1D3C4284B51D44296F3034504997E1CB19 JERALD.WICKLIFF
529,710,267 *36241D87007F6563EB730D7458CD99E8DD1FC254 JEREMYVANDYKE
529,710,268 *362D6489C03A7CC87043E242F8CC922F7526D475 JERE.TENUTA
529,710,269 *362C99F47EC9A2DE516775D33A4C83F2D97F8D40 jeromytowle
529,710,270 *362BD86EF1B91978B747385A08D3C4868674827E jerroddienhart
529,710,271 *362ABA0D25171A9E81F57E8B08FDD6D37CFE755C JERRY GAY
529,710,272 *362C32A0201DF3B94FB34A8CE12B8EAE6E0D19A2 JERVINAS1
529,710,273 *362185790B6D90731CE5E452FCBF2F4E5CFA0472 hardtravelin
529,710,274 *3625151BC68A68463E8DD81ECDFBF0118F2A776D JEWEL.BROZEK
529,710,275 *3621C2DBE19721DC99E3B50B45C075BC2B67E37B HARRY.POOTER
529,710,276 *362F1EC169A1F4C7648AEC63F08DFC5F58D66615 JGCYVLOW
529,710,277 *3627EFB43A4DEDE81D594CF395A456AC7B556379 havocker$
529,710,278 *3620D37246C21323460B800BB104CB0DE322C02E JKLAZURA4
529,710,279 *3624EA42CD10834133D9A05A7007BE8645E8AB57 HEKOUCHENG
529,710,280 *362410DC535588069062005630E19384E12FA091 HENRY REDSHAW
529,710,281 *3622151A1567531293D7614444F01090CE3A6B61 joaquinmcelhinney
529,710,282 *3625F59A3E85BF1534DCC86D43C0BCDE61DE4BEC HERBERTSTRASSER
529,710,283 *362B59D1033CE218BAF3942EF99F8C2650A03C4F herpetes4
529,710,284 *362CE8F0051F6B5396B07DB0E40149D65BBF4355 JOHNATHANWHITERS
529,710,285 *362FC5F147E647BB4590506F4D4E39EA563681DF hgfjlhljknm
529,710,286 *362E895727FAFF3263011EBDC5C2B8F6504A484F JOHN.DORIAN
529,710,287 *36282295911557BD51FB5BFCECFAA473D722493C JOHNIEALBERTO
529,710,288 *36295E796F27935785B9ABAEC72ED30136276A9E JOHNIEBRADICICH
529,710,289 *362A1E21113E65832CE0D43FB6E5ED33467F75BA johnniehardwick
529,710,290 *362053799817445A7039E96B1DB7147FD7A05559 johnnyrussell
529,710,291 *36212F267E447369E8E0BA9383A733783890B795 JONATHAN.GRIPPI
529,710,292 *3622BDBEE80347E7CA0B3506B2B2E701FF3D2819 ho
529,710,293 *3627779919CE925FD6743EA38CA0D76F27D5C47C HOLLISHILDA
529,710,294 *3624E9725C7CEE8082A86B19FE6E2CB7630E9638 JOSEYANEZ
529,710,295 *362A5150CBEFD3AE16DE28145FB6D82AAA74F1A7 JOVENRP
529,710,296 *362F12229728579E84ED0FDA1D737D40126A03C0 HRDONKA5
529,710,297 *362F35D09FC5038E59E724470C1B7F7B0A309BA9 HRF733
529,710,298 *362EE6DB540D9414565BB02869B6B6B4C20212F5 HROXIWXS3
529,710,299 *36280B6B7D429CAAAA749C2559DBF4FCB95F3A21 [email protected]
529,710,300 *3620A1B3F0E8A337C4F122CF1324B5F158BA400C JUSTIN.MORELAND
529,710,301 *3626848D151D8E539D29B2C761819BE91069E1F0 HUFFMASTER123
529,710,302 *3626E9ACD2AE5DE924644348F0866F3695E1AFC1 K12361
529,710,303 *3626F988E2D25BB9159B1657FB5E02F2F36712DB hwef7niysvcf
529,710,304 *362F03B344401F468208257D532FDCA50A5C3BF4 [email protected]
529,710,305 *3629031BC45776BCCB269B58A4D8177D5E3A3DE2 I8*O
529,710,306 *3628C8B876E7FF085027490D3DBA99709D79CA4D KATE SPLATT
529,710,307 *362200B187355008152B59BA9C36976F2801879D IF.YOU.WERE.MY.LOVE.(TAKE.2)
529,710,308 *362B32110D5D677F9111ACA66915E2588C0AE331 :iidieuestsaint
529,710,309 *362516D6FA75E6354A4995B9C0A51BEFF98D55D1 IIROSAL
529,710,310 *36240A964537103DB7D2C04144DB05F389D10A3B KENNYLATSKO
529,710,311 *362EBEEC51B203B05DF8BA134AEBF69B81FD3331 KEN.SZYMCZYK
529,710,312 *3621A24F2F3414BBB01ACDDFA1E18A1A8A942DFB KENTAKYK
529,710,313 *36217B4235BE77C9632A642EAC5000F75CE226B6 KENTLLORENS
529,710,314 *362E527A91720451D8C052F1A1A670A55617EBDF illlived./i/l_l/i/vd
529,710,315 *362B861697C2BC9F2C57EE2852F5796CD7D009BD iloveanders13
529,710,316 *362EA2280D8498614CEA3126BBD766EEFE0F6894 KEURIGERED
529,710,317 *362DE860C16AA334963C62956670F166A07A10D4 iluvheather54
529,710,318 *3628676165B6AB788CBCB0F9F4337AB6F89C12B2 ILUVSTELLA89
529,710,319 *362AB92CD1D5C347014CC699A6EB2009C51B624C KIRBY.DANDURAND
529,710,320 *3628637C609A168DA1243C1FE14AE13EEACCEBA7 KiseDayaaNahVichhre
529,710,321 *362AB771529BA2A666F0391DD22452E17C2D98E0 inconvertible5
529,710,322 *3625997270C2C3B3A32A9E1AAC920BE7A7AE8CEC INKTPOT!
529,710,323 *3627DF3D2161AAE02F24E3DC3BE34CAEAFA6DCFD [email protected]
529,710,324 *36209F7759AE75E1D8C8041F59E88D2C7141F16E IRIPSART3
529,710,325 *36210CA69780F4F0C77566684CB29BD567C4E6A8 KÖYLÄGÄN
529,710,326 *362417F60785197327DA449E6BFEE4C08A263D05 IRPALEET8
529,710,327 *362536CDA9A010565BF47BC8328B274CD746C7A6 isaacolynger
529,710,328 *362FDA6747828380124FED6C27BF7EAB39A6C164 KRISTENBANKHEAD
529,710,329 *36264E049AB4D611BBCD1C14202B66186D6AFEB8 KRISTINA FOSS
529,710,330 *362D626313EC2EE61EB0B55FADE1723D481125F1 KRISTOPHER.ANAST
529,710,331 *362F4C087D54BFC2819FD7095D1217DCEFE1C202 isiakaan
529,710,332 *3625F1818D62AF7E55E4F0EEC10F0E55B4700E0C IT-CARRIES-A-BRAVE-FORM-BUT-'TIS-A-SPIRIT
529,710,333 *3622758A0E33FBC3EA1406B5009CB352B416C407 kzzdeph3
529,710,334 *362F949562F23AE983BF8188B898C90DCDC95D79 JACQUEES LANG
529,710,335 *36263E4E09D20748890EC98250BB283178433912 JACQUES.MAYZE
529,710,336 *362084CAE3B50FB6DDB4A361F12A01B8008C3B40 LANDON.ALBANEZ
529,710,337 *362597C8E2DB1F132E0B6F9B39B3458C39FF84FD jaemmerl
529,710,338 *362725B6509BDC038242396EE598366AB1A6DE00 LASTERJOURNALISTIEK
529,710,339 *3627193DA160B6AF921FA2ABC537A7E1098F2835 LAUFHILDI
529,710,340 *362DBD91D91F61C1520A0A031D3F588E91D81DAC LAVERN.TIZON
529,710,341 *362ABE31F662FD98A0D094D6ED776E4B2BC6A528 JANSSTICHTING
529,710,342 *3627075B78F44C64B0C1332EF2363ACC7AE15F45 JANTOY
529,710,343 *362E2865F56319C0D9AE54E8F379E022CF837BFA Jauntness
529,710,344 *3624D5508230E40A651EE54F5987CDD7F55EEB67 LELAND.GIACHINO
529,710,345 *36217C8785691E5FEE6B18089507F40D6F34C976 LELANDLASCANO
529,710,346 *362917194D404BC530DF87F107252D56D8C254E4 JAYSON.RUZBASAN
529,710,347 *362EE7A18AE46B3AB12E6DEE7D6F0F9E7E87E4FE lemuelgalen
529,710,348 *3622237D7FC94CCF7EC5B68B012D900F981D7609 JCPICON
529,710,349 *3629FD45083D1097D4A0D8DBAF259B13F6CF0715 j~,d
529,710,350 *362B42A6DE77C9BE43D5B98791B256E4F35AF479 JEFFERSON CARDONA
529,710,351 *362EA3B718A2771AF8BD069F002BD63AE9E30C8B jeffmatthiesen
529,710,352 *3622052ECFECB9E0596808110086F259B95B48FF JEFFREY-LEMAY
529,710,353 *362C9243BCAB4825A897D7CAC2173688B0BEA67B LEVRIERI!
529,710,354 *362D43469C876D5671383705787FF74AF7902E59 [email protected]
529,710,355 *36279121D96643F3632BA57106FE593372E24800 LIGHTER TONIGHT (REMIX)
529,710,356 *362EAB38E58B6E5302DCE4ED5FA52E7608022D8E [email protected]
529,710,357 *36240239CA81A68E9EFE3371CAD4317BD707DC12 JEUGDLIGA
529,710,358 *362DE358D081FAC0BFBE1C228D0220ADD33235F0 ji
529,710,359 *362F47ACB43C70619CA1176484D135A8B1525ED5 lista.de.capitulos.de.angel
529,710,360 *3625F3A3C50C06D2907CAD97E22F8A396C534A12 [email protected]
529,710,361 *362EFB98ED62536754D14EF4E2C8E761F43192B1 LIVINGDICTATESTHATECONOMICGROWTHOUTPACEPOPULATIONGROWTH.
529,710,362 *3629C59A2BDD15341D17E45826B33B5FB66CF597 lK-
529,710,363 *36225076D34B5B2098399CAAC5F7D12FD2315E0C JOANNA.PATTERSON
529,710,364 *362B1637BF3AE79C0FEE8721B8A1AB66BE5DA7C0 joaquin-navia-osorio-y-miranda
529,710,365 *362A45A0AC500227BE43080BCB17AEED9B6C11EC LO<
529,710,366 *3629711C359C9EDD41AEAA359E00E78698E31148 LORENZO4
529,710,367 *362E671368DEDE99255A9502F43CEE61D1499805 LORNACULL
529,710,368 *36282915EA2F682B187C05418E1FA204FC83339B johnnyhammerlund
529,710,369 *362ED7D4B8EC477BAA89B06719E588896170CD30 LOVE-ME-LIES
529,710,370 *362ADFA8246468E916236EAB47D4E33A0B014042 jonahkiser
529,710,371 *362F925DA838658CAF9FB7D1EB600396160FEA19 lucassalatta
529,710,372 *362603EB01CAD5B1980FBA60336A0959811FD6E7 JOSH IRONSIDE
529,710,373 *3628FB19C7C2F7EEE794C13E5473661A38181023 LUPEALFORD
529,710,374 *362360DF455E571E5EF657487E0236D1249A7D61 JOSUE.SCHNELLE
529,710,375 *362978ECF49D85D803ACEB3D61634F866CF2517C LWQ{
529,710,376 *3620A94674012A7DF6193B2D33AD848B173D10BB ju811at3d
529,710,377 *362FDA509B0DD6971EFCBEA53C60DCDD91C2AB7D JUDSONCARDIFF
529,710,378 *362A57CE03AD136E6CD0FE598F5A4209E7AD8CA1 JUDYRADKE
529,710,379 *362F1433D119FC8E10F423AF434AC84AC422E562 M4LF4Z3RT3145
529,710,380 *36226B3EE5A06829A3C0E65509B1D9AA3BCB6A17 [email protected]
529,710,381 *3624B7F9FCDE09E30B4590E02D645479FE9207E6 [email protected]
529,710,382 *362B37D78DEB452E9DF9F9634FF1E90C5D0274C1 juliobleck
529,710,383 *362AA653E02AB104F83D3D54747567664EB0718D MACKMATH
529,710,384 *362890BDA465A35E93ED4D579DDE9135123AEB3E <JV
529,710,385 *362D98DBED6ACA6C408C95E54C2477EA262C1986 mainbhipakistanhoon
529,710,386 *362FC95765B3015C9B6FA83C2DC5E7AE4B851CF6 MÂMDEY
529,710,387 *3627267BF9CCC6ADB55FCDA030766FBDF416F2ED [email protected]
529,710,388 *362F195FFC6E420015E06CED34B958B13757A182 MANUEL.WOLNER
529,710,389 *3624CEA91F544B9B6656A961E059300E17087F22 kelvinhunnings
529,710,390 *362997691B46A9FCF688979584BCD308B952B363 KELVIN.PHIBBS
529,710,391 *3628770E0361B67805305AC8D533E5EDFFDF426F MARLE)
529,710,392 *3621AE880ECA76E6544080FC8852362553FE3DC4 MARLONANTLEY
529,710,393 *3621E890C2C686E3473E4FFF6C4DCFFC373422E8 marlonpytlovany
529,710,394 *3627F7EDCABF9DE03EF57AD1712C958393191136 marquisdani
529,710,395 *3625D7A54C4DE90AA2097D3D46FF8F2353CC069C KENNITH.KILLPACK
529,710,396 *36284186EA4E144FD35332FF96D58752375745CB marvunappcomappendi
529,710,397 *3625FA522BD2FD068262B8EB0539971FB0B1FD86 MARY.JO.WHITTAKER
529,710,398 *36234A1608D2AAEC14BA766B15D0742CF5FC2BB1 marymontaya
529,710,399 *362B007A309C75AF26E803497EEA20A301572F75 killer.instinct.(b)
529,710,400 *3626E8E9F6FD821BE87F1589D0D67D71C7ECE462 MCDILDA8
529,710,401 *362EE6648AEC002208B31372B4D16E78BA38DFA9 [email protected]
529,710,402 *362EF9A860AFCF06C93697890B592A5DBCEC5B15 KLYVYTAN
529,710,403 *36208B3D4B07E4276058662F339F9CD52DAB96BB KNDRFSTED
529,710,404 *362F51C5C031FE76B6DA23DFF7E88F62CE1CA212 kollektivsiedlung
529,710,405 *362A7294C1CA4C6130D5D1913559A74A60888179 MERRILL.GARRIGUS
529,710,406 *362434D1B88ABBE0D28A33C328DBC45F8C623591 KORNEGG“
529,710,407 *362B76A2ABE04507835BDA536B4CAB064D65F18B KOTINDA5
529,710,408 *3623B2C91AB1AC9571C8F557918812C539E2DAB9 MICHAEL-LEROY
529,710,409 *3626B736B11BDF74B1927E76935493384753323C kristopherflem
529,710,410 *362A301F06B1C979BF833E091AD30145F50B0882 michelle-revette
529,710,411 *36261C154DB4CE099155ECE0EAE5FB06A37AE7E9 KVESADZEG
529,710,412 *3628C912540050F49FE84CABEA43207078D10E3A L3PR3C0N
529,710,413 *3625A4428ADD5F43E3F53BC09BE3CFE72F211BA6 LA.LELLUIA
529,710,414 *3629BB36C0001407E5E70550A314B888192FB6CB MINH.KAY
529,710,415 *362813704C0243B8755E1C64F40199D05F43A74F MINH.VANBRUNT
529,710,416 *362D19C7D2898E8D694BBF8A62B208FCF8C1F93A MIQUELTEUSCHER
529,710,417 *362F83E7B954D1B18CA0B74C3197E4686764A384 LANNYWARRICK
529,710,418 *362A0E764CF8F909BE86DA7FE183D2B69D762E04 la-novia---la-ladrona---mi-primer-amor
529,710,419 *362E1CE030864B38E4D0B7098DDCD38223358C20 LAS.COSAS.VAN.MAS.LENTO
529,710,420 *3629B87380C02DBEF92B32212DF1B76C0EDDE3A6 laurenceheick
529,710,421 *36285AFD8A3C0945FFA2F4654AB0C6F3701F9907 MOHAMMEDHOEGER
529,710,422 *3628CC2082B3237272EB394313ECABCF586D2B19 L"CF
529,710,423 *362356F03D83C56132994C1EA1C0E8A0BA41F620 [email protected]
529,710,424 *3621E803DC1260DC2CEAF3E2F0FF76DF8DDDDDDA LECOURT7
529,710,425 *3623622318CDE2E89422868AF5F90BB89A200D4C MORGAN.BIRCHWOOD
529,710,426 *36255927DF07A20D2ADCD80B72329610E996E8FD lenardmecardo
529,710,427 *3624B23381F7E8E1B03A065D10271340DA3F828D LENNYPARDEN
529,710,428 *362A0F03617D1CE332561E099942DFD8E3138991 LEOGITTER
529,710,429 *3622A6EAE54E024AAA9D3F65C637B33A32BAD8C5 mosesgallatin
529,710,430 *362EE3687E14E65F26C27E0BCEB6531F777C8F22 MPJHTMO1
529,710,431 *36264B451325ADF8E4F7C12F77CCE5A1BF59127C mrsootycomwww
529,710,432 *3628B1514BC3C508B88FB20648F267CCD225CF55 LEVI.SKOIEN
529,710,433 *362D4AC7C6CD62EF56D92E6C9BDC8F74EF86A654 LEWIS.GUDIEL
529,710,434 *362D083CF2D675D75D3B33F1CA633AFFBAF7B979 MURPHYTR
529,710,435 *36289583758322F81ABDE74A38FCA1B0CE0DE5F7 mvyi
529,710,436 *36250AE832918D8FE70C368B0580BC43940A8867 [email protected]
529,710,437 *362221E9EE341FA1970AD8F353EEB5953C46D12C MY.ANGELINFANCY
529,710,438 *362C8DE11F1B2889501EA783DF99C61CFC9D6E54 myxxxxxx27
529,710,439 *3628D4586118C5C43CADA0E9E53E0D6500FFD060 N00FFUB
529,710,440 *362760C96FF6574BF13CC47B02784B70D5551A25 NAGANGOUDAR
529,710,441 *36260829D59A4924FC00358656E2BA079AD71935 little.pink.elephants
529,710,442 *3623A26BD3969E4A50EE5BEF769E738E3DD3D388 NAQING
529,710,443 *362C55AECEAE4049DE667C52649331680FB6AEA8 NARCISS,JS140
529,710,444 *3620AADA3E62AC7FE739AE5BB434952E6DEE20CA Naughty.H
529,710,445 *3629C239A638F43CA251029B2D40F534428CA35B LOCATE1234
529,710,446 *362ADF18B6822DB358634834C179C81BE2781E85 [email protected]
529,710,447 *36282CEE4940CDF839535C01785FAA5AD2EB0A34 NELSONKOKUBUN
529,710,448 *3626FDBDD6A4EE27F9BD2C08264D831282E97F92 [email protected]
529,710,449 *36293F79DF9529FBE4BCA208213B7954C8932BB2 NESTOR-YEPEZ
529,710,450 *362EBCE0507B0CAE017E4918CE83C3CDCE1EE253 NETTIPALVELINTA
529,710,451 *3620DB88E7AF72547FBE39D202A8968598BCF785 NETWAREDIANE
529,710,452 *362B7B75A2C2AEC845FC2463E13BE3CC508531F7 LOUISPITTS
529,710,453 *3620464DCD6A82F86FE2CB179261CF37D321A7E2 [email protected]
529,710,454 *362CAC330801BEBD4BB74C1895FB7C666D8A3819 L!PY
529,710,455 *3628F403E4BFD82307E40D14EB40711D50CD5BA3 NICOLE DUGUE
529,710,456 *362517AEA8EA98C3A88BABCCA2C9E2A500E60BFD [email protected]
529,710,457 *362C490F270484B421D90B367F21E93E905D9A77 LUKE.RASHDI
529,710,458 *3628801EDF5907CA195720D9EF9B53E950C81CDA LULLABY-FOR-YOU-(INSTRUMENTAL)
529,710,459 *362D4C0C8FA081087E16EBAB10A0787D7A9FFB5B LUNACYTH
529,710,460 *3623CBC26A7BEDBB882F03D232705093FBCFAFDA [email protected]$
529,710,461 *36255F1E632D683A3FF51A891B34FFB40531F858 [email protected]
529,710,462 *36229A7371889105356C21EEDCF1F538297AC20C NOT.TOTALLY.GONE
529,710,463 *3621805656BEBA6F579779E66B35748789333147 MAKEOVER
529,710,464 *362C9C1A93326F2CF8F3B953C9E624FB7E9FD808 nrswanson'-'jeffrey
529,710,465 *362F58626DB5A6BD90D2C8B13DE7090AFEDA3A4C OBLIBMIJ
529,710,466 *362EE393B9803F7570965E2933A949BF4ADA6DBB OFELIA5497
529,710,467 *3623C8EE6EAE9C3064F4175427CCB273A545E464 MARLONPUTNAL
529,710,468 *362C395F6934D0BBE7B5BC2F412CBBB1EF7060B5 Marmotter
529,710,469 *362B8281A46291B20174ABBAEBBECD85E602794F OLINKARNISH
529,710,470 *362354F95D4CE09863A2E1CA167EF8320C245A54 omerrasely
529,710,471 *3628CFC56DF677526D8BDBBC4323677F27B5012A MATRIZ VON
529,710,472 *362688D0F02DA77AD6CF211EF60CB49148322D36 mauricekaleel
529,710,473 *3629F0274C90348EE15850F3289E3F9D0232D079 MAUROANGELI
529,710,474 *362E1A0F9B26427464D525873D665414F63DD201 MAXIMO.WETHERINGTON
529,710,475 *36289D8255F18E0D7E3A6999287E9DE9F591EEF4 MAXWELL.BLOYER
529,710,476 *362C772868265C088123819DF0353B90CDC33A41 MAXWELLMALOTT
529,710,477 *3620F54FFFFC40E247BA475F0758580D351B3E26 OOIIXUI
529,710,478 *362BD44DDB5172B25B0490D2687861BE405F6506 [email protected]
529,710,479 *3628253819B27F945B05B96793DA9D1A50E86833 MCKENSEY
529,710,480 *362D30C8678C91C6A611F2A9724074FC8411C9F6 MEGJLENITENI
529,710,481 *3625F12FE77B5324AB5228259367EBDA14D6C47F MELANIE-KARP
529,710,482 *3628CBC81BA15673CBB547073CA46E1FD3D63348 MERCEDES751
529,710,483 *362CB56A11D3E220E512F343C99223582FD459EF OSVALDOCHIARMONTE
529,710,484 *3620D9503CCDDD0355F8ADB578376A2CA1746E6B MERLIN.RISTO
529,710,485 *362DF1869B4FEC2C42534AFC36700D8518971550 OTHA.PYANOWSKI
529,710,486 *3621F8CA02DD0A1DE224F2C184C57ACCA21B44A8 oughtlings8
529,710,487 *36249B81FDBC15B8FF99368C58FFAFCAA18926D5 ov4ritis
529,710,488 *3621A6DD09F51FE68BDF4523FD9C291008D4F554 MICHELFEICHTNER
529,710,489 *362FCC4CE113301E29E449529EE7954DC93D4630 mickeygekas
529,710,490 *3622FEB372094C6A9F1BCDB17450B74387F00CED midnight's.song
529,710,491 *362A0EA18D45452961BF3D7892C183A93EFF094B P14TIN$
529,710,492 *3627312F00B4296D121BE3C04C5D4FF59F602C7C mimimarley
529,710,493 *362236EF5C5B682F6A4C0B0A623C244EA3EF24E0 MISAEL031
529,710,494 *36262B49BF88A83B5501A9C5BB74451B57B8B1E1 MODESTO.FREAR
529,710,495 *362C43E7C7EA323F990C5282788834A9F97E0167 patball?
529,710,496 *36201251DBC81128E05F6107D6C31C415C2FA2F9 patrickogasawara
529,710,497 *36232527AF6873CE7CFC056AEC98EDF04C8EA73D MONOAO
529,710,498 *36221B0E2E7A864EB7EB179F55F355C18963253C montevettore
529,710,499 *362F0033E8ED905446149FD38AE267AA2CC06A9B [email protected]
529,710,500 *362F416C8F5567E2C57B5455022EF1C4DC087D03 [email protected]
529,710,501 *362F737DC76A69F3D34D7624308079F3964023D2 PERRYMILSAPS
529,710,502 *36216C72A400423C5772C81CE0F56FD589134378 MUSKITS
529,710,503 *36215776E1716796E10BC97A313D60D4BBD4962A PETEYPIE
529,710,504 *3625D22A7004A6385918DA34B92778F4B95DAB7D [email protected]
529,710,505 *36222CB18632BA381B2A533FA05A44DD95CFF3E3 mya-combs
529,710,506 *3629A176A0C46DCCCCC6E29F35920330032AB138 pffindty2
529,710,507 *362AA921802A129714FE9CCEFEC08871870CEFE0 philipbellis
529,710,508 *3623C0F178B81A2FE41D3CFAF357859A28EDCF39 My.Private.Tokyo
529,710,509 *362F1209BF59BC853535E9169CA2C8F643614BFC PHIL.MASTERSON
529,710,510 *362C5521F91C62E8A421311FF1DA2122DFEE9D4B PINGTAI
529,710,511 *362ACC735A0447FCBE55BC2C36A0DC2E2A331B94 pirometrooptico
529,710,512 *362FE2EFA7AD9C52B62EF1B6560C6C38707A0A5F PÍTANE
529,710,513 *3620238EEDB0C43AA438FDCD76C0AC512B54B14D PJEQ
529,710,514 *36221D7B48782B78FDC30E7E6660D34759EFFA4B PM"Z
529,710,515 *362CB5725D34E1758BF50F753B59E5A799322649 naukowca8
529,710,516 *362D30337D51C066722152C6478359BEF6AA3C8B Need-It
529,710,517 *3620926DC4473E3ED1B3E0F11B40C08E208B117F :p-O~-(==p
529,710,518 *3628D355A6505EA20C899C9DC729E9F741E6A83B neilhackleman
529,710,519 *3623DB76C0D4D309FF44094D5036A6171E45E17D nematode4
529,710,520 *362BDD5CFAA828B75398D36253F56B75CE64993C Neurosyn
529,710,521 *362E9052B96CF1885A3384854620C02EBDF22DEF NEWTONMCRATT
529,710,522 *362582B74CBD174DDEF87C64578706595748ED99 PR3C09NI+I0NS
529,710,523 *36283882FCD3BE347D87B1F81267FB22066DD0D6 NICKLAGASSIE
529,710,524 *36295F534BF6CDDE02FFF1FAC56F569025998649 nickyalderton
529,710,525 *3623506B5F1B570FEB60E297767DE33B53470106 NICOLA CARMAN
529,710,526 *36288721F991312D2FE30D71498A140796686C4F princeplease
529,710,527 *362F1F38011F3399A52D4F6570172BFE2286829A progressivelyrefined
529,710,528 *3625986C80B4501BA60C9B6DB6E7D102634B0316 NNNFRCTNED
529,710,529 *362C3F4AAD20D1C5AB50776B9707C43D595A6B89 NNSLBLTY6
529,710,530 *3626689504FF61B227B522F75511E67F01418C6F pseudodo
529,710,531 *3620A969451553162A78569DA42248A6D671AD02 NOMINATIVAL.
529,710,532 *362396231D0B46606975CEC3A84A83BE0632D308 PXQCAA
529,710,533 *362463F4F850B4B0BD572D8787B926CE33DFC531 NORDTUNNELPORTAL
529,710,534 *362064388CEE213DB45CA3146E5727C3CED87156 NOT-COMPLETELY-RELIABLE,-BUT-IT-*DOES*-MOSTLY-WORK.-*/
529,710,535 *3623E798B2B28E3C745C7E1F386D56A0AFB78E38 [email protected]
529,710,536 *362F0D51FA8424D752F2511DFE0E0DD9853D8217 nowaka”
529,710,537 *36279F91A3CBE9E0D8C5B750103FC526B5547CF4 [email protected]
529,710,538 *36296B29AC48297C1CF8BA3D855749266AEBCE7F NT.SUB.BASS.MONSTER
529,710,539 *36247841FAA2A006F1DC124CFBDCACCA53BC3B94 NUMBERS.SOLMONSON
529,710,540 *362E89EEEB7B02ED10A24F2BBADC8B0DF00590B5 qpr;
529,710,541 *3625116959E551F42E239E7B953B92D25C7B6C09 RALPH.ROSSING
529,710,542 *3628C3B68F3DDFE5611F4F25226AB808A5AAAA64 olensiddle
529,710,543 *36217FB1418798D5BF5A3B1E8CED94EFE05D2BCF RANDELLSTRAUGH
529,710,544 *362B4CF9650A1209ACFCC5BA85B17DEE3DB89996 RANDOLPHBARTON
529,710,545 *362AAF98058837B64FFE42BDE71F90C75DD62ED6 OMALLEY1
529,710,546 *36282F2BBBEB991C435D9F7E3B46FAF3129B7B9A RAUL.MASSANELLI
529,710,547 *36270D5FB6063DC6DF634F17C9A5028DAB15E96C RAUSYANA
529,710,548 *3628EDBDB45845B17ED507F7C0D883480308DD96 (o_) * * (p
529,710,549 *362CFF8A35FA74E964F8233F74CAA7A8E6CEEA82 ŘĚČ
529,710,550 *3622D5FC0222CF77411734C8AE2B365D4CDA970B ORIGINAL-BRIEFEN
529,710,551 *362002155979E4A22EC0B0EFF3A63E66A66CAD07 REHCSIFIZEPS0
529,710,552 *362197D0459A99A1843276CBAF77C8B2D4337F05 OU7P47!EN7
529,710,553 *362EAD970F5AACF67440936E08CBBEFD42BBC3DD RENALDO.MANNO
529,710,554 *3623D37A2430F387EFD47708A3021A304EC8F48D renemmokegrehad
529,710,555 *362D08740B836C99195A4A211A1B41F428AA8551 P0CK $CAB
529,710,556 *3621758C0962A7778F6FBCE9C08F75887D048723 p=====)*3b<
529,710,557 *362EEE1B1F6A7C7808B48FE531C0F3BBAB9382D7 P3RS3PHON
529,710,558 *362DD41127ADF9D72A83DBC4D5DEF696D9E29705 [email protected]
529,710,559 *3627B93323D5B193585AF10A4F8A9562532D7C8F 'papa'johndefrancesco
529,710,560 *3621B85ABBABBF659A8DE8E51C6D181737B699A1 PASCALEABI
529,710,561 *362401F75BDBE2BC79F9470F337A9007FB3F8FAF pastes!
529,710,562 *362F19355B5A462B3ACDDCC84251757056DC6478 RICKVISCARRA
529,710,563 *362865E1106C065051DA70B3071FDF95C77C0C86 RIDWANPUTRA
529,710,564 *3629EB15E4220C82C93ADBEBDC25B6FDCCC7FB52 rigobertogallaga
529,710,565 *362ACB509890B46E80B8081C3F4B8BB0175FF93E pB~.`)O(
529,710,566 *362AD09F6D7620320B5410D592C8926FC7FA2129 RISTORAI8
529,710,567 *3620A6EFB4EA6EBBCC8317D8FE07D24CDF02E854 rjkugmo
529,710,568 *362215B19CC2B9F090EB1E29D08A8CA61A212B59 people.rock
529,710,569 *362C756941E0D5885867BF27DBC3AE8EE2E91248 peras-de-le
529,710,570 *362603A56FB0A052673B84AE60A3C31B13BABB03 percolative5
529,710,571 *362F0881140ECA9452A050D68415B74461D3331A PERRY.ZOLDAK
529,710,572 *362CF342E12FAB5E79A58BAE252BC39FD9389BD5 rocktime
529,710,573 *36254465E0EFF70040F9C4AFDB84D5936DC78960 RODNEY.BESSENT
529,710,574 *362C0BBF3BCBABBAF95802726F82390208F9EE2A RODRIGO.SEIRER
529,710,575 *36247E3FFF6581EAA017011D8D21C931EE701EBA ROLAND GROSCH
529,710,576 *362AD7BBC5228E4BCC72EEA31610EFEC26A1FF26 PIERRECHALUPA
529,710,577 *362A2AA01577A2656905AD3FA87C910F8EF608CD ronniewillick
529,710,578 *36251D7329AFE7E600280502EB09EEFD5B16BD1B ron-sullivan
529,710,579 *3621C27ED5AB5888962E477164F7889F734546CD PINKZANNE
529,710,580 *362FEBDF34CA81AFAC9CE21DBB7F73FCB520416B PIO
529,710,581 *3621DBB76B284A2B664252095D8F66AB6498FCBB 'round-Midnight-(b-side)
529,710,582 *362DA1A76519EF4D2F0F93C830C359A11F56BCF9 ROYALHIGHLAND
529,710,583 *362D3F6A03A86A525345D7E04198C6F698FC74E9 roybarette
529,710,584 *36200F51B5CA767FC250A232CCA539600AE6C4E8 po0906
529,710,585 *36280E6741714BFB3A5C77EE0A3D7772132203E6 [email protected]
529,710,586 *362312FF2729527FD807C051397B1C185AB90F89 rsteuerwald
529,710,587 *362DD4C9DC1600113A2EC567499F329A1C70B8BD RUDOLPHDONATH
529,710,588 *362E69A90BCDA2272F5715DC63D283748AFB5A44 Rugi
529,710,589 *36221D5DBAB81F61E220FF5040BEB62906FE43ED P---P.~0~O(>_0)
529,710,590 *362FCAC070A3775AD4AF8CF5E6BA1749046B3325 RYANIRELAND2
529,710,591 *362BE5107092E5302D20EAF790E7E30B9012BBBC P##P.~O~O(><)
529,710,592 *362702114CC60025E86B07040523293BE1AD2BB1 p----p * * splat!!
529,710,593 *362AD35A5A660EAD21347C3611B1E3254AC40C26 S50799
529,710,594 *362D286EF3B5677E5862E1B6700052E33DF64E52 Preno
529,710,595 *362937505B208566D0DE742363D227DD77DFFDE9 SAFETYBELTSAFEBSW6
529,710,596 *362068E0233C5E1D8CC789B081576DAB31143F76 SAID.FCONAWAY
529,710,597 *362AF1767BEB899ABB1D75DACB77F6740D3FBDF3 [email protected]
529,710,598 *3627B829E31D20894E88F1ADC845D359C6CB4784 PRODACTUAL
529,710,599 *362A9591F1B446ED1A042250F52029EF5F0907B9 PROFFITE4
529,710,600 *362DBD8FF9BF257E7E261E63DECC441E9DF46C4D PROJEKTJOURNALS
529,710,601 *362848352C57AF4DD7AA48DFBF4DDA396ECE47BD PRUDERIEEN.
529,710,602 *362705D1D4DB383E41B91E44725D0759874671B6 PUJIE1978
529,710,603 *362A55C472ACFC598855627491B8254961926FE0 PURPLERONNIE101
529,710,604 *3627D49762AB36CAB29863504CC2034931B4674E SATIRUS9
529,710,605 *362D0EA4274E7816F766F3A63467DA8154BA4739 SATTILEM
529,710,606 *362C8B0F164916410C59FEDA083BC544B7D03463 sa.tuled.taas
529,710,607 *362E3FCC5C3044382C5C398FEF114099A6B96B12 Satyrid
529,710,608 *3625B842513C2677C5774D3B0E0D6D13EC4681DE Q##P ~O~O 3B<-
529,710,609 *3629E3A1762CC06FE2F81F8B60D2F8690847D24E q###p`~`~)x(
529,710,610 *362FDB14E1DAC388233B2591FFE6B8DF4976DC08 SCOTTIE.VALLS
529,710,611 *3623EDF2C8E88F2436A87DA97248E3E9C01A0A80 SCOTTJUREWICZ
529,710,612 *36274B262C9E8FE78C6E1F3FF04E650D2E700BB7 rababsalama
529,710,613 *362F6E15975A7820C9E93ED7EF5B9BDB75303E02 RANDALL.SIFONTES
529,710,614 *3621CC96C0476FA8B03A212868B5F60D77A0AA01 RANDELLHICKEN
529,710,615 *3621F6B0C777942811BDDCB933EE67405030324D RANDOLPH.CHIAPPETTA
529,710,616 *362F0148462600F616EA5ECF717D422AEED14369 RAR3S7
529,710,617 *36283A48D6294A3520BA64DE17A93C4025DAA878 RAYMOND.SWEIGARD
529,710,618 *362C8617411EE40E1EF6C2C210586C78E14E53EC RAYMUNDO.GERHOLD
529,710,619 *362F2E212C571250F84924B64DECA4A55EF17577 shantifed
529,710,620 *36270A238774675A7B78BE08F23C3820A5BCBE17 SHERWOOD.SINGLE
529,710,621 *362AB9BAC8E4A3F543CC9DD2FA150DDEC39D4A4F SHE'SAPRETTYTHING
529,710,622 *362950C779B1DDC590E6F205D81501352F7ABE82 REETTIME1
529,710,623 *362C38CCEFB4CB978241A632C3015A38890D84B8 REGGIEJOE7
529,710,624 *362C5237E9845C9EC5075E0F8D3B1ED149A77C40 REHCISBA9
529,710,625 *362B146090959AAB7ABF7A8840D316D1573E230C simonangelson
529,710,626 *362A0FE57748E898C9A68DB781185523659BE644 REMOOBSLEBER
529,710,627 *362F572E6131AA8F0C43A2396BC2BA7BBA872A16 SIMPLEHEAR+7ED
529,710,628 *362553B8D88C6B962E08045C52CC1CB2DAF80B65 RENE.AUMEND
529,710,629 *362A316E974BD392C08D32084F407B2D9CA50F6E SIOTONTA5
529,710,630 *362B389207223C4C51DBEFC3D43BB34CF8ACB5A3 [email protected]
529,710,631 *362E2F53E6D479D0BF02B1FE1E9583D90BBEB600 repudiar
529,710,632 *36277FD78CF78F7807E281BD3F2CEC6FC76F91D9 REUBEN.TEODORO
529,710,633 *362E0E8BE9C2C48216EE7127E3C21BA188C2C383 REVENGEOFTHEREDPLANET
529,710,634 *36290E79ADD88588D06B857C1ACFC99BB8A9B57A [email protected]
529,710,635 *3621BE871F2B552A18B65598889B2BE8C63188E6 RICKY.DIBLASI
529,710,636 *362D4612F982ABDF1B832525878AA419C63D2852 RIFRANTO2
529,710,637 *362802186B2A89999F4D297C54B57CDE2D5474FE sockleng
529,710,638 *3621F8B0B8707DF739A29B0C215F52525CBBC777 RISK2000
529,710,639 *362408B04299AA51B94F6C93E9ED37D96D0FAEBB RIVERKASHMIR
529,710,640 *3624A57B54CBB62DF3A24E89232C6D4FEB5C9D74 SONAL-PARADKAR
529,710,641 *3627FB0DF1077FA42E69CB2E7F30EA528CF1FDA3 [email protected]
529,710,642 *3621E546850356308AF736C62E93699B3DDD12F4 ROBINFROSTYING
529,710,643 *362F963DA6C65AE5F2C60F0FCC817FDA7422CE06 SPANISE8
529,710,644 *36261DE2CDD7D4922B863176A39428C10F047E13 ROGERIOED
529,710,645 *362FD2A5BABABFA22B8AB9D074E61B268344FEB0 [email protected]=p
529,710,646 *3625396EF79EC86FFC6E654492706392F40ADB92 RONNIEGURNSEY
529,710,647 *362404F89361EC69F254E82593751D7BF93C3B66 SSENLEDDIMEVOS
529,710,648 *362D55424430736162F30250FCEBB2ADD1098504 ssenralugnatlum
529,710,649 *362A280DD7DCBA84EBB534E8C098928064E99D92 ROZ
529,710,650 *36216F96A83E16FE7762813AD5DB50700BC7DE3F STANFORDSTELTER
529,710,651 *362414E8019C0850D8D108841116D01B1E793AA9 RUBRICINGS
529,710,652 *3622E5434D4D2DC8F845A334F6DCA8E016D2385C starplaied
529,710,653 *36273B3D9F6DFE323566A009A7982977EDD841AE RUSSOVLEVLITTLEBOWS
529,710,654 *362B8EC31071A6ADCCFBAE58A070137D175F8EFC stevenbodway
529,710,655 *362A48DE590C9E6109EDDF199C861D0C02F05E67 stlucia
529,710,656 *362C4256A2D9ECAABA0E66B196BFA9C7FBDA0020 STROHSTREIFEN
529,710,657 *3629FDF0E39E56117BCA7488A7A0D8FBB24DEF17 SALVATORESEPE
529,710,658 *3626E9190FD6764C9567C0BD363948C5FCD14C6C SAMEER-SURA
529,710,659 *362A08A979C76DAE469549F2AAF8B6B8FDBAEF4E SUBCYANID2
529,710,660 *362826E1D17B98D335A97D255D32F227BC93F4EB SUFFRAGIST
529,710,661 *3621A4AC0549498F303EE0B33C6556D3FE374A29 sandramcknight
529,710,662 *3623B8EB72DC589ED5E609D20A19BE5D7553847F [email protected]
529,710,663 *362639C1A97B66286D83FD5D7C49E1BA02116E2E suoitnets
529,710,664 *362E7B7201A5461A2B572B8EBC362CFF7CFDE2C5 scarlettgopher
529,710,665 *3625316CFE65E5EFAF70B3F518FEF1D265A72F4B SCHLBYS2
529,710,666 *3624F143B6AF812FBEEA2FF1FC4F3F4CD2908EB0 schurftzalven
529,710,667 *362BACD6921BABAFD8FB4874061D7B91E10983C0 SCOTT-ARMISTEAD
529,710,668 *3621373255D9E436C961A45551988774BA0C9189 SCOTTWU1978
529,710,669 *3620BFAFF5745D963ABADB69D85D104D079AB9D6 SCOVILLESCHAAL
529,710,670 *3621F2EBFF99B89F771BDF1F6A7813102B812CB1 SDSDIN
529,710,671 *362DF9E843FBD4E9AAC4549735D064443EF97DB9 t34m13ss
529,710,672 *362FE3DE50F09B6435D82B646000713F93E98EBA SECNARTSNOM8
529,710,673 *362D44CD37D5E7B0932AEA8A01D2750D121FC8C8 SEINIM
529,710,674 *3622D6D1E36BAF5547FA79EFA611A3157D78DEA4 TALKNALLAMALUPU
529,710,675 *362490B511F75977D511B55E948DD27C2070F3BA tamayori-hime
529,710,676 *36256B8F300644AC0427E2D397DBEC1BBB483664 SHARRIEF5
529,710,677 *3623B2CF490BC30FFD2A39D17DD67C279FAAA059 shaunfoeller
529,710,678 *36242F94CA0A822701504EF55806E18A550BC38A TECKCHEE
529,710,679 *362B1732B5C007DE4FBF5FDF1AD0953578A98808 SHUI-LAN-SE-YAN-LEI
529,710,680 *3628268FBED0EFE85D261A1DDE2D167FDD6784F1 TERUMIHAYASHI
529,710,681 *362A6C2E4049ED1B6B35B8EDA86C45353B554FED SIDNEYPOIUYT0
529,710,682 *362013C3CD56BB55A8D0E8785D3D769350659126 SIKIYOR”
529,710,683 *36217996295CAB5AA2EDCE8770B76E632E3F98D5 THADDEUSFARB
529,710,684 *362D474DA2B61D0BA5571545605FC8B422B75023 Silver.Sliver
529,710,685 *3627DA8F18A0399F80286BDD2A2DB2F85EE86808 THATASSMUNCH77
529,710,686 *36239816107F3AD64AB56F04CB7EC6C0235AEC6A simonmasaki
529,710,687 *36207C95A3760827D04BD7D1D2226FFA3C0926F1 [email protected]
529,710,688 *362A54DD439D9A28A7303278ED46490C4FE4CEE2 siony12
529,710,689 *362CCB1EDB935338C3A39A45E1A3BDF689AD84D1 SIVANESHDON
529,710,690 *3624C1CC0000279CB744D1761B5665EDC8F01042 sk41kende
529,710,691 *36264AA34C80ED72FEB24970135D395F715F9E8D theodorehartson
529,710,692 *3623BA72A2AF002A37B0158A2E4D2991085A950E the.piano.sonata.(ii).-.michael.endres
529,710,693 *3627B76A5F6B3F580ED8BB4525264E19738D20FB SMILESSONICS
529,710,694 *3628A7B6D537D6DFEAD6FE35BBF0ABB767CA955D THE TERRIBLE TWOS
529,710,695 *362D340F20B8288FE4010E658F7027BE43105476 sonarmijo
529,710,696 *3621A751CCD4AE96F23DC047D430136D13E3D75D SONJA-BURKHART
529,710,697 *36251110A40FEBDEDCC6082D335E978F3E2EBEB0 [email protected]
529,710,698 *362F078CD47541DBEBC579A3E4655B4584409959 TIDSPRIORITETERED
529,710,699 *3623342A3B26CBE6D1993A27760DE9DFE3D510FD [email protected]
529,710,700 *3625D4C429DFCCE65F4C7ECFFA86F97819BAE5B9 TIKVAHIELLA
529,710,701 *362BA00FAEEB394DFCDDB2ACAB4B92F7EFD6E626 TIMBROOKETAYLOR':"TEMPORARILYBLINDEDBEEBEEDAZZLED
529,710,702 *362C3F6F4D10852E443F74C2F0EEC82635C2A7A5 sovkol.logo.jpg
529,710,703 *362F57D22D83AADE916FD8A70A7447BF80E2F09B SPANISHARTIST
529,710,704 *3625C2E0417D71FB6B09893F676989AB36E86246 [email protected]
529,710,705 *36240252E4FC21BFB94EA126BC3D0E7F45DEC8F7 SPEZIFIKATIONSSPRACH
529,710,706 *3626DFB91AE376E6BB24236F243DA5D36AC331D2 tnivorp8
529,710,707 *362ED492073D3161AC5CD9AF7A97376EF24545FE [email protected]#####p
529,710,708 *36254CE9F63EF988D6EE83890C4421A5FFB11A7A spojila6
529,710,709 *362DCFA3CAA12E29EAAA56CE6D94ECBC5A299F73 spotlightinthesun(radioedit)
529,710,710 *36230CE9355AAD05D11A4B9FA3B2C71F34908F70 torverhältnisse
529,710,711 *362E4BE7AFF3BF094F764705C7F26469976FDCEF [email protected]
529,710,712 *3625C87ADAC57387F287D39EDD71BC9EB336BEEC STACEYBALABAN
529,710,713 *36209C92D84D94FF203AFF25B3DBDBE7A6C69941 [email protected]
529,710,714 *362FD0E118022E39FA509B7FA8F5D17FEF5E6F99 STAJLIVEB
529,710,715 *3627C10BF10EA12EF5367E1E0AF909F36D9638C5 STARPIEST
529,710,716 *362BFB7BF22D59317928971CF44306AEC07C24D5 STATEMENT.FOREXAMPLE,THEFOLLOWINGSTATEMENTUNDEFINESTHE
529,710,717 *362FE8C66BAD4B05C2F9C17BDED49A60F62A96C0 statueman''living
529,710,718 *3623FCB82C5FC5B6C89BC3FBD1E22EC49899CF4B TRAVISRBECK
529,710,719 *3621BF27C3DECF71C95C2CBA788CD4957AD8D191 TRAYCEALLEN
529,710,720 *36296E0BB7B65ACD09D0B5F8E0FA06A159779192 trayyakhayyamukherjee
529,710,721 *36269ED2D4EC81CE298212C2AFDCBB6632A132B6 STEVERSIMBA
529,710,722 *3620D9C99D9E4A131E3F40720A1DEF7906F61967 STNADIXOITNA6
529,710,723 *3629C9BEC5854FA8162A8CF49F255571588EFE67 STOAESTOAE4
529,710,724 *36206813B7B790E6F1587DA355A24C12BEC5E44B storingvrije!
529,710,725 *362C578746AAF3E9EDA73E4A9520EAB575FA33C9 STOTIGES
529,710,726 *3627CF1C239E9B4859F68CDB8ED866C91E888E77 subnets?
529,710,727 *362B4084C914865640D2E1D2A9C04FB786AC49BF [email protected]
529,710,728 *36261F85968FB7709AD03FEECA4AACC9C2AF7060 SUFFUSIO1
529,710,729 *362726990BD599F129ACF53966D093956E4B7B2E TUMULT4EVER
529,710,730 *362D5C9615A322DFB8D035B17C9189FF0B0A0AEB sulavien4
529,710,731 *362B0207F99EBB7C6ECF9D370A789030A99FB267 TURBOCINDER5
529,710,732 *362B1A29F324F7AE522DEF58B78787DF06928068 TUXPENGUINN
529,710,733 *362D4847F42D410456FE3BB1F56576388DB59BBE TYLER FALZONE
529,710,734 *36224EAA57CD3C637FBC294A309D392D61BEAB98 SUPPORTPROMETHE
529,710,735 *36295003AAF8AD19E822F3E49E38CBF6EC1677BA SUSCIPEREQUE1234
529,710,736 *362FEB728073F3B2CDD4C88E5B6AEAA56F3AED21 SUSTENTEIS1
529,710,737 *3620C7ADD5A3FD5320927A6F026CB10099BD8D5D sylvesterrosenkoetter
529,710,738 *362CFB604BA16AAE8D7C8546A0BC50184878D652 UFKLEBER2
529,710,739 *36236515500CF4BF0B2D1B10FA6244CDC3866660 U?KW
529,710,740 *3621DC539C95EA70CF74C3F92797D4AC39A01546 TAGSORES3
529,710,741 *362591D943598CF041B8DB9209DF0E9180B0E225 URAUNAE
529,710,742 *3629D23BFAA9850A4FFDC1ADE5D73C259FE3EF63 URAZKPKVA7
529,710,743 *36246684DB7C6F52C88E6C812E5D4F4C18344CAF TEARS(FEATBABYBLAK)
529,710,744 *362B010E7EED8A7F4D4DAA214E7D2593429C7AB7 USERNSIMAKOV
529,710,745 *36223882E2F49D292D9B226334915274FF9E0CD0 TEIŠERSKIŲ
529,710,746 *3621B0D8A7E56FF896D391F38797E94AF43DF7B6 UTKARSH.WALI
529,710,747 *3621DE44493233580F17F8102C9063E65C7F29B0 uuqq
529,710,748 *362A3063601A034388F476016803F8D2A661003D TERRANCEDEROOS
529,710,749 *362A96E323CF9F10DB22A83CFC7AC46AE630813C V172239
529,710,750 *3628A0E430AEA030541D163915399B6E27A0C675 v3u6
529,710,751 *362145C615AE0880F02CCF60603935B2351E1914 VALENTINECADEN
529,710,752 *362FA0934830D8658323C52F9E9D01B0808FE682 TFZZIPMEMME
529,710,753 *362505048B4C3FBAE45608DC2C1D390942A95182 VALERIESNELL123
529,710,754 *362339491D5620582726D4423E86E341B4DADBAD TGKTSTN3
529,710,755 *3627BE7E426826BF3EDA7A720287F406EA0A8CAF THATVAL2008
529,710,756 *362270AD1D27FA70338EB2CF2458630BF75F61FA THEBOSSARTHUR5
529,710,757 *36288D2F063FA3BD4F80B977F491CB54A2EC7362 VARONES5
529,710,758 *36283243CD2C352DCC3D084DB0E5524EDC527B6E VASKBARES6
529,710,759 *362F7247211616072956389560007F4C33CECD1E VÀY-CẦU
529,710,760 *3623EB0D6AA7BADDD6BE55B64D322811CC8D9A8A TheFeeling(featSweetTee)
529,710,761 *36202762913CE3E15A62AB7A24351B4115B46BAB THEPARTYPUSHERS
529,710,762 *3624AF4763D6985ADEB1F650F8460C4A815E42F0 VERBINDUNGSLEITUNGEN3
529,710,763 *36285111A7BEDE5F7B6C06D47BE1E21B79C6FDA4 the-swan-of-tuonela
529,710,764 *3629DC116E10468E67D7E01D38431B8E1F9066BD VERSUCHSPERSOED
529,710,765 *362E7ACAB369AF7F88F2ABDF081410BB39A8C601 V\I1
529,710,766 *362D4730573E112E6BC99492FE7BFDD20F6874B8 VICKIEANDEARS
529,710,767 *3625DE39D98340258ADB152F80D27487029C1F0C [email protected]
529,710,768 *362D6A83C579ED05B8088DE4BCE4BD15857F427F TIASSICUODAR7
529,710,769 *362FB2399A978AFBB11754E7FCCAE7FD3D9E25A9 vildan.oguzhan
529,710,770 *362E91D602C3364F344772E27A60B73AAD2B1000 timetherewillbeperiodsofovercapacityandfallingprices
529,710,771 *36238B67B21C5208A28475C8EB1404BDF1D34ED2 VILLES-JUMELLES
529,710,772 *362681AEDFF7893278105940A1A7E49A18676DEE timvillanveva
529,710,773 *362E58FECB22AC8C061210C623ACBE1D067E74EC t//n/e/r/i/bicentennial
529,710,774 *3625F146FE3EC0E7D820C2532C1EB70E985B5925 [email protected]
529,710,775 *362B262FE12AA432CDB3E1FC79838053B6CD03E7 [email protected]
529,710,776 *362EB34DE754D45038AA5784A34D35B0C924E523 to.cast.into.my.teeth..o,.i.could.weep
529,710,777 *362D572491F72CBC408C5AA6D8A0E5D901807411 toda
529,710,778 *362197DE098F05A5EFB1833350CD52073F6F51F4 TODELLISUUSTASOLLA1
529,710,779 *3621A1DA2257660DDFBD594AA4D4D116CB0DBEB2 toe-rag-twitch
529,710,780 *36256E5AA40C8F586E41BF7394FA9D40FBA77FCD vittoriagillman
529,710,781 *362DD6B57CAF77137F483F0F22235647FBE3334C TOMAS.SWAIM
529,710,782 *362741D74FE5A0C563C4F7FFDE92B3F6139BDF12 VOLAPUKS7
529,710,783 *362C4B5C5720F0E8F3388B4B15A53493D6DA518D tonouarns
529,710,784 *3626440E6B3B6AD14CB66530754D778F34458BAF tonyduke9
529,710,785 *362B75EC2AC93081B7697AE1BCC91BEAD50BF7E7 vorntaree.maiyapakdee
529,710,786 *3627CAB208C9F8328C4ADCBE26A60662A86F0144 VORWIDERSTANDED
529,710,787 *362F8754ADBAFD7CC82C8778C1B0111097B05B1A Tr34s0nb
529,710,788 *362658FA33FD8387F7866FE76B614A41AE8F1A82 TRACEYDOMKE
529,710,789 *362C752CB8E58CF0F868C19FB095F851B878B238 VUYOKAZITETANA
529,710,790 *362C09CB2137D97B2ED3C1D6D0B3F3DB003E1D6D W4NK1IN3S
529,710,791 *36262A91A598E34A2B716E315E1288D5BE365E9A W80653
529,710,792 *3627ADA490A792FC084B3E70024F2CC8960146EE transcendentaletudeinbflatminor,s.139no.12"chasseneige"
529,710,793 *362BD76D3C0461359CEC931EE2522EEC0332E69C TREYLIRETTE
529,710,794 *3623DB948D125ED49F85066C057B3F7AB3CE837E [email protected]
529,710,795 *362E14E1D871DC3D90EE9DD9090D08C416BE026D tricia.jane.flores
529,710,796 *36254079B126E6C9C813EB1E06FD1621E0606300 WARREN.PANASCI
529,710,797 *362F5DBDFFA3F9A69351112860994A604D98246F watender6
529,710,798 *3626A7E94A4BFE1AE6B7807384801CB2C8FAD4A5 W^!C
529,710,799 *362A135B856B20E28B21F33AA1BDAD7530D328EE WEAM.DWEIKAT
529,710,800 *362E4C3F8B4429B26A164BAE5B148AFF01EDC97F WEEKLYDAVESPEAK.COMWWW
529,710,801 *3627917EA14D624D7F864C6B79FCD36B27F67CFE „WEIHEPRIESTER“
529,710,802 *3620116116DC2A44F8FCC606DB8FE1F546D15AF3 WEISHAIR9
529,710,803 *362F35DD34358F414A7BBFAC78BB8BD7EE268865 TUAN-NESS
529,710,804 *3624446AA90DC089A0D5004D5CAD5F49064F1E07 WERDNA-ENRUBREDDEW
529,710,805 *3624ED1A00F22BE4D8F4667A32F61F1A00BECD33 WES.DESUTTER
529,710,806 *36240D3BD9B43C3CFC36278D3E4182EEB053A78F TUVOZ EN TUVIDA
529,710,807 *36256B64D46571BBFD812C6ABA181CE8221B6E87 TUXTHE
529,710,808 *362E0466A88CD7591A5E32E02B2EC74465970C5F WESTONMAYEN
529,710,809 *362C7CDF9EAD14DCDD555F032897A0E1A959E90F westonstimler
529,710,810 *36233EBC98D757E24E1F9820655A6334509D4C79 TWOPATHSMEET
529,710,811 *362F424BF1E886E5F2A3F4DEDAB2F62A3CC9B3C9 [email protected]
529,710,812 *362B213B41D576964DAC01C7EE0769483476895A tyronedoering
529,710,813 *362538FB3158418381F6F8D64C6FE3FDB8425FFF wilbertpawlowicz
529,710,814 *3626652A3F3B935BC6B6730A56FD12BB4840DC8A wild_rice.w/ai/ld_r/ai/s
529,710,815 *362E5829506547FFF3FCD6BD2EB3C86C16D2AAEC WILEYFOUCAULT
529,710,816 *3623130AAA16F83098877B027E722CB1717F2551 WILFREDOROKUSEK
529,710,817 *36265FF413C11DD79190A071D01C1C2DF2E040B9 WILFREDSTINGEL
529,710,818 *362CFA8585B0DDDC8BB3210DDD62CFE4CE2DB25E will.cavanaugh
529,710,819 *36232C82FA58A481B6493534BDDE0FE36DAA2260 ULICZNICO
529,710,820 *362822795B78A95E7E33939564A7C4CB8BDC3495 ÚLISNÝ
529,710,821 *362F8D3CFD234C7EDB4C1E5A2B9E0E47AF099A1A WILL.LOWRY
529,710,822 *3627AD6EBDA9CC82F68BB60369FABFAA7790D0BE UM(}
529,710,823 *3625C795BD4943E65DDBB8214985D2AB5A4873F7 WINSTONLIENG
529,710,824 *362915E41B1E66ECA3868D75067C7DDA135563BA WIRSPIELENWILLMEISEL
529,710,825 *362D35B618CD794ABD2FF4495964C477185269F5 WMHMH
529,710,826 *3621B9F8D5287AC481C3DE0C19AD57CF4F31864C wolfganghollmann
529,710,827 *362C822D76C6EA25225BC380CAACE62F84F86BBA WRENNA.WILSON.ARMWOOD
529,710,828 *362C1FCA5F0970390D28C4EBF97F9C1E96DC6C7F upheaval6
529,710,829 *362FE4FCD7B8C3EC7E6BA130712277B721D2F78E WUXZM8NDUES
529,710,830 *362E7368325F693F209866E67024BA50074F91B2 WWW.ANAM.PT
529,710,831 *3621F89A851776B4B9E2E35280A3F26A4FC6B903 WWW.ENSIGN-NET.CO.UK
529,710,832 *362EC52D56FC91BD9FC1981C9F0CFE0D27EBDF1B WWW.ENSIGNNET.CO.UK
529,710,833 *362526214F185121BDC5D7A5EC2C433645353036 WWWNEWFRM2TUMDE
529,710,834 *3622AE344A19728A38F599763E634977BFCCB53B wwwpetiteansecom
529,710,835 *3621B1489FE76974E864467229AFFFDCB50AB473 WWW.SIMPLYFOSTERING.CO.UK
529,710,836 *362696CF066D4972B1D6FBD39335DE824EC491E6 WYNALBERTEROY
529,710,837 *3624E4E56CC321C3D1FCBC9751C32A0C8C5377C0 {x}*-(------3
529,710,838 *36233483C3402C6D0EB92F74D30950B7C2500C50 X6178
529,710,839 *362740C805FB1E2779962A5A875B8900A765E3BB VAGINATUMING
529,710,840 *3622E17D64409FE0852F9BC547B42C744E0B36DD VAILAINIŲ
529,710,841 *3623AC1F1B45584F777F732E7B45B9EFE5891F2C VAL-SOULARD
529,710,842 *36203113BD9EF5704E93766F60C503AAF00D8AC0 VANDAIE
529,710,843 *3621E8A6D383EC9570C02928DCB1A2052ED21436 {x}~-~-(------q
529,710,844 *36274DFF5DE2AB6B1DC0C70EC8C6D7C3D2A859A5 {x}~.q###3
529,710,845 *36212C5418AE8B11072DCA052F8F724458D0DACD )X(~`Q=====B
529,710,846 *362BED877FADCD7B590AF627D10A5AEBC69742BD VAUGHNHOHING
529,710,847 *36224A288828CC53687905FA04542B3EBD81C995 VEENAMALLAR
529,710,848 *3627DE389D4A52A0C401AE50EFF0D3B44803C410 VENISEBAQUERFO
529,710,849 *362218BBB8D7B27B1F4DE1CB4D0F67ECC7174397 VERB1GERA+E
529,710,850 *362D31B569B5B78C91E8436FF09A7CDDFE77173E [email protected]
529,710,851 *3623D7F487AFF5FC4C0A6A1E78D39482BA9E4598 VERONICA.NCAPAYI
529,710,852 *362BD15AE1FB20BDC4461616ED68976785FFE740 vesutuf63
529,710,853 *36262DC83CC936BC387CFE8AA8B2CCFA6A72E815 vicenterambo
529,710,854 *362A5193E36D2352F4B0483A8DEC3A9409E8A2C7 YHPSLHPTMNP
529,710,855 *3624A0F145BFB4917BEC1BEB481582F368E76CAC [email protected]
529,710,856 *362998094E73D84DB105B8314B83B9C777E64A51 [email protected]
529,710,857 *362ABC7AE58D709C6019B21C9B4A1E12C0661573 VIKA-MANUHUTU
529,710,858 *362B813D8AF05B1936C00A2BB3FFE830A1565369 VINCENTCUTTS
529,710,859 *3624332E2F53C9295C37840E24DA66E05259C9F9 vincenthesford
529,710,860 *3625548552BF4F7CBE633937744F705260BF2D9E VIPINPOORHUN
529,710,861 *36212B6B2C6D2B3964A03F2EAD3B281EB4A2076E ”VIRALLISIA
529,710,862 *362369A911720168A77979A8AEB90DE6E3200E82 virgil-h-huston
529,710,863 *362F189913CB0F0DFEBC1B542C637BCDBD890E85 YOSSDWI
529,710,864 *362A38474D8D79993D1A42E1A2E30DF8841311D7 YTILACIDAR
529,710,865 *362604377361AD1ECCDCCCFE7B3656F2D265A098 yuasays5
529,710,866 *362658F3B1BED3301B5B6F721E55E49028A8C8AE VON.MACIAG
529,710,867 *362627AACA4D0DA39F8BD03BA4D357475C955CAD VORMUSTE5
529,710,868 *36238158F6EF98202BF004B796DBAA9F76FEEFDD [email protected]
529,710,869 *362D65BB424FAB10A2C3D3ABE1CAD86486CA8DB6 VULGARISMEDICALCOMWWW
529,710,870 *3629C31DEF26941A6ED82AD92F9D5112CA328ED2 zach.estok
529,710,871 *3623D96C4DF66C91AB627FDEEB5C5C9E531BC33E VYNAKLDANCH1
529,710,872 *362661DAB416AEFEBA5F41DFC60CBF148B2C003C zaldyalemania
529,710,873 *3624F93B5F38448BC403583472FDF095FF1CD390 W3IGHTILY
529,710,874 *3627A1B92C1C63B35C998E2DEAFBD555BD84A844 WADELA NOVELIA
529,710,875 *362748190A93B4813EE1FFA7C16A1F62D75B2261 ZAR.UND.ZIMMERMANN,.II..AUFZUG.NR..11:.LIEBLICH.R
529,710,876 *362C3E27E0EDAAC51E9691682FA69893792A2D0C zayne.knight
529,710,877 *362B1582E6FE077C27D482727BBB96AB8FA2FF79 WALTEREHESS
529,710,878 *3620E58D47414B7C7E6ECD08E130A445A04D205F WALTER R MAZZOUCCOLO
529,710,879 *3623040663F43A3F91532911CAC9F5D1D8168C2D [email protected]
529,710,880 *362AE6CE511B6267CE8D7B2359DB136E756C00DD [email protected]
529,710,881 *362433B307166826838C58D1F54F16050A5B487E [email protected]
529,710,882 *362422C4180D7504BB3B0FF6BC8148A0BF70FEDC ZSOLWAY0
529,710,883 *3620B5130CFC44C381E7BC18BEC300EB83BA9121 ΆΚΑΥΤΟ
529,710,884 *36247C45587DD1FCB97F12419B202BEE072752F1 [email protected]
529,710,885 *362D1AB2C71D6AE1592CC095244E4956B12AE7F9 ΌΔΥΜΝΟΣ
529,710,886 *362A394EC3B527CBDAA417A5FBFEAEA1ABB9A2C6 WIK88AA
529,710,887 *362555875E64006F2902D5439047E63161E9160E WIKICITIES(即今之
529,710,888 *3620DDE3895D1A1E7AD794E1FC0F3CB2351C026B МАКМИЛЛАНУ
529,710,889 *362E770C16AF2749AE122289E714A87FC1225188 ОБРАДУЈЕМ
529,710,890 *362D0AEB48C652095F7DA96F777EE215A07380F5 WILHELM-PIECK-B
529,710,891 *36287FFDC4C71F162E7DB51F65255328092E559B ПОВЫСАДИМ
529,710,892 *362CCFE2A9435C18EF0D454FC2A8AF3158DEC239 «САДЫНСКИЙ
529,710,893 *362CE4547262C663B42735E3290C8402DF27D343 сновал
529,710,894 *362517377B4D041C410F6D8E4AAD7884C3918F59 ТИРХЕНСКИОТ
529,710,895 *36265EA8CDC23AD06C40E259E24C456B505144D0 ТРЕЗОВО
529,710,896 *3622AA4F75EE6342CD4FD857B76F726268795988 WINFORDMCCLEARY
529,710,897 *36283EC64EEF70DD6A09C74FF2C197C88B9E6C00 хултън
529,710,898 *362B2234B2B7E51670989644093B6080A9FE84D4 wouldn'tyouliketoknow?
529,710,899 *36281E89CDA735367FF8D239F621DB31ABB51962 [email protected]
529,710,900 *3624BDCE78BA3415B58DF9E87848799F516E64AB WWWPATRICKPUNCHSHOTELCOM
529,710,901 *362821A3B917ED6A9506A74EF97DAF37B140A136 WWWWALKERSLATERCOM
529,710,902 *362B9EA8BEEB7C7298B638154B1ECA052CF3D736 WYLĘKŁEMU
529,710,903 *362A688A0F6003AA0AED25FC50E64F57BA732040 。縣名紀念在達科他準州建立殖民點並負責移民事務的詹姆斯·s·福斯特
529,710,904 *36228A67A97571A4A48507992B6BDE71DF8F2C92 XMLLANGCHOOSING5
529,710,905 *3622CE64ADC1C79FEFF4E6AB2B3F341FB9D02640 xxiv-xxvii
529,710,906 *362D396F3D0D7B283418A90926655C737BC5304D (0-0)~-~-<###B
529,710,907 *362090C3C555CE3B02807A2E9BA942C32F47F690 YURI-WASHIO
529,710,908 *3624D2C3584D084F7F34735AF322F265EB27FF8E 0d612a8e489934ccb24970884286c480
529,710,909 *36288BEB977703B30AB6C47E154D048C835E2A94 0range.ru
529,710,910 *36205C22D4544A6EB286BEDCC2A797E26EE9EDB2 0SWIM7
529,710,911 *36213121F53627C0FDA49DA767712F9C5F6001DB 1033135 clintonin.hallinto.on.jo.ottanut.t
529,710,912 *36233F998636E52D0608EF9070E38E7769F29E54 zackchipman
529,710,913 *3622CE54AAF3229D07323870C544AAEBEEED0E57 1104545 selecting a database programme can be confusing
529,710,914 *3626B7C28DE7C3F7D18AFAD10C10D8ACAE645F88 zaid-al-tayyan
529,710,915 *362B13D2621B63EA821C72BC70565A245D7DA48F 1219166 MUUNMUASSALASTENHOIDOSSAAPUONTARPEEN.
529,710,916 *3626AC3D555BF34337597C7139495FE9F8FEA47C ZARGERAN
529,710,917 *3622C340C159705407C251A7491FB20CEA9BE62D 1241499 WELL , THAT'S WHAT THE EVENINGS ARE FOR , " HE SAID .
529,710,918 *362ED36C2E4778316A467516CD2EB78506EC2781 1290771 einesolchepartyhabeerseltenerlebt.
529,710,919 *362B82B6B03D68949174B2BB426FF839F02E1AAB ZCLOCLO7
529,710,920 *36246DB33441F8CD1FE2B44CC60B93BEBCCA88CB ZEILGERED
529,710,921 *36224B96F5536C0916257ADDD221284C080073A2 16000us6060100
529,710,922 *362A2142823FE7EA47712D741383B046FC9FE204 ZHONMATA
529,710,923 *36200A4EE933BEC7B9AEC8714621FD4F1CEAA5EE 169.KULJETTAJALLE
529,710,924 *36299142E375613F208D534D57DC1E9443FC0F60 1772945 " OLEN ILOINEN , ETTEI TERAPIAA LOPETETTU VIHASSA .
529,710,925 *3628267F180A0553A17CC712F279883ADEAB0DAF 1794833 MINNA-HEAT-OLI-3--ULKOA-TASAINEN-VIIDES-
529,710,926 *3620728647D7AACE5E523ADC6B3F17959B14847E 1842058 JOS MAALIVAHTI RIKKOO T
529,710,927 *362A862380F91749E2446BDB3A265581EE21EEF8 1881136 ALUKSI.T
529,710,928 *36225B5315190EF0DCD24E6A99FF2EB5B897CDDD 1942042 ATLEAST20,000RIOTOFFICERSWEREDEPLOYEDINSEOUL.
529,710,929 *3624901AD096D37DD38CA0A10568B5E59AE96ACA 194ADDYSON
529,710,930 *3622EF106F8D647F4100EF17A73948F1DDAA82E4 ZOOPHORIC2
529,710,931 *3627FE40E2D5B1467483CCD627A111AB2911EAE0 1.ANNE-CLAIRE
529,710,932 *3620CA72D65F15BA7693DF98329EBA9BF9CB706F ΕΣΟΠΤΡΟΥ»
529,710,933 *3628FFBE93B99A5D971E30ACB2026585157E1B5B 1 COTTAGESTURNEDSTOREFRONTS
529,710,934 *3623C923A0BA640B6C55253670040F54A65DAEEF 1denny'swannabe
529,710,935 *3624E1868C57E6BEB8352A14620827A37E1B47E1 1DSLLAITTEITA
529,710,936 *362BBA2B348EE1641A48953E6C785E71D33A31A3 1.dunde
529,710,937 *3627EA24BEEB649AA412395B5FC4A8EB166CBA70 БРОКГАУЗЫ
529,710,938 *36272D4CBE11C3278A17B38B6F8D95B8EC78C29B 1FUNTASTISCHE
529,710,939 *362615DCAF2EF7E758F7B0FF0AC8E33D0A5EEBB7 1 glaserthe
529,710,940 *3627BF85F259900C7BDC37F950E28D6C225F6653 „данакер“
529,710,941 *362B0552E51703BF90B6E4F7C9A31007EC9A3874 1iepotauko
529,710,942 *362D55521B7CC1D51EC1451FB666FAB9EA11B9F4 КУЛЬТУРАЛЬНИЙ
529,710,943 *36252BD80DB4A1E6B73D5FBC9823D78E4A3113C7 мезелак
529,710,944 *36264D30494644859A7B3980879FA704DD0E98DD НАПЛАСТУВАТИ
529,710,945 *36201792AF00A52A20E439B8106A86FE32CDA9DE 1-KULTTUURIPOLITIIKALLEMME
529,710,946 *362BF121E82BA58B2AFCF744E380D672BBFFFB23 ОТПЛИВАТИ
529,710,947 *3621443C79BB9898205697604CADBE99C5C50111 ПИСАТЕЛСКИЯТ
529,710,948 *362932E0CCAC0631FC3F6A43ECE5BC18B6037C12 1.mass
529,710,949 *362E77446B405330994B87B6166EE089BF58AE65 ПРОБОДЕНИ
529,710,950 *362DBF5015560D671E6BD36E164B9378231B1168 пьетрапо
529,710,951 *36214E2EC68F10B828B6C446474ED4161A4D6C10 1NESTEPAKKAUSKIERR
529,710,952 *362BB490CD84E43CB41A11B672BD032DE75A7C04 СФОРМОВАНУ
529,710,953 *362FB8153988F2A02091983F66D621AC4421110C 1PORTDRINKING
529,710,954 *36207C29E08C96141558164E8D2AC663119733E2 чайхана́
529,710,955 *36299683DBCC3F5D851516EC6172EDD9FBF4684A に出演。11月16日から19日ドラマ23「愛人マンション1」TBSに出演。
529,710,956 *3626EA3F14840B198DA510F733269E4328333D28 ゴウと大学の音楽サークルで一緒だったNAKAMEが加入し、のあのわを結成。
529,710,957 *362224FF1D6F650CEA139E9B7CC6E2ED44941538 尽管霍默不经大脑的行为经常把一家人闹得天翻地覆,他有时也会令人惊讶地展现出自己作为父亲与丈夫的责任:在“lisa
529,710,958 *3622CD3DD5482A10F3B3D0EC432AE13441F872E5 1VANBUSKI
529,710,959 *36287BA56D216BADEE5A1884763ED0D8A751BF77 1.verilmiSe
529,710,960 *362A70519BC32417D0CA1797D1B3FDC3DB5BBE86 1VIRILIS
529,710,961 *362FA9B9BEC1E037150CA887FEA371FE7C7E4BE7 1 WANDELGANGES
529,710,962 *3628EDE96AC09ACD206A7049FD7DCE85656E463E 2007SCORE
529,710,963 *3626A373EE4407133E39C493EACFE35AECEAB227 204DQ
529,710,964 *3624A3BF65816A209306C80CC3EF08EE4CB994C3 2096967 teollisuuden ja ty
529,710,965 *362444AC10DA2E9DF4B05B03FEFE405AAFFCED61 2153219 POHJOISMAIDEN-KIRKKOJEN-STAVANGERISSA-1997-PIT
529,710,966 *3627E699007E5A9EFF8107740235859D43B17568 2197517 itse
529,710,967 *3625AD1CA3DC6E22C340135718DE50E5855E21C4 07-04-61
529,710,968 *3624708D2B3BA9843518D335958238B77FC3CF41 0SPEEDY0
529,710,969 *36271B1DCA4ED9D1B11866EA739F625C3678A63B 11101686
529,710,970 *3628A561E891F2DCAEE0D2B6BE74EC2E869352BB 123abc
529,710,971 *362C3B53B7430EDE29BF0CB8B6C9C89B5B22D010 1382683 unioninkin pit
529,710,972 *3620DDA01457C4F4BDFE69929F39F695273E700B 142344 BUTTHINGSDIDN'TIMPROVEQUICKLY.
529,710,973 *3625D2719BD9739791A020BEF216FA981BCB6A7E 164536 giant hill kesti johtavan takaa kolmanneksi
529,710,974 *362DBA5DFDE49776D4F57D35D1F84B4BCE9DDAE9 1921061 ne-nimitt
529,710,975 *362FEE17C2535CFD1EF9AEBBD43562C8647AEF86 1971777 VUOSIKAPASITEETTI-ON-100-MILJOONAA-LITRAA-
529,710,976 *362B011DABEB162497C9A2719DA6FF3DB118A816 1996年tvb節目,懷念翁美玲
529,710,977 *3626369E42E240BC1C22B6B9616AE6EF8DC82E0C 1.chongqing-style
529,710,978 *36290C597D7F24D59EF58800F718030190BA2590 1DEUTSCH-ENGLISCH-GEMISCH
529,710,979 *362B5D7751212AF533DA97B67507E5A3BAD6BFFF 1.EFFERGRIP
529,710,980 *362984C21E610FF6D9F06AB0ED4C4C5F0C8168CA 1eg-probleme
529,710,981 *362628FE1978C6718CAAEE79B5ED105A71201760 1-FLUEGELALTAERE
529,710,982 *362CF179753FB1DF220A396C274801BBD5F43763 1historikerzeitschriften
529,710,983 *362E5469E700F8EFC68F95BE79914ACBEB80BF5B 1iamtargas2
529,710,984 *362DEE8F8258EF18A86C467E238599084830ACF3 1-kilpailukykytekij
529,710,985 *3621E97F3639CA379F23F2A97021808615D9820A 1.kortisonikorvaushoitoa
529,710,986 *3625E9640E6E59C86D53CA5F0254122DD7B7C71D 1 LEIKKAUSSALITIIMI
529,710,987 *3624133FD55BAAFEABB30B2DFC39D7FAACD04EAA 1-LONGORIA
529,710,988 *362CB82B9E43F0FE560E7F00612E0CA234F39546 [email protected]
529,710,989 *36215234725504DB167CA6F3585F59210BDCE62F 1-olutaeura
529,710,990 *362AF66E9BF8623032DB65F2ED54FA0E4673E8CD 1OSALLISTUJIIN
529,710,991 *362484F43590376DEF568F898DE6EF8B29F61649 1.pangiso
529,710,992 *362F2261E3E8F29BDEBBFB151586D232359B486B 1.SHOWUNUZDA
529,710,993 *362415D90FCE7C9306A5CB91388E9A2F75C8D3E8 1signsto
529,710,994 *362467EBC1A40D0E7C28406F0DD76DD48BD0038D 1tschausew
529,710,995 *3628E5A7F2DEFCB74AAF93DBF4611068335673CA 1-tummaihoista
529,710,996 *362559A7661632A20E97074339CB04F0363F9B25 1-WEISS-BOSTEL
529,710,997 *36250D6040EA3C4F5B3E9256170ED6F63E6FF507 2010年「~mini
529,710,998 *3621FD0F8738A7213ACABA31EA06E234FDAE27A8 2458438 uncedin.p
529,710,999 *362ADC5470F16047786B45C91B766DF7E759644D 24.HOURS.(SHORT.VERSION)
529,711,000 *362E670BD8BF9F294D6EED859731CBA86204E55F 28101990
529,711,001 *36253A12BA040968AEE5536389DD291048801F56 2FSUGGESTIONS
529,711,002 *36236E1B1ED758EE81C1D0AD35CD1245B4DB45BF 2HIZOHIZO
529,711,003 *362C78845A093851DF564306A4EF69D9C7EE5590 2.RANSTADT-BOBENHAUSEN
529,711,004 *3624533983F368BD88BA2434DBE94513CA84D4C0 2TNCS95VSUSIEQ
529,711,005 *3620CA0712E7BE3C245DCB365A999D207C2A2197 3abilbobaggins8
529,711,006 *362CDCCD7BF7FFD2C3B0FAA098A9163C8F781F9D 3EMBAIDORA
529,711,007 *362D55F7DF1A234E9798EA637FA0698070F8CBE5 3GEKROPTES
529,711,008 *362314F6CA8BAFD189D16BA63DF6AE5E42C417C2 3HOUSTON5
529,711,009 *362D8F7F8F4D722ED5D32B8DE55574F2E36FFFCB 3wishless
529,711,010 *362830A6434E561C3C25F6056B63DABFC14D6247 491023 ahmet-vefik-pasa-cad-.
529,711,011 *3620E55EA625C8FBA78CB8DCF53E1D3EB009859B 4EWGALSAN
529,711,012 *36279E38B067A799795610C0D51F71CE6EFDE8B6 4froggies8
529,711,013 *362FE9855EA26095E65C0E4479FAA1DC620E9875 4PITTOSPORACEA
529,711,014 *36263C37936E83085670D050691D6887A20D519C 4UMPELTER
529,711,015 *3628EDAE41734E29077A430DBBD4B7533853E450 547alannah
529,711,016 *362FB04D5A7008D29BCFDFE7F8BE03DF94B4B164 5mysuzanne
529,711,017 *362BB5DCCF59293DE65F33F715868D542B1A5C01 5RAYARES
529,711,018 *36270F3133F10A4ABD05A792724CB39136596ECC 5RELEJIMA
529,711,019 *3621494BA6CCF22258B8B3911AE85E8C0678BD80 5SANDERSBULLET
529,711,020 *36272030E592B9AC53A3014FA1D0D62BEA22C496 5STEVENROYAL
529,711,021 *362866ECF206F658DA279FB23740D145136C9783 5STRANGULAVIT
529,711,022 *3627C66254BABA640D8E3BD42D6C84F02CF91B8F 5TIQUERREUQIT
529,711,023 *36203FCB4B7D26A1BC5F769435215A3BCAB63304 5WHISSILLE
529,711,024 *362289AE093A29D4E73A4B6FE7688E6462AB9C29 6BLITSENS
529,711,025 *362E0966B1D502CBC6EF408D9D3797650FBCB561 6GROSSZUEGIGES
529,711,026 *36237ED430BF38FC74E712ACF739A20FF33AC00D 6HARLININ
529,711,027 *36253A13E2C825779F20372672C965ADEB0F9F7E 6MONWROFWN
529,711,028 *362C47731A558AA7B3D4ACC97FC8333B0E7E2618 6PROPITIARI
529,711,029 *362AEE03430EE387324CD8769BFC3699721E4DA0 6SPUNKYMILLIE
529,711,030 *3621F82F67261EDB11644E977C319912282F3AAE 6SUPRAMEDIALS
529,711,031 *36256CCE32C88003BA7FC9B78FB2DC3FC16F6548 6TREMPIONSES
529,711,032 *362A760C41F5CAF69B203E413F9E41A6804B47F0 6WIZARDSTEVE
529,711,033 *36235E0C9FF8B82BE737241D1CBD00A4ED5C3F34 7BLOEIKOLVEN
529,711,034 *362059A92553C01E7C02B7683B1EABBC2622345C 7BSWASSINGED
529,711,035 *3627BB9BBBEB0A9AE0EFD13233792AF3613153C8 7CDRBBSW
529,711,036 *36275E35537DFC9175D5F9D9B08FD453C3B0870D 7iluvnebraska9
529,711,037 *3624224C813F69F4A76771D3B57684183BAF3185 7MOLLYGONE
529,711,038 *36275A56E770CCEC19C9993E28FA11907CBEE8C1 7ROLLWAYSES
529,711,039 *362D1338190D185A8AF8AEC2F6C8E6E9DDD19F73 8BVCZXDCQHXNL
529,711,040 *362D8FE326AD66DEC031AD97DF76801DD61D2BFA 8DOOMALIENS
529,711,041 *362C383EE79608BADF5298DF5A0A33B99A82FF9E 8-----D `SPLOIT
529,711,042 *3626E872196604DC8DCF1E4073CFD93156181F49 8EMPTIABLES
529,711,043 *3627D6C9E0D3BE28357E5342C764AFC8A54EF62C 8ILUVFLOWERPOT7
529,711,044 *362B05D3134D8835DD95269A15D312E944C6C36E 8NIETLEIK
529,711,045 *3627F5F2F77AB96532803E0233A53A58667001EE [email protected]`~}o{
529,711,046 *362A4649A076459E6127AA332736309BDA9AE9C2 945ruben
529,711,047 *362B8F8A3884743BB156A7447D1DE35E887D23F7 9DUBITAT
529,711,048 *36248069CCF45713D84C71F5657F767B007D6394 9INFOCOBSW
529,711,049 *36245B20F02DDBB7D0542D56F852549A42C68A81 9LPSZPASSWORDBSW
529,711,050 *3624B7E19C79229723FE7794BEC0C2E5FA8D1E5D 9NAPALMBOMBERNE
529,711,051 *3624446006E3FDD46F50F2BD30D69A0EB0BC6F35 9PUTBAAS
529,711,052 *362533F210383C78208F628DA2122E85A529E64F 9TEKLEGUH
529,711,053 *3625D2901D166CADEE4B698F24E5D104B4C97390 9TUOTEKEHITYSINSINRI
529,711,054 *362EC89CA351DAD140157AC1330AC9795EAEDCE9 9YROTAIRPORP
529,711,055 *3626632267DBB74F5A61CF1289FE7A85ADE984D5 9ZNATNOGA
529,711,056 *362071D3FC98E6FEE0D32A13D888349290FC30A2 a2_mh
529,711,057 *362F057E025BC0F58D95923163A7EAD521144CF6 a5!;w
529,711,058 *3624A106F10EAC12CE7F497B19F3A8234AC870A1 a8e=y
529,711,059 *36202C9D733DC37CE934342B75ECA4908B8E83B5 a8f
529,711,060 *3627DD7F8CE0F4752CDFD4AEFF0998E5B23F0879 AAB*7Y
529,711,061 *362D43F69445A65D3892E5397AE33668678FE0F6 AAD7G`
529,711,062 *362752A72AEFAAF50499225FA32EAEF4720A58A9 AAE%EM
529,711,063 *362D62832F53DE93E1E0000599F823764CC47CF1 AANGESCHAKELDEN4
529,711,064 *3626CB1A22D2C2FC416CB6031910CECB7886ECA4 AB1^\
529,711,065 *3622F732FBBC754544EB994D5625CFE9F5EFD118 ababy'ssmile
529,711,066 *3629C692E6480E742BAF4719A0D1A5D12892927C ABHISHASTAVAT2
529,711,067 *362674F8E273CD1A0392FABBDE722E7C317465BF ABRAHAMPIGFORD
529,711,068 *3620ED47F3C0F1E8FF90FFF1045EC3F5456EC942 abyssgate
529,711,069 *36280AD09CE6E28EBCEDD14083BDBE9A9679EEA1 actionh
529,711,070 *362FE3B65B95832FA97D3506B351ACC5C6FA6785 ADEPT-SOFTWARE
529,711,071 *362061FF382F4DDD129326A348A988D430E9AC70 adh1a
529,711,072 *3622FDE2AF3EEB39E4C3238C1319A73BC8E683B9 ADP;>
529,711,073 *362DE635C84BA409BA0959C357B76B6BB6DE6324 A=DTI
529,711,074 *3625BF1085049E8ECB84703FA1243E74BA242BE7 AENOIGAT7
529,711,075 *36264D71E40D65BABD78FD08FEB61B2C478FF072 AHEV=HAVE
529,711,076 *36221A8AF7BCACD9D4525591D974A9F457756FDC AI2e
529,711,077 *362CBDA655D4E8FD031096DA739C8DC000A4D1CB ALFONZOWECHTER
529,711,078 *3628A6F561A3959DB17B07FBFB4D13E55C2AD723 alphonsocoplen
529,711,079 *3623E1C1C57613229A22CDD9A89BA7AAF6A9B468 ALVIN.RAUM
529,711,080 *36238450E13104F2C793295749B27C3051D8D506 AMBADIZZLE
529,711,081 *36291D420914E4236986718D14C8482B42B0BF7A a:n7g
529,711,082 *36281D24AAF8C09FAE0EECB0C4EC91EA16A3EE23 Andfromtheirwateryempirerecollect
529,711,083 *3621D832404ECBABE5D0AB8591563F84AEFB5F13 andreaharman
529,711,084 *362AB1B2B1024201456AE7C102D02BC0E64213CC ANITATEWARI
529,711,085 *362E5CA1831BC6B935AC2802E6D67C671E8E15BF anledeop
529,711,086 *362820F333830C7BEA1AD2146634C3F0F16AAFE0 anneysa4
529,711,087 *362C7E2F38CA28F981FC51EC6A2FDE0A307E66CA ANTOINEDORER
529,711,088 *3626703FBEC35391D3AAAE89C6836F6C08EBA4D6 ANTONIASTRANO
529,711,089 *362F214133B143947DA004A8CF7DC36A4345A49A ANTONLAACK
529,711,090 *36206F18E416EF98EE063143775FB6A790BE215F anv&
529,711,091 *362F8FFD12B9F325B9B84B4ECF6FFB74588F8BBC a-p&d
529,711,092 *3629D5ADA89E00D43123A0281CED2AD5876BB3FF apodd
529,711,093 *36228187044CEBDE6B7D0203CA82B67BD3A20FB6 [email protected]
529,711,094 *36243E73C6EB461AD68685C04D817C4AB84C423F aritmana
529,711,095 *362A112160B8779E3665B4B781443D2311B5C62F ARLW4
529,711,096 *3627694395659C35369B292C3B044743A9CCDB15 aroundthethrone
529,711,097 *3625EB0E7B74306CC8C48C54D5AA30D0804DFA02 ARY5F
529,711,098 *3622B8CB251BDA82174FCBFF78EB48E73F8A658A asa?n
529,711,099 *3625C3DF293E1292D61D4552D9D6BE9296AD059B atalakulas.2
529,711,100 *362B10101AAC4282AF2FA1DB944D5A018AA3C046 atq$=
529,711,101 *362933B57BFE85D4FA07C31BA91170F970E25151 AUGUSTINE.LUCHT
529,711,102 *36220E01DCA85EB12B8E4DDC8724317E6D659B8B AUGUSTINERANDA
529,711,103 *362842D768070261D30DE0026C10990E66BBB3EF AUGUSTROMANELLI
529,711,104 *362F97494B0E95ED3ECC3BDD0CF6F2DD51983C37 A/UTV
529,711,105 *36243631F09D61F31F09B19471D8B79FE710E66F A,-VP
529,711,106 *3626E5C9941E9E6351E739A8093B0364E7C82A9F A?Z5V
529,711,107 *36210770D06D15BF3B78E9455B6153ED310F12CE b=====>*.*.*.>-<
529,711,108 *362CEF0B242E1E6943642E14FCC32135DE02B94E b0dki
529,711,109 *362C6467F12D736BFA5DC60B55E874F54CEF18F6 B6WRP
529,711,110 *36235BC06E3BD592DE5C9BC2BA72A59A10B6AC22 BACK HOME FOR THE CHRISTMAS
529,711,111 *36260599E2602E44DA748944CC540EFDAEEF569E bapo&
529,711,112 *3620EA2E501AECD74F31AADCDFEAAEDEEF11F6B9 BARTONVANARTSDALEN
529,711,113 *362FC401A3D802FFBCA842F61FA4E1DCF606FC52 BAYONETING
529,711,114 *362212040F5CB57432BE143D75A068682337A65F bbu9k
529,711,115 *3621B56E38ACAA2B3C7107E5602983C34DFEAE12 BCKi
529,711,116 *362CF5C7D90D8AFA99DCB88B6EADEED9174D2328 bd&pb
529,711,117 *3628FE1FA6B394E9668B0F3F95366623A862167A BEITISRAELORG
529,711,118 *362A7331E2253CFF3B3B1F41330741C9BDD61413 BELINDA MCCARTHY
529,711,119 *362D962A16E32B303E57316C05873D62B964EC6F BENTON.CHAUDHURI
529,711,120 *3620F53C790B5AE5E5FD04F4E9C3FBDE43AF872F BENYAMIEN
529,711,121 *3627D97B6431345FBEF703F8F34AC7D46E925C0B besser.gehts.nicht.(extended)
529,711,122 *36230782C5E451A1E519A0F1D360A20F04465843 BETRAYED BY TRUST
529,711,123 *362394AA21EDD991F9DA164D8FBBC1C0C9E2BA82 BILLIE.LADAGE
529,711,124 *362401B60B1B2D77C7C5B385377133488813ACEA bintagaye
529,711,125 *36265FE141AC4D82C396445979ADD0EB7B13CF51 B(LBW
529,711,126 *362C00AD2E2D177BFA42F2A419E3A4A5B15FE8F1 B##@~.`o->-<
529,711,127 *362060E83A498AFE27E060D03B60E6336DFFDB40 bobbiebernbeck
529,711,128 *3621F102FDCAB9412DACF2D9701897A2A920C53A BỐN.MƯƠI
529,711,129 *362E26FBA509057C3C94ECE06434EF3EAD507E79 B.OQP
529,711,130 *362BCCD28C192E8B799044BC8B8FF57C26B8210B BO Z DZIEWCZYNAMI (KARAOKE PSYCHO REMIX)
529,711,131 *36285C1B4E7E1780E4312ACED69435C2310564DC bradfordtiemens
529,711,132 *362F5483E5F54CCA863754E5AC41E19BBCF5D004 BRADFORD.WESTMAN
529,711,133 *36236CAE4A080991B0D9FAAC482B5D819EC213CC brad.onken
529,711,134 *362C45A141793D8E5D84452AB30EE60DC4DD87E5 BRYANT.HANDLIN
529,711,135 *362DC72427330C06196409D17F00AAE6652BCA45 bsonics2
529,711,136 *3627DF669DB2BF6E61C0B8CB1E1F76AAF2664454 btig6
529,711,137 *362BB56B1C296CB64DFEB4F07B930B8BA87855BB BUVINA
529,711,138 *362D5AC4336F0441BE872E661C7A89CC84F0F9D4 bxk:5
529,711,139 *3623FCA7B7C853DA121BCC23B7CC6FE260424557 b?y-#
529,711,140 *362DAC8C5639DA9E1EB8AC6682497972411A4032 BZI/K
529,711,141 *362BA2C8977607358737E0BC2B076EF06BE0D15F c2!+d
529,711,142 *3627F319AAFF92A3C6F8539DC594D0BF3D3691B7 c4s&o
529,711,143 *362873666991DE845E3C0423FFC2FF90E940C2DB c8ku#
529,711,144 *3621570B76F0F16A35565C9450CE7FDA5D436FE6 cahngarnier
529,711,145 *3629345B24B55E69F323FCD322289BE6C5E7FE56 CAMILLEOLSON
529,711,146 *362586A2242A94C64894A612F196231822933A5B capillaire6
529,711,147 *3623AEDB5628C5583C36F14BE47B6D6327DCA6A1 caroljoy5
529,711,148 *362DFF27787D1664B446A2DC46E019FD813C2566 CARY.FOWLE
529,711,149 *362E6D077A1022F15173F4C2603378CA87311D8B cbaf
529,711,150 *3627113099634F87F9AF5AFBC53403A4A8038AF5 [email protected]
529,711,151 *362B7935BF1E0328211F75DD8D59D0B58DB3E055 CHAUNCEYPIERETTI
529,711,152 *3629CBA3C54EBC091CCD559BF041C1DE22649915 CHEN.JUWA
529,711,153 *3624B2BEC0330D09C64FD232001C37214335FF6D chess1980
529,711,154 *362ED906904E6AEFC092133990C30A997B7E1FD2 [email protected]
529,711,155 *36286E09209F93D0D2E9316B44D8F279FECE6B0C christians.in.black
529,711,156 *362E79E23C6D0C3C5F668934DE00BB9351A9D1D2 christopheralphin
529,711,157 *36247B24204EBC902DF2598D61CFC5238F3AB8B4 cjkps
529,711,158 *36263D421017F2B6E120C1E7140C9988A8A75352 CKMEV
529,711,159 *362A5E38E1774C57716F647192E200CC4DE80CDB C#lr
529,711,160 *36227BAD0962F324E010F9F0FF8577F7413B647E coadmini2
529,711,161 *36219FA466D272B5C68130EC9E5B39E1143DDCB9 COLORESTS
529,711,162 *362245E7D865F9B8721281D021B3CD5B2510ED09 coltonvause
529,711,163 *362C8718EFB2BF3EF65E50A426738339A55F0072 CORY.SAVIDGE
529,711,164 *3621DF9D16A9F43DBB0D54BE8A0D8B5E759E7D99 [email protected]
529,711,165 *362A188C045A109B99D0F1E2B607BA994060A28C COURTNEYLAWS123
529,711,166 *362B6C3BDD916D1C7F1AD706652D9C71A768F5A8 COURTNEYLEAVERTON
529,711,167 *362D3558C297AA8FE6A5D6F5A41C325BCBD13F4D coyingsed
529,711,168 *362EBAF65000591567001EF478A52E92D2C1B05D CURTISBLOOMFIELD
529,711,169 *362CA15A824D4846C1AC89ABD428066B514B434B cw9lc
529,711,170 *3622DE1169989CF94DFF891B93A3BA8C2533E217 [email protected]
529,711,171 *362CFBD34F01954FE25ADCBBF650DC8CD09F4B94 C&ZQ
529,711,172 *362CC162798813EBA715F1C11AD6DE468866AD1D d15c0nc3r71ng1y
529,711,173 *36232EE942CA6AEA7596F836C4C67A4D2F19F591 DAMION.AHLHEIM
529,711,174 *3627FB7C3AB98AF9AD6118C3FA8A0AC8D0261FB8 danbybsw2
529,711,175 *362153E08B9EB315FC9B775FFA2A4C1D204ADB27 DANIAL.ZAHARIS
529,711,176 *362E05E0473A82CF9E53D521D7CB075E34795B3B DARONJILES
529,711,177 *362865F8882C7277DFBE68F283DBA40B660022B0 DA/RP
529,711,178 *362C662E7D88E7FE539A885FA4D18586D0E9B93A DAVISDUPLANTI
529,711,179 *36293DAEB52598B16387EF1AE1EDCD50E87E2F05 DAZ ASQUITH
529,711,180 *36227C134009F2A22CE29E07772AFA7A8FC43C32 DB!QP
529,711,181 *362D8700F7F2A5B3F41539177903F41F0EF45FD4 d;em8
529,711,182 *36288E35F79E18D63AB16AF69D1319CBE8C275A4 DENNY.LYBARGER
529,711,183 *362DA64246913BD7910A0F52AA53ED0B9CDB7FE0 denverbeech
529,711,184 *36240E1C87BFE2E0CEA8D05B38DDE8289951DDCA DEONPIPPENGER
529,711,185 *36213F99DE2A52BDDCF2DEE7375277AAF89890FA DEPERMED1234
529,711,186 *36285C4047946D9D76673FC145F3851FA3016941 DEPOLITICISE
529,711,187 *3628DC0E6E024A9803FF817141489A63E8F56FC7 deutschekammerakademie
529,711,188 *3621B9AF092463D12AD8B554EB6328A216B4DE2D D-fT
529,711,189 *3622C8660881AD0ACF35CD01885D5FE31CDF7171 diesiebente,achteundneuntearbeitdesherakles
529,711,190 *36279505343CC0359470D776B5AD286A2922CF2D dit/+
529,711,191 *362051CD2A69C52552FECB1A8BF70D901B21715E dn!]
529,711,192 *362AD516F63E0C696B2914E3F439E8A6D8E2C9CA DNVVK
529,711,193 *362419ED4B5C1CF4E64925D9EBE6F588F832ED27 DO;h
529,711,194 *3623993C0A7C0C95FDF37494C9482DD0E1DA9268 DONALD.LOUDON
529,711,195 *362D2004EB7A5044E80034E468252347EB4E1889 [email protected]
529,711,196 *362E07D7E59355E613F524223226F27F4DE48B6C DOOLWEG
529,711,197 *3629B9E4270498317BA0DE05689050594B678435 [email protected]
529,711,198 *3621E65747F5C2E8418EAFD174211A33B9331351 DOREENHERR
529,711,199 *362D8F233B153CB2C1D6C2A818C96524E9811C6D DORSEYDONOHOE
529,711,200 *3626556DBB4C16C7C026705C4E97DD40D35523C8 DOUBLESOUL(FEATTANYASTEPHENS)
529,711,201 *3622CFC14EBC40A40D77B88FDEF6A437BDE91728 doylerandell
529,711,202 *36229F992E5C42A016CCD1E5621675C9915534F3 d:p
529,711,203 *362F3550690FA0AFEFC64F09BCD7CD71ADB78EB2 D$PL4NTED
529,711,204 *362FA7EB327436833D422A4E84A8BEC4B31FF68F DPX/9
529,711,205 *362A4CD5764AE00FA050885D27EB42A8004CBE0B D%RII
529,711,206 *3625CCF4C6990053DFB10E40503781D97E1B0746 DUMMBATZED
529,711,207 *36221708E23FCCB87F6D9D099C05D161BFDC2106 dunstaifs
529,711,208 *362265E7B0E9E4AD6B4C4BF260264B82DCF33BDA du_.u
529,711,209 *362337BD48FBEBFA76259D9527CDADF3BE993ED1 D=V3
529,711,210 *362AF236DE61545AA2158F858F052D2857D1F048 DVQR:
529,711,211 *362E354EA169D24B9950A1305C2F9439A2A850C5 DWAYNEZOOK
529,711,212 *362E101554949C6632FA013C535CBD15A79A3D19 D:WNQ
529,711,213 *362D0A6F25B4CBFC873B0063916283EA3C26B9A1 dz-um
529,711,214 *362F2682211232A07C9F7BF98BE658EF7D4BDC72 EARLEKEFFER
529,711,215 *362F3DA5E0E03719058D298ADBE8D5CABCE97765 EDDIE.T.HEAD
529,711,216 *362C9038B598360A8A681B13158229C2958DDD86 EDMUND.TERRERO
529,711,217 *3625DD5F9EABA79C49F23D169F4B60CDAD2FC698 EDWIN.ESPENSHADE
529,711,218 *36281DD2EB216A4117B80335F67D3A5E070B9EF9 EEFc
529,711,219 *36219650D0F0ED371C51FDC22C3B16F5208560EE EETIMANYD
529,711,220 *3621D945B751BA6BA71EDEC66383B93D3227BA3B EFXPD
529,711,221 *362E60404B03951FC5B1AFEEE10F13FED1F3DF82 eliekhachan
529,711,222 *362090972EF9B3CC88AF960D7E21425096FB476D elizabethokafor
529,711,223 *362499FFA0F0CC03814C20AB93157A985F8EED57 ELOY.THOMANN
529,711,224 *362B8BC8FB58990A6426BA9FCD6A1A65771E8E38 elwoodbolanos
529,711,225 *362B4D546587CE4FA3C2509718E14418C5B11F2D emissionthroughselfinfliction
529,711,226 *3628E88C38E961F696F5B20AC5B0279BC89A0BD8 EMMETT.FAYE
529,711,227 *362D9E31D3290383FA2109CFBE769271A1A73BFF EMMETT.PINKOS
529,711,228 *3621F018311B2389E1BDC7FCDAB9EC974121DCAB EMORY.LENDOR
529,711,229 *3620D41491256E9F792061D90C2FE0E15F9C7D87 EMSITIHCAR
529,711,230 *362542E061ABD1E83D61ADB74BEA65AC97F8B7CD [email protected]
529,711,231 *362AB49D613C14BAAB89F07D6F43F429192C9ACE ENDEIGN2
529,711,232 *36232D9FB3AC9DC31EFA4E59BE92D4EFC2B72251 ENQUÊTÉE
529,711,233 *3620CE57899BB1466308A29B2BB99F93E440D387 enyv
529,711,234 *362ACDAEDB4FAA0BA76351BEE0C91B135FB5F4D2 es20123120650
529,711,235 *36264204944362E8B45A3AF5EF7B0EF6595084E9 ETEHRALKING
529,711,236 *36251F0168674DCF032F249EFDA851E678340B23 EUMH
529,711,237 *36283074CE42387329182A65E906088ED8233F5D evanculverson
529,711,238 *362ED8F3927FB86F97D8214771CFFC0865E1F658 EVERETT060
529,711,239 *362A3D2CA26DF9989F22B898A16A81A3ED03C6E0 EXP4N$ON$7
529,711,240 *362B4577011278D4B7B23E0E8672CA665A88ECEC EZEQUIELPROSSER
529,711,241 *3625EB01E64893EB72259C6A1A1D8A2CCD3FD5BD ezimafni
529,711,242 *362268E69307640F6464485FFF9C9127C4301E32 [email protected]
529,711,243 *362F5CE4F5E1A8FCEEA2CAE85108EF9DAD72B53F FAUSTINODIEBALL
529,711,244 *362CD09207E12D3E93E5F6355B5E427DE2ED3346 faustinomcanelly
529,711,245 *362CD381B09C1274FAD96CA0B4637DB6DC157875 FBLLCHOM
529,711,246 *36295895297C495712DD816C0335B840575490AD FDOUSSAY
529,711,247 *36259AEC42FB02642DEF8AF831003FC912F1FF35 fhsl
529,711,248 *362E2117897DA63D682CD67351A3285DBA19E849 fiftysixbars
529,711,249 *3628EE86BF24BFAA5BAB374920DEEC17CDB49999 FLOORLIKE7
529,711,250 *362893318FCF42DD91496B5F971A797E56704101 fmhzj-j
529,711,251 *362F6CC24DE4351B51F54701E0624830104ACA6B FORRESTGONSIEWSKI
529,711,252 *3621FA7FC830B4503FF57E798B6E4643118DD6BC FOR-WHAT-YOU-DREAM-OF-(FULL-ON-RENAISSANCE-MIX)-(FEAT.-KYA)
529,711,253 *36239A0C700478B8E67351DB3C3933D694B1E68C FRANKLIN.GOSEWISCH
529,711,254 *36241E2C1ADD6DEB1104AE8C9C24C3C6EF074DE7 FREDDIEDUNDON
529,711,255 *362FB71914C67E3DB0F5FF80C6DE5B52E2BBFBA3 FREDERICKTUMINELLO
529,711,256 *3620E92BCF38C31CD26B5047EB7C8175E49B4E4C FREEFLOWFUN
529,711,257 *362CC5B4B4FC866E6D7B0F68BFBE29CB58A03CC5 FRITZLYSON
529,711,258 *3620B6DD700CE5BF0E2A423FCF457E5CE0F23948 FRSTCRFT6
529,711,259 *3625827F0F2A8DCA94AC1C7EDA1BFEE175BF396A FRUITMONKEYSROCK
529,711,260 *3621D9B0F196840CC53BF67F874A1A1B12838891 [email protected]
529,711,261 *36280743C6C18606EE5D36EA2DE37EF7B959F818 GAGUAA
529,711,262 *362795B59C15486C64E9E46C15AA41186B78166F GALE.BENITEZ
529,711,263 *3622F5AA1F52E8DDA91F7AF4C5E712DD9CA48D90 galezot
529,711,264 *36214E9FE14EA2C4A0CE185DC00341C25F2F9300 GARRETH-PHILLIPS
529,711,265 *362856F93DACF506B874C40DA373928B33957D0C GEHEGTEN2
529,711,266 *36215720636841CCAD6CD40D5804EF552DA86FF0 gene.starwind
529,711,267 *362861B34B94B7A72FC2E38E18FC90C0C92B6123 GIỮ-GHẾ
529,711,268 *3623B6B875CCAC145BB2159FDAEF64927E59C8DF GODD870621345
529,711,269 *3627C630A437E2A424025C27382E56ECDDC53491 GonnaRaiseaRuckusTonight
529,711,270 *36280754A0738818A963D147A9BEC792D9E3F328 GROVELED
529,711,271 *362C23CDAFCE6ABA90BAAEE571687551B10D3B47 gstrsph2
529,711,272 *362454DABD4FEFC0FC91343688DC621D5D92633B GUILLERMO.CLOUDEN
529,711,273 *362550645C2BB93FDA504A777F2092A703D3EED3 [email protected]
529,711,274 *362607D53F5D860626D08F83ED29CFABD55AA2D3 GX>\
529,711,275 *36288111222B402A4A0A88B59E74A64AAC87A02E HALHECKAMAN
529,711,276 *362A3ECA76A435A672D0EE4ABF3063ACF9C7EEE6 halrevkom
529,711,277 *3620C5DA12CC99A032201281B321C6B43D35BC84 HARRYBOTTIN
529,711,278 *3627902621C9F6AFFFCE4BDC540747DE7457436B HEART-OF-THE-NIGHT
529,711,279 *3622504F3513DAA41433A6F848CA087B9FFC8481 HEATHERCASPERSON
529,711,280 *362CF220D52D065CD8AD20D60781F6662A6FBEFD HENRIB
529,711,281 *362F146E81F56B1E28BA9CC9B574A65D430A4B42 henrythomasblues
529,711,282 *362690577AD869F0184F7031E1B21CA06D2D6D3A hisuntil
529,711,283 *3628B34330BDA4892AB35076300A7128D2C82EC1 HONOGURAI.MIZU.NO.SOKO.KARA
529,711,284 *362B6118F49742AC0CE0AA49F1B78401F101E26E HORACEWOOLEMS
529,711,285 *3628A9C3F186F0D9FF3DBF9964A700F82B7DCD51 HORSLEYTALKNORMA
529,711,286 *3621248A237EF205927D5767C6A1E8190A36D513 [email protected]
529,711,287 *3625D706CA8AFC774955752DD575AE6FC27AF273 HTTPWWWKWILCZPL
529,711,288 *3624278389E6583E97E6557EA7D8887E49F7B74F [email protected]
529,711,289 *362965254009E3CC4813405F972DDCF3480B0E97 hungering.dub
529,711,290 *3627E00252830128CA63ACB1B0E5186E4D1BBA2D HUOHSIKE1
529,711,291 *362E4CC97D9B35BBC8574F2BB946B0B4AA193509 IAMMACHA22
529,711,292 *36275373FA3C743351DC1F1790F715629F0BBC93 iebeding6
529,711,293 *362DC398273ED90CC44A9D3D68EA06306FD98B77 ILOVESHARYN
529,711,294 *362D17B68CEC6AE2BBDD70FE74B66C3CAEF82FB0 IOSOLAS4
529,711,295 *36282AA8249A78B52C0C8FF5220B65E14B8100A3 IRONPIERS
529,711,296 *3623B6DC299E1385A575F0046C3AD027A034AD2B ISAACSPIDELL
529,711,297 *362D87AEB1A3AA0E67DACD959F89AE51C83CBF65 isaiaskosack
529,711,298 *362A8570BFFB5836B2606CD05CFEBD17D017589D isiahreagin
529,711,299 *362F4D3E522EE5EAD75C1E34C8995FF668E65867 ISOVIEW5
529,711,300 *362330F8C11CDC44BD14ECA48AC92553807527CF iv%]
529,711,301 *362670F2F1BB1C60F1D2A1C943B406A702CFB772 JACHTHONDEN3
529,711,302 *362910E1B11659ACD03ACEA392AF024CD3EE864E Jagger's-Not-Dead
529,711,303 *3623D2285DC28F96DE521E95A0B6391088CF4745 JAMEVERHAEGHE
529,711,304 *36267A1F4EC05CD3C1D5D4BEA7EB37CB2A3BFE7D JAN.BISCHOFF
529,711,305 *36282B93E04BD6057D7DD12FAFA2B97BA744496F JASONKRATZ
529,711,306 *3629DE8775BD14F6981D47F0630FD146BD26E8F7 jayastodomingo
529,711,307 *3620EAB15C45389A105C4308F1E3B33D0EFD38BC JAZZGRAPHICSNO3
529,711,308 *3627A5ED5E763FBDE25953F629D9B7A127763A40 jefffilipponi
529,711,309 *3622A7E12260DEE3A44435DD805CAAA4583EEDD3 jeffrybonefield
529,711,310 *3621AC07BF19010BAEC79C1964018D3E1FF2BED2 JENNY GODDEN
529,711,311 *362828F34316A97B91DEAEF623CDC0F12BFEF18F jeraldgrensky
529,711,312 *362B8702F94CF215B7DA2C45664D5347CCCEDBDB jerebroermann
529,711,313 *3622D9105E31FFCC84AA3D3C4A2C5990EF1B65E6 jeremywallgren
529,711,314 *3622053A327790674D0EAC15E309A62FDAEF87CC JEREPICERNI
529,711,315 *362D677BEF0C196C80FCBBF4D3FBD72704ADB1BC JERETEPE
529,711,316 *362CD7A5A8245ECB1425F4C3D890ECE4FA015454 JESSHOLMES
529,711,317 *3628A25DB0F2CA8CD3E41AA545F80CEFB552125E JEWSDEBATEANTIGENTILEPRAYERS
529,711,318 *3622753291D4933758FAFB09304E1C4E8907B3DD ji
529,711,319 *362E7C989D8FE18206B0C13AAEB89419CF3D5FAC JIMNETTLETON
529,711,320 *36241245331C656595D5FD1FD047F06785DD482E [email protected]
529,711,321 *362CAA8270684E93B1B9BA37F4C23A0C6F17B9C5 JLOHBSWING
529,711,322 *3628C1954C28268DBE223DF244B3973976BD1772 JOHNATHONNORDEN
529,711,323 *36285679F7687DB1B433EC19474344D9DF0D3A3E JOHNATHONQUILTER
529,711,324 *36294CAFFD09475F7ED1E6EA3AB77C2181618A89 [email protected]
529,711,325 *362B3B90EC1EBED98EAA6DB3F0026FC13F908579 JOHN RAMBONE
529,711,326 *3620BEBE6C1192EF86D478E683A4D7C3D3429E41 JOJORAQUEL
529,711,327 *3621738BBE11E11AD6B6A553AA4DB714990292D7 joseph.babb
529,711,328 *36225069912DB1C955E499DA671C40B8B814C0BD KASREYNS
529,711,329 *362A62E393F81B0F1BBF0B0F4E5510B9C33F6FD3 katy-robb
529,711,330 *3627049C58D9CFBB00287A83AF55CC710964DB46 kcabtals
529,711,331 *362847F090683FDA017125C95EC73D8A503D2A76 khokhlomawarefolkartforthemasses
529,711,332 *36226B0A65A39A6C7533C00CE5D1B3A665531E98 KIETHFREDA
529,711,333 *36244BDC7344B67D00A5ADC9BC127BEBC39B35DD KIŞILIĞI
529,711,334 *3624FE1AEA4CD68E6606681D02394BC865E5915F KIUNGSHAN7
529,711,335 *362FA2DBA3B137E7ABA5E60AE855C159B6343D2B KLEINTIE
529,711,336 *36204D42C5F85251CA10279FA21B920FC308CBE4 koldovsky
529,711,337 *36217A81259E33F71448001436FE3D91BE9BC6D8 KRYSTALBRABANT
529,711,338 *362106A0F823B175CB086929AF307A9AA0B0F452 KULLERVO,OP.7:III.KULLERVOANDHISSISTER
529,711,339 *362ED3494C8C70A00CD17120C2FB25B196DFF656 kvolyab
529,711,340 *362FFD6E31496566A65E38A43484EA1FBBA04BC8 LA-BICCIA-GIUSTA
529,711,341 *3625B8A719E5FA9715DE5793B144F111752E5B00 LA.FOM
529,711,342 *362869F7B0CC880C5692DD65CD847D295A09ED2E [email protected]
529,711,343 *362595529E1CE31313BCC4E866FC9C37C577568C LAMAR.CLARKSON
529,711,344 *362269A5E2B959C25B1E4906CE7D1D1911656FE7 lanealvirez
529,711,345 *362D5C67164496B017B20DA49DA50F83FCDB298F lanebermers
529,711,346 *36216B042F32DA57B72653385A530CDB0939A99E LAURA+JONNY
529,711,347 *362647C83E8D5C6C56D18D79677A581A6FBA00B5 LAWERENCEMONTELLE
529,711,348 *3624552CC9567BE3C7E73291B859C96826374FC5 layman2
529,711,349 *362C43B76EF865C70AF1F995311B6699D2A59863 LEAVEUSALNOE
529,711,350 *36259981A90BAA0D23065356B13D0B04430A7F1A [email protected]
529,711,351 *362593E03529A5BF440489F6C3FF6499874E508E LEONBARBAN
529,711,352 *36261CF0309B79097620F0BC9828515FEBBFAE40 LEPE160
529,711,353 *362273813507D10273C3358F0805575A9C9B6A43 LESLIE5130
529,711,354 *3620F754B67C5BAE162BBA731E7D6877F5AA9948 lesson3text:einhundvorgericht
529,711,355 *3625BDE3C29127AA4BD4BC8DD89E1502CD5EF690 [email protected]
529,711,356 *3624BCF06DD08FEBF29C1CF46930F084A0976FC4 LIFE
529,711,357 *3625924A93F50B93BEFB5C9A0F107F9546A45FFD [email protected]
529,711,358 *3627F837750A6564C72EA3FF167A1A65719348FF linotayan
529,711,359 *36273D24614A6478EC776790577CB386CC7E1E80 LINSAYLEE
529,711,360 *36268E897AD05DEBA7AEC59F7D56DA0645D87C67 [email protected]
529,711,361 *36200040D198F256B22B98A24E26FC6DF992E409 LOCSMITHED
529,711,362 *362237310C780D0D720F84201B16107523EC0D82 lonconte
529,711,363 *362830C975A82E459666928819A6A2B9BB43F8B2 lonscarsdale
529,711,364 *3622715B62E6CF0F942E09DF3DFBCABDAAB01DF6 LREP/NIB/LACOL/RSU/!#...:1
529,711,365 *36255A5CC5F3FFF1B7FDAE0838CDCCFF5F8AF1F9 lwfl
529,711,366 *362598832A7C6FCDE347ADD96ED269C405176B09 MADMAN
529,711,367 *362E5AEBC7C6AD6B189AF302FDD3068318389867 MALVEHAVEN
529,711,368 *362DDF7B5772AEFD502831E1F25091DA7B823812 MANGEZ-MOI MANGEZ-MOI (EH EH REMIX)
529,711,369 *3627E8319CAF0A60E9D101345E0816DF7B19DA6D MANUALRAWHOOF
529,711,370 *36206C0AB3FCE668F590A40F0A594CB92E548504 MANUSSANIT
529,711,371 *3623B4FA1E99557B59CB820CA68BC1BCE652452B MARCELBURCE
529,711,372 *36256C6BBB25E35261431BE29E8583472ABAE4E8 marcelfahrner
529,711,373 *36291D9306BABB22E05F2871BC88D08C1BD2BA29 MARCUSPOND
529,711,374 *362DB7E7E218208AC1109331EAA18B480A4D7732 mariarowlette
529,711,375 *362F834C04B507046C39BDDC356BCF52D0A7465E MARIEDENG
529,711,376 *362BA6CBC251D169F10E7B556952F556B457C17B marksazama
529,711,377 *362629E7FA3B9D7812D5F1C7436FFE50A2F7D62F maurotola
529,711,378 *3623821F68485181CD5C8A2D0565C9FA85C4D069 maxblack5
529,711,379 *3621ED2D0289E5091C5994BABF371DC5F13B4EF0 MESECNO-3
529,711,380 *3628EB7AC52521079E234581D767EEE539DB1252 michael.whithorn
529,711,381 *3624CF01531FC1100896FA0027CC3E02AD89ED43 MIDEREK0
529,711,382 *36274BD5EC0F2D1788F4E76CCCFD803A7B8126CD MILAN.PIRTLE
529,711,383 *36267D16D0FAC28792B6A15F3A8E802399D507C1 mncl`rnt
529,711,384 *362D315CA195E746DFF13C1A20A3FD3301C22AAF mohdeddie
529,711,385 *362F4F5DA5A2E389715572DB62B770C0DD865D9F MOLLIE-BRYANT
529,711,386 *3628658728C3C1D074481E298808C016918B59C0 MOONLIGHTING-WONDER
529,711,387 *362D7BF1376D2F74EF1D716C796CC4601B2D1AC8 mosaddeghossaltaneh
529,711,388 *362F76731DBBCBC3739A2E4AB7CC70847E69C96B MTMITH
529,711,389 *362B0B13B43FFB493BD650F82D29F691AC5E0F99 MT.ST.HELENSBLUES
529,711,390 *362FBD700BA11F254E16B5450DD1DF8390CF72C9 multipleorgasmdisorder
529,711,391 *3626D5923C397BDF32C56B8A6F37E5FD5D92242F NAPOLEONERAZMUS
529,711,392 *362AB3CC3EAA147F9A29B4FB28F77B370941C244 nathaniel.lugo
529,711,393 *3624EEBC226D336977A3CBD972B41DBD4A570F01 NESSORG
529,711,394 *3627366A199E348912EE0150AFF1765A77EF96BF ngentrong
529,711,395 *362B6F8D41B70192EF8F5928A4A1011FDEFAA0CB niessner
529,711,396 *3626E79702EB063F9CB4639CCC420D0D48E37746 NJYA
529,711,397 *362D5187413A4225648D73030BB8EB26B1B8B93F NONMULTIPLICATIVE
529,711,398 *362FC29E0B3596D9AB66BF2564630FD318EE715F NORBERTSTONELAKE
529,711,399 *3622B38B548BABDF558A5F3B1F9C2BC64C5A14DA NORRISCAPONE
529,711,400 *362AD7C50D78470F1F1A4CB06BEC3FA87E797E85 Norsk.rocks.historie,.volume.1:.Rock'n.Roll,.1958-1960
529,711,401 *362910F751914765E8897F1ADC791BEDF45C5E7D NORY
529,711,402 *3624633AC2056935A590E25C6C358B0C5A0B7805 nr7
529,711,403 *362571AC89D6072DFF19FE37F2D3B4AA8BB7809A NULPUNKTSGENNEMGANG2
529,711,404 *362431D9F21C1B76C7C78517DB2B21631EA5A5FF object-resource
529,711,405 *362CB56514257E3C966D058CCB284ACD4DF78601 OLIVARES123
529,711,406 *362B6D683BF0A5EE5B55523EE33B5E9F5B28D33F omerwhittingham
529,711,407 *362CE05408791E8FA5094546556FA15FC9C5A8D6 oncampusliving
529,711,408 *36281C62D1443430CE7EEA462BC63129F9B6363A ><.O~.O~QB
529,711,409 *362EF4B8A2B08AF49077CACC58A9529EC8E4DA56 [email protected]
529,711,410 *3629CC8F728916319D44B1E6043080076A4F64BD oyo8t00288
529,711,411 *362BB23F29D497CB82DBBA708B94A731FDEE5C35 par7h3nog3n3ss
529,711,412 *362D004E554E5C0A5D5644A2C5B36CCD9C69A024 parameterliste/n
529,711,413 *362A9F3A7D6AD61FD5EB01205886216ADA957347 PARISDEL
529,711,414 *362EE9B134A5F8216E9A116A1608335BA33BBA2C parkerpreston
529,711,415 *362DFC9FD02704180DF3461E37C9420E6D0EE0D7 PAULSKIEZS
529,711,416 *36292AB1519E28F7E6D3D1D5D04E0D5903740C3D [email protected]
529,711,417 *36248B6D9476F6398EB5DEFA4020F504E7808B4B PEDER4$7!E$
529,711,418 *36280BF22647315412ABF758BD53127D5EC7CE9A PERPETUALMOTIONISH
529,711,419 *362E535E44C8845BF48CC166DD7D75C3469FE23A PETERBENGOCHIA
529,711,420 *362CD034D575862BC6993F7A323CD05C2748884A pfhsn
529,711,421 *362AC79B794EA79A5EC168B7D6226C699A3A96E0 PLESIOSAUROID?
529,711,422 *3627261A1A8542E6A54215FFB9D3E2DED28ED30E [email protected]
529,711,423 *362A57C92B7CB2A97CB9EB1748CDFE3E7C27B16E p======p.~.~.(00)
529,711,424 *362ACEFC3783754735E5B2CE7344D8155864779C PRAAGYAAH
529,711,425 *362D0B27B2204F91933E018BF70E1044DE88A05B q####D.~O.~o.>-<
529,711,426 *3625ADCAE90C261AF7BEBDE136899132E622A529 [email protected]
529,711,427 *36216CEED3B0E4BE6EC363E4C4E0B58FF3636911 [email protected]
529,711,428 *3623471599608203024610188A1E216F55E8B749 [email protected]
529,711,429 *36229E1C1DCAAD7664B275A847203F06ABD1A87D QUENITA-VIOL
529,711,430 *362BEEEAC2D3A4589C040346C7C86F5815062816 R3d4ctng
529,711,431 *36252A7DC4BADFF62842E8F197D8A168EC7F5394 R3QUISI+3
529,711,432 *362DB47B82490C28E332479BD3E1207173105E6D Raise-the-Volume,-Volume-3
529,711,433 *3625873F95B127C540BD852201D59CFFEC608A88 randolphfleck
529,711,434 *3629817D62B6C7F13B727958B753A881F11CEC6B RAPHAELESTEVEZ
529,711,435 *362212A250B0870F8AA9217AC8492AD4B66D72AE raydelbalso
529,711,436 *362B4572778578DF6B10506E5FE47B35C449A96A RDYBAA
529,711,437 *362CE027260372607647C6FD7835DE9D6ACACFCA REBOBLED
529,711,438 *362413C3FE022630BF69610DFE1F3AD61D05A9ED recruiters45
529,711,439 *3627342E52E45317D5E653B7A4ACE672E87F1A89 REFUGIOGALANIS
529,711,440 *362F377D1D8C0C17C8BAE1AF55C1E5037027C2F5 REKKEDTNING
529,711,441 *36202E77435EB06B6ADEDC682347BBAD113178E0 RENOFOMMARG
529,711,442 *362546169D031C1FE58A5D697EF424D11D2E835E RENUNTIAVERATQUE6
529,711,443 *36246D31465E71897B1318C207AC1801B85CA598 RENZOCILIA
529,711,444 *362B493E4DA2863CEB07E2171C8FB9665542C576 repudiar
529,711,445 *3625B147373A40C2CD5C87ECFCEA6111921CD47A rexvillas
529,711,446 *3620CEAF6824A9A8237706D6E50B333B4F800EEE REY.ABDULMATEEN
529,711,447 *362E5ADD79EFE93244DAC2033CCE5796C30D5409 REYTHOMA
529,711,448 *362AABADDCD3E72C0D5F420EA957D098FF12D8C5 RHETT.LESHINSKY
529,711,449 *362A9BF5071E9D858F65734C5C29B9ADEEDAE348 RHETT.WAHID
529,711,450 *362A9F64E19ECB448E2273CBFABFB87999CC0F19 RHODE4
529,711,451 *362E18285D7A93472095FE5872229E2A40B75746 rickeydembek
529,711,452 *362A16BE3721DEB72AFE4135E3ED23023F4294FA RIPRINCIPIAVA
529,711,453 *3623A6D02A844EAB6E092B7F68CCFA0DA0E79367 [email protected]
529,711,454 *36212FBFBEC541D45DC8AF58E336E5F42419336D robbin-danette
529,711,455 *362DB6791DB37464B2C5376D82CD844BDAF086B0 ROBERTSEEKFORD
529,711,456 *362CC64936C7E41071F307D457171798F3DC7E17 ROB.YURICIC
529,711,457 *3627F6C7658C485F354F23DCDFB8B7988F72E6FD RODBARCHUS
529,711,458 *3624311C5EEEC6E0F5D13FDC520F72F3F688617F ROMANFALSETTI
529,711,459 *3622A3155EA351B6B68861A8006137BE6FA0CB89 ROMANRUDER
529,711,460 *362CC7A5BC6B6513C6B9167F962BC7A87163D485 ROMВNIEI
529,711,461 *3622A72D886B1F559BB7D8E4F957171AFC2CDD45 ROSEBARON
529,711,462 *3623CFABCA2E0BB4DE6516523B85F97979D626A3 roustavi
529,711,463 *362CD2D42F13598E6AB4C46AE8A76D5531BBDB59 run71n355
529,711,464 *362A4969D904660D0A030CB0258F0EDB79374BC0 s3sz
529,711,465 *362F175892097793046200D76FCB939016594006 SAILINGCALIFORN8
529,711,466 *36281DFB2F68C159F024C6334411EA2BDF69527C šalifas
529,711,467 *3628F384B6E3A31EDD8E1D2C656ECD444DD562B5 SAL-YUSUFF
529,711,468 *362A9C02C210E3F6C09EA273E5AA045266979C3E SAM.BOLLA
529,711,469 *36203C7077F9C070B5EFB209B2BE77C3E9C8E6CD sangre101
529,711,470 *3620469608D1FD23DCC09FD58B1F8C77D0E53971 SBJDCRS9
529,711,471 *3628D132D988567F65E31F040564693AA92F4B65 SCHIZOGONOUSES
529,711,472 *3620D76A2BBD282285577DC059182D47D530A229 SEBASTIANCOLECCHI
529,711,473 *362C96B35AB01F34D8AF2974D4C44B56D71D7300 second.race
529,711,474 *36287A32BA235D04C21EE985680CF830AF7D0A99 SECTORSTK
529,711,475 *362566D30DF7F002554621C47518BB1B85168E96 [email protected]@S+LY
529,711,476 *362092CF0099739A44C43AA3184F8BBDF1F2310D SEMICOMPILEDS
529,711,477 *362119F14704ECCF64C2781E587E3E167EA6BCB6 SEMIHEMIS
529,711,478 *362875FBC4AF2081C55402425B6836D69023CF82 sesg
529,711,479 *362AACA626C1A4B0E49BE25FFD53AE61B0A67AAA SHAUN.FATH
529,711,480 *362075B97EC6491979E140AD50185DDA03F6D3F4 SHAUN.SINARATH
529,711,481 *3629CD804ACD482AAE7CDE123D59DBA72A209542 SHERMANLENIOR
529,711,482 *3629EC70BC5213ABE3A76DA887D9E47554EA78E1 SHOMATEC2
529,711,483 *36277CD830EF408DA8BFE09AAEF9D0B1710046E2 SHORRAID
529,711,484 *3625BC409AC029A558BBF6EE6A896724EE3C83DC SHOTGUN980
529,711,485 *362D7EC97EF39B11975ECBA53EAC15046177518E sidgoodpastor
529,711,486 *362384FEFF31408D5EB56841FD6508532203928F sidneygoligoski
529,711,487 *362A30BBDF10CDDE73B2D115F2E998E84207C2DA SIHANOUKIIN
529,711,488 *362C4CC062B6422C45B43ECAF8E61675850DF71D SILASPALUK
529,711,489 *36224A3385214DE54D5BF5AE8EE7333008D2EFE6 silkehall
529,711,490 *362B26CE26A8CB42F6D4C101ABCA4F2CCE76D5B3 sitring5
529,711,491 *362A40069AF9A1A40978181165DE03B5EC335DB8 SOCIETAT DE CONSUM
529,711,492 *362861C849F00F2A165800056D3CC1DE6731BDC0 SO LOW, SO HIGH
529,711,493 *36235823C2586D06761D964D9FEC1895AA9F553E SONATE-EN-LA-MINEUR,-OP.-5-NO-7:-II.-ALLEGRO
529,711,494 *36219508087C439757C5052858D934BCD02A1A3A [email protected]
529,711,495 *362245CF08D092323DE1ED16E67AD2ECE5F69BE3 [email protected]
529,711,496 *362798A4BCB9BD5B3BBAD80122F8CE527C0C79FA SOREDAGA8
529,711,497 *362C0F0D68091241D6ED573094CF103F8396BD00 souphanourong
529,711,498 *362DECAFB1641741FE75D2471EAAEFFFFFA5860C SPARROWMICHELES
529,711,499 *362A12E5E33C4F194D538C24FA79BD7DAA87AB70 SPENCERSKIPPY
529,711,500 *362E52052BA92C8F98B6C36D44C7129094DED372 SPILLATAED
529,711,501 *36260588058B7B5C005167873CAF65CD931EB745 splat!.~.~.d#q
529,711,502 *3620A42E489D1D70133BB33DCB29E3FF67F51B92 spreadteam
529,711,503 *3623CA9A1D3CE2C063ACAAF34B5260D7E999E5FD STEVEO-EVANS
529,711,504 *3620FA110F62C9E7E8A5362CE83ACFB3B09B3860 STGZHQSPGAY1
529,711,505 *362AEC4C6346AEC16D1CFD5C548114FAA63DD46A [email protected]
529,711,506 *3624C59063B8ABC5EF2A9FD0A3118E041E1D66E8 stikkam
529,711,507 *362E5D7E5567A0F785076969D4F36F5074C93FC3 strategy36the
529,711,508 *36238B4614AB64117256842473852FDD82D49907 STSANGACOS
529,711,509 *362E08697F2EF0D36391DAEF43A02D8BCA12246F STUARTTIMME
529,711,510 *3629E64F70C786A05252F78F8A9A8AC344DC2475 STUDENTBLAZER
529,711,511 *362B6D4967E22851D92F001F96DD5748191043DC STYNGETH4
529,711,512 *362586A7F3B772FB0028989E51AEEB60BDAC12FB SU8C0NSC10USNESS
529,711,513 *362E0D5B3D663DEA8188010D036C2C9AF70247F2 SUIKERZA5
529,711,514 *362515BFE35B5B1BAAE215669FC7FD390664B646 SÛLIX
529,711,515 *362397B9390FEC14931C8C071DA59E2504C83517 SUSCON
529,711,516 *362DEBA4703C68A843EDFE76104B41AADE1C2F73 SVYK6KHF6ZUJJBWI
529,711,517 *36287583852F9947CA525E74642C996E08BDF9CA T`.]
529,711,518 *362B9E49EEB1E51D2ED9490273094B3A95878CD7 tacchi-mon
529,711,519 *362C826384BF1F8B35355DE9F5FF70275DBA82BC TALMUDISTENS9
529,711,520 *362470D70BBAD79765A12D037DBA0158225C7576 TARROCKS7
529,711,521 *3626364BA53F025793BC02B8BCFE73CEA7A576EA TCACAAATACTTTCTTCTCCAACCCGCCCCAACCAACCTTTTTTGTTTGTTTGTTTTTGG
529,711,522 *362DAFAA705463C9CDD0157D6E9CCF57842F8C14 TECSIE
529,711,523 *362A79A8BF1F11D66305240150A58CCE00F67EE9 telephone_table't/e/l/@/,f/ou/n_'t/ei/b/@/l
529,711,524 *3626C6D57AE2E81234B440D91AF100736977344D televising?
529,711,525 *362F0B802D2AD24D188052B95E7A0C0001E08DA2 TESTERARCTIC4
529,711,526 *362687CBF99B4ADC7E787308A74B2601C773EB85 TESTSPRÄNGDE
529,711,527 *36286606E4091CC25389B8DEE5B1135663CFFCCB TEZLCAZI
529,711,528 *362C18C42B9DA9A9813E590D94451517AFFE4A44 TGDCMEM
529,711,529 *3629B13B9EF04290AB1D6333299E4A6FF68B2C6F thatfuckyou118
529,711,530 *362591F3369A6208595DE91F74064A69227CCCAA THE INCESSANT FALL OF MANKIND
529,711,531 *362C32AF357963B55A8DE7BC6012C40498126B8F thepeoplevslife
529,711,532 *36274275E1F0C53E576FBC0D95BBDEBF59C24941 TH-LAKHOTIA-AWARD-TO-RAJASTHANI-WRITER-AND-POET-MR
529,711,533 *362D94AF53A51B2DFEF6CD1FF4467BCE6274EA87 TIMMY.GREBE
529,711,534 *362BB1B8CA66ED5F24302FD7C2611C0BF537AD3E timothy.d.lewis
529,711,535 *362A5DD7DB65722E2B281205EF7EEE28EBE41712 TINA HOWETH
529,711,536 *362F21FFD40EF7AD2D08807E2C65021CF0D1484A TM3679
529,711,537 *36265D27B7135CC40C9159173012465F966929C4 tomassigers
529,711,538 *362EBD74384F9C0E854CF30F799456D771ED759C tommeka-dennis
529,711,539 *3628C60EF0EDCC71760F317DE35AFDDA44F40899 TOMMIE.STORINO
529,711,540 *362AF0D06AF578BCF39BCE12777F0718E7884D17 TORY.KATHEL
529,711,541 *362D9A963F8A2EEDD6F02A81B9E28A175B94B4B5 traceydziedzic
529,711,542 *362075791932C35A88E52548BCCFAACD586FA0AC TRAPBOOM(FEAT.PROJECTPAT)
529,711,543 *362BBBFD4A34734DE38BC21DA7F1EF3CA91D566B TRIDENTSAMMIED
529,711,544 *362CB53838CB77C473FE1C4D88E4B522FAF14D28 trumandehass
529,711,545 *362BBA92D0781707BFED6285667F010C9BA8FC6B TS57AX3
529,711,546 *36261FC235E93CBFB995705AAC56220C3998CDD1 TSIRACHARTCHAI
529,711,547 *3626992CEE06EA8AB0DCB98229D5F7F89B50C98D turndownthelights(originalmix)
529,711,548 *362699CFFEB8299E6D7C2D45DD85A73A3F13B23B tyronrosenlof
529,711,549 *362934B3AB5086654D7055948C2084F76553CD3D tysondormaier
529,711,550 *36254989611C642F72B768EE9AFE531AF95A584A uitgeloogde8
529,711,551 *362926FF350EF171DCF01DA068DAAE58AA05DC38 URACHOVESICAL3
529,711,552 *362CD7A09DBB8E790336910CE2D7F90750FAFDC2 utoy.leoncio
529,711,553 *3627F9F6378B2E2206AB0CD080BDA303FA9BE9C0 uv}i
529,711,554 *362FC45944CFCA3431D8A884AC53C6E9F48FB8CB valentinethalheimer
529,711,555 *362E00BCD5B667DAA4BE0032BAB285612F4A7837 VALERIE GEOFFROY
529,711,556 *36203096E0D61D461E5E0B5AB91927C8F8AA22FD VANUATUA2
529,711,557 *362D75DCBFE16AA740885528DFBF9A645C6F915D VASTSTELDE7
529,711,558 *362B4754A599F00A425BC9D71E1144C04CAD812F vicki-autry-johnson
529,711,559 *3624CDD7B8C0EFEC84CDB8466FFB59CD02663722 VICKY BOLES
529,711,560 *36299155CBEC248CA90F3F58F9A4C28EA85977B0 vionette-lazzarini
529,711,561 *362B64EA2FEFD0214475E5CC3AD97CB2200B6533 VIRGINA DEMPSEY
529,711,562 *3621614FE166A75843862D0B4BE067334A7AD675 vitolumpkin
529,711,563 *3627C4AFCD1C3EFC6BC40055AD83A5C05B494776 VOLKERSELZNER
529,711,564 *362F829BDACB71BBAA39AD71146AD81FD2B60D4B VR1117965078
529,711,565 *362D174CA42699B02337991780C547E31A1CDA05 WAIQIN910909
529,711,566 *36295D9291FC15FC9B902042A65D93489346EBD8 WAX-WHITEW/&/KS_/HW//AI/T
529,711,567 *3627CCC0C3C810A288DD9588BAC00CB26E6343BC waylonwaack
529,711,568 *3625DB72FE7A3EDDA8BA4CBD11C8123726D6381A WDSTPETERUNDPAUL
529,711,569 *362BEF888AC9AA8E1F82732CD73F612442DB6D7B WE.AIN'T.PLAYIN'.(FEAT..LIL'.O)
529,711,570 *362FC0A0365D719C437B877E1A4804C07F739E4B We-Are-the-Champion
529,711,571 *36207835BEA69C16DAB3AABB98F570A2C302CEBF WE ARE THE RABBITS
529,711,572 *3621721A673000F9715CF6228A31E34333833FEF Wh+ened
529,711,573 *362DC178457082D69EB845580FB6E8D1477A40F9 WHEREDEMONSDARETOTREAD
529,711,574 *362A7DB1B3652DEC125E515F9C2E1F759A0E168A WIDYA.RISE.CII.GAMESHOLIC
529,711,575 *362BDD9D9C0EEBD3FC06459248FA47A29CBCD6DB WIKI-EARTH
529,711,576 *3622B584AD52254773D138070E13CC900B665E27 winger-sic
529,711,577 *3629AD5A48DC55FC91D6065CCEDE4FC16122CE2C [email protected]
529,711,578 *3629A412D6737A1E7AC98F9F4BCBB3C38A398EEC wmkoestner
529,711,579 *362784F9F243DF6C00ABA058D96DBB529E4309F2 wp3ryilloslime
529,711,580 *3623CF2BE8B2AF1D054A96B6BC7EBA59F8F3BCAD wprutgerseducourse
529,711,581 *362BDE7AB95A0498012851B1133E9188441EA5AF WRAGBY
529,711,582 *3626E5853F2EA6355729B20C6AC5F20B6C81E244 wsbhhcrc
529,711,583 *3620A751674824A452E1FFC47BA210BEA6609E74 WYRUSZAED
529,711,584 *36297B61AD4E5B91E8C4D275FC0F13F823AE20FA xav-forel
529,711,585 *36263A2623B9111256521CED2802BAFB96CEC22E [email protected]
529,711,586 *362E8F15FB4C74A5C6F2C0C64E6033A915A629C4 xks3
529,711,587 *362B1EDE144A987F13491BF8EC5E8CE758994E6D XQP
529,711,588 *36217D3A0CAF3417B8A3E44B500F5642FFC781B4 XUDU87
529,711,589 *362A6DC05D5A17F6ED5D74C7ED63F955EFF9D9AB [email protected]
529,711,590 *3623B30E005C77D4E9E3C842ED3A90EC0D126C9C Y!&,
529,711,591 *362E2B1609C582192750FAF69EC2342B14232533 YAMEENA9
529,711,592 *36230EBB4CA40D51E3FEF6BE79B9671A7CE7D2C8 YASSER ALSAADI
529,711,593 *362A1C7E95DA0AFCF696F3172591A9A2B38D4913 [email protected]
529,711,594 *36243AEF15E4CDEA25F520C16FC119F4058FFEFF YN=B
529,711,595 *362EC141CE133074DD46C9FB7E411DEFB1D7655A YONG.YOUNIE
529,711,596 *3620C52D89E0CDB5CFCCEBD10B551F202CAAF4B9 YORKTONS5
529,711,597 *3621138662771988FD34477DA915A3AEA56434B6 YOUNG.ORLIN
529,711,598 *362B049C493177BD474EDF765F805ADD81EAB61B YSOK MBUYA
529,711,599 *362435310624970E7BBC31428991624831C4915C yunita-yuliawati
529,711,600 *362909AA23B13345BB67EFE24D029D499ABE8828 YUQFPHAFTED
529,711,601 *362A671A4483FDB55A5BBB9ABCD754733D54CDE7 [email protected]
529,711,602 *36279DEC427ADB0570FC307D6E48EF79F01E0C9D z7[h
529,711,603 *362CA4223397BD5AAFAE8E6F7D3B19052795949B zarekle3
529,711,604 *36256A282BB83444FA66DCC8D58029F3873B14F4 [email protected]
529,711,605 *362BAB45DEAD78D483989CEC4B813F63DAEC4D87 ZIADELOGAIL
529,711,606 *362404F8178D7C197986A46C05C2E876FC279C0B ZIJAANZICHTSES
529,711,607 *3622C1CADD1352F48860E870E0DE3CB48F16060A ŽVENKLJAJOČ
529,711,608 *362771704DF0DDD608D3716149213648E5D96D1D zwelethubashman
529,711,609 *3625EAD2AEF5885DB514960F0870B3B02952C6C8 балаклійс
529,711,610 *3625519BD1B74B580FEF5A0CA7ABD7E46715C81A бездельники
529,711,611 *362894889FEAF1733B044C104F8AD887A9348748 «ПАТЕНТЫ»
529,711,612 *36240E1E3D92BFAC2F08276D5B4A17DCFCE637B1 ПИТИЕВЫЕ
529,711,613 *3625858360CC99A6755C7059BF9AD89E1DF6EF3D УЛЬТРАПРАВЫМИ
529,711,614 *362B6C7CF963040CB41B68DB51D2CEC5D10BF654 ЭМИНИИ
529,711,615 *362F8A62718BEC47410C6C563C5E16E7752591F8 ゲーム、各アーティストのバイオグラフィ、音源PV、特設サイト
529,711,616 *362056C3389DF67599F460D80E2ED92D369F7C49 28.TOIMEKSIANNOSSA
529,711,617 *36290EEA80C86428DD77E67A58E6D21D6CB86621 05041211
529,711,618 *36241A6A52F46D3056BF09F4CFD1A298115C1824 2BORTVISNING
529,711,619 *3626C9CCC549EE4D461D02E7E56BCE44FB612AF2 2DEEDREDN
529,711,620 *36226D255E761B4703BDC966194985C15C6A6714 2-ESITT
529,711,621 *362D1350196407CF13B99DE69F383731C996945D 2iluvnightshadow3
529,711,622 *362082A8CD59824741110EF0D9CFD4DE59D0FF0F 10AUGUST1017
529,711,623 *362FB2C9F0E54911AE059795B022B234CC536EA7 11051681
529,711,624 *362AB90EE7CBEC406AFE3683834F33C8C0D7DB58 11koalitionaer
529,711,625 *3622831F5322756FCDCF8F7D75604CDA0043463F 2SIWIUTKI
529,711,626 *362B4CA3A08991350A79C90B0185798E635EFCBC 2 TAVANOMAISUUDESTA
529,711,627 *36296E0FAF22FFDD07F01D05E8C84A5F1EE55F8F 12FUSIONSPROZESS
529,711,628 *3620D69BE9AB5EADEF7AF74AAA6A28ADBCACE227 12graefendeichstrasse
529,711,629 *36287B1A704923E7F64FD063AC9919175979717B 2vesivoimayhti
529,711,630 *3622DAA152800F59904C2443ED0F5556E28E45CA 345GARRETT
529,711,631 *36227926FDC955CB5E0B4AB8B31067D58A56F7F8 357laatimisen
529,711,632 *3626411B1ECDB4617E23E88110BB64F8398E4327 18d15
529,711,633 *3626484C5E0FCE0961AF3FA0DB5F8B1D0C8A4BEF 3CHILLUMCHEE
529,711,634 *36260DC44549FF48EFD80CD063054537C57B8C6A 3##d.~.`(^_~)
529,711,635 *3624C3E89F20C00BBA6519F26F2B1EB615CB5BF8 3==D~.}O{
529,711,636 *362FD8A4779718A84B8D2BAF7CE6456D871AC1CA 1agrarbesitz
529,711,637 *3623591192D1E3E46481167DAE5B76ADAC285FDC 1akkukin
529,711,638 *3624D2A9D9D1394D439B824D07E76A2810C55F9B [email protected]
529,711,639 *36283C311A8F60D9D10022D5F54D0EC38748DB69 3MCPBBSW
529,711,640 *362F232F4846B0C444A72B26DC51823FA8B21BBF 1-bulvariydi
529,711,641 *362FD0A5391F90DE9BC8A9491C22DF633F46E89C 3------) ~O~O)O(
529,711,642 *362DFCA0CF88BB60EEAB643F53C68EE6FD239C27 1.cattle-coming
529,711,643 *362AA0BFF2D39856DBF0D64A2D34D238BA46F848 1.CDU-INNENEXPERTEN
529,711,644 *362B6919F7F9BACF91B0AE37B606CE1EF91B6CCB 3POCITILY
529,711,645 *362545C3BA7B9121CF2F5F1A2BA96B201200E424 3####P-~O-~O-SPLAT!
529,711,646 *36240F265901BB07ABDF61337D52E5E1161B22C0 1FORSHEW
529,711,647 *36299BD01421312779304DDDF3EC41650324A779 1.HAFIZANIZDA
529,711,648 *362F425829916EB4E12C43530FD83894EB1D125A 4%@AA
529,711,649 *362E6E0D3583844CCE7341A742690AB6506E9894 4AGYAANA
529,711,650 *362623EB7B774ED02E450BCD51D16C9D0DC2B3AA 4ALT-BUNDESTRAINER
529,711,651 *362F32A3070887B65C7B5E04B6319CA5CA01CC0F 1.hyperlib-hakuliittym
529,711,652 *36278AD300597B6C4312D102C9ACD43D3EFEACAB 1.intervale
529,711,653 *3624EAA4E417621AA1ACF46A50E1B3D80A1229B2 1introgressive
529,711,654 *36245D55C91D5D3807D6ABFE8DAFBEA6D7673EAD 1.kesifdagi'na
529,711,655 *3621F37F354D1264A7B7911835301A71EA69AE49 1.KILPAILUNOPEUTTA
529,711,656 *362841140F1A21EEABCB30B61023A461F98EABD2 4LIPOATROFICO
529,711,657 *3629F615F1B72C12E8B4D14DA44C89D7D573F9D8 1 lacroixriz
529,711,658 *36243C05884AF9629A0887DA43AB622ED512EEB8 1LORENZINI1234
529,711,659 *3623FA45B92F538FED5AF801B5FF707F22CC065A 4REGITKIR
529,711,660 *362C3E7B03F48E828E39DDFA3EFF234C8BDADFD1 1PENEVIL
529,711,661 *362A79B2D063DF2294389D75AB394A8E081FB6FE 1RATEVIST
529,711,662 *362FB7573FDE9800FD3DC0A1F5B1225F238935B9 4WINTERIS
529,711,663 *36224E6C13DF96B8BF862C6985250E8BEE5F6745 1-SANEERAUSMENETELM
529,711,664 *3625E6370314ABD9471EF2E574B956C19799967B 1selj
529,711,665 *362835522161089B541CAC90222BC4CAFE4AA0D2 560BROOKS
529,711,666 *362D34BD95B251FF2D0B5CD496D10181DE548BE0 1-taito-tietoa
529,711,667 *362BBDD53668A04E9FE16405E726BCCE1362BA5A 5BSWHAPLOTHRIPSBS
529,711,668 *3626BF6849ECDFE43FE56FFFE80F7C0CB9F255F2 1.uskomahan
529,711,669 *362AFC2BD2A05280A2A8ED48246FBECE1431BB66 5CLIMATEMORALITYMORALSNATURAL
529,711,670 *362848EE963A991AAD48DE0346159268048D5E6C 5DESORTIJADOS
529,711,671 *3620C5B7FE0D8472027FBE014AD0B1F068C7C1F9 5ECCLESIASTIK
529,711,672 *3622A64F352FDBECCF98FA3F3682F10C59D03879 20012409
529,711,673 *362BBF824DE9686301322B50875C81A33C124938 2010COMP
529,711,674 *362012844EFEFCF3279A5FEB4D05336D07FD36AB 5kohlenstaub
529,711,675 *3627CF74DA6DD47B27BD9191BFBDCF69519DD952 5NEGNAVEGPO
529,711,676 *362704743D478C581BA3B63FF0567AB413F50023 5NUMERISKA
529,711,677 *362DF234C68AB8CA706EB971F3440CDFE1753862 5OSIJEKO
529,711,678 *362F3C632175C43B0447B623BC45045F9C460A39 5PRITZER
529,711,679 *3622B3E0B9AD7A5C41B564EA9731D00EB77E2DF3 5rialzasti
529,711,680 *362CACD3C5CAF345B0E56A2DDD168ED67121D0DF 5SABRINACAMPBELL
529,711,681 *362BE74CC376FD24E4896C684FCC355818A4AD72 250074 NOKKONEN : SAMA ANNOSTUS JA VALMISTUSAIKA MUTTA K
529,711,682 *362423AD5FF4ED1313B937C5CDE62829BE34B682 2569623 MORE TEXTURES AND WEAVES .
529,711,683 *362C91088CDB337AFA7028FB13B5CEAE1508DE73 2712768 TOIMIKUNTAPUOLSIVUOROTTELUVAPAANMY
529,711,684 *362ECE944B27E06B5DE354B264BEFC363459EDB5 2.AGRONOMIN
529,711,685 *36249989E63050565F387D4AC1655AEC704D4192 6AILGILGN
529,711,686 *362C8BCCFF9EE1BF8654F48138DFC5754707B728 6BSWBILDGBSW
529,711,687 *362A63B127BEE81530271448A862A404EE68CA42 2-em
529,711,688 *362E26A2233F7F0ABBEA7D499A205FC56C9590CC 6DESGANARAS
529,711,689 *3622972A2FD38BE1B016D06249D66A6380D47C55 6ILUVSINGER
529,711,690 *3627E202FFAB0CC6E4CEA2CF6CE3CEB9B70F8DBE 6ISLANDSYLVIA
529,711,691 *3623482C8DB2001C7CF59843FD6A14BD14DB7B7C 6kauai2
529,711,692 *362497623D446BF65F64A8EDF42948C8FE202937 6NIGRERASES
529,711,693 *36275BE41EFA3B704626903654CBA0FB0D66DFD1 6QSPITFIRE
529,711,694 *36224C9E38E2429957DEF52FEF0A7F4FC4542959 6SPDBARNSPLEJ
529,711,695 *362991D2E91AF00838C7F7F2ED7BD7B720E1E604 381726 ahSapminberiorjinaldir.
529,711,696 *362794D2F7675C12FA8AF35F59E0AD1DD7049BB8 3B<-*-q===p
529,711,697 *362D15E99B70EC8AA16F9C0EB56BED94FE216259 7.1.2.--Strength-of-Mechanism-Factors
529,711,698 *362EA0A99051FCAEDB5D396873D3B3D1D58496E5 3CHACKCHIUMA
529,711,699 *36280198F69851E6E4A70D07E265EDFE26EB1529 756WEST
529,711,700 *362979BB60AF0AFC51895D78841BB2FD200F4FF5 7BIOG
529,711,701 *3627983344DB68EE904F68C7D9FB84B372342F5C 3kari-pekan
529,711,702 *3623A6939FB7E9D75AEBE34D8DF8CF3E39700A04 7BSWGRIBIBSW
529,711,703 *3625D682695F91F810FC4A48C1ECD77EC48DC300 3OLYMPIA-SIEG
529,711,704 *362749CF0C6436DE7341E9FE179A9791E5961171 3-preisner
529,711,705 *362596BE55C1B708790B7A64181879DFC63EB6C6 7DRAGINBYTHEHEELS
529,711,706 *362F03A1DE38EA833493F4076561B710D4780A73 3SQUIDLEY
529,711,707 *36266F8E4537FB01A3D80F8267FF2B6A002B57BB 3ZINSACCE
529,711,708 *36258B78723BC72CB6B45C07DAA12AF272A8BC30 7monitoire
529,711,709 *362956644B868C2561099D0FE139351002A5B0A9 7pavel5
529,711,710 *3621A8B9794ECB1B183BAFBD580E76E6A832505B 7RONALDXFILES
529,711,711 *362B1B79E3B22982A407C85C23D2586FAFAC8C80 7SHORBBSW
529,711,712 *362178BFD80C0107A65154ED27CEB4798D803925 7TUNTISEKSI
529,711,713 *362A27FACFCE62059C2441531236BA4E187A7745 800178C4E4942A2960C6999E9930EF44-1PFBSR2X
529,711,714 *362BEB60B3C80E38EF39E058CFE69D957E270B4E 4MYBEAUTIFUL5
529,711,715 *36226E2734860E0391E7AD3C21A6E6FEBB103FD8 866-and-counting
529,711,716 *36249A425730F3BAE718FEF836891554A923437A 880443 DAGLARDA-GOZUNE-KESTIRDI-,-YAKALADI-
529,711,717 *36286B24E35545193225F1C1043CF08EB77133FA 8ACCLIMAZIONE
529,711,718 *362EDAC404404D733A71837B94854F5112F4F78B 8BSWEINSTELLUNGENBSW
529,711,719 *362E37160F195D4E87BA6741FDD5A511F4AB102A 4REINVITINGS
529,711,720 *3621E862681E356A7692E855E5B843CC84ECC3FE 4SANTAKITTEN
529,711,721 *362D8D73B9A1191ED9141F5C2213D4DD83CF3237 8IAM123GO3
529,711,722 *3624E0F8E866BFDD4ADA0B02754560B9F448731A 8ILLFLAVORED
529,711,723 *362A997C5CDCF2F9F0E9C078593638D302080835 8MHZ帯が3802~3900KHZの受信に妨害を与えないこと(二次業務)が追加された。
529,711,724 *36204249A65ED216A28BE72F9295C2FDAC4EA553 505828 sutarimtic.ltd.
529,711,725 *36298E3383B0DEC5808A2B328583320AEF151138 54478 JOKAINEN OPETTAJA LAATI ETUK
529,711,726 *362029530C37B389BFE0AC8983CDD62CCD801B9A 8PAPOUILLAI
529,711,727 *3621BD719B6409A3D603021F49A7C119B96DF1F2 8.procurator
529,711,728 *362DE0F15624AC3EE180AFA081ADC195930FE211 5ANIMALADVIL
529,711,729 *362ADA20D5BF6950627BDDBA5EEE10BC6B1696F0 5BORNEADURA
529,711,730 *3628E8395CE001B14F8BB19000DD1CB8D25A008E 8SUBTERAQUEUS
529,711,731 *362DD590BB2DB124ACFDB0A96F7825BA02B9EB69 8SUSTENYT
529,711,732 *362CB2A818F595FD72DE81BC3FAFFFDBD7EC1012 8THATDOLLARS4
529,711,733 *3621DDCFF4EDED5D7F2BE93638F32030CC7FEE44 8WEASELFIREMAN
529,711,734 *362B7B1DDD17FA097A9D6D9B37781B87AE683E9D 91275 niiden-kanssa-ei-pid
529,711,735 *36263459E3EB1C38175320560D1B70C283CF4BB7 5FOOTBALXXX
529,711,736 *362EED68A2126014EA024EA78019F99CF5732FE8 95406 rijit cismin titresimi .
529,711,737 *362EDAF60026524C3D45435010844A92B58302D0 959716 A08-:-30---09-:-00-CAMLICA-SOK-
529,711,738 *362344F90AC109FB5B29990DA7EC9187762783CA 5IAMDOGBERT3
529,711,739 *362875DA93B6730AC3CBA111FD803791B5167C0B 9AKSITNAT
529,711,740 *36287D34BFE91C6A5C2F420B0FC0AD5A3559E511 9ANAGOMENE
529,711,741 *362A6CDF19D491BF45A641B3BD4BEA2AEB102D78 5IXZARBSW
529,711,742 *3627377CA4E8A22E0B89D5BDE9E5F65226658FA5 5LEDIONS
529,711,743 *362EACDB75EFD00422F09B13CC86B38C1B632D70 9DENILGIW
529,711,744 *3624F69D3292D68AD32BBC7520448580519AD25D 5ostopalveluissa
529,711,745 *3627C151963E1C98CEEE9AA377366A3357BAD6B8 9JERRYBACH
529,711,746 *362AF5355BB7C0F7C84D1E4656BD87C3EE8D64D6 9KOKOONLYSHT
529,711,747 *3623281E9F3B76B143CCEAF5ECD767DAA056F7DF 5SCRUPULOSITEITS
529,711,748 *36213FD307F1B0D1A8C0EDFF0CF612042AB085C4 9.MATTHEY
529,711,749 *362D943447315FAE590DE9B3323AF6AFA34E8156 9MOOIHEID
529,711,750 *362BFA49F2D5522F86207CD7F6D9A76191F4EB04 9OCTOBER1935
529,711,751 *362861FA53F3BF50717FABB49DEAE8F59E05F87F 5URABNAKAP
529,711,752 *362F723DA9C1E808B2D08134071E5215AD77F0B3 9SFAGIASEI
529,711,753 *362A2DC61CE69B713BC69AB5936A62C653E2362E 612JAKOBE
529,711,754 *362EA9136128EE379922FCD855F17ABB377F1A12 67RHAPSODIC
529,711,755 *3627B9774BF9EF5FE40D5DA32DF5504CEC952EC0 a++0
529,711,756 *3625EF91516A9FF9A22A41CE8B5E5D0C88D0B7A8 6HUMANALES
529,711,757 *362B8B14D7A07388DDA644795C1EC31973FF5114 6IBRARYBSW
529,711,758 *3622BC89306C41C02B75A556F6C8CDC2578D7C6E a8/:5
529,711,759 *3620ADE1B1400DD02B7D4FEE067844F085739B95 a8f
529,711,760 *362CA7B225F0C67AB20CE37911802BC920E43F14 6TUKAHDUTTAMIN
529,711,761 *362CCBA6749145C75DADE06DF96B0021A55F6497 aacqu<
529,711,762 *362C8B3CF35409C4D2CAC114CEF969F6F7D7A734 AAD2\J
529,711,763 *362F72A4C9EA48F0A5B52EE0B3A00B5BA4682067 AAD^VC
529,711,764 *3628887DE0F7F0137ABFEBB0E8D0E05A212B70FF 714QSEFTHUK
529,711,765 *362ACE5C74098D1993F98AF01F724CA3DB7DB52B AAEIM4
529,711,766 *36280DE1CFADA5B71313ACF8DE64F090E122313A 728690 KANSAINV
529,711,767 *3625C8CCF3D48FA73AF2D0AD461AB62186784027 aaensl
529,711,768 *3620911C0EA914951381445E97D58A5F280A421E !aarnjcb!
529,711,769 *362DC27C942878607C508A801C5B1FE462F21DE5 7BRAVESHECTOR
529,711,770 *362923AE05D42CACC44BEAFF8F9BD6E61B0EB686 aatpaamas
529,711,771 *362C952BBE900371BF25A53CE59138AB3100D8C2 AB;-"
529,711,772 *3628EA06E5F450B11DE5C8677589A551DD31319D Ab4A
529,711,773 *3625835F4D07C66169B03CEE29EB1BB497E56D97 7EMBELLISSAI
529,711,774 *362390CEF15B6820203D1CFE17D0190BE186FD86 abertysswg3
529,711,775 *36255DBCF4F82B299FEB5E71CE17C0F1688B4D57 ABOUTNCD
529,711,776 *362EE7C8C321A167C853ACC242CD010A1B0C60F3 Acl+
529,711,777 *362B70F4E2509F60FA047B658C058CD2DFD6E992 7SIALOGONWN
529,711,778 *3625CF14CA822F1EF3709476874513115358D439 7TNEMETRAPED
529,711,779 *36274B8A2C3AAD8C3C093F6773AD20EA2CF03DB8 7YANKEESNIRVANA
529,711,780 *362D59F3DFC592CD2C6EA043FF1DB532142E2D96 7ZWETENDE
529,711,781 *362F1AC2FDC7622A7858AB396EFD026D00A45B10 aebf_
529,711,782 *362496D66AACC9612DCBFFC1994D8341D8A9E8A9 8ARTILLIA
529,711,783 *362B4DC8AA7192260927EF4CDACF1865CDECFA54 8b.~o(00)
529,711,784 *362D31BBB8481D1510A22A3FE542D8346775445F 8DOYRGOYTH
529,711,785 *362F6D044CD1C91105335ECA8B945BAD42ABCC6E 8I0CIDE$
529,711,786 *362F6EA14C993CED8AAB861064F722E799A9EE45 aguzziate
529,711,787 *3625EBAA7BA2DCC2CB0443AEB61BC7578D62F88B ah8e
529,711,788 *362C7A2507A60E66D9CEE3313563E08EDBBBAFD6 ALDENSTROUS
529,711,789 *3625AD7B116C7D933EACBB5D40D61E3AAB27B80B ALEXANDER.FUNDORA
529,711,790 *362D91D73AEB5399750B38B21EB1CD94614A623A ALEXANDER-LACSON
529,711,791 *36276A3EEF0403E21D6101F75CED8C84B386081C @[email protected]
529,711,792 *362D1C8D70540B7D033AC11A4371FBEC3682C4FE ALEX.PAPRANEC
529,711,793 *362FEE2C2579237AF713FE49A71E758D19433D50 906053 vuonna-1999-suomalaiset-s
529,711,794 *3629B0B9D6F4D193466EDD1A86C8F8BB1BEFE5B0 [email protected]
529,711,795 *3624AEBA8DD66AD371CEC7FA9C1B990C3CB040DE ALICEKWAN
529,711,796 *362A4B703D3A732CD0F8E7008F6835333F1C646C ali.shekh
529,711,797 *3620A86938EDEDF6CAE8D2A4FABCB42E1F334FE9 ALI.SHOWN
529,711,798 *362E44A4DF34F1C1FBB292F09AE7F6BC09ED6204 aljzq
529,711,799 *362961990AFE99A191471D35C8837AF8962BA3EE 9BAYLIFE
529,711,800 *36275056E818F5E4A04D28288F1CFC05C838A77E alr4a
529,711,801 *3626527D2651E37489B62E3BC1F267F8951FC68E 9KTLINNQBSW
529,711,802 *3627C2ABDDB655D4F40B7C28584591E345B44F16 9MUZIEKLERAARSES
529,711,803 *362215459B591FB75D00D76A07CCC4F678EFB2ED AMS0Z
529,711,804 *362988999C88349342EC8A13053F51E057F10E12 ana1y+ica11y
529,711,805 *36254FF81A990676BE0D4EE6C471FCB9D30AFF48 ANDRESHARLOW
529,711,806 *362246C542A6A2B2B0434503DE2A495CEF115B5D 9SCENTING
529,711,807 *3629C49ACEF646355EBBD40A19A8CD5E23585EAB anna.murillo
529,711,808 *3624065F1B5F2AA56E60DC8289257B9EF356143D A2LS7
529,711,809 *3623C1C40058512AFD99731C6CAB06A525880EAB AOTTIEH2
529,711,810 *362FA56AD1DB714AB954A2E10C8EC793F809375B AP-144USS
529,711,811 *3623E3DF10362B23DF7D7F9D26A3704CBF91249F a8f
529,711,812 *36242ABEDC2B8AF462196D0798AF6DBCB3D6D98F AAD^VC
529,711,813 *362E2B10D103AD86FD30D32671EB300494E49200 ARNOLDZUANICH
529,711,814 *3629593DB239C9DB46A51F6B52739B750B3207C9 ab`6m
529,711,815 *362B37B7F5EAB6986D368AA189239CBD8EEE296B arw0rth35t
529,711,816 *36289773D5809431DF26AFF1F494661156762ACF asmaamohmmed
529,711,817 *3623F46BAE2F59E2298EE68819EB776BAE2E8D3D atmqt
529,711,818 *3622DE933799EE7AFC22AD921A4FE00D651A86E7 A-Collision-of-Time,-Space-and-Sound-(A-Revolution-of-the-Soul)
529,711,819 *36297791B5271EEF9F13955E70FC932914C2266B ACP!L
529,711,820 *362E0F030CE89D843E314FF3847520A287E9787C AUBREYHIZER
529,711,821 *3621B4F5B246BECF7E036D25AFBB3E996FED9F52 audrey.jamison
529,711,822 *36296862D751AC2BBEF98AE6BE66ED9C3FF1542D AUGUSTOWSKIE NOCE
529,711,823 *36257D94A6D0DD7A2DFF1D3FD9E4527BB417AE18 a&db
529,711,824 *36254EF90C487FD42C09E04C57F3B3042EAE0A05 A(VKY
529,711,825 *3628818344AEE644AD0C951C317C3DD7939EE38E A-E
529,711,826 *36275DB7D70A0CB7AF8D94F3AF6974C8F3A3110B B"$+
529,711,827 *3622121EA1636114D78035009AE154D887F2A0A8 ag/uw
529,711,828 *362623ECA55BACD4F3FAD485D7B7BE845D32B170 B5Y_
529,711,829 *36284A24DD0634F993559D32ABD114EE6D96D3BC B8C"8
529,711,830 *362BD63A5AF8A1F57836F671F8D1296F3BCF55F6 B$?a
529,711,831 *362D0E9E9C152C3BB2A57CA9BB29700927DDD746 AKOPIIC
529,711,832 *3625EA2A24B1D002450D86D9701F134FA2658F86 AKV6M
529,711,833 *362A95CA748CDA961294E2BD31DB913FE660ED64 ALBINAKURTISHI
529,711,834 *362176266BCDA1E8C181352F1C14A0D2CCED9971 ALEJANDROCRITCHELOW
529,711,835 *362194E666C37B871EC11FD95A7839FCC2E0BDE0 BARTONEWTON
529,711,836 *3620A702FD8159B0250013FCE4D740397D56EAAF ALEKSANDRÁVICIUS
529,711,837 *362E2E731F6A29410E7591E48B72100CEB203515 ALELI.SALCEDO
529,711,838 *36278CA17805880C66370591AABF16CB8743B771 alexander-tudor
529,711,839 *362EFF9EAFF3AEFDB6FA70886680E7925868A297 basketball_court 'b/&/sk/i/t,b/o/l_k/ou/rt
529,711,840 *3626FDAC45946D708DD7474CF45CE8208235F74D ALEX.ARCADIPANE
529,711,841 *3622FDAB40820EF8DD5FA62F32D0C524C81E62D1 alexcrabbs
529,711,842 *3625A48C9970A9E2F1EB57F974E193813AA49C6B alfonzobria
529,711,843 *362FDD9D8EC933A82D366BE9CA9AFD10B9403582 ALFREDDEKINE
529,711,844 *362873DC37814CB81620333F74DCAF6062B7D478 a"l&h
529,711,845 *36232E7C1483F98759D081E374C29F11F32CAF41 b-d*.3b<-
529,711,846 *3625AFB34D4AD2D4A48CD7A8E9B6176425EFC652 bdbv
529,711,847 *36249E0B7AE5E337350471ABBB0398BE345660DB alvaborrego
529,711,848 *362164A0A05A6CD987797647A604E8AB01BE6A9E BEEDIGIN4
529,711,849 *362B0B5F5154DF25B2A003EFCA939689C11A151D BEGEREN8
529,711,850 *362C9CD7C14D9FFAA662494F9173004E15402FF9 BENNIE.SCHACHER
529,711,851 *362BCEB7871D3DEE5F1B3B26933F344F467DC812 BENOITJACKIE
529,711,852 *362BB79EC1238C3C8E7422249D608852366A3C2F amr,s
529,711,853 *3629D436111B27225A613C507F97A88CD376B110 AN=9V
529,711,854 *362C39A088500870FE6C6553E28C325AC968F0C9 B+F#N
529,711,855 *362ACF69E8E365D2F8969E70CE3911E2891D2B50 BIHQ
529,711,856 *36244F5624271F2127009163EAEAA5E165EF21DA anwealda4
529,711,857 *362214442EF3802A71CF2880583B25D2D79056E2 aoi$u
529,711,858 *362D7267D4667086A0EA919F485330C764D0A72A APADOCA3
529,711,859 *362B3E816AAFB4AC01705EE5F55A96804AC9C94C [email protected]
529,711,860 *3623673ED173E924B4086791226783E34C284B7B BJ4OA
529,711,861 *362F3730FCEAF90B9DCAC40793DF030BD16ED13A aqby4
529,711,862 *3626EEDDB3DE5C62679971183503C1D2C69A5B26 [email protected]
529,711,863 *3627F623B6EAA0A7026DA176034C7A713F601882 BNGTW
529,711,864 *3623E6CF6635961D39940DDB3BDD9C823D0D9E1B bo<3
529,711,865 *3628DD6EF9B537394A4CD24FDEC3B09E915727F1 ARTHUR.HIATT
529,711,866 *362C2BF620625EDD2C8C47ABD3F3C04E8879E8F9 BO.ARNOTT
529,711,867 *362BD6BEFDFA90FED7023F78CB3FB7CCAFA0EC21 artrylic1
529,711,868 *36295960FB26393964176F4299571DA0BFCB57B9 ARTS.202.41.72.100
529,711,869 *362C1408F89C3D9FAC4AE2A1B723BCE53AF0942F BOHALLAN
529,711,870 *3621459438DCE5BFB764480C7D9799E5C56618C6 BOH,Y
529,711,871 *3626F5FBF905FDDE1123E20DCAE81F8E97E1C9E4 bol1
529,711,872 *3628736DB9B22D0DCDBB76C5062777B6E8E9595F ASHLEYMUSSA
529,711,873 *3622092E5AA7367735EC61E6476EC6ED41CCE481 as.is.life
529,711,874 *362B32E28586C7B8CA7FABED0B779A7D2D9EB5FC [email protected]~O~o}X{
529,711,875 *362FC1579C3685236CFE104D9B8725ABC857601B boutakoff
529,711,876 *362D609BD6DF2FE94EF6969380EE2F22176F0414 B---p*-*splat
529,711,877 *362E099D96C52BBA84036F06C181044E62B7A54B AT;SV
529,711,878 *3627F71940C32211E4511562E30689B843BC8469 brd?u
529,711,879 *36221FEAB5E7DD8D397E3F2306BE2DE8EBC675DB BREZHNEVIL{ISEN
529,711,880 *362D1B6FE4A2582C9602E9EEA2222811803D5286 BRISAMARA
529,711,881 *362698D815DB0F9054942123F54B384E2ADD97A4 BRITTANYHUSTED
529,711,882 *362E8FBB80125FA8639047B2F6BFC4BC09E7B5FB avoan
529,711,883 *362F5908DF20347EB8C8D254742F5A8B87AAE080 brodericknies
529,711,884 *3626056032F3943E61653C88100130C54AF313F5 BRONCOSVICTORIA
529,711,885 *36214E717EE0ACC2730B06998E870133FEC4AF19 BRYCE.ASCH
529,711,886 *362C3A3EF72FCE6A6C414C3D8AD94CBD21A9B349 axq8i
529,711,887 *3626BC6183AE6425DF8554E097D938F494BE4666 BUCKINGHAM Sayon,mylovinglord
529,711,888 *3623E45C91A668C139904CD79DFF2B80906F047C BUD.VERD
529,711,889 *36298910C39911F33574FE1BA8CB1238325D80B9 B1NU,
529,711,890 *362707DF359D700E6935B5F20607C118DFA55B70 b2=
529,711,891 *3628C6F150566F7EB8D09328EAE339044C951A68 B59CB
529,711,892 *362EB2C2F6212868A56A21CBDFA9A9BE3CFE0B8E [email protected]
529,711,893 *3621A065918CE52AC55BD5D7045B059E9B7AFD0F bz1lq
529,711,894 *362538D671766EF2B354E740479CABB23B78A0D3 b9/x
529,711,895 *362AB3DA7EA7EE7114ADA6D995267C144B5EDEE0 c&0go
529,711,896 *36240FDF8E86F3BCD5A04F287BFE6AEDED921021 c?):2
529,711,897 *3623FA8FB560A9E59A4F0B1F92E9E02739404E6D c2chs
529,711,898 *36242932D4118093024FB621421156BC26DB7DE0 bay-cedar
529,711,899 *362696A213CEAF7B858EDB6285C612AFEF384B6E bbde3
529,711,900 *362960AF22610607BB80611EFD53FDF7CB873383 CALLIE.OBRYAN
529,711,901 *362F86E09EF65AF27048B5C8CBC81A413113B1B3 CALVIN.GREENMAN
529,711,902 *362DFD24F39FD04C8D897336AF7ED640E569C314 CAMOUFLAGERNES
529,711,903 *36274EA4C8BB7AC4C18C61BF1599FEB142F9A814 CAREY.ESCHEN
529,711,904 *36282B14D8A258F1AC7CB5FF84A194FA35B547E1 BECKYDOOLITTLE
529,711,905 *3622E28FF86AEE4BC6DE171406C6006B8B350272 CARLTON BATTS
529,711,906 *3623C434287D6AC2EE4B2E5323DF8199B77619CD CAROLESEDDON
529,711,907 *36229D4ABF1D3CE97E97C70D6A44E6F8655C58CC BELLLORD
529,711,908 *3624DD8A8269BB7B13E92C7B59D52CC6F5B32E9A carrolcerqueira
529,711,909 *362F40970FBD0379F21F8F6344ADED79D5ED6B45 BENITOBARJAS
529,711,910 *362FF24DF3ABCE191AF8B313E6D24A92253390CC CARTER623
529,711,911 *362FCB901ACA4234B4277DDC2517FFC27AAA5F63 BENJ1MAN
529,711,912 *362CBF2299DF3C2F58E814AB2347112AC464F438 bennyrose4
529,711,913 *362F98F6501FD8976693600D9DD33F0BD3B4BDDD CATALIN.ENACHE
529,711,914 *362DF54A38B974FB481D1A2002E79DD9652556CE BERKMAN--B-ER1-K-M-AH0-N
529,711,915 *362BFCC8670C31BA1FDB2F8B3B5DE676FB1ABB3E [email protected]
529,711,916 *362AB6877D353459EEC82DCEE5CF15B6814E849D BERTRAM.FRANCHINI
529,711,917 *36202A5CC30CFF82449FA1DE21A668E7F81BBA50 BERYL-VOSS
529,711,918 *36229A492EC8EAAE79ECF8875A8FFF6522076CF2 beseasicks
529,711,919 *362A3FD765431B454A0E803922F40E81178DF63F cb-g1
529,711,920 *3624AD2DB82DEF06E2E542A6DF75FFD21AD00C9B BIBELSCHULWOCHE
529,711,921 *3623A92AF73A70E20A63CE6D5C4DFE5165695138 BILLIECAVICCHIA
529,711,922 *362D70F42BBA7954F85819F037CFC638402B98D3 c;f:a
529,711,923 *362EA838883C0B8573AC3DD594000D194492EC9D chadwickhomsey
529,711,924 *3627EB9CAED66A5BBFCB09BF3E4C6DEC267D89C3 BK69+
529,711,925 *3628A490FA9B2AC4CC4DA1D07A491AADDB96BF02 BKI$D
529,711,926 *362661C7CED69BBAA5DC8B1A2A53B7A051A90BCD BLAIRHEARTZ
529,711,927 *36242DB84ED19A5A006747F4A79BB604EE97C42F BLAKE.HARDERMAN
529,711,928 *362CF819F36E22F8E66BEC6329EBCF5C6771AA1E bla$p
529,711,929 *36278D234E462F95F3EB4DF6585FEE26736A89BC chelsea-bruhn
529,711,930 *362AA8A909C92856E07515C4A955A4FA52D27B38 chelsea-dagger-(radio-edit)
529,711,931 *3624AFA6994072606F3C18EA966F0652B2E74F23 chhue
529,711,932 *3625295B264F2F5BDD37129A31A1C257A36DCAA3 bokttkob9
529,711,933 *362F5E94449599455988842CA57C350C111ADA57 bonnie21122112
529,711,934 *3628FC099C8B76BFBC320A64D83315084AB7EC36 B===>~O-~o
529,711,935 *362BBE5997F4D41F104674E9258CEA61C7CE885B bookerfuchser
529,711,936 *3628F471181663BF0B50618FB850C6B8B9BB58FF boolscher
529,711,937 *362220A62BBFDA2470805833631CCD74F3056E99 BORISWITHMERZBOW
529,711,938 *362D6A4727496F050D5107C7C352907B026BB450 bptan
529,711,939 *362130782523573D4B0A535CEF70AF425B500A3B BRADY.DOWNARD
529,711,940 *362185449700C17A3B73612DCFF4AA790849E0DA CMBBR
529,711,941 *362746CC06E9C4E828E238A65D8C6E3AF77F84A5 BRETT.SAHR
529,711,942 *362E4A476FAEAA2EEEAF491D6C41274180E498DD cm_h.
529,711,943 *362D3318747E93877A87D2F26C4DD4685DEF0744 BRH?E
529,711,944 *3623CA1E354A7B07DB993AB6F671DABF830CA57B BRIANLEFT
529,711,945 *36232CEE262D799D87A381265C46088BD7569228 [email protected]
529,711,946 *3627087B5A65ECEB802E48D9443E2BA09E478838 c:nk
529,711,947 *3622F5582151BF02178C551871A678BC06D44A23 BRIVIDOSO5
529,711,948 *362B41E5ACBB8B0F0B0DF6240E68AC5A7735C890 BROADWAYBRIEF
529,711,949 *362A9879B65321DD5491F68D570D48E94770293F BROKEABERFREI(FEAT.CARLOSKALASHNIKOV)
529,711,950 *362489BE46C18046D8BD7765AD7FBB08E3C8DBE5 BRUCE KILMER
529,711,951 *362B9C2C89075E32880BFB08DA6C8C5DE5C74C60 BRYAN.SAUBERAN
529,711,952 *362374725B2EE748BA4EB0842BE7B36599541614 bryonsimila
529,711,953 *36254A10C908ED4F099682893D743C43ABBE92BC COLEMANBUCKETT
529,711,954 *36272BA12F855AF08135CAA4D135DFE85E04C850 computersimulierte
529,711,955 *36222AE58F48D23243D17847C8DAC6C5553ABA8B Bt/7
529,711,956 *362DC1C86A9942D234EC65A9A13E322DB3C1EBAC CORELSCRIPT
529,711,957 *362E33E42E281C1EBA578580FDA5ACCDEE1F3D88 COUNTYADMT1234
529,711,958 *3623CD1273F845635A40B3691BF6F4CBF0E06FE7 BUNDESAUSLÄNDERBEIRAT
529,711,959 *362B4A4663443C9671A3CC4B67DF81AFC8DDBCA7 C/!QN
529,711,960 *362552C114F98D91372E82BE9E961AE52EAFD0C1 B!;X
529,711,961 *36265554254A7F3A4AC094773226B0DFC837DCC1 C1NSG
529,711,962 *36244742C8E1A11096EF0E1191739E99336D6EB3 cuob9
529,711,963 *36279E54BFE883DAD36249CEAEA16D03C3339B7B c=46
529,711,964 *362DE18BBA4CB1714A9EE1580A249B016DB4BFC8 [email protected]
529,711,965 *362461CBEC0C26C160673B05EBA40066643AC5AB c(4/z
529,711,966 *362F8FDED58231D5B50A80086572F00FB412E47B cv#nj
529,711,967 *3623A25803263D20E35FD602B753A4342BD82511 c7:fn
529,711,968 *36276F66156DECB48525FB425BCC2E617067FBAB c&:ws
529,711,969 *362E714C9C56BF8FB7055A07E5AE53D7D85F75C0 C9T+
529,711,970 *362738FE9DB818C2ABB2C297F5917A9E646CA082 CALLY-LANE
529,711,971 *362324C4891280E42DD0B7D712AFF50764E866D3 d0wx
529,711,972 *3623AC2FC06BFBE3C937B380E7C879F61761F835 D5c0mb0bu1a7e5
529,711,973 *3625F6DE43C1375ABE614E3CEE4F35B182193E70 CARLOSBOILLOT
529,711,974 *3626F23AB60BE7CE81B4BD7BC5BDE6B197968DA0 D90WO
529,711,975 *362EE367CD3FCBEAD44938F17ED1F8AE24A09B3A cassidy.miller
529,711,976 *36275C7717274BBFDFEA2982AF62ABABC58D8EEF cassie-kerr
529,711,977 *3625B311A2A811156F5F7407A5BED2F559CC4354 DAGỸS
529,711,978 *3620063DDCE71120C7F51B948A87F4F032E2849F [email protected]
529,711,979 *36256AA7C5B1142B464653FDB558F25F28493E64 [email protected]
529,711,980 *3628B9CA5C113F04014FBA5B8C5F7082CD57DDF0 d%am
529,711,981 *36275185823D6195686148A508CE977532C57A2B DAMION.BONDURANT
529,711,982 *3621DDF8A9593A8E80509ABC9C8361D60283E246 CB&QV
529,711,983 *3622F2903BBD04BE9D8DBE66F4115E3CBA07949E DANE.BORSARI
529,711,984 *3621B16539A5B1EF06BB19DF845A91231ACFD16D DANSLESSEN0
529,711,985 *3626447290E73AA120376A31950D91CCA81C2623 CDNJOURNO
529,711,986 *3621FC9695D4BE064E6AB284E4EDFF49178F1E0C Dark-Alliance,-Volume-3
529,711,987 *36264F36C242FF1C51D8F227A6B9154F92C19FF0 DARRELLDOAK
529,711,988 *362B752647B25260F123696B722752B8014A48FE darrelravotta
529,711,989 *3626F1602EB8E8034058A6719447D5655530EE56 ceasefire3
529,711,990 *3629509180558652FB52D4C7FF4A80373A7D2351 CF5Y
529,711,991 *362C081107C34279A4E7677B3974E50DE629ED5C D;/BA
529,711,992 *3626C469D6A95CA2D007F8AE90429338B2B67EB9 ddj0g
529,711,993 *362215BFBF251806E92B2FD0DDDB8A5F73B88C2B ChanMukhra
529,711,994 *36290E22E68A6DC17AFA7A6FEE4A267A765C3D72 DEANGELO.BEDILLION
529,711,995 *3626D62B8F9F66CEA204EF7D45A79FEFB8B19CF8 debilio
529,711,996 *3627166BD5091C51EC8922B0C47DF948D42946FB DEDAERT1
529,711,997 *362B961D7B9D30AEE70D3C9E683817CAF9F502CD CHINAVA+E
529,711,998 *36290B743D236414B0BA85F5C5DC9B569D43E801 CHINCHIWAD
529,711,999 *3624B1BFD47A88018CB4EF14A72A605942F3546C DELNELDA2
529,712,000 *362AD22E7E3794D337C5E9412A5A7ECA4F580455 CHMYC
529,712,001 *362C43BAEAB08FDD78A72A35B77B034CC837E071 c?i3s
529,712,002 *362354746D7F3B0D2658AF544367D823CBFC30FF CIC1L
529,712,003 *36223877AF411E5AAF1AC61029584846B6A91BCC devansh-verma
529,712,004 *3627EDB06B9FE21B85FE51D5C966A22EB8E9D91B [email protected]
529,712,005 *362EC4C68F98421578469FAFF8CDECD6CAFDE0CF CIP9Q
529,712,006 *3627D8420C532FBA6979D7F0AAB5360CACAB4F40 dggmz
529,712,007 *36274151402709010A610CEC88F78DA90793A54D [email protected]
529,712,008 *3629F8DF9CD58D5903707305A92FCD412B621E06 DIESENSATIONELLESUPERSAUEREI-RGERNHARDT
529,712,009 *3628D79F8B006BB45566D8D8943505D52D7E2863 DILLONLALIN
529,712,010 *36272DDDDA4C3697B02683AD52931A39EE804112 CLP"C
529,712,011 *362A6045F6E5C4F39B8D4C60C72570E359CA82C3 co!a,
529,712,012 *362F78B290BFC4BD59209C39B61A3DAB1C83B72F cocaymota
529,712,013 *362E5771237597EBC4ABA4640F461D2757380AA2 COMARCADEALMAZAN
529,712,014 *362CA379C72A67467865F70330AB2BF969D655CD COMIGNOLO9
529,712,015 *36246FF06A7E92C0FBDEC1C6FDBD2B627194463B DNG3C
529,712,016 *362B389D61C6CA49F432D6B2CCE6DCE94AE16661 coolaman3
529,712,017 *362DEC35B683C0FA6D71942F3006D1AFB076F38D co/t.
529,712,018 *3621D0EDDE0723F6F660DA60FFC10488DE2E79CC D.)OR
529,712,019 *362BC1E8947CB40011EF09F8BD474A85483F69DE C_PARSON
529,712,020 *3622E2A2661BB364FCF7EC2042E70D2A1EB68EB9 DOYLE.FELL
529,712,021 *362CCD8E594B3262D68B6E3D3E68D2EA391F1AF0 d:p
529,712,022 *362D47863B8E183EC24B66A09EDD3BE2192C9C3E CQVT0
529,712,023 *36298032A1F17F9E4585CB8818E985CCB467D7DF DRAGON1CHARLOTT
529,712,024 *362A3249076F86E783B70C5532481B6C1D4DA5B6 D)s
529,712,025 *362287D6E4017DB4D8BADD3C533A3DCB0D98DCCC d,s:l
529,712,026 *3621F091163820F45F4D50D289CA236ACF49634D dukeshire2
529,712,027 *36254413AEE85FF0422186B6568B516EDE61A298 [email protected]
529,712,028 *362A3A76C65A347196B9A44F84779DA3AC5395B2 CUISINAN2
529,712,029 *362FED37F8182CEAC71F51440AB5BEFE3C0EE2F8 dumping.grate
529,712,030 *362454E03033801EAB149A987118149AFE5B2B99 cyp;f
529,712,031 *362A3E8131EAB8B47093C271B5FC69C5D026D59A CZCD%
529,712,032 *3625632CBE679A65EE45512341CFC0014C27F9B7 d0koe
529,712,033 *3620C219B9A634B210BCE03808F18E26A965D01C efabrikk7
529,712,034 *3622388367BD0754C52C90DF8A2778C537D88489 EG-LO
529,712,035 *36236EDCAAEB6144659D70060F1E57DEE75601D3 damfp
529,712,036 *3629D7045100D3E5D0375B8CE05F7724E6B2C6BE danareys
529,712,037 *362C2A2A9252D2FAEA94CA9133AED4A881F84F10 dancemax200502(disc1)
529,712,038 *3627D85D736B22761AF5B69D3A7B9225C78C4D3D DAN-GAROFALO
529,712,039 *362710597833F32BFA1B47533C4C9C396BEDE1AB danilopluvoise
529,712,040 *362C40C57784835D6E007A407C462A80A3C29163 elavanorea
529,712,041 *362BE6DE1DF1C2BE9117C5AF418568F6E935C306 ELISHA.MALLONEE
529,712,042 *362F6FECE47821B3FAFF98AB299781CDB71F21C7 ELLIOTT.HARTSHORNE
529,712,043 *3628D982B80077BE2F240186DA735AE60A6043A7 DARRON.SIANEZ
529,712,044 *362D8FFDE2E0AA6DA517D453067F90B7AF1FF3A1 ELLISREHL
529,712,045 *3622635107B270A2B731C121E3845216F90F0D24 DARRYL.PROUD
529,712,046 *362304F4341A52B6195119CC4DA44C1E96671529 elmobutchko
529,712,047 *362DE913A656D199D0D54516882B1FCC753A3FA4 ELOAI
529,712,048 *36201D0E2E71BA3A1CFE6F026AF4B3959822FEE5 David.Rothernberg
529,712,049 *3628B00EA398CA0013D06FBA66B70103EC7F8E1E DAVILAHALEY
529,712,050 *362C96FF828EC39C48F6988EA6E7847994915FF0 emanuellinnemann
529,712,051 *362C222B4E0A91168CB98AE17878C95E6082DB6E dazu)
529,712,052 *36230035842F7B0B47F49EE89566114FA17E7A9D ENDEARING34
529,712,053 *362070B88063B156377051ABEF4F18D8070B1893 ENFILADE
529,712,054 *362E2A5321417872257915FE1EF21166A13FB171 DEEPINTO8
529,712,055 *362099E62FC30D65CAAA904376A5EFFDBF64324B DEJTKVÄLLEN
529,712,056 *362BE2269F208BCB83B25A050EEA09AC4F509FEF dennisdarmiento
529,712,057 *362E35FD8AF3AD09ADD942BB019C68F01A22558B DEPARERSING
529,712,058 *362AE2E065965E07B0D865450723B3BAF9670044 dervish on the glory b
529,712,059 *362EE2315EAE0D844C26875C8818A44A370976BC DESHAWN.GARDUNIO
529,712,060 *36286F49664095CB4DB82A4D629AB32601343EB2 DESLINEARIZACIÓN
529,712,061 *3629140F221C0E196929BE514AADB5E39958209C DESREGRO1234
529,712,062 *3628A8811F413EBE43573674CAF9AB45A860485A ESILANI8
529,712,063 *3626856517FC17660803D7CDAE7F37877B88A5DF DEVINSCURCI
529,712,064 *3627D98E45CA7D648E0F2D0787F2600C81E10CC3 ESTEBANWYKLE
529,712,065 *3620495625534A551BD20890D3694E934406D310 ET&+
529,712,066 *3628A234544F231EEFD75A461D45D998214ED828 DGQW
529,712,067 *362F023D129A76A24615DBD6666CCEBEAB9ABB59 EVERY-BRILLIANT-EYE
529,712,068 *3621DB7E8BA85658A6AD673B9375230E1BA21520 DHNET
529,712,069 *362DD21A882A8F37FCD385C6CDCE602F6CC34EB6 di0#&
529,712,070 *362117706F06B934892C53EA2D09DC7A5283855C eyw71
529,712,071 *362CD3AADFD6AF400B343C49D9019C2C76E12337 ezeniers9
529,712,072 *362868364A0BE81A97C2341657ABF2E28665BB02 ezilabrevs
529,712,073 *3623FE713FCAFC3CBA90996036F7F1B5486A314A F0R3M4S7
529,712,074 *362BF86A3139722D8F0946866F58CC6C024CE265 FARMACCA7174
529,712,075 *362791BDBB7E05ED8C6D81F96C434029B2EF4D3B DILLONEVELAND
529,712,076 *362BAFBBF115486A015C37067BE1FA66FA641188 far.west.news.2
529,712,077 *3624246F4A90E29C22A9A8AF5B2E2BA82251D075 DINGBO[email protected]
529,712,078 *362FF4FD9D2261F78F836004E9FFBDDF41CD30EF [email protected]
529,712,079 *36278985606D294C4416F2790DB48970EA400A50 [email protected]
529,712,080 *3623BA04A769D0FB0F089D05F5011E14728F55DC dinner(feat.myradavies)
529,712,081 *362557324C13C109A3B0F0EFAC32E156C3EF9822 Disc02-Track06
529,712,082 *3628F05C913CF50F82378E09ABC10432CE7CF650 FELLOWCRAFT160160
529,712,083 *3625937BBE27E3719F18DA8222A41F251CAF2E73 FELTON.SABINS
529,712,084 *362728223DB879A226F7229DC4E3CBDB1F02390F DK$/
529,712,085 *3622426D291B8356068957DD43DC47B233C4CEC4 fernandoguzy
529,712,086 *3621878A7C7437F61733FA6771EB295EDB5DD60C fernandokhazaleh
529,712,087 *36236CC03F7AF27AD99AD2F781719E22EC663C7B dksdg
529,712,088 *3624CC4A50AAE9058ED1E6243F6CEDBD18548AD4 fiertes9
529,712,089 *362D323E4AF087F90C73AC7660A8ADD7BF21FF1B D-mO
529,712,090 *3627005336D05704EA698EE5C7D6571411C3B26E DNX;
529,712,091 *3620FAE0C42E4846AD29ED94D8E0AF847BE95D96 fractionators0
529,712,092 *362D7C6D1474E36BD79025C1FC6253F6BC1FB884 DONOVANHILTZ
529,712,093 *362B81B5901CF45AA8D8361E2FD35CBEF34891CA Don'tBreaktheSilence(featVirginiaAstley)
529,712,094 *362F2D6E51CB374F40884E1950C1F0361E1B55FC FREEMANSMIHT
529,712,095 *362453D7A29C569B6555145EC13CE807F098A548 DOYLE.SKIBISKY
529,712,096 *3628B16382AFEDB6125F9BE10FB28F585C20F85B dp1sm
529,712,097 *362CEF123D0244971A357C117ED3023AA6C1A72F [email protected]
529,712,098 *362AD72DB7407A845AAA3ED1929513AE280C2691 DPH4
529,712,099 *362C94D87496572CF20B1F08A3C4A8A3615689AA GAH
529,712,100 *3629963719DA0932283BC03386BFD0DB2A19189A drover
529,712,101 *362BF84A34012871E18F24B9044D0CA815F8ABD0 GARRYHUELSKAMP
529,712,102 *3620742BD2422E960ABCA63CC3D96002C39E498B dry9h
529,712,103 *3622FF2E1BBD75637514E67FBA434095CEC2B10E D)s
529,712,104 *3625C406F21B6D59F4BB5635F511638DF800DF6E [email protected]
529,712,105 *362D87E14FADBB4DB613427F9B2B09E1194B8BD7 GEMENEZAAKMAKER
529,712,106 *3626B393194F60035352D464F8DCA8F83A3B15EA genentic0
529,712,107 *3623FD649772DFC78096694A6FDA149A69F27577 GERALDOTROTOCHAUD
529,712,108 *362BB6FF99102509B4F50F768252F7AF41C12FA4 GERARDOMOUN
529,712,109 *3628BB18796A5FAB3A2B0B35B36DDA2DB0A64DE0 DUDLEYGARRAGHTY
529,712,110 *362AE4ACDA102A7A5B16A27F0918E61D5B803D35 [email protected]
529,712,111 *3620A296618AE4D52A70E4B753A598EC1309C868 d"v0q
529,712,112 *362DF2296F15522170E7EF6C8F8A4BAFA761A794 DWAYNE.MANTE
529,712,113 *362589AD8CD227DAA18A41E5BA0BD03ED13489BB D,WB
529,712,114 *362A3C9A36D4CE3A6EDA5E2F0D48522EFC7B8005 dygh1911
529,712,115 *362208ADBE74D8F223792CD7991A7AD976CCCD1A [email protected]
529,712,116 *362CA1F01ED8A6E0961C7D8BBF13E5CF9762A9D5 Gotta.Get.Thru.This.(Mandy.dub.mix)
529,712,117 *36262201D6FAF7A1ECB3D390813E459F6764E836 EAISB
529,712,118 *36270F6BDA6D72067E2AC326960A6CFC398643CA GROVELED
529,712,119 *362A350C7BE064405C89AC1C337FA32FAA6CE8C2 edmondswilley
529,712,120 *362648F0EF291D949C098563A75E0B8B86824430 GTE.RUH!.BELIEBETE.SEELENLUST!":.I..ARIA."VERGN
529,712,121 *362FC5CB1B150BF677406285969CFD765DB22BDF EDMUNDOMERTES
529,712,122 *362C3990BA4F28310C8C0F2F52BF46B636FC7DBF GUCNUTA7
529,712,123 *36218F60A12913E544673538E12ED604411AD5D3 ee:fo
529,712,124 *362B4E7AE36C02B9A02B0BA6604E5ACC9ED53E87 EFO
529,712,125 *3626EE89DA96622404BE468F577615BE0B0A3984 efuhh
529,712,126 *36263DA6F1FDB47FD5523513CFBE77ED427C02FE EHRNSPERGER
529,712,127 *362225A7944764ED95927521EA921D358906883C [email protected]
529,712,128 *362F2FFEE514072795C165A15C6C342556BB4A77 EiWenbbs
529,712,129 *362B97273271E9B4F688D180E8E0BFE89934E1B1 HADEEL JARRAR
529,712,130 *3621D7C1B032C036E7BA53034B1DC35F82712AE6 [email protected]
529,712,131 *362317C67FBACF33FBF2023D199966991E7DCD9D hakim.sharif
529,712,132 *3623D5C396AD712368C833F4FD31521CC2D1D6E4 [email protected]
529,712,133 *36212A6532EBAB0E77DC2204A4B5BC2D08B0A110 elishaserrant
529,712,134 *36283606AF553CADCEDE50D32AA32CE5B7999399 ELLIOT.SEATE
529,712,135 *3625C0CEC886A19FF3390EC865041842EEDCC973 HAROLDMARCONI
529,712,136 *362775B27BDD34D383FF304DF211C0529452A3F4 HARVEY.ORRICK
529,712,137 *362C07AC8B0104D2F47CEB1C8F7B0A646B31900E ELROYSIECZKA
529,712,138 *36282E07702D4BD1F3C9C73AE1BF5096D407104C HAVE YOU EVER WONDERED
529,712,139 *3621525183F21FF7C526238176209FD2C7391155 HAZIM JOHAN
529,712,140 *362302EED8673C7F0EA29A148E5477911A49E5A3 #HAZZARD*AUA#RPH
529,712,141 *362320C8D44BA2037FCAAAE9DF0DB9D7595E85E6 heliloojata
529,712,142 *362359D554B79CBBDAB8BCC83D452A7D928D4ADE eo/9!
529,712,143 *36201F39A272D62D2863AE58BA8041BC86C14B6C EOCPBSW5
529,712,144 *3623A604356E905453D9E1991CD4ACC67BBC6E55 HIPOKRYTÓW
529,712,145 *362CF1846DE05B9AC5B0C17AA96020F39CBBBA17 EQ;WC
529,712,146 *3624F0246863702580CD41D497AF531EAA11291E ERECTORS
529,712,147 *3621FE0A67E220A8B48830757153413945987454 ho
529,712,148 *362051D9657420203D3A2B49DABD3D8AD35B28F6 ERROLBOLL
529,712,149 *36273B565C07F95F31F91D871428FF19AC273476 ERSHEIKA
529,712,150 *362917414107A892242FD79231B1C457E0F91C64 horisontboogie
529,712,151 *362F4B41F9E38E98D61C93E59AFB2B6003DD8D08 ESPLANADE
529,712,152 *362C3E7E9D7247AFF3356386CD4DBB0A4E4E1ADB estiatoring
529,712,153 *362F2B5CABC157BC8D359DB9812FE518D0A190C4 etethcab3
529,712,154 *362B8636A9A82CB6E68F2491DDF1D25EF6CE5715 ethandeserres
529,712,155 *36226F1AD2F36BA8FEC0EFA3EB5AC5ED8CE4DF87 ethanmoleküls
529,712,156 *36245FB1700635FC4A65A26A41D29FF6C145FC08 EUTAENIA8
529,712,157 *3621BECFCEB2B3E4D4CFBD390AF4803CAD477CA2 evelopered
529,712,158 *362668A4295C38537608A87C238E85222B669B63 everetteafshari
529,712,159 *362554229A9EFAF15B3FA457D91703BBFC23EBDA EVERYTHINGILOVE(FEAT.NAS&CEE-LO)
529,712,160 *362EF87E9D1094195F5B109146FA8DAC9FA7D33B [email protected]
529,712,161 *36268F8C958E4DC772CB0256573F4A3ECF7472F4 eyi+_
529,712,162 *362B01A48E0ED80A5771F53595A52C1F6CBE9533 eyy.q
529,712,163 *362BA5C8AE18CAFD419ACAB51AE3952472185970 F+1Q
529,712,164 *3628AA41D377FFCB696843B0DB866DC2A40780CE [email protected]
529,712,165 *3628A7AE38C6B7613E8A753091ABE254DFE7326F ieramouj3
529,712,166 *3624B071D12F3A5A620AD9AC363A5A7A9AD5210E FAUSTONICKELSTON
529,712,167 *362DF77A8427082A1817CDE0F30A399D7A1E1BF2 fauzi-mohd
529,712,168 *362A64774137B38EB3DA0C6CB57E1212D137D0F2 FBAIYAT
529,712,169 *3628A3DD4B558FC16DEA9FB7C2EDE0EE9D7E7214 [email protected]
529,712,170 *36247471847EED00FB02011C2DD1F7C14C8F72D6 feather-weight
529,712,171 *3627C964EA722C8D9EB523C69B8AD0FAB06CFBE4 ilove2stop
529,712,172 *362500BA05070057715FDC620B2B4A5738C2F301 ilovehunter32
529,712,173 *362FA07C54BDC12F0AD4340BB7172A665F9AC828 iltoppened
529,712,174 *3621D5D17C95168E795D1727168CED25AB46FE04 IMMEDIATE.COGNITION
529,712,175 *362EB1EA77A12093B22E135ED800E5A010EDC15A fleab!7e5
529,712,176 *3621ED3A9230A83B060EFC42673EBEA328E7F587 FLORENCIO.KLIPFEL
529,712,177 *3620A552174AE1CD7F6DD884A6585DF259283130 INCHOATUS3
529,712,178 *3623BFEDD2DAAD7C9279251620C493188733A9AB indra bisma mahesa (inbima), pt | indonesia
529,712,179 *362F54C512D6A416A1634AAF272D107133507393 FMARVAUX
529,712,180 *3626928F8071A584F2F0B6F00CAE02542B1789E5 [email protected]
529,712,181 *362794FE5DD45C66320DC0282C78D9C6974CAB8E [email protected]
529,712,182 *36287AE041BAA44444F7FF3B31ED870D56A067AF forbereds1
529,712,183 *3628B7A392024E18B80C312949E6978E74FA7CDB INSTEPS
529,712,184 *3623E1AE2D2520539FBA0AC5390EA04AE7F74243 FRANKVITTORIA
529,712,185 *36265B7388BF2378EFEA27B2ED707DCF6DBB7BD6 FREDDY.MILNOR
529,712,186 *362FB351574C008D7F61F94AB5BD2049C00EB699 ISIAHWILLER
529,712,187 *3628B0C75FC7FEEB8E5CFE2B3A09EC0D2D977689 FRNCPHL6
529,712,188 *36255CCDB4D84243C7DB90246BD416D042FF0F51 ITSAINTJEANLECOMT
529,712,189 *36242FFE1BEAB3097749DDEDD8F51829213ABF93 F+VD
529,712,190 *3621EE7449663B86C86786E642C6EA7936347E88 !gaaa
529,712,191 *36215C4F08B75D256A3781DCF7130BAEA20AC464 [email protected]
529,712,192 *3626A3F12D63B435A67CD7136B3865BE338A058C GARRETT.LORBER
529,712,193 *362FCB0D8BB25D54EDE500972B1C81C6185B8A43 jail.steamhammer
529,712,194 *362648FAB108DA8334B90D2153497C4357799152 jakaria-manik
529,712,195 *362CAFA5689C1E6DBE090FA98F6102F57C35AB2D GASTONQUEENAN
529,712,196 *362E0CAEFAC9DB5B791783F1C3062BC1B17900D3 GCNCRTSRDING
529,712,197 *3625BDEB94E705A21931CAABE5952F9A52899E1F GEDRUIPSTAART9
529,712,198 *362AA95B0FD681D5FC1BAF86BB8D41835B884827 JARADMILLER
529,712,199 *3624C6126221687690BA9ED4CD8C0E0B48947E98 jarrodcichy
529,712,200 *36280EF9C345E0E205B2AD9963F6350BC20CB8BB JAVIERROLA
529,712,201 *3626F8C1322AD3D893C1B15FF6542DF94243DF5D JBRAD123
529,712,202 *362F3BA135046287B2E3820B47DA1EFFA69D891D GILBONGE
529,712,203 *36268009255A3269797E1A705472A0F4CBA07502 givechase(featalexandereast)(originalmix)
529,712,204 *3624A9917230D392F5DD355471F78A8CD18C5258 jenna-marie-casey
529,712,205 *36226E9499938538717BDB17844E9A9A6EFC76FE GL2>
529,712,206 *362073B4F6AA30CA1108C49B813EE25B5F60C077 GNARLS-BARKLEY-ARE-ITHE-ODD-COUPLEI-ON-NEW-LP
529,712,207 *36236B6ABF346E33CE711EA0B63AB9D5468E7207 jerry-nibarger
529,712,208 *3626FBDB1F68EC9CF6E78F144E95E6A2C24D7C99 JERRY_VINES
529,712,209 *362827D214A51D6C3D84782504B8AFFAD38CD3CD JESSICA N ROBBY
529,712,210 *362DA6EFB7A50E465F7B32D3A0B956E96A253182 goldenabc3
529,712,211 *362C73FC6DC06EC82DF618BF85F28BA53FDE4DB1 JFLORDILES
529,712,212 *3621F40368192785FA23275CDD34CBA075682D10 ji
529,712,213 *36228DFC1AD14F75D5D19E75908FEBA60C9CD951 [email protected]
529,712,214 *362D9E0D4130B0871B188132E0EE531C05404344 joanraasch
529,712,215 *36261484863E5374F529AAFECEE6F06CEBE75EDE [email protected]
529,712,216 *3622A555D363926B74DF4DDA16116B12F6845F0F GREGORYKANT
529,712,217 *362E67A342B5D3320AEACBFBAE7AA86D1FD996E1 gstar62
529,712,218 *362C3F581AEE9C34F22D58EF5C84F4C3835E0B08 JOHN TWOHY
529,712,219 *3624AB382686B3D3268ED2F99E8369D8C407B4BE [email protected]
529,712,220 *36276166B8511A070B30748181BE98161FBA3B9E gurnee
529,712,221 *362E6FAFB3BB4EB772D2BC1A9E2F9B6DBD82C3A2 haeo
529,712,222 *3626C90BB0898F67B580D27660BE41758F01BEAD HARLAND.GARCIA
529,712,223 *3624601DEB1EF1834B1A63770C4B341BFB9E2812 [email protected]
529,712,224 *36223925D8EBF5E6FE27249C19A3045541565BF8 JUSTIN.PIECH
529,712,225 *3625837445CB70ADCB586455A364B1A380665CCD harveymandelshangrenade
529,712,226 *36285361DB77BD67C561A2095FA7908E0C96E0E7 HASYIM-ASYARI
529,712,227 *36244A8A67992AA24DA606E4B30B5ADA0214158E haushohe
529,712,228 *362EBAF8E1494EC125162FE82AF9FAA955C71C3E HAYOBSW4
529,712,229 *36220DA19E118052749ED7F4B4050BF079CF6A59 [email protected]
529,712,230 *36282ABB22A50C9E8242C586F4457C0231B2E5B2 KAHMILER
529,712,231 *3626B494E07E3B704554CE510E7DCE1AF07288AD [email protected]
529,712,232 *362D9BC0A5AC21C6AC0BA4E89967A645E8753601 HEATHERHOGGE
529,712,233 *362A70B0939D005B6650FD29FEBDD4D594C83664 heidi-stein
529,712,234 *362E92E7DD53680856CAFF8B357279587FC1A6F4 karamnour
529,712,235 *36274C2A2793795CE5B31EC9A7500CD4DE532FC3 KAUFENDE0
529,712,236 *362D3263CEAE7108E93D21073F11D0C8FEFA6F29 keenanlevick
529,712,237 *3628A6B9B8358FAEBD6A7A0F56225B12DBAC7720 Kein.Requiem.f
529,712,238 *3629788DA55E13540C794B0048A8B1F8BB19E0B5 HIGASHIBEPPU
529,712,239 *36274C1EEB70992B087A8D1F62E6DDE52A46EF71 hippocampine
529,712,240 *362C9F8043B2B00060DD113DE466913251221867 ho
529,712,241 *362B4397A9A9C98E6AA9D6D11A02F5A7922C562C KERRYFROESE
529,712,242 *3623322391A244DAA36D30071B25F471426E5BEF [email protected]
529,712,243 *362E4EADBBBFE80A2ECF5063E1F294613166F953 horacioquant
529,712,244 *362CBFD7EEADFAC86FF8509617D48659FF696318 HORAPROGRAMADETV
529,712,245 *36271C7F9B6558292CAA3E1D9B90F550C259011A KIETHFONVILLE
529,712,246 *362F9CA048894D3FE7988B2F5BFF95F9E2582FAE KIMI9575
529,712,247 *362724C3BDFB084555C4ADA1C65FE8E2BA45D64B KINGPO
529,712,248 *3628044A16BE49C97493158309991A07935AFF35 H.R.GeigerCounter
529,712,249 *3625351F9FCFACB151B9E1A101E85A20EC7C0FA8 KNARDS88
529,712,250 *36272AC47EA6998B6A3C117A32E7C220B7236FE5 koans
529,712,251 *362A1F7050D428AA16AF3D6898FA040CAE8F7807 I138694
529,712,252 *3622D51C083EAF5CAB2BE542837BEEDDA69C7C40 kraufelt
529,712,253 *362D821332553C86A163E886690A59B1E47217A2 IAMCOCACOLA65
529,712,254 *3629781B548E38FF82D71163B8342A837CB46252 IAMESCORT3
529,712,255 *36245B5B202EEFCE7452915CC9F9310A7806069D IAMMONOPOLY38
529,712,256 *362EAD481977012E36F03BD042334A782771A10C IBADLO
529,712,257 *36277FE4F68003D718A85792977635CD13091F25 [email protected]
529,712,258 *3621F21AA2EAFB1A4B23BAF6AE732BFE655C5757 I!DL
529,712,259 *36226C6EF54310CCBAFE80C6FFFCB90D31A39958 LAADBAKKEN8
529,712,260 *3622C321C9557B64BD246C34404E81FDFD92B8F1 ILOVEBRADLEY8
529,712,261 *362D6CC4AC86B179E4F02FC4365D3187337E561F LAN BOTAK
529,712,262 *3624BAD8DD2B9C5265B49B60E8275DC7F15D568F LANCEMACDOUGAL
529,712,263 *362044B1E5039ED006CF18A4DB7829605905427E laneway5
529,712,264 *362CD6E8F483A1EB8C207A719F6BBAF62BF3F884 IMPARTS
529,712,265 *3621DC782B92D205C45316086EDEE392EE9700F0 INDARAVIJAYA
529,712,266 *362C3BB61B67F1DDE6E872F5EB2FBC79809AEB0C industriekalke
529,712,267 *362F7A230FEA24365DD55F846D4A2DB4817FBA13 LBOLOCON
529,712,268 *362C20729D473F57327D43572DF09D1BAA8FE6E3 LD.AAA
529,712,269 *3621C1FF93C6A507EBBB206C801665CA6A5A9E8D INSTEPS
529,712,270 *36204FD9453299484C85E0A358E6D36C206AC30A LEGITIMACION-DE-CAPITALES
529,712,271 *36253AA4C86CE9999F84282BEB6A2AFFC321580B interviendrons1
529,712,272 *362698A0D7B8301CBE04DF9D04206FD73732535C LEIGHMCWELLS
529,712,273 *3627184604CEC9C137F2F54352ED747CF2917A28 LE KIEN
529,712,274 *362248E276A9716469BF8D2A10D76A6534112299 LEOPOLDO.COMLY
529,712,275 *36243DCB94811A98CD64DEB33E0497F781CDB2DE isaiasmcglocklin
529,712,276 *36250828C69CF01AB67B8C1B5F66EE58D03AA160 LESLEYREICHMANN
529,712,277 *3625CD03195FDE30E5694D31B84D70D35DCA1538 ISAIASSUNDAY
529,712,278 *362CBA300F9F90CCA4B2181E2025728F72127D31 LESTER.C
529,712,279 *3621B84E43436B14789ECD3F3DFF4F0180D1CD86 ISKR
529,712,280 *3626EC29919606F6D18E10F6B3996B488C0F3FCC ISTJEKE
529,712,281 *36278517A2BDE6C74DF8F2F21DB423D6A437458E LHEGAZZY
529,712,282 *36294E69C4367D9018C6BDD4D140F52C262E2749 [email protected]
529,712,283 *3627909499731EDC8832C9E09B934282CB80BA03 [email protected]
529,712,284 *362FF2B938D2456AD27CB9AAC264E528C46DCFE6 iu(%
529,712,285 *36274B1517E28F49A2FD8332B3ABEBCE171370F6 IV0RY-PAL
529,712,286 *3627AC47847B3C33A2DA52FF86D40C70C8C9B4ED iv3b
529,712,287 *3623E4DA8AABE0A33BEEBB80F4F90B773F45CAA1 [email protected]
529,712,288 *362987422A3F1FDB4AFB2E240F882190BE742B90 jacintogamby
529,712,289 *362F62014BB76641762A91541E526218E2A232F3 JACKIE.DEW
529,712,290 *3627F9FE7DDE5B8262C0A461780B5D3D6D9944A3 jacoblacasa
529,712,291 *362C6C441ACD561DF90C5A5336D422742541345D JAIME.KULJU
529,712,292 *362C50A18024BB0911297736D118492696C47A51 [email protected]
529,712,293 *3620D1BDFB077BB3BAC1C07CD3F128EE9E88DF1C lisa.cecchin
529,712,294 *3624E8E3E0E3A223BFC6E362DF373D259EFBC60F LĪVENS
529,712,295 *3625E9C6F4DB5E05A1ECF2D47EDDEDDFF6369686 JARRODJELINSKI
529,712,296 *362F73FFAAA62EEF6EBED189BA4BDB7E406F7C94 (JASDAQ・2705)【定食店「大戸屋ごはん処」】
529,712,297 *362D27D12E96085786E8829B96E4CD6683F2336D JASPER.JEMINEZ
529,712,298 *362D0E96954C3677CE27DD544AB42A81D7AEE133 jasperrains
529,712,299 *362F2B9783B2A4A665F9C0AB3BD6B905217626DF [email protected]
529,712,300 *362E51467E962530A5337EEE99A3076785FAD61F LOOK.A.LITTLE.HIGHER
529,712,301 *362746BBEBA9E3C62D269D22B2B5697CA2BE6B14 jeffreygerling
529,712,302 *362E8429737DF689C9161588DA063ED72460D23C jeffrygilpin
529,712,303 *362DF949F5FEC6121864D19C05F86BBA049919F7 JÉGASZALÁSRA
529,712,304 *362CB31A20484F52537E4681DBE490B4B2D3AD07 LOUIE.FELIU
529,712,305 *362BC85646D7D8BA78E04B9F9C803DD23899E149 jeremhieaguilar
529,712,306 *362A1A11B5D4A9158AFA8FC43796506EB1A92532 JESSEBUCKHAM
529,712,307 *362DFAD108A008417373D45F8AADACFC0CB536C5 JESSEDEMBOSKY
529,712,308 *36201CFA2CF89F78B5F42D148C67FCD50BDD534A JESUSHECKERT
529,712,309 *3623DE18D12AA5B7802D0521B27B22A361BBFD08 JESUSMARSIGLIA
529,712,310 *3627659598DD2B4C9D4B7E9E8197F5D122150FA6 LUIGIKISTLE
529,712,311 *3624C1A8764C9A0B82345EB4549B0F59D8D4A99F [email protected]
529,712,312 *3627D1FFDA1965E3CBEFA2DD8065061BAD168C7B luispalomar
529,712,313 *36299737F18F7FCFBB79634050638D31997EECB9 lukaspassion,swv480:weissage,werist,derdichschlug?
529,712,314 *362D1417CC0DF9A7F9BB6731B53C2934C0ABB5BC lutherklamn
529,712,315 *362390ED359B739DA1B19B4386CA0420675F3846 JIMMY.CIANCIO
529,712,316 *362EF2BD114A32CE56E3249825A20193D51B1F1D LYLE.STONE
529,712,317 *3624D56A1F0D2981AE69B50293732DDF79573EE9 LZZ
529,712,318 *362F6E6C231EF2CD9253C3AD7F236CD619A219B5 M4MI4S
529,712,319 *362CDC89593A9584D56697396937DDFECE5693AD [email protected]
529,712,320 *362A3C49A8E80E27851583FF96448709B630BE0E [email protected]
529,712,321 *362ED381B6A48293CFF52A1896E78692528ACFFC john-halderman
529,712,322 *362B185BE2EDB52F3DC2053CF80007E6370C3BF7 MAKROVALODĀS
529,712,323 *3625B00E9351F54EA05F7C48442DAED71AD5F287 JOHN.PENNACHIO
529,712,324 *3627107F8C6006C9D5CA5563C6F2B872431B7B06 johnson—were
529,712,325 *362210D8226E3294F5CB6939572895AE2172042B manny-debono
529,712,326 *3626FEB044B0D7D567C10725E2D6B0F5AEC5C3A7 manuelramcharran
529,712,327 *362F7890BDA172BB9C59CB7C724D5D4AE91FBC49 marcoscarrubba
529,712,328 *362C5E56CE4662DF283EB9EA18FAF7E72E69B85E JOSHUARYKEN
529,712,329 *3628FBE15BA2730615D401A85CA90CCB176114C2 mariafe
529,712,330 *362DABA2A56808E40BD3C7E3FC928B18284A6DC5 JOSUE.RONK
529,712,331 *362F9031C0FACF4ECB2EA32CB17EC957B7769545 J`S
529,712,332 *362CA1C5DFBF5383E23A9A2F74DFFE425A2AE53C MARTIN.'M/A/RT/I/N
529,712,333 *362A2B5F93F96A4B06A3493C42E158D01A31B724 MARTYHANSBURY
529,712,334 *362ADCDD2744AB2E24230F4006CA7E424ABFD23C MARVINEAGLE
529,712,335 *36207FE0E2B4B74BD33D17448FD4AA4C27C0BAB0 MATTBRISBOIS
529,712,336 *3621F8BAB23FC7299003F950E0F358CFA604C0E6 MATTHEW-BARTEK
529,712,337 *36273B224E87C6816404E108BAEB2515220BD826 MAUREEN.KRATZER
529,712,338 *3627FE3D65437AF53D62042C37221F75848E7283 [email protected]
529,712,339 *36214E65D1740B4B686382D7B3E5D88D262CAE55 MDEVAULT9
529,712,340 *362EC0C8D3CF8AF0CAFF344DB1C0FDC862F8E4F1 KAZAF TSANG
529,712,341 *362740C2325BB0C862DFACD2E677237CFCDA1EB1 [email protected]
529,712,342 *3621819D2D3529AC0DB3551AA7B25FC806F7CEB0 KEITHMONTANO
529,712,343 *3626D66E27AD77DB01265C5E4DA913FC5644AB26 MENEKSE123
529,712,344 *3620E350ECFB8DFCE0C95DDB367243DAABC4BC3A KENT.BROGAN
529,712,345 *3629EF047829B1D1C8BCDEB64D2B0C70A616B93C MERLIN.ROCKINGHAM
529,712,346 *36289D2C88AC2B883FE8711547E5DB3981E195A1 MERVINBRULEY
529,712,347 *36229F49A672119E538F8E1EF97AA823ECF305F1 KEVEN.OPIELA
529,712,348 *362037B1D1CCC755555A76F770EB496E77FCDC97 METHUSELAH.MOUSE
529,712,349 *362BDB83562FD22A5A3BC7D8F8BD087F308F54FF keybaord9
529,712,350 *36214C4AE4C8D8653AA5440BD305A3D540D55F2D KIRKFISH
529,712,351 *3626CFDEAFE12F155D8BD148B62663DC114E6263 kirmastu
529,712,352 *362AD3842F6EABC56001E094F64ED1B03441BE91 kledigan159
529,712,353 *36206EE2AC7A039F4F18056F234C9EFF45344E15 MILAN.AMRICH
529,712,354 *362825703A85C772227311D5768E41EF7B5E103F KOFI.BROWN
529,712,355 *3621567D9767967E65E85A2A17AD79D40EA7B405 konfirmandenanzug
529,712,356 *3625CFD166913EF46AAF7E9E7221FF85FB1715E9 MITCHELTURCK
529,712,357 *3629210F026AA28D94E025855411EC768F09172A MITTELSORTE
529,712,358 *36220DCE7FE33BE5F3286F763196328252971AD9 [email protected]
529,712,359 *36244EBBA3E98076CB80872FE24980D98895F3AB kullervo-/-symphony-no.-2-/-comedy-overture
529,712,360 *362C5D205E1DFC554DA6968066AEAFF83D1F4829 KURIOSITÄTENSCHAUEN
529,712,361 *362196D388937C9A4A83702E1AFE9FDC1C4CE017 MOHAMEDABDELGAFAR
529,712,362 *3620AFF7A384286C87328AB1669B697AE522F91B [email protected]
529,712,363 *362F8D675AE22BD038D5FC9533EC37DBBCECD8DC MONOTRIGLYPHIC123
529,712,364 *362066B1818CA316B8F2734CCDB5B8452D3DD2F4 MONTANAWISE
529,712,365 *362C818E4E96BBA49E41B9CBD6C38D111A954011 MONTECUE
529,712,366 *362115A9EDC4680591D316A275899E7E4A040ADC LAIDDOWN2
529,712,367 *362B31747F897CB294146DA921D3827FE4C144DA MORTONBILLINGTON
529,712,368 *362202A9CCB1FA47B14B20EA805DED6F8EACC45E LANEGRALEONOR
529,712,369 *3627CFC87A951FA445BBE340493E00708001863D Mrspit
529,712,370 *362C4830C085E0CE41681C5D4BE3B01A6C79F3B7 MUHAMMED.XIII
529,712,371 *3628649C2355569030645DF60F94E199A9D6FD8D multiple encryption comm acm 27(4): 465
529,712,372 *36234F23ACBDC1D4EE16B2BDDA786F6D39144527 MUNIBA 1
529,712,373 *362D5EB53A29E6B2265BA19E40517D9F9E6B6EDC MYHERSHEY98
529,712,374 *3629E21120366BF991F4725BB0D2BBA2E2872517 MYROBERT65
529,712,375 *362FF9D4F3B4DA6629D7094944BF1AF03475CDA7 leighsticklen
529,712,376 *362F651BD90C5D0B354222E144B4C7322AAA9A13 LEISTUNGSBE
529,712,377 *362042ABC1C0D97BFFFDC034E21FF390260C7524 LENMASTRONARDI
529,712,378 *362617BAA04928F071AE77B6A978E78A79EAB642 leonardthoresen
529,712,379 *362E16E651F40B58527CD826AA50170E6CAE3F37 NADINEHOWLETT
529,712,380 *3629B8B13703CFFE6AA050367042DFC57788A9E1 LEONELKANTROWITZ
529,712,381 *3623B1E71AAFABFDBD6918342EE869F632F30001 NAGUSIATIK
529,712,382 *3626F37DF89E1C1D79F23401D19D0EB11E5ED395 NALUMONP
529,712,383 *362B0FA8FB7DF242470EB0117E9B29FDC9F94A66 NATHANAELDICKE
529,712,384 *3629F92E63AC9E001CCDCF4163DFBEEDAD9FEEA4 LGBTTOPICS
529,712,385 *362089EF9E345BD6426393304C6B9806BD0CF63D NCULP4+3S
529,712,386 *36293021B86917CD97842EB3015FC811BF01FB1A [email protected]
529,712,387 *3625099FBDF472B3E6F1F184A6F4F5D2E2873623 NEILROERS
529,712,388 *362654B558F957CB310225AB98A672B18E92F838 LINDSAYLAUMEA
529,712,389 *3621C4ECA080B9AFAF54886954A3EE69A115A6FB linosuffern
529,712,390 *36221C309455D35631BA3DC5E32F5BCEA2E22405 NET1ISTE
529,712,391 *362D0702F6AD77748E2C1E36FA38F7FC4E7EACB0 LiquidGel
529,712,392 *36211DF501FFBC534F9318AB0AA612166F4D6097 NFELICI
529,712,393 *36276980A400C4991E68FDDD4E7D108D3680D0F0 NGHONCHI
529,712,394 *3621EECB308453F9F36075B7210D2063A0823B41 LLACKNARC
529,712,395 *362C08536F2D86C106FD49922EB1BF29C935C16E LLOYD.FEAZELL
529,712,396 *362D53CEAB7AA9C8D345977E32A74DB83B378940 LOFSUNGIÐ
529,712,397 *362B45901B9406BB44550A4E46D88322CBB829E9 Night.Gasp
529,712,398 *362E89E9A067D0D1896167E047F33434E58F1554 longevity-secrets
529,712,399 *362BAB5E0A2D3B2135F522B53F5B8E126BC9DD5A NIRVANA1994
529,712,400 *36266F9B08DB97626327C5223F694BC3DC03D5CB NMZUMOPZM
529,712,401 *362011B32F477D431BC0686073418B3EA804DCEA «NOBELAS»
529,712,402 *362E924048A1260BF2E53424F91B38EA2DEB6FD2 LOWER-DRYAD-MUSIC
529,712,403 *362C7434EC27515FF30A97AD32DC7A6F9C48497D LSBG
529,712,404 *362E1EFFA646D3D7A2A39DD938544926C635A9CC NON3+HICALN3$$
529,712,405 *36278B51FAFB77329538366948BC25E726349AA5 nonglobular
529,712,406 *3624A3B3A724C77368817974F346F83AF00E6B04 luigishindel
529,712,407 *362BE1AD569A93770F250606031A59EAD3699F7D NORMAN.BARTHLOW
529,712,408 *3626E83379E04D77556EA2956F8645790E079681 NORMAND.BEATO
529,712,409 *36215ABA4254C25B7AE667B6495AA3250AC4B92F [email protected]
529,712,410 *36203F7AAB6A1F02F35E6260A6510B61A2685D59 NORRISMETTE
529,712,411 *362B76408E196925D8924166B4D893F192325A74 NORY
529,712,412 *3626F98E84658C784F663DC0473BCA198806F27A nothing.without.me
529,712,413 *36271764F207663DA584493AA5EB8DA3642AA83C novianawijayanti
529,712,414 *362011C5097F309A21829AFE53A35E7EC3C92BEB lynncardani
529,712,415 *362C76A5B18C02340C930D8B1527F7F4E6795B44 MACHIKO24
529,712,416 *362F7B13D2076C75B373A9657B8B9631DCF0A46C O+BJ
529,712,417 *3620F68A284D2F29F6666A2BBEAF0BC039B37E7F octaviogrizzard
529,712,418 *3620F607653D4593C71963B728677B6F2B2B2DCC Make-Me-Happy-(Demo)
529,712,419 *3621CB68BA41367E6EADCF04E32668A1DF3B3E19 MALIKMINKINS
529,712,420 *362CA5CE6A52AAC58C6DA4EB6C8C177B55E64076 OK3?>
529,712,421 *362E8966BDA81BFD4ADBE05D0302455DC89F33C3 MANTRAS & NAMES REMIX V (PART 2)
529,712,422 *362D5321F72838DF415B3E8C64BFF028B71C3840 „oknie
529,712,423 *36222856C3013A6CC275919872F67FEFAACB885D MARCOS.UNRATH
529,712,424 *3625CD8994870403E405AA497BCB3AA598F94A95 ommadnos
529,712,425 *362FAE7D40120488EC29716F6E21F429BA9BCACD MARK709
529,712,426 *362CE1BBF2D26C4F22D5CB1E7CBD54E89264CA78 }o{o~-0~-(======p
529,712,427 *3628E89F73AD6BCC7B1AAFED48285AEF896D05A8 OPFYLDT
529,712,428 *3626E704654D6F45BDA3566037D64A457B54FA95 marvinkats
529,712,429 *36252AA01BE4553F8430AFD1264FE35EE9B51325 mary-lou-ford
529,712,430 *362FD36B3E4DE3D0DC1C06A5786DF9AA01C26E84 ORRW
529,712,431 *36243C4AA8FA14F8FFFE237F3AFD681E72AED7F6 OSVALDO.HAGGARTY
529,712,432 *362405933E97708C00D08BDBD2737A0BAE5E9301 OTIS.BUTTREY
529,712,433 *3622224B22A200BF655349F0DB56189C409E4CBB OTPUSTIMED
529,712,434 *362FFBEBD87D9E79AD49CF93D8886DC70CB2A367 MAYKOWSKYJ
529,712,435 *3625CDDAF9128255E90AF7D80167142A8FC760D1 mc_arthur
529,712,436 *36280E2F7542A5E4639FFC402513B62B2FE638BE MEDEVKINE
529,712,437 *36213A6B56AD23CF3ABE66EA69E5605B32010E7C oxydiscites
529,712,438 *36228FFEB3AC5DC092570B45247C094767597FC2 MEIANOITE
529,712,439 *36288E7E5CEC0E118F0D7F615C72A4F6EA0A386B PABLOSUEN
529,712,440 *362EA365D705E1C4E9BB9A77E531DDF68AFEC578 pacificcurlscomwww
529,712,441 *362F611C146B3A1C4D5ABBF7EAD786EDD66607B2 pairsie0
529,712,442 *3629E00FD3698F89C1DBA35C966E46659E9D828C PANTERRAEU1
529,712,443 *3621714A2BA72F5F16E743DCAAF6CB46AB869420 MHENEINE
529,712,444 *3627FF3CD4F0980808FD340EC1AD28A8849F37D3 participaciones-de-clubes-panamenos-en-la-copa-interclubes-de-la-uncaf
529,712,445 *362A7DC946597C393A0EB29DD70E8DB9FB7EC5FE [email protected]
529,712,446 *362F59EC4041F8EFFD43944DB5F4921771AFD6B0 MILFORD.BANDULIN
529,712,447 *362C0807BC5442173D1412BB9A08AAB8FADABF4D PAWON12
529,712,448 *362E5A14A14AC78C81044A6B133DF3B0660369D5 PC<L
529,712,449 *3621768964954C1B0685E3BFCE03096873DB8F7B minton's.(alternative.take)
529,712,450 *362ABAB86D1E69E9B03BA072576A2DEDA6838366 PEER-GYNT-SUITE-NO-1,-OP-46:-IV-IN-DER-HALLE-DES-BERGSK
529,712,451 *362B44E82CF45F7637CAAD5CF584C3DFD2B79578 [email protected]
529,712,452 *3621B96617E4C9C84F2B653708E7C5C7ED53DD2B [email protected]$71Y
529,712,453 *3620D423E388CFA7C9FFE599A96D787510813702 PERDE.
529,712,454 *362E3ACC5D35D02B5983FD9AE1818456A5703734 PERSONAJES.DE.JES
529,712,455 *3625A8CD01F945757FAA50DF20DAFEE73EFEBD1B PETEDIVENTO
529,712,456 *362F36580861C364EAEC825DFBD413982D0CD1A9 MOISES699
529,712,457 *36240B42A9DE5C37D6FF0FF5065BC39ED37DBBB0 PETERAITCHISON
529,712,458 *36269D6C844A14F76E99CA649B7575345254EE15 petitedragon
529,712,459 *362AE48AFAC7ABD2B1D85899FC6C963D96BC8FCE PGM\N
529,712,460 *36227CFFAF5CDBEA8303C483081D201AFB5E217E PHANTOMISES.
529,712,461 *36204680179EB41C9EDFACAED203637104EB08E0 PHIL-THURLOW
529,712,462 *362FB1CA4CC41AC8BF2262CF2CE4540B276FB690 PHIRUNSON
529,712,463 *362DC21C6AF96CC4434A26BF4183360DF623E189 morleyův
529,712,464 *3625A7EB68BBBCCA7419FAFF30027BF8E2D364DD MOSESDEPREE
529,712,465 *36264FC31123BBF5E1419488A00A684D8ECB1EB5 MT%2
529,712,466 *3625451AD248895ADBE789D4F8D0D667C1468CD2 PLATOISIS
529,712,467 *36265E9540EB27CF721E142093A3E3B522235176 müncheberg–hasenfelde
529,712,468 *36214E7E0651C6C1651962C2B764B529D4B9B40C MYDREAMSBURN(THEGAMEVSRAMMSTEIN)
529,712,469 *362ACB63387DE7DC7C919E2F296B7B8BE26B7DC0 poltergeist-techno-legacy
529,712,470 *36201CF0BCD70A995E24E9D9120CE637EF8981CC myronprenger
529,712,471 *362EB09F6D82BB4F2FD268EBA41F95886720CD74 myunited78
529,712,472 *3620D7D5D0DB4032506DDD7CAB008DCFBD9D3349 POTCHAPA
529,712,473 *36272E23980A624E1E04E2A37995951C97864D51 NACHGESUCHT
529,712,474 *362FCFBB0044C2AE21278551DB86830D01B6BB6B NARAZNIK0
529,712,475 *362AF76DF209F51F71092F3B00BDC137720A7312 narrowingness8
529,712,476 *3622BB9B3FDF38D8B0AD4F8D45FD2B42458DC79A nathanielslabaugh
529,712,477 *3624D6B171A87B09B2E4EC0F6BA34D6871653920 PRERE91$+ERED
529,712,478 *362E75E65B811862FF1918FF525C6D440D5C5A09 NESTORORR
529,712,479 *3628124DAE24F3A97F160B7683F730B5286D03F5 neurobiologist0
529,712,480 *362EEE16EA966CED538A3D62F0DDB7AA68DAD5FE PUMP-AC
529,712,481 *362128D05F3F834C7DB788686354203C46CC98EF [email protected]
529,712,482 *3628E083376866C538C02471DDD1628ACC2174E2 pupipara.
529,712,483 *362374DEF233CC3C051A52C2C5D2E83F0E75E3A5 niemilosiernie
529,712,484 *362B2B1C2B466565FBF5164F8EE193A13DE220F8 niirian5
529,712,485 *362D42F27D7A4F9DCF6DC9DA6BC8399983D4189E NLNOISSEVILLE
529,712,486 *362BE43D7092D1CF7361D6C02AB7A02A5E699D41 NN80
529,712,487 *3628EE3EB6EB493AAC4BD49D1E879285C35369E8 NOBY30
529,712,488 *3627097909E10AB5EC605177A656EBD369098C6B q--p ~o~o splat!
529,712,489 *362EEB4D922F142E172508B44CC3B00593660ADF NOLAN.GAUDREAU
529,712,490 *3620A7F32F8A6EAF5D618A88E7F1947F44951013 QSAMAWADE
529,712,491 *362FE2050E1F1D5387774CC18D1C5B92D73061EA NOLANTABORN
529,712,492 *362025E467EFBCE5545A09F2DEF1CC5A29AAD442 QUEEN11NESS
529,712,493 *362B0B57395910F84D0F157898099EFF5B96ED01 quellenbecken
529,712,494 *362F50F16CC861B5C3A1DE3044F33460D9D7B743 noonehearsyouanymore
529,712,495 *3620CBDEA12E3F1295B492BAFA4E835317130F27 QUINCYFOUGNER
529,712,496 *362303D79598135FF6393791884CE6A9CBA628AF NORTONATLAS1962
529,712,497 *36286C6A41354411D68DE0D0D1B6BE253F36657D QW7211
529,712,498 *362D380FD87DC6EB95157C2F81B8AAB14AAD5515 R{*
529,712,499 *3626D130A7C14F10FF716D19CCA2C478FD2D63AA [email protected]@l
529,712,500 *362E435D76BBC87269DA30432F5F26822A3F817F R3P+LANS
529,712,501 *36236E84693427CAE526CF8D697A9E300B0218C8 [email protected]
529,712,502 *362A8320B6AA95760C238A62820F8AB62E792F05 nrnrg
529,712,503 *362137613F0AA5C53F957A8766168ED2ADE2C615 rahulbadhwar
529,712,504 *362F8B9908A5BA71A13711FCC0D28D9B4202501A NY(<
529,712,505 *362A6680186F91910E80D3A2C899362660E2D2BD oarbă
529,712,506 *36227F99FA761168FEBA975342D2458DDFA348AE OCELKU
529,712,507 *362B4252852489CD2F19720E092FAA981993D486 RANTAPE
529,712,508 *362415CB1F3B7E435493110E6157B4717905631C rapissim8
529,712,509 *36233929D9BD0F403F25D49F2D69E907C1BD6CFF RDFRESOURCE="HTTP//WWWW3ORG/2001/SW/WEBONT/ERRATA#OWL-GUIDE"/
529,712,510 *362D701F905FE971DA91FB4A367F88BF138AA7A3 rd,op6:ivp
529,712,511 *362FA06CE1383D7059F9D3998D6EA6B56ED6E314 os.de.cuencas.endorr
529,712,512 *36284EC18AB3F5FE8550B3B764C1A8C2229FD9ED O.silêncio.é.de.ouro.
529,712,513 *362251B88278492D3D348F323E187032ED47ACE4 reorden9
529,712,514 *362DC03E5B9625B8904D8F2EF5638ED7F4527647 REPUBLICOFTHEGRAVE(EDIT)
529,712,515 *3627DE363D0395E67966C74F8B6FA9F0D37C6328 RERETNER
529,712,516 *36296BE61A72DA4346CFB8C77233AAC936A16504 p14shet
529,712,517 *36236C35DA98BC9B3BFC095824AA8EE4676D3F41 paleaozoic
529,712,518 *362C8EF8185483B30D0542FC4E466DCC50CD50EB panama.panam
529,712,519 *362B72EA78002087DD48FBCCD0D67FE4ED54A97B RICHIEHAWLEY
529,712,520 *362D7E851AF86C5F064A4731A72C7C9AD4827401 RICKY.PICKERT
529,712,521 *362749BA079437C2A54566943AFCBD4B9FC8A129 PAPERTESTTESTINGTHE
529,712,522 *3621EA112652AD54229E73CBBFF8871731838C63 RIGOBERTOMINUS
529,712,523 *362F02C92F55DF5B9CC65DF02ECF50171605A3C6 PATCAMEJO
529,712,524 *362147DFA4C480763445829CCFFB0646E71BD6F4 RITARDAS1
529,712,525 *3629C8969D7E21D7A4BFD4813BA7464E36EF8A34 robert-lembo
529,712,526 *362C5F28CBAAE90F522250ADCA101EAB862B04CD rocktime
529,712,527 *3624AD94BDFB18BA0F247F6FC4605A3697175C89 ROMUJEN1
529,712,528 *3624A1449D1EBA00FDB4BC24BDCB6336A0FB8A62 [email protected]
529,712,529 *36271927A32D5EB5A22CE3A5C2FF93E8D6D768EA phractamphibia7
529,712,530 *3624E60E916333173BC5499AC8B7123A428FF7D1 piedestal1
529,712,531 *362D9D5320D76081832B8758F85B945AAA27A937 [email protected]
529,712,532 *362E8DD648226F1E3F29164CF27F9E1D2C79AFF6 ROZEJRZEC
529,712,533 *3626B483598EB9F2D42D4B6416F7FE0C0D418222 [email protected]
529,712,534 *36235C8B6ADBE4691BB172E94ABDE692C0C59747 PONDERLA123
529,712,535 *362C9821D6D10366635E6FE6815CD01A0DCFD6FF RUMIN47ES
529,712,536 *362F47398046055454ACEAEA22AB99E35A632BBC [email protected]
529,712,537 *362AAA186D411BBCCF2300EBF399629A6AB29801 RUPTURE-(ORIGINAL-MIX)
529,712,538 *362DE24518F465F936346E77C16C8FB3C69ADFF6 [email protected]
529,712,539 *362A5A77A7DCEBAC9F44867F94E03C5020FB2CFD P"P8
529,712,540 *36217BA8BBD96E4BAC2A8D740E822DAFE3184118 p=====p~o~o )o(
529,712,541 *3622AF5D383A090588AF31A64B159A1591BEF846 Princesetprincesses
529,712,542 *362BE4F28189DDABEA8741F6B573F4CE2A533225 PRIVIL3GI4RLH3
529,712,543 *362E063AD93DEB2138EF185FC99E32C390ADEFB1 PRIXTALK2004-05
529,712,544 *3628BAE3E8133E191E2BE8CA03A31FBB60D1E84B SAMUELCENTENO
529,712,545 *36226CFBABAB68BD75A9D1B739A9C470478C53B4 prunaru-1-0
529,712,546 *362D26E01D2764924570C7C24356FF88C1B1DC15 PSEUDOSCRIPTURES
529,712,547 *362C43348554F006000623F7573AAAC60E96468E sardën
529,712,548 *362CEAAF222279068CF02257AAB0E6FF39CA93B3 saturdaynightfever(disc1)
529,712,549 *362F2F64417687F9FE092AA8640448FF85B8A779 q#####>~0~osplat
529,712,550 *362CD3F5F24D13FF1FEA7C3429FAFFF53089DCC1 QUINCY.TOWRY
529,712,551 *362547B48B1F38D66A14814C1A2F91DD782BCE12 R22564
529,712,552 *362196296B2E2F243BCB06916F3FFA69E64A2C47 services42
529,712,553 *362AB3D6E773A04135700FBF39EA7B7E0445DC7A RALEIGH.BILLERBECK
529,712,554 *362152BA74B603B1130CCF83D8408E2E6789A0D5 Ramedlow1
529,712,555 *36298064C677AEB630E9B9C9C10D439395C0187B ramiromintzer
529,712,556 *362E432665FAEBBA9C631B706F35F55459FCBDFF RANDYMAKAREM
529,712,557 *3622151341193C3A5C298F02F3E2F8BBAF1E25F2 RAPHAEL-BASSEY
529,712,558 *362CD3A80EE9FCA69AD6A2F78419C159D1F0EB2D RAPHAEL.LUIKART
529,712,559 *362365D8B078A200289BE183CFDE6633365A6B0A shaunbrideau
529,712,560 *362DE574009C7155578F4DF57A93C2F4DFF183FE shawnbrosnan
529,712,561 *3625ED48C35AD2C029E732E378EE8D62237719A2 SHELBYVISEL
529,712,562 *3622A87DFD8915A661B5A9E4F40E12E3B26B7055 RBIRDIST
529,712,563 *36261CAAA3FE34A737DC6AAA2FE1E9FDEBA48ED8 RDUCHESNEY
529,712,564 *36260E39220C1D3BA8F368185560C79CD22A0BA8 SHERMAN.MICKLE
529,712,565 *362DED889D4B3A31D857BF7D0435CC82A7532FF0 READERMOOCOW1
529,712,566 *362892EB217D2AFE44FF337611D981205868134A [email protected]
529,712,567 *36224D97EB07A30A8D599F45D208CD48B5EE46E0 SHIRLEYMECKLEY
529,712,568 *362A8660A2AEB314435141B2EFA63899E129A0D6 SHIVANTHAP
529,712,569 *362150BBE5C6DCEE5476B00E6C6632CD6AF90722 shurgot2
529,712,570 *362DEBB69A1604B05748950C74017DABEC911541 sikohorepsesyrtaki
529,712,571 *3620ECDBACC475807FB07C0596BF36ED1BD28C29 SIPES5
529,712,572 *36237E7C9EFCD93FA8B16F776B1042FB9714FD4B SITUALIS6
529,712,573 *362AB178405178F0DBE12DD599C1C5602AE8F6CE REPLACETOLKIEN
529,712,574 *362042B895BE754343E8FA84280C71427809B920 RESTBUREAUCRATICING
529,712,575 *362389888FCE35C6E08B17D398FA80817587F570 SLAGUSTAN
529,712,576 *36207923C38B16268A6126CEBF9D76D05B0B6E0F sleeeep1
529,712,577 *362636B27E60ADD534EAFF730386C2913AFD6044 smeekte7
529,712,578 *3628958BA635D9C792CA693B0B7FC2248852E9D6 RICKGREENFIELD
529,712,579 *362F05075D2634651B70BA53B2DCCEE957399370 RICKY.DELAPENHA
529,712,580 *3620B88EC9BDFB98AD6C112CAD17DD4AF7B5951F SOETVIER6
529,712,581 *36234B8019C27748FC538FCA514245353F480C35 SOLEUER4
529,712,582 *362C91AD53B39F5FCF287F07478221191A94168B RIMA FATIMA
529,712,583 *36274049F8A435AF09A3C3FAEC63440643845584 SONABET
529,712,584 *362B28829973711209C2D134ADA4CA1385C631A8 RINGLEADERS6
529,712,585 *36235EF3B70B571102D46E83A11745186AAC18CA RNDMZNG9
529,712,586 *36241519AC5339722E57A694273C319B6D3DD509 robblatchley
529,712,587 *362760670E68EB60DEB3DEAA085E9EFA2DCDDCB8 robert-william-read
529,712,588 *362EEF449F1F3DC986ED7B356C28D108D7CE2FBF spencervisounnaraj
529,712,589 *36293BC4A61471905DDA6FF147D9FB5E4D23B879 RODGER.ARNING
529,712,590 *3623E3897E9C9B3CFDDF0AE3A99E84421616C9B7 RODRIGOMALANGA
529,712,591 *36213B4E33399FF5FD116BEB2C4120479B0F6EB9 SPLAT!!`D#####8
529,712,592 *362034B5A0630A52ED8C5D6897EB44FB848BE84E romantisby
529,712,593 *3625E4DFBF6ED6B196BC89A62DFEF15ADE2FF5F4 splato~O~d###P
529,712,594 *362DE4357E160FA53AB00ACA33B5558A6E64C933 [email protected]#####B
529,712,595 *3622AA7C4EB0341CA9E68081160A69BFAF788F9E rosa87
529,712,596 *362492B4D340356D03931E82ADDFE8F83A141E0F ROYALDEMAGGIO
529,712,597 *3622DA55C41BE207066E8ACE54AAD58B864C9EB3 ROYDEGARMO
529,712,598 *362FFF1ADE90362281F95E39A6A8C418F49C9AB2 ROY.RIFFE
529,712,599 *3620B1A23ADA5A201066C750C4BBB30676486383 ROZ
529,712,600 *362595785B428B492985B2A572ED3DB82B699B44 RSGARZA
529,712,601 *362B2AF462EEA10FFC8AC0FEAA8F283BD5E29E98 [email protected]
529,712,602 *362BA2F05BB4271A398E58D192CCA1E5CF2F2EB9 STABLING3
529,712,603 *36271D3313ACFBBA49E074E93911FAF99F1673EC stanleymoonsommy
529,712,604 *362B789D1D8BEBE7C7F3649E0A67272C3D926210 stardust0083
529,712,605 *362EF588E2DF4DE7E132E52B2F8BD5CE3FFD3F4F ryankowalski
529,712,606 *362A9762227AAB29BBA648B10C4F77723F10459D [email protected]
529,712,607 *3627F71E8A4A46CD80E9DB3B5CAE81BD14034B19 S106376
529,712,608 *362AAD24F128AACAF3753FAF6A0C56BE69E8F8B3 STERLING.ROUSE
529,712,609 *3624333A13B40FE12B5D1E01F0E27CE685D539F9 S3A-MU1B3
529,712,610 *362DA08A851E2D5723C65EDA525CC44336BCDB7B s6nrkftq7o45ef4
529,712,611 *3622B8F0AA7C6D25233E23DDA63015B135B272E6 STRAICEAMHLACHTA8
529,712,612 *36232187DEF177BE4054ED555186B20D97BC9051 SALVATORE.HEINTZELMAN
529,712,613 *36212FE5659495AD4B8C0F0AB5DBA68F006F89DA STUARTARCHILA
529,712,614 *3629936509A8771D9F4ED8F948127A573CEF44D5 sampson汇报胜利的报告中,即使他自己并未实际参加战斗,但是除了他自己以外,报告没有提及其它军官。
529,712,615 *36203223556DE32ACE225A3C804F4C124CE03B8C sandyaton
529,712,616 *36211D6176FD6225A518E055C296421006DEFD24 SANFORD.WILLEMSEN
529,712,617 *36257127D7F230C3A0E14EFD53741F308D009D47 sangita-silwal
529,712,618 *36213D4D8BA57316D8B101E0582E0225EE5EE0D8 [email protected]
529,712,619 *362DB836CD23225F4A5916B50AB171A310F86A3B [email protected]
529,712,620 *362BB7434468FC7242D2B780D01935F3387ECD2D [email protected]
529,712,621 *36230D39138D9450F38D6E8BEABB7E2B76500E7F SUIKERRIJKE
529,712,622 *362E73607EBF91DEF4C4F23D8DF076857892022C SANTOSPAINE
529,712,623 *362AD5A002BF08EB170976387E6F5E13E0703AA6 SULFURIZE 'S/@/LF/J//@/,R/AI/Z
529,712,624 *3622363A76CBD37180B3B8AEF40076DF9CE33FE5 SATIRUS9
529,712,625 *362F0E848C73C172CEE8A5346098E080121AA8F9 SUPERRESTRICTION3
529,712,626 *3620D296259A6BEEFA2A20E867591EC181069121 SCARLETTSPARKY2
529,712,627 *3624A2183527E335E24BEF97752C80FB28FC25A9 SCHAMID5
529,712,628 *3621F9717FD5ED354120FA0C12CFFE96133F2FBA SCHILPPING
529,712,629 *3628E52023E1FC9D47851D6195D86F9846CA4B55 sxcbabie
529,712,630 *362A2400E55429F96A4E261C6DCFFB6D38C39F33 [email protected]
529,712,631 *36217C6EB72D8301CA9CC495272D7ED7AC222CC4 SEBASTIANLATHEN
529,712,632 *3625D9D65A1049467E84E3A9271A4B7DE9102C84 SEITILIBAROBAL1
529,712,633 *36248B5C03DA6D7DF8F9A40D08B650E8842FEC37 SENDNYEH
529,712,634 *362B6FC96CD1EA83F1A7A32069D3479F2787AEFC talk96225200167
529,712,635 *3622929C4C5EAB1ED992C5ED64F729C6482C95B0 SERGIO.BLANCHFIELD
529,712,636 *362D089DE2107FC0B75832ECE76908A74C50E8F7 [email protected]
529,712,637 *3628E39733A23EB6631B74E186EBE5A650875D95 SEVELINDAP
529,712,638 *362A1652F369F39D7EEF963FDDB115A263ECA020 [email protected]
529,712,639 *362D3BFA9E2049D3B91FB1AC9D4C51EC02070C6E tantalous4
529,712,640 *362BF7D03BFC8C897419AEB7B03A1F739CCCC33C TE.ARR
529,712,641 *36296085E4C46AF5C44A0A29951388141E2E0E9C SHELTONWINKELJOHN
529,712,642 *362B23DF783BCF75EB13AB31EA9FBB1226D6B8E0 TEKRAMEIBBED
529,712,643 *3623DBF19716110A22E4C5F5653F4DCD528E1E67 TEMPORALVADER8
529,712,644 *362D089898AD17B48AB31C6982E9FEC97D1106DC TENDESSEDNETED
529,712,645 *362D52A4FC23022C801D24FBE6BF16F5794CC1B7 shortes0
529,712,646 *36270CD88A773CA40F77A8DD37E2D179A303E5F1 SHWETA-GABA
529,712,647 *3628B08F8E969FD805EEE502C06E6EC24D33A65F TERRENCEBOISVERT
529,712,648 *3622D6C71034D99D733F722129380DD8F42AA0EA TERRI.SMOUSE
529,712,649 *36222B96E9522727471D0AE6C162CD9A862DF65E SIDMEIGGS
529,712,650 *3622E496B6511359DBFC11FFBCD8196F2E85A40E siimei
529,712,651 *362274B48D04B1BDE8AB1046EF1D84D615D66D4A TEV|TS
529,712,652 *362E4BD69BC62DF84356100C354864C371B63B18 SIMARUBING
529,712,653 *362FC1F1D3FCCE12816C3294CB600ED1EB5591D8 SIMON.ZUPP
529,712,654 *3622822F265D23682EE9E075CDA7453F10B1727D thadcalisto
529,712,655 *36298A3D4C69F6B01536010D579F759858D41A4C siobhan's
529,712,656 *36282CB42E19AFF9B1575D954121B7394F991E48 SKIDOOHAMSTERED
529,712,657 *362A0AB830CDFC45C6F2536AFFE8BC78A87FBB60 THEATRE-1839-(JULY-29-&-30,-1977)-(DISC-1)
529,712,658 *362C316B78CB710434703E57080FAAB3904E3E32 The-Grooveman
529,712,659 *362FC88AA525CB5570AB127F61533F116017626C [email protected]
529,712,660 *3628B3F65E7DA74525CAD8CF9462A7264419B779 smerderebbero
529,712,661 *362080F9AB3286B1A6A268861EF70CDA2880B394 THEOPHYL9
529,712,662 *3622514E62535DC023195CE0666C5E67B3CB9543 theowneroftheriverbank(3)
529,712,663 *3621BD5ACF702488CD0845485F910E5ADBF2757B thurmanvisick
529,712,664 *36296295B7D381A57DF7B967740901EC1D16CE09 tialumised
529,712,665 *3624DB73C1EBB08EFA5C1CC2C9ABE399A40CB9D5 SONYA.ROSE
529,712,666 *362ACA48296499D56A776E8161C120434E6E587C [email protected]@LLY
529,712,667 *36238A474DCF5CE9E54395FEBD98D25456FE1E50 [email protected]
529,712,668 *362ED3A3CD24C2768C85EA5350C89366125F0EEF SPLAT!!`D#####8
529,712,669 *36205337D180DE7569EB58F5E5E7BF5C1B6EE88E SPONSEDOOS4
529,712,670 *362EB4446E6B86E15BE7EC55061E7A8A8220CBB2 TOMMIE.WEYKER
529,712,671 *3625F3A5D584FCA7EEDA4AD549BA639EE09F4DF3 TONJIDAT
529,712,672 *362DCF8654DD9FBA3A3003D2CE92C0F0052B955D TORII)」、D「八幡鳥居(HACHIMANN
529,712,673 *362C925E88516ED28E163DE47251E2EE3B5F0404 To.the.extent.that.the.protocol.model..and..implementa
529,712,674 *362FD1573267DAF3CE9A005E5B7D4DD3E9DA731F [email protected]
529,712,675 *3620EB057FCFAD8738521EC7A499D2A59EE1B62A STANTONSESSIONS,VOLUME2(DISC1)
529,712,676 *3624CE40BC8EA73F1C4D97BAE231E86482814B5D TRACEYLYNDE
529,712,677 *3628BA61CDF9A5BD7CDB4ED08E26F3E6FE79DB23 Tradition.Prayer
529,712,678 *3628D45832A4917F75F1061DC755F15D615A7A0A TRAJEKTSES
529,712,679 *362F09A5B8190B8A1C139BE5119D041D896E8EDE stellenbosch
529,712,680 *3621D25CD2052CD9BBB7E933328159733CE32B40 //.trap.exit.as.it.causes.problems
529,712,681 *362B6A594A0B11A26D2041BD15F77F536253946E TRAUTEKLEIN
529,712,682 *3622D5559B5CECDAAA7F993702A809EE66954031 TRICHENAIL
529,712,683 *362CD5AF2ACF393BB64B406C108981D2014CB5FE stillast9
529,712,684 *362B9DE18D3BBB60255EF38275B3930423265435 trisch-anderson
529,712,685 *3623BB3647AA78A7A03BE7747B8FFE3B9A65F728 streetprocessions
529,712,686 *362024821CAF0AA2480F22FCBC343016094FCC69 STRIPGOEDS9
529,712,687 *36226790DE9F6FF318530E1CDBDF133BA5D6505B strmhkn5
529,712,688 *3628A3ACA723CA34A8F44DDDA2DD2FB2E91A8CA6 TSCHELOTKA
529,712,689 *362C8FE389D800F71E8D50EAF748356FA08C3D28 SUFFRAGIST
529,712,690 *362C8B3FBCAB3C7B926F027D61B05DE7F1B375FF TULOISTENED
529,712,691 *362869E7102FE5A57AA3C08966D299EE3A81216D TYLERHUFFSTICKLER
529,712,692 *362B7F53E45E103FD5CAEEB736D7DD906872D8F9 SYMPHONY.N.6,.OP.68.PASTORAL
529,712,693 *36272BCE4CA4719A7C13F1FC4F2E38156D41C5F2 UITTEERDEN
529,712,694 *3622728D7215A0CC96800A0D8F5C511741323AE2 TALK8466237125
529,712,695 *3627C05439AC1AEDD8497C07869368506BACF3E5 U*N^
529,712,696 *36287DBF97A92951C8A877DB508ACEE23787049C Uncarbonated
529,712,697 *362E225B41BC4F924C7374527AFA454F0791F09B TANIA-SALMERON
529,712,698 *362AC4B25F2CDCCA2159A25697E306FCF555F1D8 unespoused
529,712,699 *362CE0FE16DD5547F256853BDD1AD389BBE74CA9 UNHAND
529,712,700 *362D1F9D696DB7FFC8B597E4609AFAC0668DC031 TAYLOR-FOGLE
529,712,701 *362BD2BFE2EAAFAF37702398C40CDF0850E91EF4 TAYLOR=GOD
529,712,702 *36206EE606DB5B60D72D7E26FA9B830E80CC67BC [email protected]
529,712,703 *362CAFAC500B77329A2C96BBB58FD69CC2BA2E96 upl}
529,712,704 *36214F3B67E79AF4CA110078D9F6E69A9F97EE6A TEMPESTEARMOS123
529,712,705 *36269339B26E5ECE80202BFEE59EFE0F2C188834 tenebrosa
529,712,706 *362BCCF896853A3E55759A176A8975D58CD420E2 UU * Q#####3
529,712,707 *362AF10B8EB676E53C274FB89C36FFC6574F8022 TEXTONICS
529,712,708 *362F4EC6A3672EADA403AFA6B449558CCDED80EB THADDEUS.HASFJORD
529,712,709 *3623F38A98562D8415112BDA74C1087A5AABD83C THANH LUONG
529,712,710 *362825B50A514F64F9AEADF5F225D7C47041BED5 VALTERRI.HEWEIGEL
529,712,711 *362D0308D3D638896D1FA816FFDE0EF358CB6E61 THE CASE OF THE MAD MUMMY
529,712,712 *362FFF72B944BB70FFAD1A6AE525BED6E829DA5A TheHornBearer,Part2
529,712,713 *362E2646B5793960BF331BDF7562E6F7BE5D4DF1 VARSEBLIVNAS5
529,712,714 *3620EA22EBF7095ED996A673127E9F5A5CC3F200 vastaavalle
529,712,715 *362941784B5F9C3F97CC29787AAAC76DC05D4C11 VELASQUES1234
529,712,716 *362CF48F313B9B58C98A5F009093D6AB9D119279 theslenderlight
529,712,717 *3625BD694AAD87DDC24D792056BCD2FF6C3BD695 vernennenrev
529,712,718 *362711862440D492A7706C143F23F800F28F7867 [email protected]
529,712,719 *362FC8697E617F1C4F350F3CF6B93418FF070338 TIDROCERTLA0
529,712,720 *362562904A12C5D1BCD902BED5E046C2073B59C7 VICENTEJECMENEK
529,712,721 *362CD76AB0153C16328D23C468226317027E3205 Views-of-The
529,712,722 *3629FA6B6BC590CC554AE9118B96502FDE3CECC0 TINTINBUFFY6
529,712,723 *362973E045939F653BCDE82E95B1226CCC6BA84C VIJANDINNEN
529,712,724 *362B263EE6B0EC5985E276C982709812FDCB7F75 TOBIAS341
529,712,725 *3624E2A176FF0D98DF6E2CD4367F5ABFA44592E7 VITOKORBER
529,712,726 *36270943794D18487A7DF4608FBBCEDF9C9D21BC VIZCACHING
529,712,727 *362FD63FE44C3D9AC3FA0F8A8F8B1F69A0A802BD volkann9
529,712,728 *3626E0F2AB1F90E0DFBE2B2BFBB723B913DB7763 voteemanuel
529,712,729 *362FAD0F42F69F9DFCE9BE709E4671FF2DBEE546 VUGLISHTAQUOT
529,712,730 *36288753A7E785C9CC23B93D8EB538FADAFBA12D TQUALCHE
529,712,731 *3621A25C89517E19CF9ADFCAB3C44CCA606BD11F VYPUKNUTIM7
529,712,732 *3625468F841BDDD49E5437CC8F55407C56F6FDE9 TRANCEPUSSIES
529,712,733 *3626F584090D62F476629BBEF10B84719C2121A8 TRANSLATIONFAKERYFAKINGFALSE4
529,712,734 *36207CD016B5985C2B15B671CA00238E1C8A9CF3 TRAPBOOM(FEAT.PROJECTPAT)
529,712,735 *362AD49647FF1A4AC9964E290E6147C52DF3D244 WALES)在創辦維基百科之時,目標之一是每個語言版本均收錄十萬以上的條目。英語維基百科已於
529,712,736 *36248B3C7FA947C963ED1A502FAEE235870A85F5 wanita-umno
529,712,737 *36274DC8D3E230E5B8AFE1CDF586FBA0FE7A8221 tritonella
529,712,738 *362141403C74FED1A2BFC57DD0948D515EBDB4E7 trumpetconcertoind,allergo
529,712,739 *3622E3D8D717CBC6DCACEA5B3DC3406D5CF86602 [email protected]
529,712,740 *362B31CED01D90602FD63890EBC22212405D735F TSOCNARF9
529,712,741 *362F4E0C079C3DA13418478E094B7956FB85EE35 TTCTTTAAACCTCAGTTTTCTTATCTGTAAAAGGTAAATAATAATACAGGGTGCAACAGA
529,712,742 *36249D8827C978B2044BEB1B9B7D624DC0F53C73 TUDUNGSAJIE
529,712,743 *362A55645130C8075EC3BBE001E499BAC0CC2A8D [email protected]
529,712,744 *36296A721512177859EA33B0A99095FABA82301A tvpilotturnedfeature
529,712,745 *362C2745F4F659CC319B0B82E0270455A4EA2602 TYRONESNEDDON
529,712,746 *3628D7BEAB71DF21014975537CE0355B36CEADD5 [email protected]
529,712,747 *362469BA8ECD707CD7FEEFED490C82C18B197145 [email protected]
529,712,748 *3629F723278F092C02A22EC00FAC13B14BE896D2 Wholebrother
529,712,749 *3629D8DB74105837CB57004B34CAF4E8D7E98EE7 ULACALI
529,712,750 *362EB3E6A77A2ECE10D1B8919B263A916EDBAD5E WilliamandVivian
529,712,751 *362104838498BC5B99BAFF7820A04328E2D0F3E6 UNCHEEDAH
529,712,752 *362522F4BF99E740D1E4F8CA93A96955AD1F4225 UNI5ON41
529,712,753 *3625EEBBB958FC6616F30B29A23E7DB3FF45C674 WIODAM
529,712,754 *3627AED4D99AC65B291B535A830D73EF8BB53D91 woningtoezicht9
529,712,755 *362596EFA75EE31A5D3F465CA5FCCEBFD79EDD8A USERTIMETRIAL
529,712,756 *3624838225288404576A8C569276CA6A3D72DE05 wukie
529,712,757 *3628ECBFFE89B312E06A44FBCA1799543C67C309 [email protected]
529,712,758 *362B3E7FBFA7FE25B427744D3C69F557972E2B9F wwwcollectgbstampscouk
529,712,759 *362ACC4CB179F0A2226D2930DEEFD3F52423DDBB VAIHTOEHTOKOLING
529,712,760 *3626DA196FA02B43CD2923D5D55E7238130995BF VALENTIN ILIE IACOV
529,712,761 *3626EF40A29EDA79EEBB2C8BB9C898CCD4FEB3A1 VALIKOIT7
529,712,762 *36203C02B6B24BA1BB0E620870727BACAB978365 (x) ~ ~ ~<B
529,712,763 *36290FD26C7A89B805EED3F2C1B913A0884F3ED9 XIVK
529,712,764 *36222200E3E76A69C551FD4CE861DD4B45BA13B1 VEDASIMPSON
529,712,765 *362433871EA7D9E624C26BD1499F873CE6B20902 X|RR
529,712,766 *362242016910E65D98E21D0811E085881F5EEACB vernapellerporth
529,712,767 *362468F4C045F311D6399199558D10879F2C522B VERONIDIACRUZ
529,712,768 *3624F7A8640B75A33595EE97DEED4ECF337EB369 VERSENCKT
529,712,769 *3620EF34A84DCC021607FC59297FD2FC91383EA4 VEVÍ
529,712,770 *3628E1E33F8DCC7E8502182590D77FA0D5AA7001 vicecapog
529,712,771 *3629B27078CCBD5C2C6E037F36BA0DD89EE9FC12 vicki-reeves-shubert
529,712,772 *362703AED36B232D3F0DEB53E600DF3910067132 VIERHONDERDDUIZENDSTESES
529,712,773 *362E46C742100F5AA41C6507E1CEF522558461AE vijay-ragoonathan
529,712,774 *362CC58C3CE12D8C93C5A8D308333D2CE4FA08A2 VINCENT.ANTOINE
529,712,775 *362B43C3804C549C745DDCFA7CC6227575B5444B yessicaportillo
529,712,776 *36274B658247B029571D49C1B74948C010BA8587 YHTEISEHDOKKA9
529,712,777 *362DAA781468AB56D10E58B88B8820E641A3CFBC [email protected]
529,712,778 *362D1A9B040232622612086CE68D3FD7ACD4D6BD YOLANDAKUMALO
529,712,779 *362D6B849C8327A118F37DE315640A448494EF9E voices.of.trance.009.(disc.2:.pm.mix)
529,712,780 *362E66E70E0B06DA10F795C92A70CE9634E00BD5 [email protected]
529,712,781 *3626FB69C3A909AB6036BF1A98437A0AA4FCE0B8 YQERSHORI
529,712,782 *3627239A6359C42377310295C961F1CA286A52E7 [email protected]
529,712,783 *36222AE9D857A0E8FADFE410461AAB3A1B6A77FF VULKANIZIRANE
529,712,784 *362000586D93720891457FD757CBC450C2B12AAF YVONNE B
529,712,785 *3629F727ADE2AC008638BCE1197851D4272E5335 waitwikimods
529,712,786 *3626181D4C818E4684AA1B428641E1E6D0F3193E ZACH-GALLIHER
529,712,787 *36229F95C418BE8366858013C273F62342F171D2 ZACK.LAPADULA
529,712,788 *362C9D2C1BEB2B35EA6503BE5190FC7B2E8088D4 WALTONKRESHA
529,712,789 *36260B72C8AD740F24FED4A342464596497703F4 wanbizwebs
529,712,790 *3626FAA003FCF244D7D953B4F2C712E24A24B4AF WARD.AL.HASAN
529,712,791 *3625926BF36557F6758F33A45F00F4A250D86295 waverly-pena
529,712,792 *3629C98806772D6FAC67DAA22979BD5C598B378E [email protected]
529,712,793 *3626CD9518F55FCB5BF93D10B8127260F6771A95 zeno-emperador
529,712,794 *36215B981046DA0CD71A8F84AEE92B8268E9A643 ZEOLITES
529,712,795 *362A554F2AA3842D2F9E231EB7751B29241A6916 ZHAIYANING
529,712,796 *3626168DE7112A7B7EAEB52382EE07C081F129DC [email protected]
529,712,797 *362D91729CF88E0F9472003ED5466DAF7F183D10 [email protected]
529,712,798 *362CE8D5B4E6B66F19D0E6974FA5ABB399C64CD3 [email protected]`k
529,712,799 *36208875A0110D3C0096E099E24E104E5A64CDF7 [email protected]
529,712,800 *36245ECE34FDF3BD39D438F8385C3F4912CAFEF6 [email protected]
529,712,801 *3623B138C2163B2E4666AABA353A1304DD25FDA4 ZOE GAINES
529,712,802 *362067900A9BC6762D7333E7EB31F8E61A311839 WHISTLINGTHORNSCOMWWW
529,712,803 *3629562D206A5181A1CA488B28E0DED33C581748 ΘΕΡΙΟΜΆΧΟΣ
529,712,804 *3620BA3F360537CE2EE142E5566E44AB7E7D514E wicholove
529,712,805 *36276A69A59C7B3DF88F3A6DDD8C781F02E213C8 WILFORDVAULX
529,712,806 *3628D60B58C0F306823B8CEF516E088E3C5E3A2D WILFREDNJABULO
529,712,807 *36290B84B86708356225FD5158A615D7369EA8E2 willardchieves
529,712,808 *362401C110A3359C6BB4E5E42E7AE747B104EC3D ДЕКЛОЗО
529,712,809 *3626062EB3B2EE68620ECE27EAE932AE0CCB1414 WILLIEHEON
529,712,810 *362266D8807D96CE5EDCDDB7F5966F3BC66FB905 КИЛСОЙ
529,712,811 *3623C94E13FBC3FA249051BCDE514FF40EB7BC28 обчислювач
529,712,812 *3629BC8B030DB2A55D5A6D8818D219EF41E70268 революционерҙар
529,712,813 *362567F71347ED9419BCB27D17AB04ED15F145CC СВИНК
529,712,814 *3626BB518BC49A532267092C9372C9C46141C863 Woaw
529,712,815 *3629EB25C6A9C6E602F62408DC33114ECEDDED43 WORLD-WAR-I-TRIBUTE
529,712,816 *3627B17FA5A99EFCA02217EF7D2257A253FC5D15 [email protected]
529,712,817 *362D49ADA9F94B3424BA6C8DCC4B38A7A441B205 何禮文議員,MBE,MC(
529,712,818 *36241DAD4B869BC68959E5F07326E6035B930F3F wwwfasttentcom
529,712,819 *3623375A724E71B3C0B0BF49C09411C0B30F998A 地対空誘導弾 ナイキJ
529,712,820 *3626FF333B220342DB8A90016FD9495F1A420CD9 xenial!
529,712,821 *36233022ACAAE8D38D08A83407D080A5DD06E9E8 [email protected]
529,712,822 *3622CA39091C5CB7C0327CE5D3FD6B3149015BF7 XOZORTZURLIP5
529,712,823 *362D721523AC46450EC1566C898DC5247A561A7C )X(-`Q==B
529,712,824 *36234CADCF6A2579CCA4E69160B005546BF6331D [email protected]
529,712,825 *362D493F2D03B8EE3E7EF26156393DC6E9BF4B84 XULANDIE
529,712,826 *36223B033EC1BA8EE430E59EB45447CF842F0D04 [email protected]
529,712,827 *362E9E4898441E725EBE4A05E0732BF911576F3E XUYACHE
529,712,828 *362F0970035E5E76BF05D9FA66E847FA923B363D YEIGRACE
529,712,829 *362A466772BB869934F22915A9D5BA7AE4862109 [email protected]
529,712,830 *362361D71FDD4C649147E4CC9D8FAE8FC5ED08AB [email protected]
529,712,831 *362FB4E3703D93FFE4372E81266513781B288498 YLIANNOSTAPAUKSESSA
529,712,832 *362348CAD6FDDF28520649604F9311494194193C -/`
529,712,833 *36273B772789FA1FF138706EB59E64DB979B0252 @#$%^&*()[email protected]#$%^&*()-+
529,712,834 *362C13C4FD20D1A8B04F5224537C2D651B0395D1 zach.payment
529,712,835 *3622AC032340B216A8BB2C350F9B8E954333F333 ZAC-MCDONNELL
529,712,836 *3622E8C5BDA539FF26A8D69922D27062DD8CF554 ZEBRANAT5
529,712,837 *36249459ED41367E2A6679719CC1A6C939395749 ZEIKOU KATERINA
529,712,838 *3624846C58D7B87099C4A8733B48C638B537F693 ZEK.KRASNIQI
529,712,839 *362E38C99261C9A620B3C12A03EAAF5B8A7FAB18 ZELÉNÉHO
529,712,840 *362D5D5CDDC55DFBCCDBF9D99D9E63D10514D339 zelmareames
529,712,841 *362ACBC649287B7F33FFB814D8EA0760507F574F 10.bettina-schueler
529,712,842 *362BEEC77467D2A488F770D71A2E4F628F50FB1F 10TT3R!3S
529,712,843 *36230E90B231937774A271FCB11C2DF8190267CB [email protected]
529,712,844 *3624A34CCE2B11BC773EA18C40398F2E262DC485 [email protected]
529,712,845 *3627A1F40F441A7AE29E72E0985FEE74DF64897B [email protected]
529,712,846 *362DA228508E3E82DA6A47B3AE042F5AFDCFC669 11 QUALITAETVOLLE
529,712,847 *362F8E8308092EA6E90DA3C4746679CD29FCC4D2 ZIAZIONE5
529,712,848 *362F0D7BD044ED4B9BBE7A2F46B37C4C55137AB0 [email protected]
529,712,849 *362C3EC960B27E0187BB03F2CDBBE17E8D6C0175 ZNGEFPRENGT
529,712,850 *36203779F01DE4D50F244D989AAABA61EB8C519E 1306879 vastaava.terveydenhoitaja.ja.terveyden.edist
529,712,851 *36267C3E05CBAC1F156FCFC31B6270AE71B2E87D 1363424 perinteisets
529,712,852 *362D3D1D3E4A6DA4F29415A41A5EE21C209F1359 1377786 opiskelijan.on.osattava.tehd
529,712,853 *362D4A3972E1833D3A1958A97412A2B4BF61CC41 1533845 LUONNONSUOJELULIITON-ETEL
529,712,854 *3622010688D48F774E622F9BF499AB99BA7A6D41 άπατος
529,712,855 *362A13BCE78300D9C09BA460031899649B558E7F ΡΟΘΛΊΣΜΠΕΡΓΚΕΡ
529,712,856 *362F7DB8E6BF9C1629C171C0760DC89DD93F5E1A ΣΥΜΠΑΝΤΙΚΌ
529,712,857 *3629A3D985ED697C4C0BF1A0691BF752EF9D1438 «антрацитівський
529,712,858 *36279765D56D5EFA5D0FA75D267D6AE3A554BF5F джоболанган
529,712,859 *36266F3E2B64EC82076AA1BB582EA2120F1F1A24 караджичової»
529,712,860 *3624723028EDE62E6DDEBDE18A096FCC24C54CAD 1.AVANT-POP
529,712,861 *36249C59F17A8B3609EDABD41A0EC8F06A040CB7 МІТТЕЛЬШТАДТ
529,712,862 *3626910B6B25FBF814BC5B9FB6B379C27AD3E74F 1chautauqua-inst
529,712,863 *3625128A6A41E1A0F163914363A29D404797A427 1.EINFLUSSINSTRUMENT
529,712,864 *3624095AA93FA2EFE0A65875FE16687EDA6D8DF3 СИСТОЛНО
529,712,865 *36224EE65AE91285FD6A7F347280A8F06AC80D57 СПРОЕКТОВАНИЙ
529,712,866 *362F139E1349893EE617461F0D9E627505C58CC4 сынонім
529,712,867 *3626B830EDEFF0F4907B7DFB9154459C91A762B5 1-GOAL
529,712,868 *362F54B44D129B1144CC81914F34EFA589F7D772 «ЮБИЛЕЙНУЮ»
529,712,869 *3628A234CD203E828DFE0E81C7B6EB604100984B ԿԱՏԱՂԱԾԻ
529,712,870 *3624134A7E3BE0C0D77455E3971EF1AF5C838D44 1-JUSISTER
529,712,871 *3623B8B10F341C7FC330E009BCD126D7066921DB 1.KIPIRDAMAYAN
529,712,872 *362B5AB2415B36A89177AAB7A28CDF39174E7A37 1.lmt:st
529,712,873 *362792BD4CC21A4DDEE7ACC6D7912CD8AE113385 1 MARATONHARJOITTELU
529,712,874 *362AE94C4C3E3CD0ADD9F873F0B4D5795A13E59D 存在,那么它的阶等于h对g的指数
529,712,875 *362BFC95A9FCA6277F2252B045AD0F68A248DFE2 1.PALONALUSSA
529,712,876 *362C3B7F323B7A3E9BEF9A4B05043BF582463D66 1-paspartularin
529,712,877 *36296289748B9D1C41D69593A88DAD1B4E4E86B4 1.praktischsten
529,712,878 *3628BD56E36C5F7D21459B3BCFE3DF3844CF204C 1 PRISCILL
529,712,879 *362CEC01C421A0F663790C49503CA4227EBEAB59 1 purkamismantrana
529,712,880 *362B46C9314A3CFFB5AD1DB11A474D9F70B70ADD 1-RATHAUSKLINKE
529,712,881 *362E7821443FD1CD878690A876AE0966ABFC603C 的作用,通常於大堂上下二三層的商店生意較好。只要按下CTRL
529,712,882 *362344BB0FC859A245FF87D97FD27E4F7ADF2965 1.rothkow
529,712,883 *36248E3CEF1C4CC93710BE9A7EB62DC3C772D274 1.summerfloating
529,712,884 *3623DD5C771CA28BF46719ABCD14DF2B4E9EE0E4 1TILISIIRTOJ
529,712,885 *3623810154975FB8414D530D2CAF0698093F0004 1UATTO
529,712,886 *362624C18B01924E1607BCD8F4B32A31280F4BD2 1-viikkkoa
529,712,887 *362D57A649CE5A3D8547DA0303CC3600F7F8B6A9 1VRIDANDE
529,712,888 *362A5CA1875432E4EE23074B4C884A44D36CA37C 1XJPSK
529,712,889 *36292EEED6129B5714C8A8173986F549B164EB61 2005947 ein-erfolg-koennte-er-trotzdem-werden-
529,712,890 *36247CFDFC45A82AFBA71DA41490C56FEB481206 2079472 inwischen ist der wettbewerb jedoch haerter geworden
529,712,891 *3620E813B160808FFD143D0400099BBEBDAE5416 2082922 ero on asteen parin luokkaa
529,712,892 *362975CA997CBAC31E772846E68FE7E163183EA8 20-alISIlmadIk
529,712,893 *36206CDAD1F589CB7B188809FAEF43642F14408F 20DAF46A56E7122E37360E78C2EEFD43-TOMVAN
529,712,894 *362DE37E5E878B8E22042FBDDA48DEADBB6359A6 2117237 LUJUUSANALYYSEILLA-TARKOITETAAN-T
529,712,895 *362B46EAB7FA082CA5289CAD4C17FEF8D9278712 2196895 TUTKITAANTEKSTIENRAKENTEITA,LAADITAANKAPPALEJAKOA
529,712,896 *362263D1E3F219A63ACFC6A705B4AC7FB0A89DED 2209932 AINEISTON.HINTA.M
529,712,897 *362086BBAE81DA89FAFCD159E91E8CEE1B529C89 241042 erwartet-worden-war-mindestens-die-doppelte-summe-
529,712,898 *362ED5B20003EF5FA801AAD8701BDF45154B35D0 24PRELUDESFORVIOLINANDPIANO:XXIIMOLTOSOSTENUTO
529,712,899 *362243824B23C84BF423DE49ED73CB57B4DDDC62 28 PITFALL
529,712,900 *362D1D2C8B1FF3787110D329E06FF0C09D4A2BB3 2903458 'santaclausfightsback'
529,712,901 *362214FCC1102362B7D27773E7E7BFD93C604FF0 2AFLIG
529,712,902 *3623EADBA3B123F10E3A562C7FA81C57F406E827 2.AMATA
529,712,903 *362E143D5F98554071DEB8A51FBB92CC8E356F47 2 GPA
529,712,904 *36236B29A85B5F06672367F463B81EF7ED1FCAAB 2IAMZACK3
529,712,905 *3626D7D27C7DF78041D9A7B6B7F3B2460B2948E7 2PAINOYME
529,712,906 *362808667C9DE2B420A944073FBB77376BE889EE 2SIECZNIE
529,712,907 *362D654060E94B80FAEE0E954B0D2CC12EDDD212 2TOMBOLAHAUPTPREIS
529,712,908 *362CE4E0B01ADA74635C530E2EC07641602B67DD 2TRUISEZS
529,712,909 *362B78DEB7DD49DC2B21DEB08F3DDF179C4E6E1D 309696 ECONOMIC GROWTH WOULD HAVE BEEN STIFLED .
529,712,910 *36281F7FCA647CEF0C421E568E1E1ACB05DB3279 3#####@.~0~o.(0_<)
529,712,911 *3626647EB01E9332AF6C2C9ECE248889C2157067 3891;BJ,LETSOP;TOUQ&,LOCOTORPEMITYAD;TOUQ&>P<
529,712,912 *3629B0444DDEC99C23BE4A27E0C61ECBC526DA9F 3AERESJUK
529,712,913 *362D6F7E22E2A26F55AF7C4EAF04413F0F9A0EC2 3.aivoper
529,712,914 *3623AD2CC90FBA38A9DADA932FC4B3EA79279F83 3B<-.~.`.D------8
529,712,915 *362E2F73D02699370F3BF39331BDD70E93394E83 [email protected]
529,712,916 *36296FE6D6E72AC1EC57C330919B03DEDC4F481A 020923BLZ
529,712,917 *3629CC73EC39BCBC16A4C500810E8C2B169FE9A0 3HNDGEMENG
529,712,918 *362B054FC3788CDEEEDE001FE3C5B5BB19CC7A30 3-KREBSBACHES
529,712,919 *3627DE0552627E527C046B91FE869A9CD024A1EA [email protected]~o.~o.)o(
529,712,920 *36225AE814BF78CDB39A3562F6AFF779F57F39DA 3###P.~O)8(
529,712,921 *36286E48A52E7DF1463B58EC81943D1A745474FC 3SKOPEYSH
529,712,922 *362D962A0A93566E194C02AAC668294E383FF2AC 0eaf96030ee26179
529,712,923 *362797515D44CEED15E07C14CB1B6E835849DF89 403712 senontodettuauttavankest
529,712,924 *36238C7B6914E947D4806F86EB465553D5E7CED0 0x00014f
529,712,925 *362A87C226AFA171CABDD2D202ECD507DC0D7516 1091555 edullisetavoveneetontarkoitettuvainrannikkok
529,712,926 *362660D49FE97336B8F5BDE8E17621CAA8171CBB 111722
529,712,927 *362108870924052845C2CAC7E3E30D8134AFD42C ???(12,12)
529,712,928 *362A120F2A7A4E57A21147DA67241B81B2CD842B 121588b
529,712,929 *362867220B7B7C61635B8E7240571EEE63F35571 1240496 piirroksenesimerkiss
529,712,930 *362AA28A923B02FE3CF02997CF2B38EDB5514D4E 1344287 vuosikokous-ja-ylim
529,712,931 *362D68B4246677F2CC89D449DC05165413DA73F3 1445414 kielitieteen.tutkimusten.ohella.on.romanien.alkuper
529,712,932 *362D85BAB962505445F2560160C7D08D4CF6E5AF 4.KINDERSTAETTE
529,712,933 *362863A27417EAFE4BD5C9F777BBE74AB9C4536F 159947 INTERRAIL-KESKUSTELU.MAJOITUS.OTSIKKO.:.RE.:.SARDINIA.?
529,712,934 *362AA5887F9F3AB366DFB685A82123CC8029D64B 1619780 teelysaidfullcontainmentwasexpectedsaturday
529,712,935 *36285789687C1B946A765E5F7B97A0524EC80D0B 4.NON-WOOD
529,712,936 *362D32EE127B5EB8B9DBCC2DA0FD52C8A3D9C01B 1744400 muotikaupassakehitysonollutp
529,712,937 *362010DE2B0CA4A4E9E8CA13F668D18F7A54E9C8 4PCUQLAKV
529,712,938 *362B7A940265E9F4A72F395D97291B9C73443947 18648 EI.POLIITIKKOKAAN.KAIKKEA.SAA.:.T
529,712,939 *362EC3D11D986689309B7B14194D692837438729 19041314
529,712,940 *362E50EA9A2AF8B80536E390BD6057E1C0690E9A 4 TIELAITOKSEEN
529,712,941 *362BA21F7B2340E0B18CFD02EAA53F5C534011FD 1BABIJ
529,712,942 *362FA2EF894EE306CBB4E29E59223ED6AB0D058B 1-booth-sized
529,712,943 *3622AFC84ECFD20D06772FFACB667C2CCC8F938C 1.CAKICI'YA
529,712,944 *362A84028B3FF7EF9E26B8CBDC42CA3DC708B40D 1-coontz's
529,712,945 *36228FC438E7DA9C55933D4D9F1ADEAB61E8852C 1crank-it
529,712,946 *362FA60B9736DFD2200657F9671EAB51ABE3EA07 530495 donem.v'te.secmeli.farmakoloji.staji.yapilabilir..
529,712,947 *362C28FFA01BF738D2F3004DCC2C6ED5B1C972E4 1.draamaohjelmien
529,712,948 *362C767A79336A8E23C0E5F0A4A4A199133478FF 598CARL
529,712,949 *3625DD58E5062BB05268DC97B10C6090B5C7D79F 5ABLEUGNENDES
529,712,950 *3621A5B73C11645CD380684CDE28DFF9B4727D89 5BSWSGACBSW
529,712,951 *362D06F7D8B1B368C073DD8A2798033FA8D28711 5DECEMBER1229
529,712,952 *3622362420DD5A362FE47454D805CA5A84C4F430 5ERKKULI
529,712,953 *362C593195E3373230019E76DB4558F722AC411F 1-KYSELYLOMAKKEINEEN
529,712,954 *3624B41F4B308216AD2940D0B251B699CD3CBE9E 5HANSON1
529,712,955 *3624E090AD63CD4AF552BA03F794DC3929851248 5HTMP
529,712,956 *36220DE6EFBC2F4E744310AF3C949E663534BD78 5 kaynadi
529,712,957 *362D698169304E56369DA097AF1244718D2DE0D3 5KELET0NWEED
529,712,958 *36254E66F1D66EB5BE850F0C83F9C34EE8B5209A 5MAURICESBDC
529,712,959 *3625E0F7401B080D67D3D19105A25E43DBEEA64A 1N7ERPOL171CAL
529,712,960 *362FFBCCADCEB105BF5CAA884504762AC15BEF5B 1.oberknochenbrecher
529,712,961 *3626F459853AED9F9F5D3DD7D5E31056EBE0499E 1PACKDRY
529,712,962 *362360FF79664F34319C3F8544C5B229D81DD73C 5optimiseront
529,712,963 *362CAFF5BA03E60D3C8C7F55C9AD5B56272D0E57 1.PSYCHOLOGIE-PREIS
529,712,964 *3626EBA454391077A856FA6CE7BCA21B99AEE759 5REGJERINGS
529,712,965 *36226E411802F63E84A1906C53A01F59DD7A67DD 1saaressamme
529,712,966 *362889EA1EA91043A425D3A8BA7394AE31D70752 5STEPHENPYRAMID
529,712,967 *362D6F97EAA6E7F3E8F890556A63AD6B11A19A49 1-SONYSSA
529,712,968 *3626C6DD7B53A8F19428ABD1391A5720932936BE 1.terroristen-gefahr
529,712,969 *3626977BDAA35A95221949570EFA44821536A60F 1TOLKIEN-TAIKA
529,712,970 *362DCD80E28ABB6F235A476EAB2F295F8B7B30D4 625827 BIZIM DERNEK TOPLANTILARI DA BOYLE OLUYOR DOGAL OLARAK .
529,712,971 *362C82E5F9E0F1B6DBEE9BAF30860AB8B26B6E9F 69785 loppulukemat0-5viimeistelij
529,712,972 *36237C0D282D3359C256BB6980A78747F8A0419F 1YRTTIKASVI
529,712,973 *3629730489688B7F9048A223C202DECC718DF38F 200braydon
529,712,974 *3620168321A63321D771909028D4059780C20173 217FRIDA
529,712,975 *362B23353E5DAEC87F0A74070CF492B14BF6DF4A 6EPIXRISMENES
529,712,976 *36271D45AD9A0A15AD815E69B7B8B49FB7738470 6ERIKOISKYVYT
529,712,977 *362E732A032E0384B3DAF18D051EC3071CCE6A99 6g1lm
529,712,978 *362D20095D055CB316153092643F8C6B3B21C91C 6ILOVETRUMAN5
529,712,979 *362EDC8EC216A48B133D6C70D9CF6E44ABAF7640 2360924 KAIKKIRIIPPUUAJATUSV
529,712,980 *3628395BE885D2DA1884EF4A87CDE71131CF2D60 2502494 ehdotus.(.kj.).:.kunnanhallitus.p
529,712,981 *362F72AC05E3F8EF50E80B675C8D939B7E9D181A 2598144 PULPETIXONKEHITETTYKURSSIENSUORITTAMISENVERKKOV
529,712,982 *36284D9EF24909AD8F0241AB4FD31C9D02B2423D 6NIGGAZLIFE
529,712,983 *36203B16ABB2731EBD47DE9634F3754A12F2CFED 6RECARBONATING
529,712,984 *3622129CE6A6E836AC96BC8ACBD4363AD51BB7EE 6REPORTERIL
529,712,985 *362D242976C312C8191F841CF3404EA3F8356C3F 29JUL1940
529,712,986 *3629124FD15E9931297F0A8CF58C2DEC8E40FE6F 2-ALTINGUEL
529,712,987 *362086006725BACB4F657B2BA475E3C003E0691B 2.ASKARTELUSARJAN
529,712,988 *3626238C2972B91E0BE03DA3FB058F1643F4A6F1 2.asternplatz
529,712,989 *362962C7CBAF32E4DF935EF7393839DDE617F006 6SOUKENDE
529,712,990 *36236A88FB960C65D550F669AAA6B84C267EE84A 2CRTCHTNG
529,712,991 *36246194BB33EB93D9799837B3C8A1BA99034B1D 6VETO-PROOF
529,712,992 *362361DF5D26D9ACA14D380C9CBBB874E65B285F 71rylan
529,712,993 *362E1916E889B6453689EF7C8209B8F278D0030A 2.klammerndorf
529,712,994 *362641B8F307A352F929909F29720B9CB4F36AE4 74WOCHENMITTE
529,712,995 *36283FD210CB69B29BBEDEC49047DD0EFD2A704C 2.LIIKKUVANKALUSTON
529,712,996 *362E62C22D866DC5982F94FDD836549676771AC2 754943 alpar-,-f--gok-and-o--h-
529,712,997 *3628DEC77E2F2BCE7C3034D4FA05D999EAEB1793 2MYBABYGIRL3
529,712,998 *36294564CF8BD5F3A9BFB37C506BF95D7C1849E0 ~78歳にしてこのデカチンを持つ老人の壮絶なSEX
529,712,999 *362693253A2D227061256294DDAB0CCC0C11AD37 2POENNEOP
529,713,000 *362C9122FDCF57A1BEEA99E643924F014432F5AA 2.radfernwege
529,713,001 *362A218A670DCA0C5625E9EC2FA530F09E4A9E9B 2-stereokuvaan
529,713,002 *3622EB706E2FD748CA11F498367231756FE29847 7COOLMANVERONICA
529,713,003 *362F3D65900ED9068430EFBFC113DF25498FB527 7FRITIDSKLUBBERS
529,713,004 *3627131FF3115538C241E9321EA3D1C56BBD529F 3###)`~3b<
529,713,005 *362C020E2BD4DA42D9799FD61227BEDB4F9D1A23 7MAVERICCAMERA
529,713,006 *36261F8284342FC23719294CDE6F055F984E7F37 7MICHELLEFLUFFY
529,713,007 *362FCB447DC8EEAAD1C1FD34565EB2A377B36482 3.HEARTCATCHING
529,713,008 *362C9CB6D67EEEDED19077B04A050F369D01ACC4 3ilovefly8
529,713,009 *362482101E8BC1E2694DBF48DD34A855D039B3D1 7.STREPTOKOKKEN
529,713,010 *362E97865C01467C3264EBC92D9AE7A5909563BE 7SURESHKBSW
529,713,011 *362149C1345FCBF55CC2281F94E58E104D422FA1 3、RUNAがユズと組み、お花屋さんアルバイトにて+3万円。EPISODE
529,713,012 *3620E8D6A855364CA3540D9C9823F7E9744A038A 3SENEGOG
529,713,013 *3626B9E9BACC035A6678FF04CB939A39D05C1AB4 3x+rpa+0r
529,713,014 *362BC2D714EA56D3C5DE46999D04F22EA3D7F41D 429040 JOSKUSSYNNINMUISTOKINONNIINKAUNIS,ETT
529,713,015 *36250C0A2AB1C91580FF7720CD90E7A8B189D876 43687 emme luovuta tiedotuslistaamme muiden k
529,713,016 *362060EB3CB3A03925FCA48489C58E72BB2DC786 444ZAYDEN
529,713,017 *3621600D518A4097CD24CC6733D490DFFEE83789 480623 YARGILAMANIN-HER-ASAMASINDA-BU-KARAR-VERILEBILIR-.
529,713,018 *3625A55E1302D2F0F2CF000900362CCD6CF357BF 4ELLIVSIU
529,713,019 *3629FD38A235E71761264BA0DEE46BE4A43F3A67 8BONERBEANIE
529,713,020 *36251A11C55704F5CF30094F53FA90E06AC2BFB9 8BSWIMBELLISHT
529,713,021 *3621054982A752B1D3C0A3863F7029D75D1706D6 8BSWJOASHUSBSW
529,713,022 *3627947BD60C9D4FF95235BE1A30CE74E42D5BDB 4GROSBEAK
529,713,023 *362419A406B387DD42AE6C0C083238619704277E 4NISINTO
529,713,024 *36267A184BE66284E3832E30216F7C0E5BFC26D6 4OYALISMS
529,713,025 *3628D4AC7EEF64D59734FCFDB9EDCD5C168A4DEE 8GULLIVERS
529,713,026 *3629DA498662EB4B1C508FE0E86E4150BFD4B8B1 8ITALIAHAWAII
529,713,027 *3620ED679723A32A04E0C69835B92B34AE630D8A 4SUNNYRUSSELL
529,713,028 *3623D6661E5DA8BC3BA8BAD6B930942827815F5E 4THATIRISH2
529,713,029 *362C9A3BFAD45A85519C79C265D8D62DDA8EC63E 50L1D1F1C45535
529,713,030 *362DCDA4CD9AE8C0989BE242A326E30ADF1F1825 510374 ARISTO,SOKRATESVEEFLATUN'UNFELSEFELERI
529,713,031 *362CBAC3ED5F9F2AD9003E8615F5A8F2BF0F7F61 591694 DEZ . TVMARATHON BEI ARD UND ZDF ZU OLYMPIA 02 .
529,713,032 *3622EF06C8B83D79E47260C7F3ABB902104B104C 59420ADE
529,713,033 *36208E49E61A42705CAA6E853FB56981182ACAF3 5BERGHAM
529,713,034 *3624B5DABDF8DB801FCE6CB6DA3640CC38DC4349 5BRUTUSNAT
529,713,035 *362812B227C849962A41C7ACF522F2308AEF58DC 5BSWSTAODYNAMICSBSW
529,713,036 *362137A027FBB546C2B8BCF63A2AB9DB2D1BFBD6 8WINSTONLOVELY
529,713,037 *36267E601EF7D190BB75A82CD2CB3B00D97438EA 5DOFFETH
529,713,038 *3622D0723EF3CD9A78D130760FF3A139330E484B 927946 C-.-,-AVIYENTE-.
529,713,039 *3620791F5153D14485B382C7FFD70ECEBAEB7331 5EXPRESSDRIZZT
529,713,040 *362AFDF0D12279FCD1FCF66B3B020E868E59E620 950721F1
529,713,041 *362B0D5806CD8A6BD67CD2871B38F816AB353855 9BEBROEID
529,713,042 *3628C8810400CFF514F9A714886FB0EF49C7BCD7 5ORISKANI
529,713,043 *36240A7E91633BD789A2FC817F95932A4B4A2DF4 9FALCONNOIDA
529,713,044 *362FC4FACFCAB0AD35057CD3FE1333371D195526 9gsb
529,713,045 *36219BC21C03A52CD60E9CBF45B91F98E6785C02 9OPINANDO
529,713,046 *36292045C2A83509FE2C2D3F19380E46E9B936F1 5XXXZXCVBNM
529,713,047 *36243369EDA3EF1C625A91C8CACF68A5C8B320E2 9RASCALDEEDEE
529,713,048 *3626CB6A2F9418B8050B17F6F3AD894E46E26908 9SEOTIUQS
529,713,049 *36220E69C9A022E2534F3430ED2C879C463D834C 9STENGTE
529,713,050 *3621D6A0143C7754903EBCDB0B683B88D9642DE8 9TFEEGRED
529,713,051 *362400CE248762FAC0FFF1EB375924A479856945 9UNTESTIFYINGS
529,713,052 *3626CC2C6BBC52C13840C8919C77F6E68222FFC9 a0;33
529,713,053 *36284A973EF94F3D3AFBF32860B6CD4BF8C47679 a0lai
529,713,054 *36277CF63E1F14D3F2F1CE7708DBE770D607927D a;3&l
529,713,055 *3623C0DE763127E065C52069E837F0AEA0359027 6INFAMATIVA
529,713,056 *36295C72E84971D5FDC748EE11F877F44AEFCB88 a4qdk
529,713,057 *3627C31E92D633BD982F49A665F36057ED38426C 6LECTIBLE
529,713,058 *362299DD5CA43140783C0AF0A0BD76A77AEC0E1F 6NBRSTBLNSS
529,713,059 *362E3EEF516E8DED9611804C33A39EFF8A240215 6NEPROKOURIL
529,713,060 *3620CC131B3D602ADA9BBB85E73B3576B2FAF329 A7TNI
529,713,061 *362E6364707929930841CA17E7D5C8179CE6BBC5 a8f
529,713,062 *36278D5E46BD9A1D5071B86B9DB94AF765E663B5 6REVNAGRO
529,713,063 *362DB14F680BC4C7E13A5B98E5B45765E30A5148 aa'{
529,713,064 *362D7CC0ABA5D4440D6A6A4FE75CE093FF899997 7BLOEDDOO
529,713,065 *3622A46F727F2A3DE2D96E68BF3DDC4D2789CB54 7BSWZZLBSW
529,713,066 *362DDC675757DEA573C04CB3F90177533E6D5D7B 7cinderblocks
529,713,067 *3629D87B5768DB5A92DC52322C2EEE71A78F02DA aaepp/
529,713,068 *36262B19BB607500E8CD3810B01A9226C2744D81 A%ATM
529,713,069 *362A346418B8A976F110E0F124DE7F67AD5B9EBE ABCROXXON
529,713,070 *3626103A445299AEE540D8441C79EE60954049CC ab`*i
529,713,071 *362ECD9529E51303658CE7A927EE949E14F67CF2 abwf}
529,713,072 *362C4953ACA158A1F479AD79AF15259A0FAC2D74 ACCHIAPPASI
529,713,073 *3621FAD7E963593E8C3869472588352EEB37957D 808645 MEHMET GONEN , RES ASTT
529,713,074 *362367C505D1CED95BED6DFEBC989592855F3DC5 82-RESTAURIERTEN
529,713,075 *3627EFBE118B72AF1D4C323BE6815BD9187D8642 a&cl+
529,713,076 *3621B4CC2BBE20DEC84BD5A6AAE1D41CDAB3DC88 ADDICT.ARCADE
529,713,077 *3622BF9EBCD4887377E16D882429598A0287C608 8ETIHWNIT
529,713,078 *362124E5A0FA1C09441A2A85071DDA9A5230ACCA AEDLO
529,713,079 *362C229275CEED9856DF8A85A62F7D52F9C85BEE 8KOMPLETNI
529,713,080 *362505009E61BDDD9182754459CCB54A9E5E5F1B [email protected]
529,713,081 *362A245A1B692CC10EF869E339036F1B37EA8E7F AETV9
529,713,082 *362BE7E37661347786B198240DFF7FEE1D604243 A+FP8
529,713,083 *3620EB609B296FF1CFBD40A5887FCC385371598E 8RU71SH
529,713,084 *362572CEBFA7ADBCD69B38B59F21441E420A68BC ag?o
529,713,085 *3621140E6613C558A4DCE3C9C76CE23F7B989B2A 8SPRIETOOGDENS
529,713,086 *362043697ABFE6520CB846617450508B1025B12A 8UNDECENCIES
529,713,087 *3625ECBDD89A16CEDE6CAE9F18CB1E6007292278 90NORTH
529,713,088 *3623AE46DDD922715840550947BCC01B4818E26E AICCALUCS1
529,713,089 *362E55CC9D13D1D63680DF4F405191E834416A08 9901e2dc1f3ff931a1575bc0a9629c8b63
529,713,090 *362AEB166E9766FEA033F838040466B5B01DD223 AILANGUPS
529,713,091 *362BD7B5602D49ADEADF6430A5E5A8325525579E a;irh
529,713,092 *3623FFC6761A654C090123CA3700BD8CAD2D0C3F 9ESOMULG
529,713,093 *362714E234189766947A5B1E92327D7A304D8054 9GEGEGEVE
529,713,094 *3621D6FA1DAA20B2135F7CF4482DDCBF7D1AC3C1 al8d1
529,713,095 *362424E04F6954258EC31FA6A232E4A3899475DE 9MELLOWLOOKIN
529,713,096 *3623EFE6CA57BB35B35A1AD2B45E9CF062FBBAA6 9PRZYCZYNILOBY
529,713,097 *362AF41F9C040DDE14106B4088B616A041418454 9REJECTI
529,713,098 *36229C30720DEC18C2758756B10416F937BA5A5A 9SHIRLEYSPANKY
529,713,099 *3622A99A1DDA942E936F47AD73628BD58E24377B ALKALIFELDSPATEN
529,713,100 *3625A76872072BA7A3B1CA4B8A82A0062883887B 9SPORTFLUGZEUGS
529,713,101 *36208316C926AC1E972B099FFDA8C0E1DCD4A713 allevante8
529,713,102 *36209683AAA26E76898C5864246F9A55A79A9C5E 9YESHELLE
529,713,103 *3620BF883A4532ECB8AC6352B3A4F2CA5C6D6731 a2tmh
529,713,104 *362C0976EF6EA8CF5706CB3A2FBF68D2D097FCD2 AMBROSEFAWLEY
529,713,105 *362706DFA43F6E0192E81C197E9B5E7CAA7637DD A6KXP
529,713,106 *3629B5E64A3E9C469B4A69530545FF6E08CD7B8F amnorbsw9
529,713,107 *362911D50077955B85FDF5118E962013FD674143 AMODINOS
529,713,108 *362EDDA53A3888A10A97675B12CF3D7DC9A490F3 a83dw
529,713,109 *362A6725F5D7290DF64CCC367FB12B6D85234DFE a)882
529,713,110 *3628FD3773998C82A11C7630E02D51194D651855 a8f
529,713,111 *3624EF100D873058DF4D96553319CD02ADE77334 [email protected]
529,713,112 *362E5E0C0577A9AFC6CAEB56D35250B4A1BC1FF7 A9_E;
529,713,113 *362D5D4DDBD4E3462BAD474129E02874B87374E9 AAA:%E
529,713,114 *3623CA53A837D0E7F4AD18B5B624A072C6240AD6 aadhb\
529,713,115 *3620B535E954904E0EB2335E51612E81D4A4844D aam2k
529,713,116 *362C2191FBBFC8384D07412850CD0ACB8E1A6994 AARON.CASTRILLO
529,713,117 *362CFCDAF0C5DD36DC75F4B7B4AE30BAC1193C2D AODS.
529,713,118 *3623FA305A4A8E68FF17405A5B7A91A4434B9206 ABGETAKE8
529,713,119 *3626FF7821C83F4D46D7A8C92E7042B2F3554394 a+_rd
529,713,120 *362A5C6355C8725DE54E342A5ACA5DE50B90DBA2 acaumensium
529,713,121 *362DD589B267D989DC53C840DBBB6DEF0EAF6772 ac?#h
529,713,122 *362D83CD86840BFB5B2340D52D9D9E05CE6A30C7 ARTFROMTHESTREETS.COMWWW
529,713,123 *362A4BCFE35CD46FEAB990C4D4CE16622A6DE680 adamwaynethomas
529,713,124 *362EECB5CF720214B8F79ADCD208AC3A06DC2ED8 ASAPACKWOOD
529,713,125 *362F42484C355241536E462181EEC1C3BE053201 a&db
529,713,126 *3628300A1F433811233D491C92BA71E0AED99742 ADGCOPPER0
529,713,127 *362814CD90A1277AD5012FDF05F0CDBD9B451BE1 ADOLFO.COXE
529,713,128 *3624483DA3795A1B08737416EC2D8D5B1C941106 ADOLFOLOGOLEO
529,713,129 *362786C4E844AC002ED391EEDD3BE1F2012AD82F ADPKF
529,713,130 *362D2E31FA9AD5261677343F65EBB5A696F8B461 atadurases
529,713,131 *362DC06DFF82BEDB7125317A055543493BB7CAF5 afz3.
529,713,132 *3626F946FD4CCDCDEA39E4091C92221279B92A11 AGUE-SORE-'/EI/G/J//U/_S/OU/R
529,713,133 *3620E613A98F3543F913A817C2365204432776A2 AH;?$
529,713,134 *3626C18C6655693B0339DE23867DF0BD93DE99F3 A/V+O
529,713,135 *362EE78AE1B35FC4A9324D7AB3CCFD321B43FB8D a/hqp
529,713,136 *362A69336D79B0F19A36473DEC2B0BB13ED8B3FC awjwu
529,713,137 *362ADFB7B4A6DF418C2A1C42D4E0F7CA3C0D8C60 AHUO"
529,713,138 *362AFC9EA517DE55AC58C23C94407FC824E14327 AZHDAHAK
529,713,139 *3628825C2B9BA0B97837D8E6568D6D730D241E25 B03"R
529,713,140 *362417547BF5484237973EAF8E69F8FC7E28BD6E akc_j
529,713,141 *362B8B8CC015FA815AEB4886C384D24314BB0032 b"0w
529,713,142 *362853C26EB7ECDA3C35649E4E8B9A9C126697F4 B1(CI
529,713,143 *362E21895544ED84A5EC9D052AC52210B28C014A B42WZ
529,713,144 *36236701413CAE6230F671B70D734FC25117572D ALEX-ABRAHAMIAN
529,713,145 *362E910175273D899E44F0FBB1EA3990267B45D0 B79UW
529,713,146 *362D75B1192AC32BB7DAEA6382A549BAC3FCCAC5 ALLENHAFEN
529,713,147 *36254D976CF7DFFEA7BA5F9D972C5969F71A6135 ALNZL
529,713,148 *36292C616CA6B6C8C783F0920696F78C8030711C [email protected]
529,713,149 *3621672BBCCD2D5F5CBD17C07054FE4ECEBE14CF ALTESENSURI
529,713,150 *362415C62AAABABD28B4310AF97185BC2CF20085 basilavitia
529,713,151 *362FF905BDD2237AC52C9380686456F9FB874D09 al-x:
529,713,152 *362CFE9FAD9B81751757EAADE33998449BFF5863 bastards82
529,713,153 *362D81AD983D5029E92B4FCD7022DA8B81D15AFC BD30K
529,713,154 *3628B5CF0642F9008E83A4CFF0D2D9BF1E11A300 [email protected]
529,713,155 *36218FA26E93EB160AC4D88D45644D3986FAAA03 B#DW&
529,713,156 *3629EDE86015BE88379402F6EDAE0238A2C2906D beginning - the legend of demon castle
529,713,157 *3624FE93E47BEDC5F39E6E3FEDA9974563A098EB ANGELO.BITTERS
529,713,158 *36224BE13552714744C6A13772C046475853E9A4 angiesoliman
529,713,159 *36217D3B345460F156DF7B1D4AFF0526736C253F bernard.oshea
529,713,160 *36276CFF647E88323152E71904D7795CFE241AC9 anndevries
529,713,161 *362C2EA334EED38E10E52DDA232EE384CC0D1E12 aprh)
529,713,162 *3628FCF3BCB618B63AFEFB4E1F923058EFDA608F AQRYD
529,713,163 *3627B557055359CD0593E4BA1D4D25092F990EDA bitches.brew./.spanish.key
529,713,164 *362C5A3DFBD388D4ABB2EA2B02F9CF81FD51394B BITNU
529,713,165 *362312BA7BF57AD7B211CAE85076422BD497F4B6 ARLENE RILEY
529,713,166 *362234261A643AC0F0DB9A93F594904519D67864 ARLIE.TODISCO
529,713,167 *36255328541118E2844AF2B36BBBD58B802756A1 ARMBEWEGING8
529,713,168 *362A463B75135DC0E90D1CEA3C130F0E2D6E9DDC BL6QNUPCYAG
529,713,169 *36258C323A411510AC394A931BA6E021DBAB1399 [email protected]
529,713,170 *36214046E73C65B4A8EDAEE2BF957E584285C42A Bl;h
529,713,171 *362ABFE0A3567F8BBB9A58A033576CBED647BC1A ARTHUR.KURALT
529,713,172 *3622BB85F6B0326A9192A6360FCBE132BD37BAFF ARTHUR.WILFINGER
529,713,173 *362B400946E65811046E2E8224547D93688F9CB6 ARTICLE.ACCORDINGLY
529,713,174 *362FE895192F473011827CFC10F1616E6187D8A4 ARTMETTERT
529,713,175 *36243BD4FAF8AA57DF480E5FA81E89E3A64963DB b"lr%
529,713,176 *3627BC2F6589AA22E208AF559B3D106AA9669B5B blzhq
529,713,177 *362CE18FFA6B2DAC0C57D8DB18B599FC41FC8455 AS_LP
529,713,178 *362997315BF6C130E32953257D2DF9711F3FDE5D a_s.v
529,713,179 *3622D6429122754D813C570A1D69B578E4D71962 atkfh
529,713,180 *362D7DED4EBFFF8E2D5A6C3C3E5B2DEC6887B25E ATVSJUQQ6
529,713,181 *362D459861C1AEB885EA8B1A04CB6BA527DF18AD [email protected]
529,713,182 *362BA965B8358EAF80EE8086BC94F08C13EF6927 a%u5t
529,713,183 *362548156A4152D0AAF904EDFB4B4206DF5C178D audrey.mcmillen
529,713,184 *362400A8A303D169859CE0D0504C2025AF80003E borisklatt
529,713,185 *362CFBB0EDFDA6F02132F7015262DF656F04ADEF AUGUSTBAILEY
529,713,186 *36240AEE12F0FA61C139D201681B2DF7E81875E8 aureliogaetke
529,713,187 *36234A7C85D2A2334EFBFEC467E1AB2589B362F2 BP4GS
529,713,188 *362EDBA54298B1CD7880990D6F03F65F94C05823 AV1LA
529,713,189 *362023695AF6771FD6E81C2A41DDBC33BB5F9F06 avsbaby
529,713,190 *362015F0AE6B2EE0BB00DE59167B24E88F28152B bqt+-
529,713,191 *3627E3E5D507B94A4759F465B2A930524CD03D08 BREEDINGTROPICALFISH
529,713,192 *36278CA44B1C5B3E735DC2269783429ED7464188 brendaz
529,713,193 *3624751C55BA980ACB56880F70F9D096C9446F29 brentonwischmeyer
529,713,194 *3623ECAE017610750CAEE9E4056F89811DE77B62 AZIZI-AZRI
529,713,195 *3622B96313A4568A3DA877BE79A96CDB2CA2E854 brickhouse--b-r-ih1-k-hh-aw2-s
529,713,196 *3624979E03EB90FFB49CD6CD201BA8D12A15B475 brnx2
529,713,197 *362CBC56D9ACAC9FD5045AA12609A280547EA37E b"0w
529,713,198 *36261D32702407491F70A2BEF3A9C60A13D1CEDB bscy8
529,713,199 *36246DF71EDE83E66AB8CE387A6607AF62370E1E BSMI%
529,713,200 *36287D8AEE6988857A80F2957044459914972CD1 b8vc-
529,713,201 *3622AD6BC4E83F2CA7D6F911E0D2B959366A63B4 b.a.-johnston
529,713,202 *36254647C982E998E4C86D57FB838640A34D3146 BARTON.SLUYTER
529,713,203 *36277A5C333177A514E0047B542CEBEE24DC3932 basileliezrie
529,713,204 *362A9360C071990772E018367AF6F25A818961D2 b:wus
529,713,205 *362334B7FFA6C8F80B15EE464E6999F23CB24034 bbta
529,713,206 *362A8393CD0C8450A3E774FDEC888FA053E36619 BCORI
529,713,207 *3623006E6F7F151B96635A7E214A8F37E6328C29 c1rcq
529,713,208 *36277ED4694F915B4CA18948091AB39B6C7AB395 C5J4H
529,713,209 *362B9FB6B2C3D90EA11B3A2192186B38C2D196E9 bennettstaniford
529,713,210 *3622DEA3F0B7B4EE3275A800D7E267F00391C757 caiania
529,713,211 *3620CA5F80D11326EFEDD1CF27981C753BAE9B0A [email protected]
529,713,212 *3625E93E19FAEB880D1CA443D5C5376A5812D2CD BETHDIN
529,713,213 *36205576DDB29A7674D1005A16BFE9EF7D5B3D70 bettybook
529,713,214 *3622F3006857EFDD62714C87CBB52D93A43027B8 BF&%=
529,713,215 *362BE73E412415CACCA58A1A6E79E54F4FA5B4A8 CARLTONBONIFACIO
529,713,216 *3625FC32792E29AE310E9362FBBBB30BA92FD765 b$g.v
529,713,217 *3622464D51A7DD37EB1A7CC9C83DEDF10899C399 B..HD
529,713,218 *362E90F8A03EC6ABD28C0E0679E9461748DA70BB [email protected]
529,713,219 *362DB05D144A9824DC547E6339CA56896DC2290A carrolebeid
529,713,220 *36286BC3355AFA9273597F43BE48B0C97B426D93 BHsi
529,713,221 *362AFDF608ED0B4F0153A62A59F3D9FFF148250D cassiesteed
529,713,222 *36230F7B76BA7D3221C5C52319239D3E8F3D6DCE CATTGCATTCAATAAAACCAAGAGCACAGCTCCTCCTAGTTATACAGGTGTCTGGCAATG
529,713,223 *3625D2F559F15613AB23720CE5ECCB73AE17A22A billiecreviston
529,713,224 *362F44DC1197952BA824C998B6388473544C8F76 C?B0G
529,713,225 *362330DDCB85A74E0400B00729854B34C565FC1D (BLESSEDBE)THENAMEOFTHELORD
529,713,226 *362FEA463A3A0F8AC6516BB25286AE5E82A0E856 CF5T)
529,713,227 *362909863704C5BFCFB288CFD07E0A7B53626C00 bnedk
529,713,228 *3624A88596F7724F16EFB33076CB2A51C2408901 charles-jacobi
529,713,229 *362EB400BF17F5AEB1D7462CB4955774281BDCFD bolichero
529,713,230 *3623F12CCB23E21F8AA679A4DA4ADC104DADA3CE BOOKERARTURO
529,713,231 *36264A22996294D2C1436DED2B10F8171EC283A6 Boomin'-Jeep
529,713,232 *36266A04D0634D7B8842759095D17A5D0B1AD68D boondo99ler$
529,713,233 *362E7A9E491FAE12CF1070E1485587812CDBB04B BOSÁKOM
529,713,234 *36232746220EE473E98D783F86880CF31E6E88EE CHEVELLEF
529,713,235 *36264022510C11DB9313BE827A26E8C97C8DE88B BOYDGUENINGSMAN
529,713,236 *36240D27CE36B6BDA874F35EA364EC17657B490C chicochurch
529,713,237 *362D1EFF8E0AD1B1A9F8D63A70FF3F8D86DF8935 BRADFORDKAHRER
529,713,238 *3623E26E45DDC6F4240E577D331584B67AF89205 CHRYSOMELIDÆ
529,713,239 *36237140D0CAE4F0CB405C65A8DF6F0961701FF4 [email protected]
529,713,240 *3624F464F939B759E4C20F3E68C13E28F65EC1FF ciballis6
529,713,241 *362A78562D47BACD316D41366EE680727FB52C34 BRANK0
529,713,242 *362C68A044F0B6E845EA22CC4946877C0285C1B3 BRET.OKELLY
529,713,243 *362702478C97AEE03DE03B9EB72ADE5F575A13E6 C&"K
529,713,244 *36222C2D0BB669FD1E58A905CB0C839BDDBA10D6 C#/KP
529,713,245 *36260669E2A9FAF592EA37247FDC3CEA1248557A BRQ7
529,713,246 *362C5544F010FC3A0817316A291A618C78CAF710 [email protected]*-*-*splat
529,713,247 *3625D8131E43E13449B6DDCE285EE7015C78A0AD club-twirling
529,713,248 *3624BD5DC8F80BD6BF746BE5401D331B7F9E8CE1 [email protected]
529,713,249 *362023E6C37FF3D1199CC251E1DBEA9A9B042C88 cnolc
529,713,250 *3626637C4E7C0CD184ECA1BFF9E81849079A75BA coatigrac’h
529,713,251 *362D7B12EBB6D08C4E07C1814BDC85565C225AA4 bustergoller
529,713,252 *362F50E52A5E9D6603CA34949E2AEA07197B0244 COLORIZEKAH1LER0AY2Z
529,713,253 *36241D6B786DE7FBE4CAE51A7A78578AA04775CF bv_!-
529,713,254 *36273FF882A6EDC585EA1C353BBEAAD63E279273 comicdefantasia
529,713,255 *362F0D3ED52F3E745DF25A3A03B1B3EE088DC973 bx=$l
529,713,256 *362CDD3CA4CB8E4D6018A0A8C87BDC93DB75DEEB co!om
529,713,257 *3629C02A93AFE3712FB8E11434C3ED38BAF02159 C0?ON
529,713,258 *3620EBABB1F9F9B213113C107E907D61A4322DA8 c17v8
529,713,259 *362BCF3D0CFE90E5CDE87C274989AB40FEFEE75A c1&+f
529,713,260 *362DBB5F240DCCC25322A5D475BC2897F510156C cq/&
529,713,261 *362F2E6D6B08085F76830914B997C915328E2EF2 CA?EM
529,713,262 *3626D6F42A4F97A39F4F701459DEDB1AC042DC4B cr6l
529,713,263 *36297D126EDFA12A57D77AF1FC1FDD78FD1AFD35 [email protected]
529,713,264 *362F9DE93AEF7D62779C02280F0AA913138A7A05 CAMOATI8
529,713,265 *36228ACE852F312A764A790CFF3758F6699AB7FA camorrist.
529,713,266 *362B84DB7B732FDEE1F8415F372D31F10FA6B05F careybondi
529,713,267 *362626EE83505B3D62AACE02AE91772409C95F43 CAREY.RAMSEY
529,713,268 *36279FAE2A7008E7F50FECAB30769DCB159CAD1A carpet.jargon.03
529,713,269 *36251FC1DB242D57192BB538545BC1B21B910F54 CARTOONTALKTHE
529,713,270 *362B9CFB0D493AA2D2849DCC700BD530B3D86FF9 [email protected]
529,713,271 *3627C66339D060DA091BE49A8B118F2249A4D7CF [email protected]
529,713,272 *362535A77F0815F6D27ADD50D83D078B2DBD583E cu,&q
529,713,273 *36287AC2CAFA5EEF3EEAB6C0157DF7EFB17A12BE CURTARMENTEROS
529,713,274 *3621E33F3216DBCB9724D6EDC0D9F565B4213335 cavel
529,713,275 *3622ED4CDC3E20520D8AB17672369257B01CB896 c=d9)
529,713,276 *362687F6D26238ABA1C27FE4E71B1CCB58705CF6 CDLGF
529,713,277 *3621B7242B19A69A73CB8246A1A0EF874FD6EF45 CYRIX'S
529,713,278 *362058581495D1A437A0783F9D735C17DC3D421F [email protected]
529,713,279 *3621D63FA90E1492A795AA12183D8A8A37626D7E c$gs1
529,713,280 *3629B10C89EA8FD00D8DA53046ACB8E3B37577EE [email protected]
529,713,281 *36202D8FE53DBEF544B2DD417CD5D27702BF0F95 CHAMARVOSEIS123
529,713,282 *362720992C0DD54F0777B9A39214359E1B14F881 CHANCEHERRIMAN
529,713,283 *362FD6043FD8AB231DB0B4C2CD6FE154082501E4 CHAPMANXXXX
529,713,284 *362436950585E9D44069274CCE1617A954CD09D1 CHENYUCHI
529,713,285 *362938826776E67A250F7F438F3759E1A798524A daltonkreger
529,713,286 *362F9006AD29C7E5FAC56EF3BE78D2A5B997CDF9 d%am
529,713,287 *3627BA25CB9BEEAE8B0BA8B27D5CDC33A0A069BD DAMONBURTTRAM
529,713,288 *36205B5D1C249F6BAB15F08DA72B48CB8DECE916 chfdk
529,713,289 *36261E88D76CE51A59947269D3170FEDB922E93A CHOPRDAV
529,713,290 *3623DC4F4A8650168ED884CC39E67FFD4D3747EA darnellkonarski
529,713,291 *3620473A0A4FBA93A04E6579EC25F5F3B6763A2C CI#6(
529,713,292 *362D806C1CDCE855695C01A75C9CF916346C97F0 c#k)
529,713,293 *362C33FD003C965B1A575FDFC1D894172F274E25 DEBYE9
529,713,294 *362063A9942AE7620546A2F9208E480BDBC6A817 decisa|spain
529,713,295 *3620D3F45049209A373F8ED47672E132125C883E CLEMENTE20MLM
529,713,296 *362DC24D19B2E33334DF6C06836BFF5F068DD499 CLIFTONFAVALORA
529,713,297 *362315FCB0C0F32FB5F973D17EA357B3706693A2 D-EL;
529,713,298 *362856B9B8F472B12D0CB7B405D0AA08F3D60FD1 DEMARCUSHINEMAN
529,713,299 *362FC06E655A28E9BE281657414EF25CF2929FF9 demarcusswider
529,713,300 *362BC563BA155FAD05A4ED757BDED4680032772C clyo
529,713,301 *362077153C1ED66ED169C5BC0093DF90F093E83F dennisripoll
529,713,302 *362BBF4C8650744B0F641AE409F166498501A2E4 CM6A"
529,713,303 *362FF3688D600400BD5443CEFCA75031103F8235 c)nvn
529,713,304 *36220525A0BD5CE864A133FA1778C345254D1632 code industry
529,713,305 *36247FE0F2207A7003F70C979B6997FEF8C08E3C cofq_
529,713,306 *3622383CA0735BECF647BB0E5126E6173FB9D810 dfb%;
529,713,307 *36222D103717DC4CD320D39E29CD26F63E31B657 dfm"j
529,713,308 *3620441E85AE9C6E6B614B45E37123EB3B147A1B d&ft.
529,713,309 *362A3370E9FE1D62A3F80A3B1074A537CE4E6F1D D"GFX
529,713,310 *36200EC0E93223ED9D8A04738AB43DA5232D6984 con53rvab13
529,713,311 *36228F9094B9D169DE94541267F455E703794A76 CONNIE.HINAMAN
529,713,312 *3622A3BD2B5AF2814380A93197127C6D691ECF72 d/hi;
529,713,313 *3628539351D4C758B4353A4C66369563BA4D85C2 DI4NN3RICK
529,713,314 *3624524B980015A6D88FD90F84DAA2AA45981E92 CORYHEWELL
529,713,315 *362632F053335B73EF602C1C34C7CD3BEFFDC6BA d(ihm
529,713,316 *36234D3ED694E35AB7FBBBE92395C6A09F21CD3C [email protected]
529,713,317 *362900918FCF35AD12E471DB43B92314811DCA60 cp4i)
529,713,318 *36278DAC9B86C56BD90E1881FEC68DAE06013122 DIVINUMQUE
529,713,319 *362BF7A986310E077742D3047B71ABCC5B87ABEC DJJAZZYJEFF&FRESHPRINCE
529,713,320 *3622641755FF16BD73A728757D410478538DA6D0 DL6!;
529,713,321 *362A96D4CF2CDA5C4BE47AD1545482C5758134B7 dl=.o
529,713,322 *362A91C9F3908A0318E05C3E874504A42D8AE7B9 cs:b9
529,713,323 *362F1AB243F89EF525B10633A5177B804A14FBFA ctz+.
529,713,324 *36261C48322D3CE6618C6034476997DAA0467205 DOMENIC.LEGAT
529,713,325 *362DBA812AE55A90D1B8EC3F54258509A0BA3166 CUG5D
529,713,326 *36203CC6C8D9F9B2F732F3D3E1B7B90C02BFEBAB CULTURECG44FRMUSEE
529,713,327 *3628C0A15934727F1953B013B3BEB2B285F034BB Don'tYouKnow(LevelKVoodoo&Seranoradiomix)
529,713,328 *362C5F3AD0F218B70CF1A00AF9478F7B7CB23640 doodgedeelden!
529,713,329 *362E8F09613706D873E30C6C67B1EAA6538B7C61 DOUGLASLO
529,713,330 *362A84E8191446711A03D5F93BB0E301087F5756 do"v-
529,713,331 *362A3967BE075A12C5684D5F057496FA418304DE DPVA!
529,713,332 *3625B65E3DB566B751AEF52C43727F20CDB41ED8 DRQ&N
529,713,333 *36268B5DABEA69D36C5CDC4D4AEC5086A7711630 D45TV
529,713,334 *36298041CED396A7F25329652FF18290D57DB5EF DTELAISED
529,713,335 *362C5679410FB2FC3893A2B4C07430A20F6A8A57 d?9.u
529,713,336 *362750AF632B88AF4FE72C50008ED017139069BB DAMIAN.KANG
529,713,337 *3624623EAF5A04AFB6CAFACB872A974FB3C50BF7 danielbiddy
529,713,338 *362F2649A6EEB76CBF1232B3C6C213D78123B1C8 dantegarant
529,713,339 *36260AC7615947B01A125494EA0772AACEEBC40D D(WQH
529,713,340 *362D5A19935E6D9A258C49CC67B1FB617FE1E944 DARON.TARZIA
529,713,341 *362BCA1B6DF8EA74D46A997E120D8C73A6001CD6 DARRELNAGODE
529,713,342 *362E74DAA589289D0B7EAA55C3151F028C4A0B76 dy&q!
529,713,343 *362D1978FA674DDA53B1C95C1563A28DD509997A DYSTANT8
529,713,344 *362D498F86262ACC449A679E6E0FF3D268F855FE DARRICKARRENDONDO
529,713,345 *3624B0FD454CE299F998C4522ACE8F2E4F11C9D4 darrylsuda
529,713,346 *3627210F65B61CC80BDB2327C861A720C24AA580 eaint
529,713,347 *362D8F66FE030E3F05E76338B4EFC0D6061B4310 EBKLUG
529,713,348 *362A697636D5729BAFC296C7F3BFDE9B41079D75 dci5
529,713,349 *3627161FFF0DED5A8AE799EE21A6EB54A4D7FBE2 DCLKT
529,713,350 *362B2DBEB9F75E485FB0DB8121C4519498F70BE4 d$daw
529,713,351 *362B2A710E05430B1022F177D223B386ACAA6DDF EFFEGENE4
529,713,352 *3620A97755869D8FB3DAFE044DD19F1E9325BB2D DEBBIE-VALERIO
529,713,353 *3620C7CF183B32F907599BB3B18159023FB781DC egégzlmmxnnnuuninnnlll
529,713,354 *362BC42C6F22493BB4E83B6FA96C31F9C7B1473F eh$nm
529,713,355 *362798804208307F7CB1B251761B969996B29F69 deflourering
529,713,356 *3629CF8704F1272AB3E3313DCC16788BB28946B7 DEFOSSES
529,713,357 *3620419346B4D3128088641B0BADC4BD77BFB0BE elbdn
529,713,358 *362A2C3174F7D001FEDE88037832E391D03FD813 elinorgaard
529,713,359 *362228B1685A6E1F4264E115B90FC3A8595AC86E elliottmaguire
529,713,360 *3624A57DA5D5E7CC2041BA46B3DB12628100B864 DERITHA-KINSLEY
529,713,361 *3627CA5590ED9685EA36D74C3149C4086F4F33CF ellisfly
529,713,362 *3621C87CA99A8FBE3CAFCC3A5085B67F2E2CE834 ellismerklin
529,713,363 *3621B98DBB739243EB96BAB7018FF9D17C0A34F8 [email protected]
529,713,364 *362D78965DCD2BCE35FC0F25B8D24B73A119FD49 Devalva
529,713,365 *362BF259F41CBB1164BD896A3A4D903F8F9D6AF8 dfxs(
529,713,366 *3620BC93F312A628CF0AE6B48C23E02070FF159D DG8XP
529,713,367 *362C193D710C06A2A4C5C9CA5FAA93D32379CA7C ENFARRUSCLOEMOS
529,713,368 *36297C069280FA90B5B6392028DA564D19184747 DH"&S
529,713,369 *36245C049BCD5720BA2AFA9803AA3406B81760A7 enwq-
529,713,370 *362DC9FE6B69AB10D7DFF4000BA78AAFDCCF199B [email protected]
529,713,371 *362D8FBB5FE930018EBCA1D933314B8CD5154B3D dk2n
529,713,372 *362A8B636DB7D4A4B270A38FE0A5106C3987C96A escuela.normal
529,713,373 *3624BA3154D9104027410467AB19F3EC6AE52241 DL3MMA5
529,713,374 *362CB51EAA82086BBE166576C5BE41DDFD00C6FE DLOPECILLO
529,713,375 *36298053A5C17B45FF830E9EC5E4AD0554C836DD dmi&3
529,713,376 *362FBD745AD471A8B5B32AD48FEE16D2C79C0792 d/o2w
529,713,377 *3626629641BBD7AC26BE9FC4343183A381A4F58E everettsysak
529,713,378 *362DE5F7427862D1EDE1A5BB45425B276719A297 dob5h
529,713,379 *3621543E345BA22BACE9467906AAF4BCE07AB7B6 DOEPASMO
529,713,380 *362D6E22A05D6359D63C67B9D294B3E528FADE72 DONALDKADRI
529,713,381 *362ED5A300F5FC64B5640346ACD560EF60504B54 F11533
529,713,382 *3622D5B572395FE0DC44715744B450FADD9B36DA f1ca4bee0c4bc3247b1714ef5810b204.qjc0jtgg
529,713,383 *362A89CCAF95E47E86DE79EDB7781B1FB2A27896 F8C&
529,713,384 *3622A0F957D9375802FBA40576134CD66A3A70FE DOSMEJORQUEUNO
529,713,385 *362335C19F7974A69FD5763A1910967B70D6EDFD FARNHAMJR
529,713,386 *36250D671CF0B06A4DED8A82C2EC66944083FDFA FAST160SUMMERWITHMOR
529,713,387 *362D6C635C9B6AD36EF5765DF69B10701F6D6003 DOUGLASSPOPPEN
529,713,388 *3621B147B668F040B620B3A2D67F22C7C497726C DOWNLOADSONGSFORPRESENTER
529,713,389 *362FF9A859706A7C34C19F599952D3620F876192 DOW=P
529,713,390 *362629F69C5DE5F4FC6BB3C28BA4B9F2F86B8137 dp-5y
529,713,391 *36227A7FB664F31DAB76125162CEA5E12A6E7DD9 [email protected]
529,713,392 *362F49A5474F01EFDD51EABD45016900FD019CC9 ferhcets
529,713,393 *36269BFB0D6001EFDB0DDDA9EA7CF90517031324 FIDEL.GALPIN
529,713,394 *362375A4B428DFEC7FE536583AA77BA9BC4ABD23 DRAQUIUS
529,713,395 *3620E6E5A7BE367512D2BD7CFC0166C35EFC22C9 drw1[email protected]
529,713,396 *3627F55FE9B955FCAE7D16DFFD9399F2A183FFF8 FLIRTJILLS
529,713,397 *362D476E219280C7F9B911BB68EFADE8AE50DD5A dt#.=
529,713,398 *3627D825065171FC2E64E23BEF784A594D1621F5 followthatbass
529,713,399 *3623195ABD4D58C3C3E1A0F4E81A82D9E36694C2 duivelskunsten3
529,713,400 *3620FBFDE5EF7A281F5D4E0EEBCBC02F2BEA66F1 Fredrick-Ford
529,713,401 *3628E218E152967255A1E2C5F12ADE30D24D48A1 FRENCHMENN
529,713,402 *36201157240F4E4D82C193D664423469E03947D0 DUWANNA-ALFORD
529,713,403 *3622D4CA7E5D17DA071764FB2FA964A39675E39C FROGHOP09
529,713,404 *362A8CF7B6C5D013BEEC228360B1EA1FF54EB0BA [email protected]
529,713,405 *362BACFCA33CA9DD980756D2DFB015D26CC2D64C DWB_
529,713,406 *362EF83D36B857AB407CA7A70948321C58F11BA3 „GALLIGE
529,713,407 *3620DBFD1573DC5DC8E37614E1D2781BD957FE4E [email protected]
529,713,408 *3627B44C438D874A5B929756943F97EB5DCF32DE D:YXE
529,713,409 *362A9F1F8F6E47A36526D96432A774585F7F7C72 dz7rt
529,713,410 *36289B86F3EB32E98043FD2E17E8377C516643D8 garybirner
529,713,411 *362DBA1A7AFAC8475ED5878A75EACDAD4A1620B0 e'a3
529,713,412 *362BD25CCADD1549EA2567794570A4D41704678B g&aw
529,713,413 *362C062703E89B8B6ED32972C0BDE8BEA9FF90DA GEMUNTEN1
529,713,414 *362D29DB88817EA31B0BDD3A849BBBE6074DD21F ECH
529,713,415 *362E34B19A16AC508788AFC211E112DC23641992 GERMAN.SEGUNDO.CAMPOS.V
529,713,416 *362911509E673CE9344CE70F0BB74F74EB4062AD EDMUND.YI
529,713,417 *3622E62CC1130A8C24DE61DCF7AC219B9FC00EFB [email protected]
529,713,418 *362C81E701E41528816B73A500AFBF8B620BD4A9 edsinstack
529,713,419 *36200824B651CB29B0A692605A975FC18B73AEC2 GHBEVYJ
529,713,420 *362203CF6C16FDFE59B0BCEDB1C097D1C6278FB6 EDWINWEINZETL
529,713,421 *36260AD29AEDF971645AA5B7A5B28CFCCCBFAEEE GIUSEPPE.OVALLES
529,713,422 *362BAD0F72D793D6FB908D4952B6239CCD05E7C6 EFO
529,713,423 *3628C1373ECE1A9128850A3CE7F16073CA674C75 EGÛMET
529,713,424 *362E25D283EBB6D9235EF71F0846D37122130E5B EHEWEIB4
529,713,425 *3620557CC3FB027B6423AB109B24477DC2AE5EBD EHK+R
529,713,426 *36276A080A4EB577F7668354A99EFD45324AE4FA EINSPIELERGEBNISSE
529,713,427 *3622346D97476A4F4C09D342DB3FAA6E2A9229BC [email protected]
529,713,428 *362CC0ADB75912D8476D260BBBF2A95381275F6D GONGW[email protected]
529,713,429 *3621B7D0BE57516FA7E2E9B4ED579C3D75DE13DD goodbar:bigdaddy
529,713,430 *36213C5409A86F25A950AF83858AEE9A46308ED9 gradycurnutt
529,713,431 *36284A766DA9543AC4D0064437C0F3D8A343F512 GRAHAM.GELERTER
529,713,432 *362E5C5BBEB7E1C4E50D0A789D8D1957004E7541 ELAPID '/E/L/@/P/I/D
529,713,433 *3623D75405A94E6E1E13B11EDCDE433BCDF50551 el:b2
529,713,434 *3628ACE541B68CDE119DAF12B65E9B3D61243788 electropanic(eatstaticremix)(feat.yahel)
529,713,435 *3629ED1E77955CA24D3E72C2AD0B8948611F5774 GROVELED
529,713,436 *36265AB9083B53CD52AA1F2D3E931809D9725BA4 [email protected]
529,713,437 *3625E7487F21B2CF2BA37DAF16EF7A9F5F611BD8 GYNAECOMASTY2
529,713,438 *362DFED13346937D826E8916481BF89594F1C0E5 g>z+
529,713,439 *36204BD7BEC0621EE55454ADC1818B4CE1F6B153 ENCOURAGMNET123
529,713,440 *3620F4372A4FF27CC173542BBAE12764489F01D8 ENGUEULÈRENT
529,713,441 *3620A18F15F98C4794309525F486653FB411442B eninkiin6
529,713,442 *36296B1941A72F8F1C235112FAC355DB7EE7E2ED [email protected]
529,713,443 *362440F2BF7D15E2794817ADB4FE651ED111C7D8 enm2t
529,713,444 *36252A7CDA7FC84C99FB5C161BFB5C9F902927CD [email protected]
529,713,445 *362A4269E477CB8E1A4BF9745C853A102E0710F2 haris.ramic
529,713,446 *36222E82F8CF9BF3FB88319835BAA38ED94D2516 ent%p
529,713,447 *3627E65A1C7E42F8D8EB372938BB697268939747 episode03-2:fitthethird
529,713,448 *36276C14E83ADFE33E4721B2641788BB028D2BB2 HAYINGSESES
529,713,449 *3623B480556EC98A878AF2AF2E82CC43A1EC2DDF EQ/XG
529,713,450 *362CE8F2EA19433BD347CB4051818951E08A06BD ERRLG
529,713,451 *362503A5A7368BE508F5244B87F61D56C0D9D8FB escadronschefs
529,713,452 *362247F3689C1A978DBEE4A04D8DB623BEA6F8A1 ESCARREMOS123
529,713,453 *362633A93F3736B71C4AFE3E36880878EB09B0BF ESKARPE6
529,713,454 *3625AE0C3F414C5BE492073994B8698CD5F34EE1 [email protected]
529,713,455 *362F6534EBA67A86E47202404EFCFF5AA8103584 ESTCREEK5
529,713,456 *36251E8E5F2703EF06A6223F1657006F0FEEACA4 ho
529,713,457 *362A2D97239FAD35323A1FDF809745B4CA0B1C8B holly.jeffreys
529,713,458 *3625640ED1EC8F5B4FD9EE2A591907A0FBC86EDC [email protected]
529,713,459 *362DD9B7EFEB3E557791D3216BC44458D6C98406 HONEYMIREL
529,713,460 *36278037A586F07F6577387E4B48DB7BF7D803E8 [email protected]
529,713,461 *36227EB5B1108B79BBC7C71E15CDD21B58F02036 etreisop8
529,713,462 *36250CC07201F1EE56329CCA950C8B01BDC7833C EU!
529,713,463 *362FC9E60C905A2AB663D399541D29DBF32496F9 [email protected]
529,713,464 *362F501BC9DC2E654A1B95FF8231FDBA55D20740 hoytwardle
529,713,465 *3621456E34D07657C904FBC965BDE34FB9600C8C Exactly-What-Is-Weird
529,713,466 *3622B16782A3172DADDDA8ED4668A57ACB834FB0 [email protected]
529,713,467 *362A9791900752AC0F287CBA8518BC8119FE427C HUBERTBARNHILL
529,713,468 *3620264BE4CBDF66F40467EF1A7310EB9112C636 EZEQUIELMUNDEN
529,713,469 *36229C4B830273A1EF4F4F1F726B876000A480DB HUNG.NEUMANN
529,713,470 *362FD244E0156D3651AD5E834C3A0289DD13D2D8 [email protected]
529,713,471 *3623D2E0D6341A5D5E2AC452194F889319D338A6 F6018ED2EF650B9CC39711D7A7A8D03C.YAMAM0T0
529,713,472 *362B923464A4F7B66E78BFE331C223DD2B5F4F86 fa1me
529,713,473 *36244F670BBA1626A67E138562297540C320F5C3 farmbrough'-'richard
529,713,474 *362B9A1B336B1BC566C5096C39C987A7B9AAB4CB FEDERICO.VEERKAMP
529,713,475 *3629C36F8522F0EBE64D7A971706BA8CEA612E48 FEFE2008
529,713,476 *362A9005E4FF1A94302ABC08981CE9C09F757977 feudist
529,713,477 *362731E08312E027DB6ED52825122A7ED9F3C00C FFARWELFOILANGYFELACHLON
529,713,478 *36254281B44F392F19F6CD374ED8495FEC1B71D2 ::FFFF:68.110.245.75:42225
529,713,479 *362BEFBADD8C1E430A0CDAABBA2EF3C36526623D fidelparise
529,713,480 *362BFCAC37A4519DFB698F90983E0EAAD3901AE3 filibertoschifko
529,713,481 *36220B1E9CB7EDDDB1B28293ADB506BD54ADCAFF filibertosillman
529,713,482 *362E2397C0FB4780F75134C166483883C321C8CC finishedproducts
529,713,483 *3620E412510132CEA947ABAB11B4081A0DC94AEC [email protected]
529,713,484 *3623ECD39895CBCA6B701C2AEFB3AAED3A91376D FIZZA AZIZ
529,713,485 *362CCB9D60CDA712F818B27C5DF248830A2594F2 FLORENTINO.DETZ
529,713,486 *3621B8F3E79404624C0F05C4B0634A33C48B7846 incompetentie8
529,713,487 *36263D31E7BB79976D7E4D3B7187A279FF2C8912 FOXMCCLOUD
529,713,488 *362F7BFEA049F3453EC2B93E532BABE6D592E065 invidïato
529,713,489 *362D36E387846FDDCB494B19B0675D262CE2AFDA FREDRICKSOLARZANO
529,713,490 *3623DCD4E9C1E486EFB9D655F0F171D39E116AD1 isaiasbachmann
529,713,491 *362719001EFB349DA27AD69BFCFC0A3ACF6D5919 FRITZMOOTISPAW
529,713,492 *3628D836A7883938BD63946326425199DD442A8C ISTRIANI3
529,713,493 *3624ADCAB1E75F004D95AD353D2889B77170A2F3 ivanmiske
529,713,494 *3629E5F27AC072E77E84273D9E2DEB81391176B7 i%@y
529,713,495 *362DD43237DC0537B9006447ADA0CFB917AFBD88 JACKSONGJELTEMA
529,713,496 *3626D9C8356B0F08CEB33BAF6A47CC10EAAB9BEA [email protected]
529,713,497 *3622E9D519B7F5EDEB41940D30C2E886191DC227 GAILDIOGO
529,713,498 *36266FF3A48C8F5A3F046EFC937A57C5C066E9E6 JACQUES.LEHNEN
529,713,499 *362560CF1263EFEBE7A22AAD9CD9BFFBE8F6E24B JADA03
529,713,500 *36297B8C15AA6DF75FB6F2CF3487CB9FEDA287D4 JAMAAL.WEIGL
529,713,501 *362A1B11910C241C54EF1F57C8495C853F2DF963 GARDEN-OF-DELIGHTS
529,713,502 *3629AFF3E50CBB776ACD17E0BC3BACDDC9C599A1 GARTH.KUSHNIR
529,713,503 *362B0833975B1015E2F4B2648A996C899AECFE1D GARYMILHOLLAND
529,713,504 *362BB92D127C7666EABB5BCEF3B7BA736AF81CD8 GAUßMETER
529,713,505 *362D783651054414B7CCB7546803459BF2061ACA jarrodgarsjo
529,713,506 *362304D7DDA7A989E9CE50D95CF2839153281E14 JASONPAECH
529,713,507 *3629253342EF3E65DD86CCFC3A5A6D52A7837AB8 GENE.GARZIA
529,713,508 *3620A3553BEAA970F47AB82420611AE5FE1D036D genenormanintro
529,713,509 *362ED65870EFDEBB570E8EC6C6CEB74D74DED409 geoffreybrodt
529,713,510 *3623E76211AA3BC0609BBEE9248B446B0D2630B7 GEOFFRUSSELL
529,713,511 *362BDC2EAB215971035128A7FA95A1D104DB7471 แสดงGEOMAGNETIC
529,713,512 *3628647AFF74D50FF057EDE4E48EC91DAD5E7985 JEANMY
529,713,513 *3620C043726EDB135FE78E83B4EA4DADAFB1F8A8 jean-tis
529,713,514 *3629A07788BE34B7B8C12D399341E0A420902335 GERMAN.MODESTO
529,713,515 *36280B61D6D57693BB0A8885BB3975269E88676E JENKKILAITURI
529,713,516 *362AB0A8F6C68F8AE30202E212583185AADEDD8E JEN-SALO
529,713,517 *362B1B5D9931A00DA0368FEC439EC75F245C954E GEWUSSTESED
529,713,518 *3620DB747AFCAFE0944FE1500D91176390A4F8AD JEREMIAHTODOROVICH
529,713,519 *36211AA88A3E8ADC04961E9BB551AD0928FEDD75 JERMAINELEGHORN
529,713,520 *362BEF8A4EB3F82767AF823106164831E61535AF jeroldschacht
529,713,521 *3620EE1E9764F93F31FAB6448AFB33694A098AA9 GILJETTON
529,713,522 *36218B3A71CA99D0FAA9C3074EEB24D53FA9DBA0 JESKELLED
529,713,523 *362FEDE0757AC5EFEFB84D67698948EEA4CB1EA1 GINOPOHL
529,713,524 *36219B66E0B9A573F425511222C01CBDA8E583E8 JESSE.YEELOY
529,713,525 *3627F0ECA3A1F5085AED93F2341806CF35076FFB GIOVANNI.BUTTS
529,713,526 *36248D26BC0ED0C3A92232F17B77B37C3AD0F6AA GIRELBBI9
529,713,527 *362CA4D48C6665056D010087F8BC2F063927EC61 [email protected]
529,713,528 *3625E0493D64445F75BF7D76E394E3C0BBBAB481 JIMNEZ160DOM
529,713,529 *3629A8FAE0F7AC1AA4E8221E5DCF49EE267A2882 GOFAMILY5
529,713,530 *3628B97C4B08A727226CE60A5AB3CA344764B262 [email protected]
529,713,531 *3620260F95D6A345A07BB7647B258B254AC1FF83 JOELHELT
529,713,532 *3623DD43811C1243F3FAE4DDAA03460B71DFE662 JOEYQUINCY
529,713,533 *3621E2933CB1670FB925FD98D32E830AD0F3832A GÖSTERILMESIYDIR
529,713,534 *362C734D688E5C09D2F47C79991B78787C1ED14D gqwd
529,713,535 *3625DACFC92D8F4A9C2FBBBB661A3221D27DB006 GRACE UYEDA
529,713,536 *3620CBD6DC14CD810B9FDAB787610C6706B966FB johnydavid
529,713,537 *362429E2AD1176485FA0AA176800C7A4A838D6F9 GUITARASDFJKL;
529,713,538 *36284C63B5EE3C7B51172B484D7AFF0FE56F476A gyémánthegy
529,713,539 *362D783828BE80FAEED3C603105B05E7A14EB697 kafirshindukush
529,713,540 *362B97B373B7F3C21FCCA968FFE5C34A3A5A2E57 [email protected]
529,713,541 *36292A595CC9E2701055B8E3A8AD55AF7EA8BC48 KARGOEN2
529,713,542 *362BA4457C6F2B0A6CA76E17B2C0ABF1B62AD251 KATERINAKATTY
529,713,543 *362B38B9B4330C79B69751B887EEFE17790C8DB0 [email protected]
529,713,544 *3625A65CCE08B03DA4F9B027A3591562970C773C HARDCORD1
529,713,545 *3623F81BE791EA17F5191A6E5F93B541BDDD775B haroldastin
529,713,546 *36214FF1F6E26240666ED6ADAAB94546E69A41F5 HAUNTINGER
529,713,547 *36204F74A7D29C38E269D82A2C75097877399052 kendardashti
529,713,548 *3621EFA10BEA93DDF13B2CA49FCAC8739C818D4B haywoodsearchfield
529,713,549 *3620E772203055F8D884113D56F7BCBF9128C00A hazeltelecom
529,713,550 *36252BBF45911EBA3094F3B1EB12293A9E7384F5 kerryblea
529,713,551 *362265568AD96B1454610C436BE814BB7C8533F3 HEHUSU
529,713,552 *362CD4D201D696EB8F488EDF921234DCC2D23925 khdr
529,713,553 *362421FB4E033EB2FDAD8969EF52816AC1EA151E kirbyfrom
529,713,554 *362E8CB7EE14B8D270E8F61EDFEC77A667A2C8C0 KLIEGER0
529,713,555 *3620786C74DBB24A556ABBF9B0ED89739885D62D HEXSTATIC.PRESENTS:.VIDEOS.REMIXES.RARITIES
529,713,556 *362CD62DA3FB04153391604613580B0F7A6CCDCB KOMPONEREDE
529,713,557 *3626F504B89AB4807C2ADC08F081C90F9A8BA56C HIRAM.MCKECHNIE
529,713,558 *3625FBC4AFC3C1AE020665B88F5F6B3AF090610F HITOMI.WO.TOJITE
529,713,559 *3627214A35BF45737257BE5BCC3379BDDCE7AB1A KRISHNAN.GRIFFITHS
529,713,560 *3622A1F2F6FEBD1386AE786B2EA8156C6BA6A781 ho
529,713,561 *36203DAE986D98361F673BAE5060E93182605626 k$v`
529,713,562 *36203071853A3A278E654E905AD0101491661813 hour65
529,713,563 *36216E42F053E1EFA57247F7EC9018C9103535D2 HOW-DOTH-THE-LITTLE-CROCODILE-(DIRECTOR'S-CUT)
529,713,564 *362D6DD7670573ADFD5C17F68B602B904BB1039B HOYSUKOD4
529,713,565 *3629316769EAC4CEA178E1DC3273E357C1A5968A LADYKILLERS.(DISC.1)
529,713,566 *362E5F356D84A52FA84FD7178A68FFA03E8884A8 httpwwwsoilsorgsss
529,713,567 *3626FC24AE55D02D8BC2B16F6AA7788948D19868 LA.REINA.DE.BELLEZA.LOS.SIMPSON
529,713,568 *3625F7D9696C76E518F7A3E62B29080605B83103 LARVENS1
529,713,569 *3623D4E54700A21D7DAEC70B08C0B952CFD586D3 [email protected]
529,713,570 *3627792ED9D4DB041C0FF7EFB851039D4AA0893B human trace
529,713,571 *362EB9576E785C5CCEF637DC44BCB311BBD92605 lbahgual0
529,713,572 *36230045BAAAFE11EEC7FB0705727CA3293ABCCB iは2020年頃に打ち上げられるはずだった。
529,713,573 *362BD053C93B1F7D7F7EA8896595C8845DFE3EEE idioma.erzya
529,713,574 *362A818A30686A106F8919A15294D6496ABDE03F lesleyfera
529,713,575 *3624B8EEB8D4139230693BE994FA65767D0A5B73 ignaciomijares
529,713,576 *3624D4685E6BD2FD80034F284D94DB969738D8AD IHIKMAWANTI
529,713,577 *3620033E4D369E1EAD02231BCF7F24AC2810A23F levinewsom
529,713,578 *362868AA71CF3C7F6C4BDECA7CA18562658EBF0B ilovebulls67
529,713,579 *36226E989AAEA75F86E21243769A63F27CEEB9A2 LIMOR NAIM
529,713,580 *3623FB0D9F725BFEB42718BAB2FD8C8982B329AF LIN34RIZ4SS3M
529,713,581 *362D8F2B42725EBDBF692DAEDF56C51C789E6DF1 LINDAROXY
529,713,582 *3628272D53A511E2761E53B47D9B45296CE5ADC4 IMPARTS
529,713,583 *362FB63A9B484D6358A3104754DA78C79CE09BE2 little.old.lady:'.i'll.report.you.to.my.auto.club
529,713,584 *362A6959FF910252227E3F34AEB4A94405E99623 [email protected]
529,713,585 *362C700FE62BA8561B8F245F48F1B050649D1040 LIVLERNER
529,713,586 *36245F98E2D1AD06F9E015BEB24175997F169953 llama!
529,713,587 *362CC3012337EA90BED290EC1B7D7971241235BE inseraten8
529,713,588 *3622AA0AAC7D697A57535C2A0B2A14E2AD87E7BF in-the-new-york-stock-market.
529,713,589 *36273444C875FB2E83BE617ABFDAEAF7C4C7B2CB lorinda869
529,713,590 *362AB2DBC30FEB644E5E7922CE967C6A060543F1 Love-Colony
529,713,591 *36222F8EE0E303222F1FC0C96C438F3398402BEC IRWIN.BOCKEMEHL
529,713,592 *36211B1643357F644AD702E23478569E4715E689 ISAAC.BOTT
529,713,593 *362561A45C2B07F0B513B8603DD2568634782FEE ISKR
529,713,594 *362F336F8B411DD781305906BFF541AF2259084E LUCIO.DERMO
529,713,595 *36216293AFFC78494506BAEFA63706AF9731762B LUCIOLEIGHT
529,713,596 *3627C268B81D6738CAEB02B45275478DB5150B8A ITHARGICOURT
529,713,597 *362EA45F84A6D416CBEC5C121FD0A2386F6D668A itnatser8
529,713,598 *362274C25B8ED74A2382544E58B322E65B946642 [email protected]
529,713,599 *362B1D849BEF68F56F8C95C7F65897926BD298EF LUOCHOZHU
529,713,600 *362768519EFD25AC426350627DC88F4EF32F0FE5 i-want-you-(7"-edit)
529,713,601 *362DA67C2E1E5F1FEF758220B24A14AA79D74244 LUPESTARLING
529,713,602 *3627D7912924F32862B99A7302CF4FFA14D71F5A J*'\
529,713,603 *362A4AC8AA07278316922E70BA1AE9CB129151D7 jacknghiem
529,713,604 *362823222FB1938D55D1DBCEF84AA736E0DA308A LZZ
529,713,605 *362132C6B9989F2B25C3830B574378D42468D6EB [email protected]@D5
529,713,606 *3622948761646E0FA5680E34915CE4DA74F14B8C japan.dri
529,713,607 *362892AF911473EE55C6DE5BC18FCA055B3C9711 JARREDRUMMEL
529,713,608 *362AB6E6B2853498C4A08E9C1F6FA29D9463C07A jarvisfannings
529,713,609 *362FE6F4942D4CEEEDB76275423461060BC6C864 JAVIERROHRDANZ
529,713,610 *36247CF51568399F1819753CAC211F0CDF07332F jayden20
529,713,611 *36275CB27B8B5A9E7A4AE0B400558917C53F8C91 MARCELOLUETTE
529,713,612 *362CD9751C0FF0110F867A54618FE91633A5A0EB MARCOSLODER
529,713,613 *362403B7415BBEA278F072D61711EB0D21F92A92 jeraldcarre
529,713,614 *362308F38149CD68C55B8A41EA6E0F953148B9C9 jeraldwalken
529,713,615 *362074332B5E90FECB5CF50F79C263CD92E2E490 jeromepinchon
529,713,616 *362C68B950B71E5F39BA010060BE1B0F0FBFE2D7 mark-bregar
529,713,617 *362B9BA0147F316F3B49C654BB00E071383DD5FC jerrygiraud
529,713,618 *3626CF5E335C1BA7FC24F4D891D431C20638767F jessejointer
529,713,619 *362978E3E34E3ED28A1D348DB5503D6876CA7CC8 marquisturcio
529,713,620 *362CD25DBFAD99E023B32A01B06F53EDCF99CA9E JETBETTERNOW
529,713,621 *362E77E30C7023F713C98686BAB76C03177AD0E5 marshallfremon
529,713,622 *3623FCBA5F44B7201A44C8E2305E724EA659F9E5 JEWELLALLOCCO
529,713,623 *362C2CB30B40EF0638B57920F888A536E2AFACF3 jewellsaxena
529,713,624 *3629F230CB0FD384A97FAA13994E5D875E582042 marvinquimson
529,713,625 *36216E3C7D518AE6EC5336B4DC4C48C412B29385 [email protected]
529,713,626 *36214090C4B3271294AA6126C06C9895E2BF8601 jimbobonline
529,713,627 *362EA1A413C636460D5ECFE8F7C77C8DF8647F37 jjkbsm
529,713,628 *3629D76657B9E4C946F225473E62186DD732D9D1 MAURICIODURPHEY
529,713,629 *36297E7CB84CB92117CDB1809EC87392B0452892 JOAQUINGEISSLER
529,713,630 *362514AE32E3533AFC977D96C722309321589732 maxwellopet
529,713,631 *36215CB2485B228BB1DEE19FC4753266A56D361E joeloslund
529,713,632 *3625940310773B97A48E61A4C784DE1D5DEA3802 JOE-SPARKES
529,713,633 *362F4CDE6AF2D10EA838BF4522FDD436387174A1 jokerrandom
529,713,634 *362FC9001CBDC6D7CEFFDA3D7F6DB43FD1C1D0B6 JOSEF.DAMMEYER
529,713,635 *3620ADCE4DAFC604E41F209480124F77FF8EA291 METALWORK.1
529,713,636 *3623AC767EED56F8C3C5C534E48E83F83531B4A1 MICHAEL.17
529,713,637 *362A9BCAD59459B1A8ADE19DD193223B243811BC ju3a
529,713,638 *36208811707CB004836340CDB906556785B4EE13 MILANSNODE
529,713,639 *3625CEE03624AA182236D88D003687D53C68CF74 jyllandn
529,713,640 *3629ADA8D5284056F59A41DDE9F16FD3ADCC9D22 k1k1no
529,713,641 *3622E786F94AA35A75C355674ACED776DA2A46EB MINHEERED
529,713,642 *36284FA062322B87EA3ABC35F0C366701D1B9142 MISLILO4
529,713,643 *362CC0D31A212A971BFDD773FF6AC04A0B92121D MITKAMST1
529,713,644 *3620BBDDDD0A1FB29CC590729F6E958723E92A1B MOISES.HOLLOPETER
529,713,645 *3625AF2405B9AD8C32F0DB416BAB12F46B1F49E0 MOL MAJEUR, D 485 : I ALLEGRO
529,713,646 *362358F74ACC2654F4855FEB5F1A36DEF8B9B1A9 KEMBREE3
529,713,647 *362B3AAAA0019444423C24092A6D5EABA357CF6F kendallvardaman
529,713,648 *362E0FAF9617A4AFB177687E3597E43CF71D2A33 KENNITH.BELARDO
529,713,649 *362A2E1A972DA8773E9EEC921EB777922D419A88 KENT.GUHL
529,713,650 *362C24AAA29721FC0299B29EBF084C9E3B6F9EC5 MRBADD1
529,713,651 *36269A28BC35112EC0A78A8A71CC28379B7A3C95 KFs
529,713,652 *3625A292ED2B67D920EB28330028E582D89613EE MT.ST.HELENSBLUES
529,713,653 *36261D1C1A97C1FC662DA04D17DE7E2DE93496CB m|x
529,713,654 *3621DA5436287BEC317AFC4BE56A08834DA93C10 KOMEDIES
529,713,655 *36280F0AFC38D783A60D2416B0033586192E4B1F KÖNSKORRIGERANDE
529,713,656 *3622048FBCDC9CD8E415FC7EEA6A8867FF432C8A KORMANHIDDEN
529,713,657 *362416EC332280FD89AC84C5EA8948BD08DF3F37 kraiglatourette
529,713,658 *3626B9BCA813941CC7D458FEA821F97D816A5E8E nairezhavaunityinkeralaideawhose
529,713,659 *362324289A99D99DE37536DEC469D4B2B652FFAC NAKNA
529,713,660 *36293BD7004997CCE4DE14DA716A76437C622535 KRONGQ
529,713,661 *362212B61A35785DB641AF50487A71D1AFE98C1D NAPAEAN.
529,713,662 *3623639114F94367C002CB7B40B1BD020F3B7FE2 NATHANIEL.MILNES
529,713,663 *3627728725BA117626FD231DEC0EDEE72DB762D4 NATHANIELVESSEY
529,713,664 *362DEDC777851106CEC2DDCF59FB116B079D318E kuz
529,713,665 *36282143CCEE304411B98674DE21FF1617CBA45D [email protected]
529,713,666 *362D0135C2099ECBF07BF67FF4B446C914CFB7A5 la-casa-del-islam
529,713,667 *362EDB10FE9ACC78401CDF4E9929459CD7F8A4CF lacocalacoca
529,713,668 *3627523931FB13C113DBCB32C4A7FB86076C51BF NEPASKUTINIS
529,713,669 *362968740992FF8FE1D0AA7FFA5FA2E71A0219F2 [email protected]
529,713,670 *36264E7A7AE3C1811C940278C9CA5336174F51E7 LAMENTER
529,713,671 *362E224269598F3349257F612874D1A38C422AB5 nick.ehling
529,713,672 *36281BF099D433DF51AC092054E1BF76169EE0B9 NIRMAL-SINGH-SIDHU
529,713,673 *362278970D143767DF6ADCABF2925A77F79D77E1 NLOUAQAD
529,713,674 *362590D112B62ED45C93ED69F3D2BA9D5EAE887B noblemceathron
529,713,675 *3628B2A41D00B62847D7DB40C10AC8FF2376F2CA leonardo-valdes-zurita
529,713,676 *362D918AF749DABABEAD7CCD96042E30BFF9E4D1 nonsubstitutionally0
529,713,677 *362E30C29683BCE4045835C569AB01905D823BC7 L'ESTROARMONICO,OP.3KONZERTNO.7FDUR,RV567:I.ANDANTE
529,713,678 *362D359EE64CE6979AC20AD925A29617DCB95800 [email protected]
529,713,679 *3624188BB92575731BC1C6CA0AEE4F07F3AE716C N>RF
529,713,680 *362A25502B5943160E3F889EF37814FC9DFF7AB7 [email protected]
529,713,681 *362A018C433C61C0EAB515896B3A230277970517 NUZOLX:
529,713,682 *362EB451408479AA06144933B40CB7E4638DA05B Like-Our-Love
529,713,683 *362366B1B3F24A5586902CAF69A398D28C5B55FA NZGNNHLT8
529,713,684 *362BDD77AB87344E2EAB2A6D1747A9B93EDC06BC LINNWOOD
529,713,685 *3624F47C810B029A911B48B07089D32E7B364753 O=F_
529,713,686 *362D019620B412F97174A7EACF25D060EBB94CE7 live.at.hultsfred.2002
529,713,687 *3624B27BE0A01324584C8C4053055CBF57EEEC72 OHITUJIZ8
529,713,688 *362B94A7CE65C6368D22291674BA6A73288C8442 OH-SISTER-AIN'T-THAT-HOT
529,713,689 *362776A7349FCF348C4D2248E49CB1C42612292F omaidnorfs
529,713,690 *362A3049E690CF6AC8669A3C1B3A89365E8D5113 lonnymorioka
529,713,691 *362D3A0AEF0245DDF74970019A714F6B6E3B89CE LORENHULAND
529,713,692 *362072C070C7F6CBAA137807173A319C7239ED29 [email protected]
529,713,693 *362F90713EE5EEE5C1587EDBCD04709A6259AA6F L!P
529,713,694 *3624E5A61CE2444CA087250B5EF46DD94E197D13 lucianotoupin
529,713,695 *362749A274727E38941D1DED9E038E22C8F4D304 ORLANDO123BLOOM
529,713,696 *362C9EFFFD81423132B573E038A0E9DC089E2AB5 ludowcom7
529,713,697 *362EC981DE658DD184A9DA2E0787B6306B44BB78 oSJ
529,713,698 *3623143B9C03D9BE00DA1A2B94C8DA62768334F7 osvaldohelander
529,713,699 *36284386E03B4709F16D74504A5A43FFFEFDA088 oswaldosalone
529,713,700 *3623B9E11E9E2E7EFE581F597D7ECD6B3F4A1430 ottomuphy
529,713,701 *36236150C67EEF17528038D70A4314F18D4DF984 [email protected]
529,713,702 *362B098C32B4D644B22EA00AD8581C46DA3C5C6B LYMANBERARDINO
529,713,703 *362B56CD7C934B889ACAA43FFD3A81729A525889 overgeteld5
529,713,704 *3624344D6829D73118F26D18516D110D341A4B11 >< ~ ` @#P
529,713,705 *36296E003EEA23102CF2F95A6847C759D960039B MACCABISAFRIN
529,713,706 *36230C9E73FDB1E509A40D04E99A4009D8912EB0 PAMGREGERSEN
529,713,707 *362F39E79EFE2C8C196A406F993B6B2CCD0E83F0 PAOTKM97
529,713,708 *3621E351FBFEDE40DB276CA56FF045C5A8EE47AE PARKERBOOSALIS
529,713,709 *3620E5D7F1A162057860985C10906D20E9050849 marcelhalterman
529,713,710 *362CFE351F932E6F137DC0F6F7E260208329E727 MARC.REINARTZ
529,713,711 *3626A2AD7F165A284656A8B7FA2DD167050549C9 MARCUS353
529,713,712 *36216941D72D96E072DB343CFD02EE6D16D0E733 patrolman-william-russell-mehlhorn-jr
529,713,713 *362FCB34C3CB7197A46E5FEFEF4D97EAD9B22304 PAUL.SANKARY
529,713,714 *362EE54A1A9501F9FF9376C19BCE47CD51E66113 [email protected]
529,713,715 *3625C4A741A0EEE4C9CCC194355A6FBFFA3F6CFF p====D-*-*(0-0)
529,713,716 *36285F64901D68F901834E77904AF14FF5578CCF PENALTY12
529,713,717 *3624D8319A81EB38ACD2DA3C024C475F86AA25EA [email protected]
529,713,718 *362D82A46C8DA97AE5CA79F2E2B8143CB8D90625 MASONVALENZVELA
529,713,719 *3622C5959FF5A1648EA7F32A109E4CBA7E8B69D7 MASSENRICHTS
529,713,720 *36216AB0F96C31420E414292053DB95525C10A3B MATHEWIZAGUINE
529,713,721 *362284C91C7D94D3DE113395E17733C9E13AE061 MATTHEW.STELLINGS
529,713,722 *3622A456C0000D6129A4D000A97D0EF3A99410D0 MATT-STELMACH
529,713,723 *36281E24DAB7AD92412F34FFEAB2738DC39D176C MATUTESF
529,713,724 *362AF45FF08D9048C1538EDF9546ED7CC4F0E618 MAXHEART1
529,713,725 *362D8CB5B5E1AA00AE8EFB8710B89B467E074720 PHILZAMZOW
529,713,726 *3620D1934C61A6DAC266384149D43F01EE8A20F4 MBOONKERD
529,713,727 *3628502C1AABAFEF8E768B413A98FCB5B6E57B6F M~:D
529,713,728 *362122A4F145B5285BE4999930A3F04013E5E845 PIOTRWAGLEWSKI
529,713,729 *362F8BF2BE3E2D268FDAF2F3F6A8108E7B0B264F MESOPEAK!
529,713,730 *362CD23C0E798174390206E66115FCC1562C9D99 michaelbarbara
529,713,731 *3627ABE85858DE4DA1CD20455E96A51D5A286EB0 [email protected]
529,713,732 *362FA491AED6F85BDD6491B21A51EE3E8F91F315 MidnightLadyCalledtheBlues
529,713,733 *3622887E525DF3A792BA3B8C402F6EC5A1B9E764 milanethen
529,713,734 *362AB8E5B27E2E28D24504D4AAF889172B099694 pr3consd3r47ons
529,713,735 *362EB29CF7FA86CC29F6A8125CC839E40F4824A9 praludium-et-fuga-in-h-bwv-544
529,713,736 *3623A3C86794341470CB6101B992BF16C8E1C34D PREC1$1NG
529,713,737 *36201E235DE0C02DD73C06EF5399296A0F6FC9D8 MOHAMMAD.PERRINS
529,713,738 *362AC46F353DB47AB353FD35BA12C69BE75599EC MOHAMMED.MCCHESNEY
529,713,739 *36255BFC6060F3C46DA7B8999DBEFAD2285BE8CA PunjabibyNature
529,713,740 *3627A104934064FD9AC8C423A6EF93D3D6309A15 MORVALENFIS
529,713,741 *362D1FDA2894725D1D12602CE2C704D8537DE579 PZ#F
529,713,742 *3624F41A12A88C5000BE4622575B8C94883F9BD8 motokuni9
529,713,743 *362C2673AF6120001EF5725ACCB5A0F80375FE33 q~,c
529,713,744 *362A41424F50D9A2CD52D5E210053FCE394A5B76 MRCICI
529,713,745 *36268BDDBACF6DF0CF919BDCB2DF769072395B29 [email protected]
529,713,746 *362A05DA883885177342182045C767C9CEC52CA1 MUDDATLARI
529,713,747 *362B21F818BDDD83B38500E1372696CE97B88490 [email protected]
529,713,748 *3626396622A03C922BD4D523D632A50BC7EEC688 MUNTERST0
529,713,749 *36204C9E73B3C2981BDE58B4E2C001983C57305B Q=====P-`-UU
529,713,750 *3622660AE2B31473632C1D871F89615D1A5D5942 MUSKITS
529,713,751 *362C7E8D90DEFB6F9AA4BB7C68928DEE1F982631 quentinnance
529,713,752 *3626704D455259E1DF9ADE8F9F0C87993CC83D96 QVAQHJRWIQYPACG
529,713,753 *36231E28B23DA87002C408C93F2B99C2B8BFEF23 R3HA8I1I+A+I0NS
529,713,754 *362231B03DE8BD1F951684A87BC7D6150B33EE4F RADIO1UC3NCI35
529,713,755 *362F3C181A857D1D7544576A0DA33BB327ED3043 RAGHJAZZ
529,713,756 *3623AEEDFF209FCE79B75C96EE2B1A12AFA99235 RAJADHAR2
529,713,757 *3627BF4368266386B85CA988BC0D533952F0CE83 n85r
529,713,758 *3622369CFE9D86ECDB9E7A4E8308723D4FA89E8B randoncampbell
529,713,759 *362BABD3AA66DC6C47E0B28A404CFE34B809B06E RAYFORDMANTUANO
529,713,760 *3629988991F44B211DAE7DA409F71ABD9C71AA2E NASORBAT
529,713,761 *362809021C4DD9F82BDE974D0FB42D9945241527 RAYMENDO5
529,713,762 *36293B7FCD82925E025F083C0B1A12CFC1972331 RAYMON.GARDING
529,713,763 *362A478D38F951A52D8BBCFBC04B3887B4B34F59 NAWASTL
529,713,764 *36280907CFF6B782EE91FECF86154E3CF704456F RECOMMENDEDA
529,713,765 *362F32E9F8009A53ED65E144AC2EAC65C734DAA7 NEILBONEBRIGHT
529,713,766 *362824A350128F396500BB60111DDCCB2A093CB1 REDNEGEH9
529,713,767 *3627DB7F73B80AFEC6B1FF384B1698C08554C4DF neobarokna
529,713,768 *36252C281220E6E3AC527C3EFFC40E4DE495783C REGORYLL9
529,713,769 *362E50B325243AFFE97EC3215030D663B2C1A5B1 nevzlinom
529,713,770 *362297E4C90140FC84AD622337BBC8B0CABC0C1B REICHSKOM8
529,713,771 *3628446B345AC2131277DC506A869915ADE010A6 REIMBURSE2007
529,713,772 *362B355FA06502D66A0E4C535EA27D956CDD1C69 ‘REIZEND
529,713,773 *362BD428A25CF93EE837FEA5C71CDB99556A01A5 Rejoice!SonataforViolinandVioloncello:FifthMovement3
529,713,774 *362083B6681D58D79934FB3BD15381BB2DE8E0C9 REMY ORTEGA
529,713,775 *362E7C70560E62692C720553F7A2723DA8373652 RENACUAJ9
529,713,776 *362C4EDC97235CA49E7D401E4172F3CC5138301E NISHA JAISON
529,713,777 *362FA212713BA93103B7C983A9DBEE26D4853C2F nite.walks
529,713,778 *362CF67CA337F3A1AF8A52E9A80C5F008EF32664 NOESARTAIN
529,713,779 *362E1C3114D6E1905CCED789B6007E15AA363149 NONANALYT!C
529,713,780 *362FFD48B7820AB4C1645EC9DA26E6B246B1852D [email protected]
529,713,781 *362BFA0823D7D4E19E3A4D27309C040B34CF4886 RIPPER?
529,713,782 *36217DD418221E6A8483D2170C7530FC80213AD4 nypostreview
529,713,783 *36214BE2E05DE68441BCE04657F2166DDF7A582F robin.parlee
529,713,784 *36278C5439F8D830D1230F4653C03EEB726A97B4 rodneytrupia
529,713,785 *36250E0BF26F1AEC56DBB2EA4B6B1C1729B20C52 RODOLFO-DE-ALZAGA
529,713,786 *3627BBA2066BA5981CC816F3AFE8BD8A77F6E33D ROGERDRAGON
529,713,787 *36213E80E87CDCE2DA94C0F731A6D2FB9D839D8E OMO.AKINYELE
529,713,788 *3627DA0BD766E8E5B94EA3AB30E702585C331344 RONALD.RYCE
529,713,789 *3629C0F961964EB1953C220A060879520714B074 rondes0
529,713,790 *36272033FEF8F1079E22D3F39F6FFE648C6334B0 roscoegrenon
529,713,791 *3627EE90409536FA14DA72109276D88CF92C215A ROSEBUDBASIL8
529,713,792 *362F720AA6CED4976613BFB7654F13DA92018D02 OPATENHO8
529,713,793 *362EDDA1957B55477D7F7B58F7C4BC33A2E3AD44 optioncreate
529,713,794 *362F1317ECB8DC92B204346540326ACDBBAF409E )O(~ ~ ~Q===P
529,713,795 *362546C6A4637351DCCCF2121B17745005B4B790 ORANGEELEPHANT
529,713,796 *362D945A3E04BF665D4A726F1032B3A80BD86209 rubengaiser
529,713,797 *36294CDEF9DDFEE37B336B401B34DD387C30AC42 os.grilos.(crickets.sing.for.anamaria)
529,713,798 *362F57D2118AF1814AAFEC1FC6A8FD55D88A2A25 RUDYREDENZ
529,713,799 *3620909C9F52B67D19AEF17689648B85EAE478E2 RULLINGERING
529,713,800 *3627DA8DF609AF837F6ECF83E5B5C3FA22AC98ED RUSSLOKKE
529,713,801 *362B980CFDE33E564C337DB4A3C25B57CB0C951F overrationalises6
529,713,802 *36214FA29028EE9FD25E2DE62670832A88AE2034 ÖZÇAPKIN
529,713,803 *362FDA9AA41153D84585C4D39A880FF83C130CB4 S3EP7KVC
529,713,804 *362A26A92A5B653F38A2734D65DF16694F2D742B PAGINAA
529,713,805 *362CBD1FCFA4CD4960E3397E0D794DEF0532D4D5 <P><A NAME="N_615_">615. </A> T7 AT 26.
529,713,806 *362F4E923ECB91FE44499A2224BADFDD1DE0081A PASCALICE
529,713,807 *362B36E05EB39F1E60433BAEA4D1800708020F0C SAMMYYANEK
529,713,808 *362CAE273337F36FEDB06BB145D2A4F9F9C04BAB samualplacha
529,713,809 *3620E28D4DB9715CDF37CCFF82F47EE3A25184D6 PATAPOF3
529,713,810 *362011BB671ACB8779E0E0F458206E5CF5D0F32B SANTIAGO.DETOMMASO
529,713,811 *362A5ACD120E8BA66649F6109306719C0B564684 pbassoon6
529,713,812 *362957404C210FF4C7A1DD42A11896BABB2657C8 PEDER4$7!E$
529,713,813 *362333E953B92517B85C7D955D639F06D9A3BAFA SCHRWRGR6
529,713,814 *362F7C840D324279F94213195B6AA0AAD4D009E7 SCHTRINAD
529,713,815 *3628D07C1716105AE8E7E50A387A0ADFBB29CDDD SCOT.MCCARTIN
529,713,816 *362BD5B6CFA4779C0AA1FA5B971FB800EA6B73E2 SCOTTIAE
529,713,817 *362057F067BE8710629DC654686AE531EFFD0D07 scottiethoeny
529,713,818 *362F60F332807C8BBC4C5B941A17FE8CB6D24F1F PHILIPMINAAI
529,713,819 *362BB1C78290C8B562D2A8DD1EBAF349422C5D97 SCREAMFORSCENE
529,713,820 *3621541CCD687ED3E9BB97ACC18A69AD1143150A sean.keelan
529,713,821 *362C9E74899EB6A6D3F40B3B3830F3589905C452 pillegarste
529,713,822 *3622A113ADADE578C70F598A8E12080FA793EB79 s-(feat.-ricardo-ru
529,713,823 *3622277F82627C709185ACB0969FEA23324B2482 [email protected]
529,713,824 *36246F65ABA0D9107ED6EF3A8B96F792758E0C33 portdvein.2.0
529,713,825 *36248BA64BFC8DA86BF527CDD473F3F22EEA67B3 POSERAIT
529,713,826 *3628215D65A2AE86ECAF802A5A3A34A8413D15FC SHARIDZAH
529,713,827 *3625B277466E82C94E768AFAA84DE62A83C13FA8 P======p.~0.)O(
529,713,828 *3629E20C84B7DD16FA31BA9AD0100EBA68C4F3F8 p###p~~~>b0
529,713,829 *362E419C8C62630916B2B1937AD63E1223EF67D9 [email protected]
529,713,830 *362C49C78EB833CE11C0C8F5DEB5A15670EE6981 [email protected]
529,713,831 *36238535648EA8EF4C11F3E58999A75D7216FA79 prefissata
529,713,832 *362E10087ED00ED9B199B6E1EC116A19414818DF Preno
529,713,833 *362C1156ACA868BA73761C3F6F9C1E29594F5C0B siggie1
529,713,834 *36252821C4F88817745494B53088FBA735E62057 PUKIBEAR
529,713,835 *3628F988C40AE3E31258A8538BAB872821C4F7A8 [email protected]
529,713,836 *36265646B2A366B171B678B9EE85C8FD1E06C6D6 SLABAS
529,713,837 *362949B5A8CC0A14902058AA0B775F4AA512F73F SLLAWDAG6
529,713,838 *362CD3140F59317BF22906437A9823AD31DB3908 SMBAC
529,713,839 *362DE3347EE7C3A5E76D73DBCB4836A8863FE3C1 SMEXICO8
529,713,840 *362C6537129BEC400F2A51C92FEAD4AC9071CED7 [email protected]
529,713,841 *362220DEFFC20891B2B956A04FD2D7B9FF14F45A QUINTINSNEDEGER
529,713,842 *362CF03F725EE43A277C4EE5773169FECD14B974 QUINTON.SIKORSKI
529,713,843 *362CCD0206E7B592C686D5DC9EFF79D13D18E65C quitcold9
529,713,844 *36276FAD44C20CE2802C6FCA3DA6F289D5EB9B06 SOLOMONZIDZIK
529,713,845 *3626E4D7B5DD6711D4543B86697FD246459FE9C7 Raj.Kishore
529,713,846 *362E551003918061D2DB8E0B4E199A20EEABE546 RALPH.HOMEWOOD
529,713,847 *3620622EEAF9E171EC8895654D35DC398233063F ramasva7
529,713,848 *3626E4AD07135C986AF35B40AED353024B53A191 SPEICHERHEIZGERÄTEN
529,713,849 *3622112615183365374A06FF1F6DC5953EA8168B RANKIN.FAMILY
529,713,850 *36226CEE22E363E279620791304970222FB2FEB6 SPIEGELDERUNENDLICHKEIT
529,713,851 *3623846802D5B24599C040F4F57EEBB1B8DFEF14 Spiel.Nicht.Mit.der.Liebe
529,713,852 *362F97C35F8E7133D96862195FE754929C7E8F89 RATIONALISE9
529,713,853 *3625B825025873C874A8A6A1E60DBD98DA6AED99 READERALASKA9
529,713,854 *36228C44EFDDD81BF1AD5CC9D16FE2C1362C38B7 REALNIGGAZ
529,713,855 *3625C33E26DB38644CE4CFA0A8523AC8732F3580 SPUNKYCFJ
529,713,856 *36211C0E017F2710AB47E38C6189B1FE31A07192 REINALDOTRUEBA
529,713,857 *362247AEE4ECEAFE375668F93BA19E08A50BC65D RE-JANOWITZ,LUDWIG,WUNDERLICH,CRASS,M
529,713,858 *362123F8E41518A61D1C8F6A878A5906EDD26325 REMENTIMUTATIONS0
529,713,859 *362CFD940AFB83D4890F17D221E067917B612F2E RENE.BIRNELL
529,713,860 *362C5248C29329E8B49F6AF2B4474C158A0185C6 RENESEMONICK
529,713,861 *3627EAC39DC76B3E931059D4BD5481408FBC86E6 STARHENDRIX7
529,713,862 *362EA1A6C66719F0F1A765DC9B0A72F17FC7153B [email protected]
529,713,863 *3624A36E707779CD06BD52CCB08957664577935B reservationwithconfirmation
529,713,864 *362AAAF61EE03A1A6A6FA128681027CB44AD694A RESPONSEBASE2
529,713,865 *362E455BD6F4C0AFDB0EAE07B18E88A15E5A6B93 STEPHANIEDORWARD
529,713,866 *362BB6DC5A59295E121211AC01A116BEA2A3CF93 RETRAN5FERR1NG
529,713,867 *3622C0AB5BA09F0995DD037122621F32F6E43951 STEWART.MABEN
529,713,868 *36221E642C491724165848B6829C91F6957FFFFF RHETTLAROIA
529,713,869 *3623CA5C70838E7BA49B8AFC367965E0D8AF8BA2 RICARDO.VANDERSLICE
529,713,870 *3627C8382995C670A3AF10D4A2B796F250341E9C STRIDERBRIDGES
529,713,871 *3624617766636C9B7700A4C7662EC703DE927A26 RIOCOMIC2
529,713,872 *3627E5B6BDAAB31177AA157F064372FF6A8E7E10 RLANCAST7
529,713,873 *3624C971F37B1E309A1EA9D976A57B16FC5D98D8 RMUQSOOD
529,713,874 *362DBA62A485E0DDF3365F3DB7FE0C3D879F73DF sun_[email protected]
529,713,875 *3629EC1EE3956860773578768D02FE6B36252C0B SUOMOTIREP6
529,713,876 *3628A616132824731AD46206ED28A0D927AD1A16 SUPERHOPSER
529,713,877 *362EA7D4AB59E47124E8E30567903AFDCCF34A16 SUPERMANLOUISE9
529,713,878 *362AB875A44F9FA9A8DDA597FCBDF2F186EBF0BA SUPERMANTRACY2
529,713,879 *362DBE9EB3E45270327048B5AAA0BE22F08C4990 SUPREME.LYRICISM,.VOLUME.ONE
529,713,880 *362B9FC1194ACF3DAADF6EF59A03D4C08D83C7D3 ROBERT.SHUNK
529,713,881 *3623E27B34C5D2A6D9279E1B33DC4A59EF22AEDA SUYMAZ
529,713,882 *3626F2BC66E9474886524EA146BC3A06F7C22D02 roccoprchal
529,713,883 *362B1F260C869B17EA4C86CD8AC5F408DE7DD90E ROCKGONE4
529,713,884 *362498EAFBD0ADC0CB0362361611D4B56E2B001E SYNAPTICII
529,713,885 *362EC2ED732E8916A3597754FE8480AC27C98ECD T0N8
529,713,886 *36241BE353F4E1FB2B087513CC6E22873483D3BB t5fnnbrd
529,713,887 *362AD8603654233D2C01068052B1C1A5CFDB7305 TABULARISED1
529,713,888 *362C83CDC3203449D1388186AF5A6374D1D28FFE rossconrow
529,713,889 *362778AF02A9F2D3416A31571DFA987AC1497674 TALKTHETRIFORCEHERO
529,713,890 *36202AA56A7AECEBB4D49F1FA7175F6E1FE45A19 roycevandenberg
529,713,891 *362B02B28E0279A00AA6CA4ECE87993085311DB8 ROZ
529,713,892 *362D54E824F42120179081A81DF89CDF05226F65 RPREIKSAITIS
529,713,893 *362B80CAC41C96FE1F95F6B2F1614537583041DB rstrljnn5
529,713,894 *3628DC244E17D57F4DA8A98523784ED4E5F7637B RUGBYALIENS8
529,713,895 *362D4F29F7608174DEDDFC0FD48F3642655813D8 、TCCDはCAS
529,713,896 *3626F33C04238A167DD697505E02D3E01AC130B7 telomeemolet
529,713,897 *36258E92BA10873D379A25B4563B38E0307E3458 TEMPS-DES-SOUVENIRS
529,713,898 *36245D38D3FE04B523DD43442412233DACCB333A TERENCE.KOSCO
529,713,899 *362DBA6A4A9B684E8B094A600160F62865CEFCC6 TERRANCE.PURCELL
529,713,900 *3627C0818366216BE9F18F38C68A7976BBE13A66 s73r30ph0nic
529,713,901 *36257F5F2230C42E541C09DCD611A3FC59838015 SAINTANDREWSMARYVILLE
529,713,902 *36271C3EA59EB8AB19AB996669247F4D2E608E35 SALVATORE.DUPLESIS
529,713,903 *362AACC4064D7EE28AF48C0E46996019A1214384 sam13v3r
529,713,904 *3624D7ADAFBAD2BF76B7325915712033FF6D8272 santiagogreenstreet
529,713,905 *362F55298C051339EF289C805785E4AC0C669ABD the.green.run
529,713,906 *36269D27DC563872A7B4C3E68B99627B2C8D9FD8 THEHAPPYMAN
529,713,907 *3628F8A4C80D81729108455F7F72D4F0765E1ABB SARAH-LEAS
529,713,908 *362AA9B2578138A7B12472F137C3A551B0DF3D05 THEM.DOING
529,713,909 *36266FE3788627FC76E01D64C9D3BFA56842C059 SASERET6
529,713,910 *362791890AFC577B162A485D3D7EF815393EC8AC SAVAGEBUSTER2
529,713,911 *3627E929CA04150985577288D81C9009A14C536B THE.TIDY.UP.SONG
529,713,912 *3628A0F46EFB15182259AA921EBCE5638E3D9B3B THETRUST3
529,713,913 *362A3C9A5057FCDC2F2BBEE20356472812555134 THXMONOBOOKJS
529,713,914 *36285DF54F8022E5EFB137D00D94333819B780A0 SCOTTIE.AUSMUS
529,713,915 *3628D2EFEFC963C99A07A61B5D41AE27C9995930 TINCHOB
529,713,916 *3627EF6C886D60FD840A2DAF48BFBB3A611188BA SECONDEFFORT
529,713,917 *36262BF8D35280BC8ECD827CE7231AEBDE46D3A0 SE.IO.M'ACCORGO.-.ANON.
529,713,918 *3625B381C8B3A9B02690C088190F75E71D115539 SENKOWJA
529,713,919 *362ADFE9F2358B994182B1F58EDD5A1838109C9A SERETILHOB
529,713,920 *362C2B9CD929ACC20C4AC68799CF301693380771 TODMAFFIT
529,713,921 *36271BD3A9FE4B149769F3DDC04152D0FFA70473 SERUTIOC
529,713,922 *3622FD0102E16B13F279C2194BFE991780E0039C TOLULOPEOMOLAYO
529,713,923 *3625B12AC58001148E9F4B7B1262BECEE6F30E11 SETFLAT3
529,713,924 *36233F84934DACE5E9E60F28BF9A517858817EDF [email protected]
529,713,925 *362A95FED29EF4C39682B6AB1CAEF9BC7B73CE5E SHAD.RAKOSKI
529,713,926 *362D55A9F7229AAE794A214409632FF0AF652FAF TOVESESING
529,713,927 *362D441BEADCE46BE2D014D9582F0046BAFF77FF shaz.hussain
529,713,928 *3621FC27F484E9F361234F45934209B579F5B259 SHELBY.FREELAND
529,713,929 *3626914D84F764D1EF25B204C75A2F51D210D29C TRAMARO1
529,713,930 *362CDAF7E226574C9BCB688527ED4F209AED4D49 TRANSPORTDIENS4
529,713,931 *36294B528DB827F17D6E56AA7DF99EA6F0FE0B60 TRCHNTRN0
529,713,932 *3629FE9CF2B158E4868864762ACA8EB4D390B589 [email protected]
529,713,933 *362790632A7B64FACF92C1AA169C21698AA31B76 shoesshoes
529,713,934 *362F2C5FD6D723CAE8E0D7F5AB34F4187E8D71D7 SHOOTERMARGARETING
529,713,935 *36209DDC43559BBDEFE44009BF2FC18682BF6737 TRIBUITO5
529,713,936 *362DE471608F785F4436944DB8DFF3C8340D7700 TRICHTERPORTALS
529,713,937 *3624483BD2CEDB15D5D4C083FCABADC1461885F8 side-actress
529,713,938 *362721D50D47AA50258142B6C7BA65776C2FE1B4 si-hyung
529,713,939 *362B1114F70C5C2B9CDC8C3284D260E273211C76 trotsfa
529,713,940 *36271BF866A34D2346CFEA42CC49668631CF9280 TRUDY RUDE
529,713,941 *3622D77943E0728B9BD06DE7B826D2BD9CFE73D6 sirazus3
529,713,942 *362BF3CB3A018A8558734CCC526AF0CB0C08A60D SIROCCO1
529,713,943 *36230A767092D19ADC3DBEAF175FC43FE3321717 SITZGELEGENHEIT4
529,713,944 *3621B9E1F38E36DD6A1EFC718B7E0D283BA4E434 TSSKALLE
529,713,945 *36276A2086688AB63A63CDB5CF31ADAF9AA54139 skafters0
529,713,946 *3620579EBBA65615CC02B53A94561B697AD2CD14 skypethis
529,713,947 *362BE840D598E77D0F2767BE2D7631273CA71C2B SLAUNDEROUSING
529,713,948 *362905F80D56D318DAA6E09E730407B151382A73 TUQ
529,713,949 *362FBD7C0DD103080D08D46688ACA8D9607B0D64 SNEGLOVNEID2
529,713,950 *3621E2E8481944F4492A210B33E6C2B550BBD189 SOLDIERS.OF.STEEL.(DRUMS)
529,713,951 *36209DA00376AD62B9C03F70809230AF84F8A7A4 UITMUNTENDE4
529,713,952 *3626BCFE3656BCA5B97861DFDBF5CAFF42401E01 ULKOKYTVLL1
529,713,953 *362F9EDD1F45427AEE21AA64E5F70C672A745A32 SOTILASPOLIITTISET8
529,713,954 *362ADF1DE5A9D699ABC42784D5E4D4165726ECD8 SOULVIDOUS
529,713,955 *36215FDFA3C529C47429A475CFED9F184CDD155C UMESH NEELAGIRI
529,713,956 *3623EBE445A624FCB726F6594B1AA8A49A95A644 SOVRAPPOSIZIONE1
529,713,957 *362F339EB3E6861B55226608A36CE6FE11DCB3AD SPARROWT
529,713,958 *362AD8F1F69035273CA7265C67B14A1EBBF9CD11 Splat~(=P
529,713,959 *36298745BC52CD2F9C7DBECA580B168F83BAC659 USNY0926
529,713,960 *362C4DDF4D2F65E79839FE37900F1580E13E4211 ssapkert
529,713,961 *3625B382A00D98418054F79EF3D5F59B583E900D staceyhuckabey
529,713,962 *362D190A8D326312C0CD17F947EFD14C376973A4 ^V4BAA
529,713,963 *362C0C503727FFFB1579F1D0167E599AEE3F030B VAINSHON
529,713,964 *36280F74F1D87891334B8D295FB7BA1E281C5829 VALARIEKINNEY
529,713,965 *3625738F09F44B24CC04A1202FF99B5FF6864ECA starla.cooper
529,713,966 *362A80A13E4A98A38AAAF9387AE117EB0A975A70 VAL.CRABB
529,713,967 *362E0FFB52AB5688595BC0C49DDAD23B819C2F3E STARTREKDOLPHINS1
529,713,968 *362DA3CBA1AC185E65742DA65B4DE2ACDAD486A9 StarttheShow(a)
529,713,969 *362EEF786117D1FF0387FB11CABDBAAA96EC6EBC stellapolaris2008:afourthspatialdimension
529,713,970 *36272B6F980460B2DD7A1BA8176F20CBEC36B5E8 STEVIE.TISCARENO
529,713,971 *362DBC2A47B4A6B7C5CFC1C6D785A1B4B3297950 VARMA91
529,713,972 *3627B554D92F6CA1C5E5D689A35C1607B5E6EE59 STOPPINI3
529,713,973 *36222B2777316073E7CAB9C28E5C27BE82C6FA99 [email protected]
529,713,974 *3626D4BC08C3E293C7B1641BF076C9F3CF173C0F sullivancorbettbubblemascot
529,713,975 *3628F3360144BFB8E1516AA1F54FD0E18A0DAAE1 vic.liersch
529,713,976 *362117E934A696E3A06755E79A9B973235749BA0 victoria.myrie
529,713,977 *3628794C9C9DB4AD02CB3732D5D6FB753294D7C1 [email protected]
529,713,978 *362DC67BEB683DEEBE61C65F0FA4F7615DEEBCBF SUNSUIT
529,713,979 *362BD66390A1C8773F019EA91CAC867FEA80ECED VIGNESHSADDY
529,713,980 *3621EFA0CFC9C0CF4F8F4A1634BC7ADF0CF28D87 VIJAY.PUSPAM
529,713,981 *36251AFA2C1FA28EDEFB3BAA4237A381915CB354 SURKSURK
529,713,982 *3628BA931794272C898481EBCE1416DCCDC031C1 [email protected]
529,713,983 *36225A3BB87E9D407129B57F61EAA6C3223775B7 viper1947
529,713,984 *362983AD681606759BCF1164C7F6A23C7F12F239 sylvain.chauveau
529,713,985 *3623ED4491F6121038CC3A0C061A3715BCF8D617 SYLVESTERWARNEY
529,713,986 *362E6CEFCFF861A8CFA8797E8BC00B114D35FE2A vishnu-iruvanti
529,713,987 *3628FF689DDB4E18D478EAAC4EA3649F2B24D35C [email protected]
529,713,988 *3626F7C24FAE4BC1CB0F7FE678C799727713CE05 tajwana2
529,713,989 *362241EB484EEC5CC27F0FD14A5D7ACB5AFC4646 vrivalokuvis
529,713,990 *362AB37DAE020BB2F85D9E1850EFEDFF2970672C VYLFREVO
529,713,991 *362AA3526732390980CEE811E343FCA429BACACD [email protected]
529,713,992 *362B022AEAFC35F5C64635F2A7EDE584DF71B441 TAPISSEES
529,713,993 *362C6DDDF86F7AB6D6782495E73ACF9BBB9CD6DF tatsetni8
529,713,994 *36296A4AD18C714973C26E7E8464FA734D1A1E80 WALTER.STORMENT
529,713,995 *36285489AB962E1379E84D1C928F1893121C2046 TEACHANARONG
529,713,996 *362C0E2B4F62AE79336238183915A03099055A84 TEDRONLS
529,713,997 *3628C5B127EC08D269F2286FF4971E93B01FA2C9 warmth.is.there.in.your.affection.towards.any.of
529,713,998 *362DF91AB9F339954F5039B4BA81007847639C33 TEMPDIR3
529,713,999 *362635889037DEED436D9C066AD5BC796D11B651 tenzor126
529,714,000 *362AEC3E4690D003CFD06E6E2BE4FD6DFDF63A5E WEEFSELCULTUREN
529,714,001 *362315580573AE61620E9D8238E2037150D7138A W=EK
529,714,002 *36205D9199531A7EBD957B08F7EBA980A32BC254 weldonplacido
529,714,003 *3622A3BE1167066C3E214D693330C839EF8632E4 THEATERPHOTOGRAPHIE
529,714,004 *362C7D4DF1C7EB3A1B288B39F623F7B553393210 THE.FLIGHT.(IL.VOLO)
529,714,005 *36276DB7378C154C0B738A1A600BE398E6C795AF themysticsea
529,714,006 *362149FBC0044C33F3410FFF24AE0584A6382676 THEOLOVEJOY
529,714,007 *3621235BD47B7B14F0EAD754A24C667A47CC8115 whoops-i:
529,714,008 *3628D128281DF1865C8D857A4CF76BAE5D9603C3 WILGA2
529,714,009 *362C4CDDC2FC5A837761AD2BBF5B7A451B41E6C5 williamite0
529,714,010 *3625D60382422D17044A52BF98D3CAAECB4374ED williamwotring
529,714,011 *362FCDA840CCEF37ADD3595D3030B688C4F3E0FD ThroneofMisery
529,714,012 *3628DA6A454BF44446D9927CBC23721612967B82 wincheltoddvincent
529,714,013 *3628BDF6C3414604DE6DCB17BAFA9AC6CE2C22C2 WINNETOU, KAPITEL 3
529,714,014 *362E7D539AE4CFDDECC4DF078690CA8BC9FBE619 TIJANAPOPOV
529,714,015 *36216F5860B9D6A1B61F6DFCAE4F3E19E879B6C5 winston.tuck
529,714,016 *3624446286CABD95C12D30A0019B3C7260566349 timuriostejue
529,714,017 *3623314AB6A4FD8012667179253FC7E7EDC766D2 TINA-ORMAN
529,714,018 *362703A460E44AA9AC6E9E3A17CA6847BCFD8B0F workhorsing
529,714,019 *3620593CCC63F9E7BA514AA1C26F3C2339B6B43F WPVWPNPOVWPNORWPN
529,714,020 *362ECADF2FD70E145859FD1812E4F3297373C887 tndlbrtt
529,714,021 *36279819F9E97F0129EAA10AFB78C5CFE98D1BFD [email protected]
529,714,022 *3624522838E9925EA7B5AA0EDE7C4A16D48E220C TODT
529,714,023 *36281477DBAFB4EC317079924BABF28FC08B8733 XAVIER.EXCELL
529,714,024 *3626218A1FB79B4F7A1F047F18C03B1E7FACB8D5 xaviersanderford
529,714,025 *362EFABE43838DEE5BD04CA44E3291B8516AFD27 [email protected]
529,714,026 *362B8B04DD68BA229309993E272DACC8826903B0 [email protected]
529,714,027 *362BBD69E7E08DD1BAF9533A7F84EE603DB67BE0 TREE》的
529,714,028 *36222271A330599BBB82E6CFE8255D3516985D83 TRENT.DUNDERMAN
529,714,029 *36223B57AE84BD0A2F375D8FD9D789428D3A02DE (X)O~O~<3
529,714,030 *3622B6D295ACCFA3B1BDED9912C201DF1178CEA3 [email protected]
529,714,031 *36253D41571797926209C6557555305F506AF23A trip.baird
529,714,032 *362409E190E227D2E6F33652324732D46E633628 trishamayquimsing
529,714,033 *362C62D4E2D8E885255E2C88D202C0D663354BA1 TRISMYWIDYASTUTI
529,714,034 *3629BA3F064FD83D3ADCE2AF3BA151B9CEBC91BC tristanehrhart
529,714,035 *36268737DEE9427179E3F31BE7C1A649961F085A XURIEUSE9
529,714,036 *362EC4F0168F9566D91051727C5313B657E10E3C XVMENUS1234
529,714,037 *36249F175BED8F3990F3D28BC4D68D3A925886AE trkrls
529,714,038 *36221564D2F5F2147B773090221E3C64C04F222E TROY ANTHONY SPENCER
529,714,039 *362AA3BFE4DC701EF4B9960AD459FEEC735EDDB6 truong-huu-loi
529,714,040 *3624C95BCF48DBDCCF312A6DC377BCAEE22A7C08 yani-edwianto
529,714,041 *3621FCB7642BB93A3870221A18C9AD7E4EFB9654 tshepisomoemisemosana
529,714,042 *3623E1A442E822AF840689C59DB71F7C0D2698B0 TSINRAM
529,714,043 *362CAA0F6A0BA147C5A624D16CA00BEAE6D129B3 tteline
529,714,044 *36229A1B95351990618D0991706E520E85EE1850 TTHORUM
529,714,045 *3624C457FA895FBB0E5D358C620A301320341476 YDYLLISI9
529,714,046 *36299E4878401142DF87614631A4954E2F320C8E yichenglin
529,714,047 *362FF7C85DB718CCBD9AC10231D9BDCA8B27271A TVU FC
529,714,048 *362096A0303F5C09195134C7FBB60828D3267023 YINTTE25
529,714,049 *3626A622B5D1EAE5A584F4826AA9D6E2C300C6E2 twin.goodwin
529,714,050 *36250DB8593854CCC1ACEAB37711015AA96BA70C TYPESCRIPT-N:-TYPESCRIPTS
529,714,051 *362649ABA45B778BD4B0F16829CCC1066C28EE8F TYREE.LOCONTE
529,714,052 *362E6AE6D1E42B0B0F8AC5B448B8F9754B60E824 yoav-eilenberg
529,714,053 *362EBF4621C364B8B8C9528DDAC6CBD7B53B6EFF YOU.CAN.NEVER.MAKE.IT.ALONE
529,714,054 *362124ECEF5E17B857F91A128E67FD32D5F1C91D YPARXON
529,714,055 *3626430DDBA5E292CCC7B4C3DD385CB0394BA37D ulviofeijoo
529,714,056 *36251F532834A922B9171062B45FBF318E528BCB yustiansuryatanaga
529,714,057 *362CC7DE890DF107C297A25BD8023ED445D26C79 z654yr4hyb35dgjz0v8a0
529,714,058 *362EDA7E878B6C482810290B3889E0DA290FE9DD zach.slawik
529,714,059 *3628B912C8C2A5EED50D4334090DE5830249C91C UNSCRIPTEDLIFE.NET
529,714,060 *362ED761ECA433F8A27DB9486A4783170CD29E88 U'=O
529,714,061 *3628C0EB9BFBDB574383C68B184C2241F012DFAF UPDATESETTINGSFTPTYPEBSWING
529,714,062 *3628D39E5B4A482F52C4B9019F32C105C677796A URINNIRU4
529,714,063 *362BB97ACEF030F6EBE55B61F584BC3DEE1F550C ZARNS
529,714,064 *3621CB5F6EFABA620E5B30B2265F0395B39C63F8 USERBERKLAKE
529,714,065 *362AD75284C3EFA87E80A7EC1D7A63B40F579CFA z<cp
529,714,066 *36208281D7B67E65A6CFF70ADA26FE89559BA637 UU-*-*(=q
529,714,067 *362A44C367EFE96BB5C7163758B5390396FB14BB UUSKYTSTING
529,714,068 *3628642E1C3CC10D5C211B709168031D0D1B79A9 ZERAH-FALOPE
529,714,069 *362310C10BF3CEBB623964AEF75B8517EE288D63 [email protected]
529,714,070 *362A4C58658ED8BF225024C7A5942A1D3D9A9A9D V03LKL
529,714,071 *362EC89E42FAD12AC7B9ED2C982DA1C66EA1C55B zhangwil[email protected]
529,714,072 *362AB82104B8C4DFE164AE77A17764D01C92A65F VAIDEHI.KEDIA
529,714,073 *362E6E88FC4050CFCBCEECA980119B92044D3A53 VAIKUTTAISIVA8
529,714,074 *362A74F850279F584C93B16D2C5568253523648D [email protected]
529,714,075 *362B87C8B764D19DB5E47B82CFECCBF910F06BFA [email protected]
529,714,076 *362CED37D94D04C04CE9B823FA771FA4E7F21960 ZINEDINEMABBETT
529,714,077 *3625234488F2260FE82BF757B0D0B849357DB996 ZIVOTA 20
529,714,078 *362F8AA0D14B3ECADD0C3FE7605C47C164439940 vatcus.dopeboi.seloro
529,714,079 *3621325B331E3DCC8FB2544A5D4749B48C79FF86 velodrom1
529,714,080 *362D7B65DD01AC7B92A724817BF572CD6334820B zulker-nayeen-rabby
529,714,081 *362D1E39DC972B1D6E5BBBAB084D726A47FD6709 verwaardigde0
529,714,082 *362347546FC43879F2AFD05E4359EA864BB42EDA ΑNX
529,714,083 *362E856E52584D8B122E2CCF54D35E8C0506922C εύτηκτοσ
529,714,084 *3621D9A701A86EB5B6F58C01FDEA23E15A5EC199 VICTORIA.FROUNJIAN.DERMOVSESIAN
529,714,085 *3627254011C015DB936D3690BFE9A252C02851C8 VICTORLUZADA
529,714,086 *362D8A049E015F857CB01458FEB188B3A5B6BC47 авторама
529,714,087 *3628C270949484536857CBDCA44920E48A831C52 лубинста
529,714,088 *36297F7EA97569800B539F0E6902CB62C36D1F77 vovetaguilar
529,714,089 *36237C77127FC1406627AED2A7CC8ECFCDA1A7D1 «ПРОКИНУТИСЬ
529,714,090 *3621698047937C1BB020698CACC07EFBD540E8B7 VULLINGHS3
529,714,091 *3623163EE2A4AE0596F46C5B9C1BCAFACC7C9360 САТАНАИЛ
529,714,092 *36249D20CE477524E61FB459E3B83DAF54ED89A1 скопљу
529,714,093 *362D121728BCC2AD8BA61DF87DECC2CD77EC836C waltergiappetto
529,714,094 *362E812169107EF4BB9EEE2FCF49E3245EFB3402 wann-see
529,714,095 *3626999DB02CB8199B95FBD6F2AC7BB887B7F043 の基本機能を実現した。このモデル以降、hddレコーディング可能なパソコンを基本コンセプトとして販売を行う。
529,714,096 *362DB4EFEBF6AF4BE1530732E3B2A9AC68F87D01 [email protected]
529,714,097 *362E93D7692063B3B4B03269D8CA87F8ABB32DCF [email protected]
529,714,098 *3621B33688C5BA00BB6FD598AC6ED664FCD9CE3E WIKICONFERENCES
529,714,099 *362AE0AE4A93FF26140B58E6A2BA7499FC5109F3 willianhagert
529,714,100 *362F4D96A730BB88F69E78A0E055AE4DEEBC023D wilson.delille
529,714,101 *362E67AEA4CC6F0F6F7E164F198F95F7C0156134 WOODROWLAFLER
529,714,102 *362F852A5F422FA6B518649415E8D25DFD7613F3 worthyciteable
529,714,103 *362EF285854A63C88EB8A052F9FA8366D0FDF712 [email protected]
529,714,104 *362A5C5C42D7869A1442A571D2CE3C1E96E6D3C2 WWW.BRIANSEYE.COM
529,714,105 *36210ECC01448AE42CE8F6C0FC205D3DD72C6114 wwwdowntheavenuecom
529,714,106 *362FC3F71501BF1680F2AEF3C691D96AE61136A5 WYATT.TRICOCHE
529,714,107 *362762CBF47B6E2D7B793FB82607441887DF8300 039303223x
529,714,108 *36235AA35918376CCCFE566AD0D802CB3A12B8F9 )x(*[email protected]######B
529,714,109 *362FF8EA3C6AF7B43BC414CDD356FFF428246F59 {X}~~DQ
529,714,110 *3625940173B387207FFB7611A32D1529EF885EBA 07041282
529,714,111 *3626C9677BB41513C046602EBA15A567202635ED XKJENSEN
529,714,112 *3621DB668D08C3AFB9458DBEA993E6788F295655 )0(`<----b
529,714,113 *3621BFD8793519FA2E1914B83741928D920857B7 xtube89
529,714,114 *36260656BCFB7DAB55FD646C300CA4EE0499A31C 1157541 OTHERDETAILSOFTHECOURTROOMDRAMAWERENOTREPORTED
529,714,115 *3625AA0FC34F26E1CC6BFCDF8F4624C7E3502B98 12:.12..-#..-&...ROUTE
529,714,116 *3627A203DF7922EAD012BF38B4BD585F20D0FE53 [email protected]
529,714,117 *3625BCF19359BC8DE735AA7D49DE750A0CAAD3FD [email protected]@
529,714,118 *3620773CB6D562D289CB153F2D3DDDC2389C939C 123HATS
529,714,119 *362C06256F27F2A057C963E44D7E1CDC5585C8E8 \\\\127.0.0.1\\cdisk<br
529,714,120 *362CDE953B8950BA2E7F74E4E8BAF8D93AE64BE9 130D7
529,714,121 *362CB6F17BDB5CBC92A9F45F6F1F75DD000874F3 14gommiswald
529,714,122 *3625A9CC256F7B1396FDA56802B7CCD98387338E 15APR1500
529,714,123 *362C3206CB379BA665FC5D34E19EA570C1358042 YLSUOICADNEMNU
529,714,124 *362773E7D1591BFCD20441C60ADF2442A91B964C YNLMWII9B
529,714,125 *362D7817366BDF1878A06159B7DF99191DD67D01 yo soy la voz
529,714,126 *362768C398C5C0ACB81C9D46465E3EC19968F617 1ANLASILABILMESI
529,714,127 *36207D038154D5965895C39A0BF440759B91D057 [email protected]
529,714,128 *36254945D21F3CF061E6B359B3E013A64912C490 [email protected]
529,714,129 *362CB732BC25B6F33ED3BE24865EF93B2D1A7D45 1BAHNSPORT
529,714,130 *3623F3B64296DBB3689143F7925E4122FB8511A7 1CELINING
529,714,131 *36268BDA7C1D184E70B4B2C9ED68D892ECBA92BC 1decolorate
529,714,132 *3622C11A870705B1A1DD2AC9F8889DFE2E1615AB ZABNATURA
529,714,133 *362936043B85BDFF2D03C734D3E1A991E31C5062 zacharyholmen
529,714,134 *362F8CA8A3A9A65EFF87CD4CD5FE3C4A53B1DF3D ZACHARY.PERREIRA
529,714,135 *362BAB10E5B14BC4D74EBC387F570C3F87D765CA zacharysuitor
529,714,136 *3626DAE77E64D6A57E592E4B84DCBE1BCB8AAB1B ZACHERYPINDELL
529,714,137 *36215AD81065A1618820F2ABBB6029E785E4D861 ZAIRELAINEN5
529,714,138 *3625931307921EC95FC852E974C23E3BE80C0228 ZAMRKALAED
529,714,139 *36286436B4A2FA631F57E51394F15760009FFCE5 1huolimattomuudellani
529,714,140 *362B7BD29C90E6A3D27011CF8E61DFD66317597D 1 KILPARYHM
529,714,141 *362CDF6A86999F66B64EAB3E176BA8DB0579BACB 1.KORJAUSTUNTEJA
529,714,142 *362858AFEEB05E8EB85982261B5DAD4EDBD51631 1.KREPIT
529,714,143 *3628513E34DA468A40965409DEEB406EACC512A2 ZHALIASKY
529,714,144 *362C5CC7E743B8496C469E91E8CD78CA58C574EF 1LITRENA
529,714,145 *362BD8F0674622B2BE70F5CA7CA9D2F0B620883A 1-LOJIKSELDIR
529,714,146 *362534EB90F8DD50AF6D2054EC570881CAA580A9 ZHONGTIE
529,714,147 *3623EFAE69348842022B0AC6A694051B36EDBC48 [email protected]
529,714,148 *362E4EAE22637175EA4140FAFF618DEE827CD428 ZIETZKES
529,714,149 *362C22A43AFA92DDE5E703A17327B30AA4EB37A8 zitbegriff
529,714,150 *3627AA1E51CA0E6028689BD4BDCB0FCABA5A97AE 1 PLOTORIENTED
529,714,151 *3625DF36AA434B0B8A7191AE31A57A4013E1C670 ZNB.TAQI
529,714,152 *3622F76F737B4D13493C34AB09082B3DACE7D3EE 1PUNKPOPSOPASSA
529,714,153 *362F9A2B6CE7AEC14891088CBF6F3D0BCCB31501 1-REGIERUNGSSCHREIBEN
529,714,154 *3628AA5A02934BFA8D34C7E32E70422C85F85795 ZWVLSTK5
529,714,155 *36221DBE669E77E2BA229BF3B28B5228644E9A43 ZZZTIRQR
529,714,156 *36250186E31B4347FEB203189F83A84B505E5CC7 1terhark
529,714,157 *3625E27CD7CD2B37147526C52C639E8B1245CF26 1.webmailominaisuuden
529,714,158 *362322AC6E8087B87FFC5316075B6D902B38408A аркесилая
529,714,159 *3624AE2F7FB6A3F5E872086505505F6BAC8E8EC3 2131475 opiskelijoilletarjotaanmahdollisuusosallistuaymp
529,714,160 *362A21C59C89E5818E7927FDEC5CE76DA003A4E0 22091501
529,714,161 *3620045FC3818A9DA550C92E268587837CB0C41A 2389931 spano,rizatto,wassoll's?
529,714,162 *3627BC64D6EBA0A733C5CCEDCC5F855054E10E20 МОНОСЕМАНТИЧНО
529,714,163 *3620D360E4EF9BCE33B982160712757758DE97B3 2429867 vanhempien nykyist
529,714,164 *362A83E2153931F46B23805D2B75EF1D5B1DA956 ОДНЛМ
529,714,165 *362546FE12544831EFC58BBE68CD17972723371E спандарянского
529,714,166 *362FDD647989264D66B96DF187F9447BDF3DEF24 2.AMMATTIMETSURI
529,714,167 *3626B72C8DDDF3434F18DD266581DD561B804C2A 2B13FCEE2BCAD4E995F1CE00FA6DC442 OPMDPS
529,714,168 *3629DB1B9E1FC8788055FB64F66CE8AE9DB6F394 2BONERSEAN
529,714,169 *3625022410F16C81123BC2F26728C573494FA006 (元素),与德拉兰德(delalande)合作
529,714,170 *362B6E9DCCDB416A13BDA7940D137599DF9310ED 2iamsean1
529,714,171 *3621B19BD00F2DA0CEF97F5B49152D89FB7D9733 2NEOPINES
529,714,172 *3627B37EE770FD33F2FCE5225E898CDEE3A78236 [email protected]
529,714,173 *362137505482A89C0A2B0866E235D6CF1CAAAC4E 2TANZPAERCHEN
529,714,174 *36265406049B0452EB207E309F3B9619835907C1 2.[[User:Zarbon|Zarbon]].14:06,.6.January.2009.(UTC)
529,714,175 *362C8330D0B910F7C6F7593FD072867BFE88F9AB [email protected]#$%^&*(
529,714,176 *362041E14B6B4673B5B4ECCD34BE94E31A73D17C 3artverwandtes
529,714,177 *362D7BFADBEE4F551EACDCE16FDBF9C892268DFE 3GAUDYNG
529,714,178 *3628CDBDAA31AE0C4FAA1DAE6A122A05C6D3BF5A 3##P~0><
529,714,179 *3624FB52B337E4A39FC13CD0021A7C59284D4539 4IAMSTORM3
529,714,180 *3620C20AEBE688BD5244CB981F2C8A0D491B255D 4IR-STR4I
529,714,181 *362504AE9EEB6CBC369C7B7FC99BC826E27B8818 4SNORELLE
529,714,182 *3627905727ED069DF97466B7D949127865261D12 4STEMPROCEDURES
529,714,183 *362930C1BF0A42CC2B31A0AAAC34FD2C66B55A3B 4.ulusay
529,714,184 *3623B0AC3F9ED00AD7B5361C30027D374A32C98C 4WOERKDNC
529,714,185 *3623D6764793A3C00285EB9EA735783AC5846066 03231784
529,714,186 *362F0B41B174C131C3826C9D3A105E34A93E8EE4 546493 MR.MITCHELLDIDN'TCLAIMAFULLVICTORY,HOWEVER.
529,714,187 *36213BFD65A95FAB104634F1E0A8E066D237E26D 551812 KATUJEN.KUNNOSTAMINEN.JA.PERUSKORJAUS.KULUU.MAANK
529,714,188 *3625A5FBEC18CFAA67DF5D0E9B375E4694D0CABA 5:..5..-#..-&...DECALOGUE
529,714,189 *362B1F609A869336B8614EDD950238F9B0242617 0awx7mxbbq
529,714,190 *362BE9A6DFE6F7849198802CC9C2DF1022C9DD6E 10-TIDAL
529,714,191 *362328EC2246A676421DC1B1F8255CDE30CFB213 1100689 N
529,714,192 *362CA91BB557B745964C1D84477551707C1DB93C 1121722 heille-molemmille-l
529,714,193 *362AE62A3AEC21C1BB4E90F77BD19DBDA0F56EB0 1174857 SEONRADIOMETRI,SATELLIITINS
529,714,194 *3623AC130D33196B285565F3948471FED7547F4A 1323650 se on muutaman vuoden aikana vapauttanut sek
529,714,195 *3624E9AD086DC3ABD2DBCD97D3AC8A089FA77B54 13510677X
529,714,196 *362A196D7E539DA91854C385AE908BECBD01C21B 1477032 rohebayernkennteinjeder
529,714,197 *36221D50116A607C85FB064DD8E009BC6A17D851 14 HALLINTOLAINK
529,714,198 *362DFCB66DF37B7EC7FF055CD5B61E380F70FF4C 1631759 hesetatentativetrialdateforsept10
529,714,199 *3622776CD7BD3797840509DE4D5BCB49915F5993 1651580 jos aumojen harjat on j
529,714,200 *362326F33115A3982984D7208597623E9FF1C186 5VICINITYING
529,714,201 *362084CDA77C28E6BDCC5893A6A586DE5240C03E 60728 uyanmak-istemedikleri-bir-ruya-aleminde-sanirlar-.
529,714,202 *362AB10327154C9101E87223D9F791E403E5D377 1790365 DAS STASIUNTERLAGENGESETZ IM INTERNET :
529,714,203 *362A1516F39DE80CD925F503A31C89F76B194F1F 18061464
529,714,204 *3625E7BC12AE21E1026420C4938B99931D7998D6 1972-10-18:stlouis,mo,usa(disc1)
529,714,205 *36297F2212D14FE70BFF4A9566F786766D521B7D 6BSWSOFTLINX
529,714,206 *3622A96AC8E4232F6CD90A1EC4F283A9697B468D 1.ayIplar
529,714,207 *36275CA39ABB53C421E7042DCE4ECD64AA051F05 1-bagirircasina
529,714,208 *36259A737BFB520C14BF0BC98DF392BD89F9B3C6 1 BENSAVERON
529,714,209 *362C4CB408FB2E50C6030EB377EF941C9B0CEB0D 1biotech-index
529,714,210 *362EDE7B46BCE3CAFA9FF5D1B33957C99090D2B7 1 BIRIPOD'DA
529,714,211 *3629025337217DBFAD4A562ADA8C0F2B3D7AA30F 6IAMMART0
529,714,212 *3622854A88C147D4AE1A3C3F0ED414EAA4636517 6METAPSYCHIC
529,714,213 *362709D4C9046EAFE33640B43A6470BF74A290E1 1HALKHAAR
529,714,214 *3627E82E381536E51666A2229CEBFC9C35ABB3C1 1 HEXACHLORCYCLOHEXAN
529,714,215 *3622097352B9FF13C0A8BD65B947F8E5EF9C25A6 6ORANGESSTARGATE
529,714,216 *362FD240596A15166419590B8F6304EE5034AEFB 1 KAASUPURKKEJA
529,714,217 *36288A866D9A68E9A44BBA4FA98CE4ED58270684 1-KOHLEZENTRUM
529,714,218 *362F1BED09A3FC2A48941D7F1D720C252FEE76CD 6TODAYFM
529,714,219 *362EFA0EBD9C5ADDAA87519AA1D32115808D5C07 1 kyiskap
529,714,220 *362377F23F616FC2FEFC7CAFBFE201A128FD2CDF 1.MENTUSTA
529,714,221 *362EABDDFA5E4EE3EB1D701EAEED03075701865C 771766 ikkunarakenteet-korjataan-ulkopuolelta-ja-ulko-ovet-l
529,714,222 *36223C774CEB18F1FB00A1A39503D45DAD172ADF 1-ONDINE
529,714,223 *3629BD11F1C7CC9B60C627A4A3947DC8F2C6E0AB 7ASDFGMASTER
529,714,224 *362EC548224B84F047A328ACBDCEFFCCA5C6ECA0 1.PETRUSANHAENGER
529,714,225 *362CB150B5699784A23B832A04762E541A469E3B 7BSWXTROPYBSW
529,714,226 *362679E244FEB12DC7A73CCAA8838EF8432732EB 7FLREADLINK
529,714,227 *36237B13AB304490C6044BE51F4FA8D4FBF5827E 1solutetaan
529,714,228 *3620635DDD3C9C36BEBB6FDD5BDA5632F7D5E3CB 7HOORBUIS
529,714,229 *362376DA40D65132D7D7D2A9227613EBD1508369 7KOMIZONTAI
529,714,230 *3627623AE462A1BF51BE9809F0AC444ED0F88E97 1.TEPPANANPOIKANA
529,714,231 *362AB3A1B246842A762B58E9CB92BA42D5F28E46 1tuonti-vientiyrityksi
529,714,232 *362F7621901B760519CB1BBD0F65BB2B919E2566 1 uuss
529,714,233 *362EA1E2B9891E1571B65103F14BFDDDD875E8F1 7OVERANIMATEDS
529,714,234 *362DD5ECA95EDB2201358DB535021DC30A5EEC4B 20101442
529,714,235 *36200BC71D9394DE0CB3355372A2E4E20D4A8C26 7VANNIEUWENHUYSE
529,714,236 *362CF771B3EE2AB9FAECEEAB65FAE79142A3919E 2374037 SILLOIN N
529,714,237 *3625D16FE53C9F8D1628D733E17EC287F249BC9C 8#####>*.*.*)8(
529,714,238 *362002763B1219C0F77C776A5EE12915D0B7C692 8BSWASCIIDOCUMENTSBSW
529,714,239 *362399B7B46714FD88EC770F2F47751178C7EA55 8COUGARXAVIER
529,714,240 *362BBE3F6075E027B1F4E2754F0785FE68EA62B1 8ENDOCARPSES
529,714,241 *36293506C87F47FBD7017D8DC093A413CBC590CC 2.galleon
529,714,242 *362A2E8526934FFDF25CD00F73B837365641F9F7 8KONTROLLAUSSCHUSSES
529,714,243 *3621660EDB42568AAF1BD375D4F41CA485976F0B 2 heimtextilienindustrie
529,714,244 *362745A3C0CEAAAA46339CFC45D6481CBE6C2267 2iambeta9
529,714,245 *3622025CA3FE1EC8A444BA28E8B008F7081B9625 2KARARINIZ
529,714,246 *362D80B4319D0F947548D5A7E1AF2FCB36EA9BD3 2KSO5INE81
529,714,247 *362BA8A010055A8E0BAFFA759438902464ADBAC8 2.maggia-tal
529,714,248 *3622DF0619262DF4B5BBB01B69688D8429A9B405 2 NUUKAILLAAN
529,714,249 *36294AD48BCFD268BF4DB48034C0B6056EEFE986 8RETROPLE
529,714,250 *362AEAB4BEB1058E219A2E79C710DF601F69FFF6 2siberian
529,714,251 *362ED2272ADE7A47261E6343B423A748D5E7C8D4 8RYCHLESCHNOUC
529,714,252 *3624FCE8CCEF9AE90E6637D45F8C9A875BF61414 2THEDESERT8
529,714,253 *362E69A8FC0FFEAE63980E2F130D93BF6917F776 8TKURDEGG
529,714,254 *36200BB0AC04816EE194FFDB9045872F4F1C0432 8WILLIAMSNICARAO
529,714,255 *36262F95178D3D0803CB2A63C0FE8FB2ABB342FB 353ABRIL
529,714,256 *362722637CF55EADD6D6BDB68E16A0B49DD4E076 356293 "I'MSEEINGALOTOFBIDSFROMINSTITUTIONS
529,714,257 *362CDB78F9921D37824CA679318441B0CAAA4B44 3.7.15-ASTRAL-BODY-AND-INVAGINATIONS
529,714,258 *362BC682817F5EF8CD1CB06DCB0004B862B50316 927751 MAN FAELLT NATUERLICH TROTZDEM AUF
529,714,259 *36243211239F45287A907A7B0420231275B5396F 942draven
529,714,260 *362AE329FDF0423E566B97D2A1F8289C49A56D01 3cd7cb9f
529,714,261 *362F2D668CB7E5D19CA6CE24A8957CFA3B760986 9BSWVALLEEBSW
529,714,262 *3629B976D11E2B49B54E6D68DDA8DA1E9BA57704 3IZNALAZI
529,714,263 *3628CD4955A4F4C6C871039D85C8A7FBD321F7BD 3krz0jlkjmo
529,714,264 *362C32B712C194D2A8D2CCDA7927C94E1008BA23 3#####P*-{X}
529,714,265 *362C998A72B93A475D03A22190BF69210E2A796B 443590 testauksen-voi-tehd
529,714,266 *362FE9C3C092BB09E5D6967B623CA20348F2D6B3 9PINMASTERSBSW
529,714,267 *362D03F679CB9C521AA1B55A44FEF3BBD60AB4B0 4CIDILINA
529,714,268 *362FF6C9D43FB24F8E2C82E93CFA08093609B319 4INDIANSHADOWS
529,714,269 *362212026919C2448E824279EB2CED92B3A4CC89 9UKOUSPAR
529,714,270 *3629AFEC12100EB84A2DCE79C6CF31AAB1411A0C 4MYREDMAN
529,714,271 *362374A69DF7F0F5C86F53D4B562339A8CEE7A2B a#0yi
529,714,272 *362F4EF63F6BB2C1116A5079620E9E676D857CEE A11-PR3S3
529,714,273 *3629B39E0F49326E1F91CBA0ED615CE4BBFBBD92 a2g=g
529,714,274 *362ECE99171B7395D9CAFF9665082C1490A5156E a:)3i
529,714,275 *3622F1E04212D0A8B5E871924228840986AA6FD0 4SHTR4Y'S
529,714,276 *362D60BC28DCBBB5F1111B81511F687B9892BDFE [email protected]
529,714,277 *36211F4C14739CA79F28A1E259029721CDB910DF 4thezhongguo6
529,714,278 *3621924368C023BB032B301DCE3652548DF1E1F7 A5TG2
529,714,279 *362A7B8BDADF6903DEE60FCC55FEFC3056A2AA6C a8f
529,714,280 *36251C1278544A809C2883058723DAA0F286A48D A9MMM
529,714,281 *362E2106C2457C16A5881CD77FF88003103FAAC1 5BSWGOATLEYBSW
529,714,282 *362DD1316D6A24916DA684B5245DD2A4960CB803 aabp.p
529,714,283 *362ADF22CB0B7C3F8EF4DBAF862084FDAF3F01F2 5iluvanneli1
529,714,284 *3625D2D6F1DBB4074AA372960BE479EE4C0AB5FD AAD(=Q
529,714,285 *362A7EE6B053BCF2013C3D4EB43ADFDA3FDA172D aahdi
529,714,286 *362760302F49D3E6DD35E4FE37FCC2575981A159 [email protected]=y
529,714,287 *362951FAD33D34017FC976EF0E73CB48B21B35DD abcdesinger
529,714,288 *36225E9CE3AD99BB5A7CB7C610370479FF2A1609 ABE.ORF
529,714,289 *36231909563EF2B5D2E2DB50B22F90CAE03EA537 ABI:
529,714,290 *362D5510DEEDE3AD14B524074624966F33370025 ABM(~
529,714,291 *362B15A7F07BF74FDF6725B996F09951452E6E22 abo0'
529,714,292 *362C4E90AB9B9F1D16432522955E02F5D7325DAB 6IKIMUISTOISELLA
529,714,293 *362E735B8754C82153B49A60A50921EEAC750286 ac}zs
529,714,294 *362B4FD3562F898E9685A2E8DE75DF38BAB11B33 6PENNEBSW
529,714,295 *362B1BE6762F92D2138F5798BE69E68E9B2C1926 6PROLIFICK
529,714,296 *36204E67E49E8965AA74639FE37A9A4DBA8A1BD8 6SCHANEMAN
529,714,297 *362AB6853FB8CA792D46F9417422D47EE4EDE098 6ZKTVRLF
529,714,298 *362A986DBEFEB614B7DBBE3A2F3E418021FF9158 755ASHLYNN
529,714,299 *3629C51A3A4A56513A7CD39241BDC2D7293C7549 AF3M3
529,714,300 *36278FB44E20B435566168E6ED9222B1FE0C906B afc!6
529,714,301 *3620270D6D2512514FA9C30263227201D7B59646 [email protected]
529,714,302 *362D17E3354893CD9ED01E08B83AB5CA08E8031B a]gl
529,714,303 *36201CC5E25498549C3D8C36F84B7265E4033758 7ENIGMAGONE
529,714,304 *3623911C390C03E8F31B7BD994497465DB8CC06F a/gup
529,714,305 *3629531392062131608FD46044414E2835721D06 7FUNREGGIE
529,714,306 *3625FBD3EB0605C9103FF71269DBD982BD36B59F AGW((
529,714,307 *36260140B56970DC05BB95E63766C8EEBA6D2588 7KONSEWICZ
529,714,308 *362D058923ABC1BD2B453638D70B049781A6054A a;i.a
529,714,309 *362671E111D2E94F92011E0FE21BDDFE7C419379 aigleses5
529,714,310 *362F0D4E66F8644F28A75C3503F3EE4FE734AB38 7PEBBLESTRIXIE
529,714,311 *362D0A5FA52D42B63F39CC1F2A4262DC91B72DA0 [email protected]
529,714,312 *362FC05E4D303101583DF7CD96A1733568C815F7 airplay2
529,714,313 *36273EAA3080A103F7F1CBF57DBC670F669358BA aj!6!
529,714,314 *36282465DF2028D86B32CD585E56A9C721438CC2 7REDISKOMUSIK
529,714,315 *3624C0D24DE9AD2A286D794AA918BF99E1BBA586 7richiami
529,714,316 *3627B69A32F1CE968C68EB78D2CED2E9A11AC775 7-TUKEAMME
529,714,317 *362DCC56CBF950DC87ACF12B1178111AC59C86B1 7WCTVBGDQAGFSEJ
529,714,318 *36268C5B6B0880086D5EA5919828BFCCBF2C7C39 7WSASETBLOCKIN
529,714,319 *3624EFD2B7436280E4C702B1E1E9CA21A4D79157 a$lb&
529,714,320 *3628CE7D45FEF44048E0CFB2A03DF5FC25E06202 ALBERT SAHAYARAJ
529,714,321 *362B4C7FEA2BF7327B6EA9F145C3768800AEF777 alcalae
529,714,322 *36282564378F38A592F2C62C0CF8466A95FA04A5 alexander.lazarev./.khachaturian.(gayaneh/masquerade/spartacus)
529,714,323 *3621B5CB81908F80B992A38256E1F41F1F31B0CC alexmanhardt
529,714,324 *362B4F4A3FAD51B4BFB8E8D18D58532B11370DDF ALI.DEMEZA
529,714,325 *362DEA1B14CD2461AA0FDED728AE2288E1095163 8ILUVTRIXIE8
529,714,326 *362E41F4A8C35BAEEF0DF1EC51E26BD15913BB17 al-machera
529,714,327 *362228C7D8832163593F60EE25AB068A38BB651B ALMOST.APRIL
529,714,328 *36218F2DD052E736DA3979A1142D7943D045CCC3 8KOPPELUNGSFAKTOR
529,714,329 *3626AA7B5B27BE71FC8D2524EACF9208508AB963 8NONSWISS
529,714,330 *362224A1DEDE058BD35084CCFAF0E7088577775D 8NRGSBLD
529,714,331 *362B9EA422D514CF050D8BE852C62BCE562AFDA9 8####>~O~o.(x)
529,714,332 *362A8808898EF3A447D4C71EF4E45769F08DC04B 8ORTUNITA
529,714,333 *362350D60BB08BA620F434F7EEB5359961AF259F alysia-stradford
529,714,334 *3620C05B75AB116523451FC603CAFC2575BBE9E2 8-----P ~SPLAT
529,714,335 *362471641B9E74DCE4C2FC1E09F1C1882C32767C 8RA++1!NG
529,714,336 *3628B46299386665CCADAA07483EAED0500185BC AMINUMUSTAPHA
529,714,337 *362AD1AD69C64D16AB84955DC11DEE51F455D9CC 8TILBAGESTEND
529,714,338 *362135B190150D35D2EFDC509F5F9D6D42BE1CC5 902913 TULOKSEEN P
529,714,339 *362E28C68509E7E4517DDDAD9C1E2669F582631E 95wablair
529,714,340 *362E3DB06B1001B234F1E9915B0DBDCD88D49A85 9AEHCARTODUESP
529,714,341 *362A817CD62853B1F68C7652D09ED9C7E14508A2 9BEAUTIFURUSSEL
529,714,342 *362DC96CB46AEADAB95EB7E136796FBFEE846025 9BSWDTBLLBSW
529,714,343 *3625F4CC885B5DE73CE7080A33D8C98DE7B50992 9COURTNEYMARIPOSA
529,714,344 *362D2E84FD71EB065C5749FAD5B269A5607EC93F 9CYCLENES
529,714,345 *362F62FEA4A568A43D5D09C8AD0C8B118021754F [email protected]
529,714,346 *3629A2E0FB1E6397EE2B7977ADD261BF91FC42AA 9ERUCTANTAQUE
529,714,347 *362C2406A7BC0A913C524189F8586818E3EB3B59 ANONIMW
529,714,348 *362C1AED59D785FC923C4F9DA81314A451429F23 9GUMLIKENESS
529,714,349 *36289BC9264D952B736AE35ADB79AE2C84BA076F anthonywollan
529,714,350 *362F564515F8B8872F6F03E8E72D71D61B53F4BD ANTINOMIE$
529,714,351 *362E2CFF0745AE38DCDCBC13EDCAAE09B25B75B4 9LESLIEWHATEVER
529,714,352 *36225598547C250B1F63F0031E2E1EC5C436B692 9ORANGEKITTENS
529,714,353 *362298E80EF760B50B9317BFCF1AC1F2A419397A a"or
529,714,354 *3623CE33CDD23A8F6731844D716972E915CC8B00 ap9dx
529,714,355 *3625B9BE894AF48AC9E3ABEFD3ABC8CF787CB9FB 9SOLAYYALOS
529,714,356 *3622B9598420175DB453B00A80308657F15E570F 9TMINISTER
529,714,357 *3626B927F81C5D5A38DFBD043101C93BAA9A1AE4 apz.2
529,714,358 *36249D4D066486FEB5EB20F6370100219B05E03D ARREDONDEMOS1
529,714,359 *3620940C7A946BB1AAA588EDAE3E3BA68CC27671 a9"qb
529,714,360 *362A88770E9997A248CC742FF53012E1A5D921E0 AAAN:
529,714,361 *3627483C3BA8D3C4F248C0CEE5C8D52430309616 ASSOUPIR6
529,714,362 *362871FE5CE1A4EBAC00D7CAF510CFC2A07E18DE ATHWARTA:
529,714,363 *3625F4C3F716CB4F5C5EB657034C52587AAADD40 a_tk6
529,714,364 *362EC4E9EAB4107538BD10DAFFA972C65EF7B8BF AT"MO
529,714,365 *36268F83AADEB76900D62FA5EE155831F58AFD5F atve
529,714,366 *362E4867189A1088BD978D7F63B917F1AC1B4411 audrey638
529,714,367 *362FF95FE77F65E820B20999DA9CEB795F96BAFC AUSTINWITHAM
529,714,368 *362404AB68B493E5AE06CE86708E8E461F22E152 ABEL.TIMAR
529,714,369 *362E559D17B5C8195B149A22ACBEE63F9017FFD9 avarose7
529,714,370 *36271C6D98A0A1D639652575E67F7EBDC14D59F5 abpjw
529,714,371 *36225CC1A35EA0B7D615A778545F0E8D29C082A2 [email protected]
529,714,372 *3627F02B9E2A4BC799BACA7294F68E4235BD9507 ac9vz
529,714,373 *3625A7491B576654B7C1D4DE07D443D4BB5B0380 achesonkenny
529,714,374 *36263BB3E8470FC54C13BC5B9866BA7F459C2B6C A.YG0
529,714,375 *362FDEE03D062B53A9F24E7B5CB8BD7A393DD4B3 acnrj
529,714,376 *36200A6ADBB3F01C1AC4DC5D2242956A73073B6D AD0~>
529,714,377 *36208E4BC4341F380AA1AE711E86C41D7D826DAB ADAMANTS0
529,714,378 *362F1FB8FDA4BF8D0174D4BD1256CD3C13846BA7 AD+$W
529,714,379 *36268CFDF43AEF51C374FDD8A7FEB9952DB31B3A aeuf
529,714,380 *362EC95B81DC7513888088392E949047ED39AE59 balling-h
529,714,381 *3620056E2583DDB47558C39705A0C24C64401003 ag+=z
529,714,382 *3626C2F79C7EFB88FDF44426674B3E868671C132 ba&o"
529,714,383 *362959F92D9B84872D5C452334D713B6EBD4D0A4 BARNESBETH
529,714,384 *362D124A8F9CCB7779060E0096095DAE036F6A51 BASIL.FORSELL
529,714,385 *362E4A87374D0E3D062B5540ED617CDF5F3BAC57 BASILFURUYA
529,714,386 *362F0B629429928692872A0C016DB229B6AA0B69 aigetsos7
529,714,387 *36209EF8F7ACAEAB196F66EE9D59D3F58D795136 aj(59
529,714,388 *362BC41B684CB369C9460FF99E6A701B27020954 BB~O.~o}O{
529,714,389 *362C54EAA42755EC5D534841C5B17767D1C455D5 AJXGU
529,714,390 *3623F35D273ACAB4F3665F374F140629104C3280 A=kF
529,714,391 *362A278E143821C5138C8A1BCE82691DE6CB2082 bcfu8
529,714,392 *362A849ECB5D90133AEFCBCD952AE64530B2F495 bdbv
529,714,393 *362C88040757C0CCA362FB32DD1E57EE6BE4E632 albanei
529,714,394 *362220CA960C8E8533D8CEFD72B1008318A6D775 BDTT2
529,714,395 *3623D26890643331EE27F374874195085F06CCCA ALLAN.CRONQUIST
529,714,396 *3624216CC9F694A416703EC73423C3A419A366C9 ALLANGEREN
529,714,397 *36219D7966AF6C8E39298BE5C222DBB9338F0097 ALLEN.SPERANDEO
529,714,398 *3620344EEBE8FECB108FAFE8072E694432E0D2E4 BEN-TER-HAAR
529,714,399 *362B2AA9891D7BDA2EF652DAF107A929D80321C7 allowuncqof
529,714,400 *3623A340C85702937914121389E7B4C58247C2AB ALL_THE_LOVE
529,714,401 *36292D942114340635E2C2C6116CED832624A79C BERNARDJARVIS
529,714,402 *362D1AFBAA36CE3A1DD93544896E44F80CD99A7B berried.
529,714,403 *3626B0EECD69155AA735F37FD90C9B464D7D7084 [email protected]
529,714,404 *362C2C293B9F20C89EE7191F1110ECFE0C08D288 AM0I2
529,714,405 *362806C32445738AE54742BD4816EA0E88FFF15A [email protected]
529,714,406 *36274CF40096F975DE14794046B582B9A32BF298 AMBROSESTRAYHAM
529,714,407 *362B04CA34A51E92369716551BADA6A86F7FBF79 BGGFJ
529,714,408 *36274F9C9266FE2FE30463CB8D5E1F6BB288773E AMRJV
529,714,409 *36289CFD2BDFC7AA93E2E139F2AC983694E9B441 ANDIMISARI
529,714,410 *36252351EC0C963B89FCB8C8D91894D3B28227E9 ANGELOSAAVEDRA
529,714,411 *362C457A56F8334B85911FD7FD4E2580AC4672AB ANGEL.TOWELS
529,714,412 *362BCFA4DA3665C04E710FA39DD93F687FCA39A2 angelwithabriefcase
529,714,413 *3628B20BA50DF2BA50E0DB5CC15861BEFD2A52F3 b;l1
529,714,414 *3623E5E96BC41F012B5AAB35EC7C1A1BC3C5405A [email protected]
529,714,415 *362CBDB9C0FA2C02EA1AA33D4A95C08A25BC8DFF a$$or7men7$
529,714,416 *3627695BCB24849B87EF076922CEE6AA4F498083 AQ50R
529,714,417 *362B1632C339509A17F9A81ED7D5220E4EF2952F ARFA-ALI
529,714,418 *362883746402B65E9D651D1329787BF425E80339 ARGENAISE
529,714,419 *36252E46739A8DA21DB92AB4B00236828E751F30 ARLIEALBARRAN
529,714,420 *3629C75A2D1BB6BAB43B34A1D7F7BE3D8378273F BonnieButterfly
529,714,421 *3629BA53F949D8671C3ECD62CB1EA9EA97F6FECD BOYD.DASHNO
529,714,422 *362547CCB187929B6DAAFAA22057AF1B5A72AC21 boydortga
529,714,423 *362DB0789515D569492207A57561F77981529357 b}&p
529,714,424 *3628161979A43F081479238FB973DBF3C3FEFFB0 BPMWT
529,714,425 *362D1F1C5DA234A9F45B9005CB785E82CD5742A7 ASHLANDBELLE
529,714,426 *362094DEBFCDAB91EE13BEC79B0A56320D9FF3FE BRAIN.BAADE
529,714,427 *3622062A8ED5F161DEC89943C26DDCACC19002AA ATALUNNA1
529,714,428 *36255F4073211268128F377631D4AA46FC9B3299 atc41
529,714,429 *3621BE44C02B407E8352E75DA3B2C4309F92E7B0 BRANT.KEA
529,714,430 *3620072A1E02A6C11D62E3424AA9D90FFE6EFA82 [email protected]
529,714,431 *362C0C02510677DF91EAAC3F07CF56032A86AC35 atokatok9
529,714,432 *3622CEB7077DD57FDB5784CFD38DBE8753FCC85C [email protected]
529,714,433 *3623C4A6360841F27F008BAE7A797509AC478BBB A.TW=
529,714,434 *362879625647C8FF24C7A149151EACC18F31D16A BRIANNE.CROUSE
529,714,435 *3624B7326EE1A15C0DDF11554C61BDD0DA841457 BRICE.HETH
529,714,436 *3626BC9D5AFFDB32BBE71DC9C5D9A440AB64D491 BR!N9ER
529,714,437 *3624FC133EDBAF94D416CDDC56E934F11586DAA8 BRQ7
529,714,438 *362FCEEDA90905D8D25D8A607E34D3093F5092C2 a&#wv
529,714,439 *362B42D220634E01D3FDC1D4BED948DE9008EAB4 B018
529,714,440 *362C8A4D4A29C38B0A9056EE55BC0A77B7D8B9A3 b2r2m
529,714,441 *3623117E142E4F0BEB4A5A5A1FBDF5B633222145 BUURTBEWONERS
529,714,442 *3626660B4B2C7C81F7ACCD65ABD4DE970B7655B5 bw.ao
529,714,443 *3626B6315FF21EB61A1F294DA7EA41EEC45AF4F4 BWok
529,714,444 *362EE4A99F139D6A008A71F02696A1A810FF7737 B989
529,714,445 *362CEF26D07A85CC4A61996BEDE217642FCFB209 BAFM
529,714,446 *362E3119D6D5112AE5BBA0E1E0DFEE1C820E9365 C0SAM
529,714,447 *362E7A93587D9722188CF504C3045D9035903020 [email protected]
529,714,448 *3624EA4507AE550F1FEADB2A318ED5908F8FE00C BARRETT.TELL
529,714,449 *362D6EBE3B9DE0471D50C957E50C4CFD03211C60 batons..b.ae0.t.aa1.n.z
529,714,450 *3625E1FCBC3EA05B6AACE8770C723B5D8A015FB4 BAZISOLAJ9
529,714,451 *362414AADA82FBF71CCDC61B50D2573FDB8B1311 bazxh
529,714,452 *362B97AAC3C21F7DE9115E5010FF8844F6F961A4 BB&BE
529,714,453 *362044AA9733B8C77EAAB41C4273611622541B7A CALEB.HUGUET
529,714,454 *3629366BB4A2A6D119E104633C0B7EFE48EF5C06 CALISHAM
529,714,455 *362F6E086E9E79B25628B27D55ABE7654E1E84BC b=elb
529,714,456 *362C84E95F0595C1DD8DC6B6767B51800EAF56DD bennygermani
529,714,457 *36292115B41D81A2288014FE81DD4260355889A6 BENPL
529,714,458 *3620C469BE2A45658D22522326F0044648F33184 CAREY.BLAKE
529,714,459 *362271C915EC5292DEC1EEBA89353A6BEE864854 CARK&
529,714,460 *36223E6F4C308827D42613AD3919582C0EE470AB CARMEN.TETZ
529,714,461 *362787BF8608F76A9F3DA2837119DBBA400711E9 [email protected]
529,714,462 *3620D95CC1041570E14EED0A450B83A9CD92B604 carrrollitt
529,714,463 *3622C55CE968C719DAE92C8C367AAD7B3C75AF22 bfm87
529,714,464 *3622842A39CDDE9A02EAE883C83EB9C131A58504 cbaf
529,714,465 *36200DD86CA2D7C43458D887A0B444A2294860BA CDEVOSA
529,714,466 *362A794EFF8ECB5EB202329CDD61FB5558FF41B4 [email protected]
529,714,467 *362F13EFDBC7D5650B30B6FAA1319D56B8412D30 ceg)r
529,714,468 *3623EBD8BC127AFA91279F746177BEA112B0471D BL60Q
529,714,469 *362B05A798A99D44D705C82ABCA269D13610E1FA cfh"p
529,714,470 *36218E24234E248768215CBF477E454F66BFF9D4 chalcatzingo's
529,714,471 *3626631DFB42FB28C6B167E2019D50E430747C25 [email protected]
529,714,472 *362012908527A7374A85D9E12FA4A52E42F73A63 bne;o
529,714,473 *3628467DF0A850CB275753E7DE37D1171C63C1DD [email protected]
529,714,474 *362108DBFC43FE54095FC52A890AD7D113B6CE5E chetishikawa
529,714,475 *362505B3F7CE6760421A1B3728621E246954D902 BOONIE.MAYFIELD
529,714,476 *36290CFACF21B3E5BAE683B6D2F2AAA0AB0F2282 BOROROS3
529,714,477 *362491C8A77F05143D53D50A340F17F491F52594 CHIM CHIM CHER-EE
529,714,478 *36230E9516902DBB7F32CC06BB946AB620CD4A1F [email protected]
529,714,479 *3624608DCF36D40BDE4F0B589CB574192D7BE400 box of silk and dogs (disc 9: hafaz al assad)
529,714,480 *36298810CE40FEBB6A22D1FC866B8B743040C2DB CHQ&.
529,714,481 *3624CCA52CF97E3BFBBAF7468DE7080EB772E60C cidera4
529,714,482 *3623FEB39449DD89C0C78E2910C3CFCCD78F6F6D BRADLEYWILLY
529,714,483 *3621EF7E0AED38AE3CF249F63A8FF705F670AF05 CIUTADEJAR
529,714,484 *362AC8BADC41DDA35E738A8947D4AC93474F5898 cjcx-
529,714,485 *362A1948149282B4CF56ECFC841FFFA378A63270 brismar
529,714,486 *3628623BE2E852CABC71E50869BC2FA711A8D9C5 CLA.
529,714,487 *36281BA7564C8C19F040DE810A6147B109690662 CLANDESTIENE2
529,714,488 *3625FFF021E1F7611B32D28277DAEF4CCAC616DB CLASMPRE
529,714,489 *36216720CF9C02143229C60DB43E447BE63EA196 BR&S
529,714,490 *3628E30A89AC2C51683EDD599FD28513A3789162 „bruderschaftsessen“
529,714,491 *362688EB6B80797B749D3D6255D90833FE53B311 CLIFF.FILYAW
529,714,492 *362E134FD5376DFAF21258FBDF04138C09309021 bsg":
529,714,493 *3621CD145D88B9D6855C7ED0AEDE0654C3839187 c:nk
529,714,494 *362D4016E701A75ADA0AEC62320CE092B931C815 C.NNM
529,714,495 *362E5B667795A74068F2518584AC088BF93EEFDB CONTENTWITHGOD
529,714,496 *36240151E9BF00860B2AA9C797446CFEDFA78C61 C276B
529,714,497 *362FC1E2B8E8A4F4C09985DF90BCED8182E09D74 c\pe
529,714,498 *3626C039484D4CCB731B8CC18DFB7A081FA7540D C:\ProgramFiles\MicrosoftOffice\CLIPART\PUB60COR\FINCL_01MID
529,714,499 *3625EF215694C880FC7DB8B66E0087C8ECDD6211 c:\program.files\microsoft.sdks\windows\v5.0\include\iwamreg.h
529,714,500 *3625D0D3D0FBE4E6B4102843B386FD71B094A69E c9yo
529,714,501 *362C16A7FA26D375B9949050AEE0035B7554B46B CALEB.HISEY
529,714,502 *362A8B78BC2565A3E74771A7520AE909AA63D008 CALENTURE.'K/&/L/@/N/TS//@/R
529,714,503 *3625A8C4EEAF858E9C9BD6D71C1BDA5E44F94F07 californiaklasse
529,714,504 *3628FC251DE048AF8EB64293811FD412351E02DC CRLKB
529,714,505 *3625E23F8DFED47FADE3BF7A6D74E1470442060E CSRLV
529,714,506 *362C9E9B11812AD66A085A0E2C03007EABAB61E4 c=u(%
529,714,507 *36278FB060873479C814DD68D43C60C0D7B9591F CASH247
529,714,508 *362B852721B2495EF21ABCEFFF5D8DC1D0352BA9 cazm
529,714,509 *3620C317A44A3316D8839280780CFFB84AB20E00 cVm
529,714,510 *3621BC08D45BBC4B0B2B9BDCCFA838B4DB445DEC CWO8
529,714,511 *3623116FA81FFF33025CD2C1E7FD06FAE9BFBFBE C#ECN
529,714,512 *362458C6BFE16F0B2FA910F548A84F6C25D370DA CEEIR
529,714,513 *36278F59DC53D6F3931880BEF7D4714C91590916 CELTNRABBIT
529,714,514 *362A31DB57B257EE928A8F00FA8CF6CB1210D1A2 D13SN
529,714,515 *362A0A722D94A9F1891F0B7F0DAD00102B331E86 cf?i4
529,714,516 *362D5424FD12B80D61E5EAD4DFDCF7C9BC33E83B CFY?O
529,714,517 *3622659420C4E1F498330F6A62542ADDC2278634 C#GHV
529,714,518 *362B0575713856047271ECB181592063F801539A [email protected]
529,714,519 *362A1D499FD17794E3CA7763D1F5873F8C58433C chapter.09..the.half.blood.prince_33
529,714,520 *36257A6C9715AE46BE550766C7EB53CC8712BC11 CHARGEITTOVALHALLA
529,714,521 *362852534BB684833531B47BFA4CF3273672CD68 CHASEDARLIN
529,714,522 *3620A7FFB9A4B71DD359810E88BA6FD476D507D4 [email protected]
529,714,523 *3625D07D454FB81F18C6279F0DFF8579FDD41A4A CHCHM
529,714,524 *362CFAC568678232CDF322DE33AB7682DFF6FD8E [email protected]
529,714,525 *362B832C009442057FD7FFAAD6F31C2535C2D1B5 DAMION.FAILLA
529,714,526 *362CA31F200733B1A7E86A94A86362D16CD48C5E chhkw
529,714,527 *362311782901D42B30BAEF15C96571822D45C782 danielmaybury
529,714,528 *3627CD27F4EA54547AEF99B9E4F99B99AF2B130C chn4/
529,714,529 *3625C36375200272B00D2201E95AA69B44286C2F chongpfannenstein
529,714,530 *3625F501D9C36FCB1F8B521B1E71CB425A39894E DARENLETANG
529,714,531 *3623664EC097066A9E00DB0C7BB2709432FD06AA CHRISTODOULOUROBERT
529,714,532 *36202435689C2FD39C24BB874441FE84DFCDA7D2 DARNELL.MUNDZIAK
529,714,533 *362449CDD5694F3D20775A10E109508E639FF5DA CI0A/
529,714,534 *3623A24F1833C650FB4B72EFE97C2749044C0A22 davidaurelie
529,714,535 *3627F119EF15CE08FA6B0220A3FBB974E2458791 david-meadwell
529,714,536 *362F7ED8C1342D28CC230414F6BD1E22DF220E3F DB:)+
529,714,537 *362A9D37F7E894798050068EB14E65ACF0B9E7FA claircasanova
529,714,538 *362F71276D8EA928ED9BBE2B51369CFAEFADE467 CLAUDIA GRIMALDI
529,714,539 *3629AE66D82E8302070C41DA50C3BCFFE2B14356 CLAYTONECKLOFF
529,714,540 *36283A2ABCF71196B99D5DB0F6542B044C9E7150 clementlonabaugh
529,714,541 *362DA9E42BCBDFD424090DC064DFE41CF94E3818 DEBORAH VANBUSKIRK
529,714,542 *362A9F4FDF78705B4DBBDC703DB19DACA3021CD0 DEC1ARATION5
529,714,543 *3629DCDB85DF4BB1F4F2111A7C27AE552E89D6BA CLOUD)中。
529,714,544 *362F0108F526C57F473FDCFD571D0F4415C63482 CLYDEUCCIO
529,714,545 *362790F64306F5D6349E68C73EDB6794D4D11806 [email protected]
529,714,546 *362CB45082D020467B00DDD8B7F17009630440D4 DELETIONPAPER-TO-CAD
529,714,547 *3629833D514B152D114D357F357D052B22DE5ADE [email protected]
529,714,548 *3627E66CE67BFAB2F262F562DF2C5486EACDC8F2 DEMARCUSTRY
529,714,549 *36257F5FE32955E3E73CAE78418D4FB026A4645A CO6%
529,714,550 *362F3B89CF4C4EEEC9FD27AFBC90F0D5E84F7E6A dennisass
529,714,551 *362A2F4C5405789C789C01BD830AD80048B7D02E coexerts!
529,714,552 *362B4928B04B7348DFB52898BDB169FD20348E60 [email protected]
529,714,553 *3624531C3BB58EDF1C2D142AF1A2350E3AF5AF83 COMPLY.18
529,714,554 *362F5588B029FE701E686D947DB9ADF193257A71 DE;?T
529,714,555 *362A7793D246923A2DB4971F137C388FB3EF4BC0 d"f8f
529,714,556 *36275B387DA12CF69D3380CD18419DE2DB85E46A [email protected]
529,714,557 *3620D537057731B0760D43D1CC95E6D71AECB654 dfoi,
529,714,558 *3625DA762AD80DEED090117F88F2DCE9CD490A8B D;(GC
529,714,559 *3625CFC65E10E4FD2194B502EB6FE131AF4BAF4B Dgvg
529,714,560 *36201CFD21012C18F7F2B1D84EF1B015FA5E545F COWBOY '78 (CASA DE SANCHEZ MIX)
529,714,561 *36278C4D67EB78B590BDD44536F7B3AA5679A910 Cp=U
529,714,562 *362D771A8409ADCDE76731C8B403C81722854100 cristobalthorell
529,714,563 *362E4033B164B0379FD41DCD18540F5FA63F23ED Cristo:.Parte.seconda..No..21.Aria."Ritorner
529,714,564 *362E62027A5FA13B17602DD22B18FCD0D9EFF57F CRQTMMKXED
529,714,565 *362C1713DDB194F19EC2244D90B07F484A5D4375 CRUZMABEN
529,714,566 *3627A7CAC0D7078BFAFBE66A851CB6208C68C2F8 CRYPTOLO4
529,714,567 *36287DD4F5715204278B5FA421D3DB4FE15AA67A [email protected]
529,714,568 *36246F919E62905F3D09A30BD4926B6EBD791CCB DKSVW
529,714,569 *362CDA99424CF104AFCFBD50371520505F36BBFB DNQ"(
529,714,570 *36280F88EA6BEDC216EA6A9E61605F36841F147B DOMITIUS.ENOBARBUS WHY,.THEN,.WE.KILL.ALL.OUR.WOMEN:
529,714,571 *3621AE4CA687C60A1FA59C17A26F2519FF27BD27 CYRILBOEMER
529,714,572 *36292BC04D4293369611D08F862DF65F1861CAA9 don6b
529,714,573 *3623AEC5F2235C0AA9266B9CF45CA16EA806E7F2 D0LYT
529,714,574 *362E725B67952895CB30067BBBC43714DBFFFEFA d5ma
529,714,575 *362BD35B357C25AD25F8BB47C1579987BD596A78 d7w6)
529,714,576 *3626CD19C1AE20B287D1964DF6C7A71661700E84 d"rna
529,714,577 *36242B32F94EEBB9E9A05119DD3FDF6E14972A67 d&$s!
529,714,578 *3628B4E0A99AFD812F629909316148C1554E989B DAMIENTANBERG
529,714,579 *362FA6619867EBF1715BE47FAD379A2EFE30C1CC D_SGS
529,714,580 *362B70C4A9167DBB3C2EFC6692DBBD5A8EB2D330 dss6
529,714,581 *36270A4F8CA80B1A4FA1A2C2EBEBDB9C12516D68 dtj3i
529,714,582 *362F33C688882057BF9F589F88FD46918B106142 DT!SK
529,714,583 *362761CC6BFDAD8500804E3F341EF800162E42E0 DUSTIN.PALIFKA
529,714,584 *3629381C9FEE4ED8F836F04274E20BE4AF1B10DB DATOV3K$1
529,714,585 *362EF944B3B2CCE7FC8A4BAA3254D13F2D9D8AB2 DUSTY.SANMARCO
529,714,586 *36248D98B1E4F1EF3D156928E870A2E5C08EADD4 DAVID-+-COGNAC
529,714,587 *36227D302E3ABEF28130F16939611D6607419255 DAVIDREHFELDT
529,714,588 *362D7B1F6E0E5CCB02681B5627343833DCC744E7 DWOOR
529,714,589 *36202D2639C34D09E888040A15022C46647F644A DZOBR
529,714,590 *3624F11BF2F7C9A202A60D4FAD1168B9127F17A4 ealukric
529,714,591 *362CDDC852A9B13C0D7CD097C7A157B5C9CF78FE dedeyaz
529,714,592 *36226FBFFC06622837F4064BEF9BDEC654609308 ECH
529,714,593 *362433C32B569B364EA34C52E9C85ED2AE8161A1 EDWIN.GUINNIP
529,714,594 *36260287C7E9A76D7FEE646AB212F8E57BD7AF63 EDWIN.MAXTON
529,714,595 *362F07A000CC38E8B9CD4CCF058FCF1F757F7666 DESHAWN.RADOVICH
529,714,596 *362215DF88E148F12AC3F9E4AC8DBBA40C9C9AF3 deslondes1
529,714,597 *3622EB85D47262624F482374268A391B306B23AF eg63h
529,714,598 *3627B18FE420BEC7B1BC64C289C5989A571BC6F1 EH$EV
529,714,599 *3623996DBE85E98B1238A2CA784220AA01B07B4B EISLEYUR
529,714,600 *362D1AABCFE0E1AB67C1E968A3A85497685C2852 [email protected]
529,714,601 *362EABC9F3D77251DCC772192442DB2150A614A5 d,;)g
529,714,602 *36244F4E4729B64D04573C53CB5D4857535A40F1 ejk5
529,714,603 *3620667FF5F1888EB34B2E121ADC1E0680063144 [email protected][email protected]
529,714,604 *362C7B6A0022D0BC9BE4D319144ED97462B9DF5A ek-h9
529,714,605 *3625D8A7B5B0841852680CA8308180ED037C8677 DGSIB
529,714,606 *362771058147C3DE5F826486C215F71B406D5684 el6xa
529,714,607 *362DDF3715F6773788C703ADCA263568A7FA1A1F DH!DM
529,714,608 *3624A494F77BB920BAF3FEE561E8419735D2D82B dhu:y
529,714,609 *362F4A3ACD3B5AFF6BC26521D1D87AB069195F9A DI/5;
529,714,610 *36240BD25E7F05BBEC0A3B3A8274454827A45C15 ELISHA.STOTT
529,714,611 *3622BC8EF08893D16B9A778602CDB30E8335EE28 dictators
529,714,612 *362EF3FDE973D6E879E79345FEEE91D94CFCF8D8 DIEGO SANTAMARIA
529,714,613 *3629F2E4462B27FD0B4CE5526EE0A80F30596499 elliottwheeless
529,714,614 *3626BCB02E0EAEF6AC8B488AA34162DD92B336C5 EMHF;
529,714,615 *36264AC107DA76F8501671C148BC8C4F38B397B4 emiliobrummel
529,714,616 *3622F8D70F86686D2181BA5A80C3528FAFF30D97 DIZÍADES
529,714,617 *3629B00860A57414BCBC00F93E10366F0A0C982A DJOHNO
529,714,618 *3620985885F5A78785D3792DF2E0D6A387055095 DJ&Q=
529,714,619 *36256B5CE24403DE882290F9E9F30F5DFFB2E690 DJU0T
529,714,620 *36229FD8206E5DAAB1D82215C4D8EB2B5DCA0D94 emotionally.unavailable
529,714,621 *362346FF8B5A012987768A95DD4B3FED5E69B6DA EN8110242121
529,714,622 *362EED381CC0E219B1FA1CABD07BB093C15905BD enchastraye
529,714,623 *362EBCE6DE714B5A2675CC77A3CA939373DF00C1 don4+1v3$
529,714,624 *3628E14EB7D65169CC2473DEFBCFF9C7CCDDA989 ERWONING
529,714,625 *362FA7CBA0F7C195D8E360BAE15D89708F620E48 DOOLWEG
529,714,626 *3620B0657E2C341A8EBB2996A3C4CD0DD4D8F200 DORIAN.WINTRINGHAM
529,714,627 *362D0BF5FFDDD4A18D3E562595AC8CB437243A79 [email protected]
529,714,628 *36259808839F7B36E6CD330A703C98DD3EC9C35E DOUBLEPYRAMID
529,714,629 *362F4A0682E6AAB4853C678339F729953CAAB036 D.?PH
529,714,630 *36296523E8D93E25867847A3BB3B363F9ED8AAA3 dq5vc
529,714,631 *362F71506F10C237AB2C21A429B02D7AB10395A9 EVANDIERINGER
529,714,632 *362D5A0422F06CF72C670EA718969AA45D93F032 EVERETT.WEIDEMAN
529,714,633 *362B139A0D302744791A906DF80B7F4C464C941E DRAVAAHING
529,714,634 *362009F3B5EC26252607C1BC7E7A71266B3B7C73 EXAUCION0
529,714,635 *362104460788FAC49B0C83B53EF5E5A5834C6D2D [email protected]
529,714,636 *3629449D6EF02121540C0A28A4BC33191FCDF47A exercera
529,714,637 *362F344187C3A259DF1513B83C016ACFDD2C360A EY*T
529,714,638 *36241406A3FF2C2F7DE208FA85867C5EBC43243A dss6
529,714,639 *3627B0592AC2149921C570E25208615D0DEE2D81 DT!SK
529,714,640 *3621F3EB92B23CAE5E9DC519A111EC96BD12F098 faltanlle
529,714,641 *3628400CCB2C862C35784611EBE02C8650FC5168 d;ud9
529,714,642 *362060E0A77DB985FA5104E38F7EF63CB7F1674D DUPDUBIDIPDI.ON.FUNK
529,714,643 *36273C8FE201FF9FAE25F81BC2CB7F681E37AB22 FAVOURING1
529,714,644 *362020C1E3F53DCD6F506F61475FD2D1F553CC46 dustycorvino
529,714,645 *3626C153DF9C64E53A970CCAC5BB31CC43C35AC6 DUSTYRILL
529,714,646 *362F17654031B2445D82B2E32A121D9AED545F84 fel
529,714,647 *362BAFA0DB2E53BD5BDD1AFEAC93AD1AD997AB4D [email protected]
529,714,648 *362ADAF45057DD1C9A586AB62F14E0BA16F7548B FENGZHODIE
529,714,649 *362BAF766928835AB8EED0DCA289C1BBA64D1114 dwptz
529,714,650 *3620019F0AF83A06F8549906007142EA3959EA78 DYNA-LYNN
529,714,651 *36222CB6FC05021B74E00F651528D3D15252E7DF E2C37320-A649-30C1-85D2-B29FF9F9E0A4
529,714,652 *3623FA74FDEE6ABA9B4400A76BCD2F14E9EC656F fitfully3
529,714,653 *36241049235D29D9D47026E5FDC7FC15CA6BF555 earlcapaldo
529,714,654 *36206A1935A88FAE287178BE442E1416B54D0FC6 EARNESTREVELLO
529,714,655 *36206D04FDA9A692DE8621999DD90751FF1A3CA6 FLORENTINOAPYUAN
529,714,656 *3628FBECF487EAB2972EA9256E30595F9E228BB7 florentinotongue
529,714,657 *362A5BEECDF3B49B4CFF75860978832E4DDAD932 floydwehrsig
529,714,658 *3629BFEF9634AF0C3C4084CC45A6683EEBF8DC0C ECH
529,714,659 *362E33B498223A9BBAC5EEF559E895C12CB6F5BE FOG,WHITBYLIGHTHOUSE(CLOSEPERSPECTIVE)
529,714,660 *362B4BB9991332913C0BBEB207B21DBD8EA23B00 EDDEORVE7
529,714,661 *362DB8453FC5AEC2C33783F25B9A14C1601014A6 footprint(klubbheadsfootstompin'klubbmix)
529,714,662 *36227535A5702FB79E234D089D74CB239F923669 EDICITAR1
529,714,663 *362D9BECDFEC7E59B770E46139954BEB29EE78E4 edmundmcburnie
529,714,664 *36245AA60C971850F29A132ABE8CF1DA2A84AEC5 ED SAYE
529,714,665 *36224DEB25D386A82AD531384728E0BDFFDA4D95 FRANCHISE.CLAUSE
529,714,666 *362E1BBAB3A522F2D9463126B28AD04179CA8137 EG0E
529,714,667 *3626AF8DA96780F1CA50B04FF5C5BB392C335835 ehr1c
529,714,668 *3629633443C1C567791CD46C1EA6CF98579DF9D1 FRJUBSWING
529,714,669 *362501D143B73691FAE0F73D2388CE368050F45D [email protected]
529,714,670 *3625BD5FDAD91D1A834C3353745702E79793368C EJGEORK3
529,714,671 *362689EE0F6D95B3D1A1571199761B94EB368836 ek5i5
529,714,672 *3626CA5391550C04F57764DAAA21C7CEEFA6211C FSGARTNA9
529,714,673 *362878E7D5709559B62499A879676DCBD0F9781E FSU1288
529,714,674 *362DEA68CECD0EC49E0047540730A8D70F0D6269 ELMO.SULOUFF
529,714,675 *36250D609FCE8BB118BE2DB44DAF9AC67C815784 GALEN.MINTOR
529,714,676 *362827969517FA95ECFD217EC8CE4ABCC21EE0C1 ELVIS.HEADLAND
529,714,677 *3624C95D5B2A1DF9FB850F1E931F3A7A4FDE6A7A GANESH-CHATURTHI-FESTIVAL-IN-MAHARASHTRA
529,714,678 *362F4E73961DD7F9C626217D5950351C4DE8D168 GARON'&LESFORBANS
529,714,679 *362B61771A5B4E0065D2804FFAF7DD4848B08B82 GARRET.FINKS
529,714,680 *362A229C11EBD71197002F31C62E76CA501E134C empfangscheine
529,714,681 *362D212AD6F93C079F252E6414D4583D713F4635 EMV)M
529,714,682 *3623BB4D5E4264959D0758FEE562AD89290D0D71 georgefitterer
529,714,683 *36218DF00D66E3A7D6193BB96D96C4EC82CE1568 GERARDOHAMMANN
529,714,684 *362726811E914E11AD770ADCBAC9B2994E3AA04E GERMANARRON
529,714,685 *362159F59AC606F7F17AA0B3BF86945CC9FDC5D7 [email protected]
529,714,686 *3628F467D83FBF6F01A58BDA935E108AA6A3D4EF EPINIE
529,714,687 *362E795A70F070009C16A50061E20DE9283F06AE ergamine
529,714,688 *362C423F5978DFFBFE69CA49E0EC3DB42D95BF77 [email protected]
529,714,689 *362BAA89F728FEA63D3440EB6062E3C3F28F5A51 GJl
529,714,690 *3624541C388A723913B82A2BE0BA2D70AC7A906B ETHANPARVIN
529,714,691 *3620C402FE98F5DED7946D2796120431FA1B3C50 ETIMROTS2
529,714,692 *36297CF333EA75F59A40F777EE7BB8A748711CE7 EUaP
529,714,693 *362A34984BBC530EE7077C194D5B255ED6EFE639 GRAIG.STEVENSON
529,714,694 *3624781C2FFD583BD0EEBED19E7EE235924CE0D9 GRAMMAIRIENNES2
529,714,695 *36277BD0202F7E5E3ACC1041D93C4E4E96D47059 GREGGGWILLIM
529,714,696 *362F394C6CBA6F495CDAA4957192984825205389 EZEQUIEL.HANHAN
529,714,697 *362F90AFBDFFAFB439CF3656D4001BB189100510 EZEQUIELSLIGHTAM
529,714,698 *362F632D0BCB61E245EF8D141D18D594E8F84247 GREMLEN1
529,714,699 *362D1ED43C5FE55D2A14CB98897DE4EDD6480D75 GROVER.BARKHURST
529,714,700 *3627A91B10565497A14C790AA13BADA5C64083FA guaicum7
529,714,701 *3627F515323D9E5FDEE84A6DC650D3C3A5E6749E FALLOFIGNORANCE
529,714,702 *362278F8CFD5199A1F280406223FB497EBFFC015 FASTBALLHIT
529,714,703 *362CE7AE5E6BDE41CD2872792D6AD6AB15C4FA2D GUSSIMMS
529,714,704 *362F091113E5BD8F8BFDFDBFECD165B524F2933F FAUSTINOLIKENS
529,714,705 *362D6FDA4B20A553F96392D751B88E6C41983811 faustinomcelwine
529,714,706 *3620B2EFBB8BF76D7804A9ECD1D547CE370B8973 F[?B
529,714,707 *3621E687541A57EAE1D630ADA87FC02B57E58A7F [email protected]
529,714,708 *362B326AE519992389505FFD28366218BA9A540B [email protected]
529,714,709 *362EEF048C9601BABD74AB4CE70C075BB050E5BD h3ad.v3i1
529,714,710 *362BAB6798CE140123557E89E1B9C1A6ED437FD9 h3du
529,714,711 *36205C010E3A3A96BF249F6252CE781219B56D20 HALOCNEMUMSTROBILACEUM
529,714,712 *3622B29E5743734B6645C4536DBC844DC9FD9CF5 FGHKEVIN9
529,714,713 *36241B19B6361DF4138DC17CF4FC007345B0DB71 fico.chileperu
529,714,714 *36244ECDB1DB8AA35EA8AC1E62EE67EE65E6295B Fidelio,ZweiterAufzug:Nr.15Duett:OnamenloseFreude
529,714,715 *3621CA5EA67FF3FAED0DBEDC7EB00B0BA6B1971B FIRSTAUTUMNDAYS
529,714,716 *362472680283DA6FDC1C274E339FE385383B9F87 harlanchristy
529,714,717 *362D4F057E8688796877B03EC49AEE913C82F9C2 HAROLD.RONSINI
529,714,718 *36220E018CB7689BDB78B1C7DA97A1E4841081BC FKVVXOA0
529,714,719 *3628A451D655188F807848BA6369132BE799FEED FLOYD.CLATON
529,714,720 *3629EB490BCEBDE76C817CF8BD8AC7E96FECD3FE [email protected]
529,714,721 *36229151ED25C98F2426DAF82864BAD7C8CC0907 FRANCESMCBRYAR
529,714,722 *3620785A90AFBF26D7053F764A6F07C4A3EFE818 HELLOBLUESANDDOWNTHEROADIGO
529,714,723 *3628F16A4EEB57ACABAEF6539E98DA1BC118A64E FRANKBUDDY
529,714,724 *362F5F7239733C2269C7BFFA7723D3EBCE0E1D9B HERMAN ARIFIN
529,714,725 *362DA1DE316FC9A63CEC5A316CBA04392A32432B fredericklemin
529,714,726 *362B7538DB5B7373BD15165C602818277D922BA3 fredricklyttle
529,714,727 *362B907DB4B96674CA136AA81C3A22E01031B5D5 FRITZSALEME
529,714,728 *36265CB0EF31861227BBC8AAC937831D5947DED8 frutos
529,714,729 *362728B798A5DC698960CF200EF80A75507ED5F7 hm**
529,714,730 *362DFE86CA5A58B76A2E2FA147646F561FFAF5BD HOEVECOMPLEX
529,714,731 *362833C67F97370955B4879628F017B23DC604EF G3]I
529,714,732 *362EC0305303238A23804894C13181EF64B19867 galetrunk
529,714,733 *362BB27F2864326144825F254A27F8731B4E8A27 HOPE,INC
529,714,734 *36293AF4616D239B6F504AE16F166DFAB0539E27 HREF="//PAIDSCRIP/REF=SIP_KPM_PDP_24
529,714,735 *3625E32373B33D03E1ABD92CFA32450C1FC2FA47 GAYLE.JUREK
529,714,736 *362063174499473FB52CC757028C1A6CA8800B8A GB)F
529,714,737 *3628CF55E6B0B10C2B325CFE87A741F40772A8F6 GEMMA.FARMER
529,714,738 *36209C94F14936F0A4CF6E37875D998F0D22D02C genecaper
529,714,739 *36280D3C28B52EDF13FC7056A7CC564C07A05953 GENE.HORSFIELD
529,714,740 *362E0ED0EC1148F0AD4549153391D1C22D5BA5BC GERIGAN
529,714,741 *362FC9545D644A2FE8A0C7B4A854BF60C584BA33 gibbawking
529,714,742 *3620CA9D83600F41178CA34DC52FAEC312135002 IAMIRMELI39
529,714,743 *3624B39AE4793CD3EF7EAEF1078CBF1C77B930CE IKASARAK1
529,714,744 *362A54913E33C2F1FDDE5931976D8BD0B9B39940 [email protected]
529,714,745 *362E776CB35F7BFFFAF550BF2C113165431C5B44 GOZMA
529,714,746 *362375FEA80861C4D0836BE882FE1ADD9B190570 inactuationing
529,714,747 *3620919B6EE659DE54D29A7A88C1DDB7325B17D7 [email protected]
529,714,748 *362EE0CB770C1FBB0442441E08ED546077A5CCC5 guillermo.marinero
529,714,749 *362982A14C04B464003203E37EB66536D0A25E6C gunposts2
529,714,750 *362E56627757D223A4B37A42F3A26580ED58584C [email protected]
529,714,751 *362A65F3E67B2F9B18936B71271FFE1D3BD71807 innestate5
529,714,752 *362F64386184AC2A559DA180BEAEBE14BB8E38E0 INPUTINPUTTEXT
529,714,753 *3621291F9D9CD8EE3A7117A5236C16D24D2FC18F gustavo-a-munoz
529,714,754 *3626E248DEC4A3817BB4BE1B9783FD829A32CDEB GUSTENA8
529,714,755 *3625030AABDA914B05ACC3C6AB12DA24129D4E5E Insoucieuse
529,714,756 *36208BC1679757CE1E615F5E2479C43C5395923C GZ0X
529,714,757 *36212823CF9BCCDF81FBD715DC218FA66A9B89F4 IPMAAJLA0
529,714,758 *362532EA51B486117B35CB5A2ADADB220C1EC285 IRAMENNA5
529,714,759 *3626F4D9423B7039484954CE229078469AD375F2 HALFVERHONGERDE3
529,714,760 *362CDF8F71581530654F2CEA18D0FF84CB052F58 hamahiga
529,714,761 *362C6E66A3BABD1C2E9C637D9A470CD39BF82D06 [email protected]
529,714,762 *3621147ACABB7CB9DB9A58FF0780E0FD65562595 [email protected]
529,714,763 *362BAEADF4680DA53F541E4663B7DBD9C42CD989 HAPROXY
529,714,764 *3622A22DE2C35E35C5EBD04F144723DB0DC49649 HARLANDEVILLEZ
529,714,765 *3629E9341B8D2DB0B274A169725FB7CD6CB777AA HAYDENLENZI
529,714,766 *3623CDF3A51D5EAA070DDEF8FB000E0C2A5FB00A HAYWOODZINNER
529,714,767 *36260B62A2713B55A18E29FC74C9D6E710BBC245 HEART LIKE A FIST
529,714,768 *362BFD1C1AD75BE1316E0205375B2A265D66D032 HELPDEMO2
529,714,769 *362BF1BB3C40643C02D677C38933F8129390C7E9 HERBMCCARVILLE
529,714,770 *362F67A33C0E7729CE8CB73C8D7D9951D59821E5 jameborgerding
529,714,771 *3625D07039142F7B1E793778C6FEA052754E32C6 [email protected]
529,714,772 *3620FBA40DE3A055A5A56987CB9DB2727910A27C HEYGHTEN1
529,714,773 *362837D945B6AD14DBA09BD7C24E9C4AFC645EF4 [email protected]
529,714,774 *3623534FB4FCFB28BE872D091976890F541C8589 himal-pandya
529,714,775 *3628EA26ED32AA23989EFAD767A58D328223DFDB JARODODEH
529,714,776 *362C1BCA411BFE8477AD9187AB5DA125199EEDD3 HIOS1060
529,714,777 *36223D4D7F79A9BD088006C11CF308EE3B6F96D6 hipolitosturiale
529,714,778 *3622E2524903E39E3A783D33A1298D6189CFA2DA ho
529,714,779 *362E5733A1EB04CC21703F62395FF4660CB7312E HOLLIS.GANT
529,714,780 *362C8CA393A2CA9A64ACB28EDB60886D244C857F [email protected]
529,714,781 *362B77FDF1E8989BD9F41E781B9DC0FF52E39458 HORACIO.NIEHAUS
529,714,782 *362AA5CE28895C577CCD0C6D80381E5A28EB17F2 hoseronses
529,714,783 *3629D855C40D563DD277FF8399D27D46CAAF22C2 jerrellbennick
529,714,784 *36201565E045ED004443629B909370F0C1BE751A href="/sie=utf8&keywords=rate&rh=i%3amagazines%2ck%3arate
529,714,785 *362BBEA1CB4439C80C5B571655430CE2C413EDF2 JERROLD.OUTMAN
529,714,786 *362B3BD9E7EE801675531BD12CE598939E1FFDE7 HTTPWWWABDURRAHMAN
529,714,787 *362E49C9519905024BA22F15C621A938A654431C jessica.eberts
529,714,788 *362DE82B507A6FE34DBC6232F23A6AC40CADE195 [email protected]
529,714,789 *362C51DC49D14479F20B1B96277EE1195AA5F23F [email protected]
529,714,790 *3623AAC985CF88D6E076591FAE3206BBA45B86F6 JHADJOH
529,714,791 *362B0E7B4CF008A1711E0B5D27638E328C1D3875 JILL CHRISTENSEN
529,714,792 *362A93A2CAC038405957465CB646EAC1E063C556 JIMLIDDLE
529,714,793 *36255D8CDEADCFFBDF0894602B71C0E433AFF5A4 JKRZMARZICK
529,714,794 *3627584485CBE03C1BA38787F4E01FFE300AB69A JODY.COLLYER
529,714,795 *362FC634064D50507D0F21D9F855F42E20371CE5 HYSEN KAFEXHIU
529,714,796 *3629116FCAE809504F07BD9F07F3CAB6E8B6E628 joesphmandel
529,714,797 *362C3F2CB8877CF8ACEB5FBF6A31A1055B78A7CC IamaBunny
529,714,798 *362B82FC24BAD45005848A89120AC4A5B95192EC IAMROCKNROLL20
529,714,799 *36221AF0366B71745FE997813C9203D41ACBA540 IAN MABEY
529,714,800 *3629530F57321151C8046388D6D992F8B5F87A33 JONATHON.ANTOLIK
529,714,801 *362CBCFA74AAAD13DA9F4A30B7EA50DF6D9624B2 jonbreech
529,714,802 *36267049EFF437F709AB50200BAEA752CF7971C0 IBRAHIM629
529,714,803 *3620D12B2DA7DC0840B558A67F4CB9046FD85ABB ICALITES5
529,714,804 *3620F870035E86CBDC3AF29208E73CD88BF708C4 iccissam1
529,714,805 *362BEDF4462E3C5542E6A4D3148661DAF0EFE249 JOSH.DILE
529,714,806 *362DAAFC755E962A1BE8918A37A776344140441D IDOVÝ
529,714,807 *362AD090D4D5276070D84F9EA1F4AD17C4A1DF67 JOSHUAWEST
529,714,808 *362C9ED958F9555FE610B5A4C7785FE1CC290DBD jscornez3
529,714,809 *362B46C30264EE2F606462E71577B6F67BC3D75E julesbancks
529,714,810 *3620A2BF8B3655AD20D6CACE6819AB2383048A49 juliette-milan
529,714,811 *362071F85928E70BC1752A4434FA485EA747A12B juliosantulli
529,714,812 *3623BFF722992D00F374420151D520B087F91BC0 julito02
529,714,813 *362FB79222341EEC04527742A23A9A2B86500150 ILUVCARROT
529,714,814 *362CABE67CC69C29D4B889BF9F500501E068FC0E indgrebes8
529,714,815 *3626B8B465FAD4EF133B0D0D6AC70512D8F7C19F KELVIN.TIETJEN
529,714,816 *3628769CEAEEF4685AC03AA8BFBA1E6DD0BC59B9 KEN.GIBBINGS
529,714,817 *362A317A280B6B05843BB7E442FD01CA4F460F0D KENNYBAN
529,714,818 *36208C60D90256C44338A6EE07A6DD9833D51485 IPEOVCIMA
529,714,819 *362B096D661453DE33E3CE54C486FB3177E48487 KESKEUS
529,714,820 *362E95058E7DACEA2C2FE848C08C376B1A6F9ED7 isiahurtiz
529,714,821 *3629246D1ADC9C893C5E16251E8A572B2EA780CF KIMHASKEL
529,714,822 *3623EA5CFABDF10D8335606A8B444676ADE5EF52 ISKR
529,714,823 *36215201E5CBA993E5AA5D201532CD0E32F59844 KJACOMETTI
529,714,824 *362606086F84E340F83767D2524DC7E27B2265B6 KJOKUĐICU
529,714,825 *362F0AA0CAE50CEF53EDA65EB1AE5C83CE64E6E1 KOZCILINGIR
529,714,826 *3627B7B88278A20B3BA4AA087E43ACF83ADE0D86 kr5"
529,714,827 *3628D50841BDDF101B790C53B9BD4D09555E8B58 JAMES-LEE-SR
529,714,828 *362D90D3432B93112BD204FF4D1D11EC6E665454 [email protected]
529,714,829 *36280FD6BF02E98F67141A5FD21ECD1C46B37018 KUBOTA-SHINDEN
529,714,830 *362DFC7B6B08A2309411CFA608495BBA31717816 jarrederceg
529,714,831 *362EC5776A1A2081176D5CEC2E1183D98C5B5C7A KW|P
529,714,832 *3623A7158B82A46D5D40834DF0C0C6F5AB2D4B2A KYLÄPELIMANNIT
529,714,833 *3627CA923131D2AA570346F3E394D9B8EDD15AE7 L4X4V3R4NTQU3
529,714,834 *36241016C6EC4326B169BDAA23248DB10708E8B6 LABELPERSISTENT123
529,714,835 *362BF1A226D575C2D29F3CA70B87F2C9E3B05ABD jcchungb
529,714,836 *3622284A9E14CC2AC181117D9BCE42E182C82F26 JEDCODAY
529,714,837 *36288EDF5B5A52B118F3507B06047EECD7BD0892 JEDDI
529,714,838 *362534741E30234C79D0065CF4F7CE3CD271BC34 jeremiahsharrock
529,714,839 *36255F73C0112EC35119676022EA3F32BBC26CF9 JEREMY.LACKO
529,714,840 *3626D52A49BA4F51DFD3C019D5030B769BD827B3 LATEWHIL2
529,714,841 *3621D148711F85A3324D1B211BB113C500900E79 LEBTEN
529,714,842 *362D06333FBE417E31715BC5E7D9AA9AC6B6E56B legionetrangere
529,714,843 *36273A02702600ACCD2BD1B3689B3F4DFB89E88E leorieser
529,714,844 *362F40B37F358DF5B010BF3C8A75AAC310A43705 leserzeitung
529,714,845 *3628C0E4ECA5171F84E388529C9745B08DC6BA68 JOANWILCOXSON
529,714,846 *362F91F718993E7C35717A277DF03B9B46298821 JOAO.GUIMARAES.ROSA
529,714,847 *36215D794A30B253D4C961E36A053E30D23717AC lethalises5
529,714,848 *3623E972FCBFC8A5DF4B25C37660DA6A04B2F488 JOE HINER
529,714,849 *362F02CA9AFA031ED20057DEB190D472A67877B6 [email protected]
529,714,850 *3625E6E66C4188826779FDF3FCC2E53D9BFAF149 [email protected]
529,714,851 *36279F865A9A48E45B52B64647B3A1FA7A07F01C [email protected]
529,714,852 *3626DCE4D9D796520F9DEC4C10B1020997DDBF0D johnnykeatts
529,714,853 *362EC561EC8308CAFD183FAC558D61F3217CBDC5 JOHNNY.OR.ELVIS
529,714,854 *3621B2FFFE57F2BDE5CAFA5902DE185DC5A04DE4 LIONELTOREY
529,714,855 *362B79B3DE9B911787691431849834095EB4788C jonathonwooding
529,714,856 *3627C0EC0D51D432904F58EEB4CFF51C2E557002 LJNTRKKR7
529,714,857 *362C5EF53ABD746442FE2C3DBCAE96ECF5D82D1A JPCARRILLO
529,714,858 *3623EF180C5F6C671CE77FAB37444398B87B9507 jscz
529,714,859 *362EAC6B0284EF19A06E358A152748B1DF95CD03 LOPPEDV7
529,714,860 *362C4AD03438898AC180599F4B2246B16688C8B4 [email protected]
529,714,861 *362F40E74AC7B292B1BF3E36198EB6299F014153 lowell-buck
529,714,862 *362CBBBE4817C5C8AB017F98ECA4EFFCCACA2180 loydfreil
529,714,863 *362DBEF5664C1E5B4D61CB30FC6EAB8E6B8211D0 JYOTINAYAL
529,714,864 *36255F9309AD67AC720FA43433D3569B80494775 K120007
529,714,865 *36231986E8558A67E8665D0CC905D98C543CCE5B K121920
529,714,866 *3623E58CB4C888362F541B2AD5DCEB4BF0C52D11 K4PIT44L4FVLO3I
529,714,867 *362A991660179B3F9ACD480240C52D5A4B4776C7 LURJIMVE
529,714,868 *362753F56E3836FE15196F189976894D76E63B41 lustspiel
529,714,869 *3624B43409E8A6F416B9206EA42CEAE1C8E38E83 LUTHERKIRCHMEIER
529,714,870 *36246BB59EADC8D2F82A412D9121B42236AEC417 karaoke (non lp track)
529,714,871 *362929F7912665C68AA05B405D05120543F914A6 KATOO1
529,714,872 *3621A521DC7AAF5854AFFC8D12727EEFFEF4DBE2 KAYLEEHENDERSON
529,714,873 *362840868EF30B835E18FDB9C7519CC97492D005 [email protected]
529,714,874 *362CBF55CC3272B4F4448BAB0B751D6D77B8EC03 kcy]
529,714,875 *362C805BABD5A833CFF08F2AEA095B2668E48F76 macmaker
529,714,876 *36229DAF2AD89B2CE2675D47388CA4985FEBC712 KELVINFINAU
529,714,877 *3627C8847D538618FA4982F103D4E4C3E0605F8B MAIA-RATA
529,714,878 *362FD48600289A443F6AC6D426FA27573CFCF845 maiskij
529,714,879 *362173D4897994E595C0C3B67F83C521B11F48CA MAKING-NEW-LOVE-OUT-OF-OLD
529,714,880 *362915A862F667609540A39AC9BEC22BC528200A KENNETH.MCCLEAREN
529,714,881 *3623C8595B9EC3A4399831C28FAC60D32F10B4DE MALA MARA
529,714,882 *362A900CFCF911AA784C186651A869F3F4D3B172 MANAL NESSER
529,714,883 *362268212E589DF1E3A6472B67A5BCBC41C0C09D KERRY.TURELLO
529,714,884 *362214C440C24205B6FE5F2F26E2F30FEF5857F7 MANSEX01
529,714,885 *362DDCC08D71437A6E0418CDE94110CC1938C621 kevinshoulders
529,714,886 *362F93AE4658EFED6A8DDA7713B08546978AC5E3 khdr
529,714,887 *3620AE9EB78CC2E2D521E7F56BFF1894F8E33F43 KimDezen
529,714,888 *362958E667F12C15560C1A923940FCA915E274C9 KLANĚ
529,714,889 *36280603B03228F34E6370500754024ECDE82CB3 klar,ferdig,dans
529,714,890 *3626F70034BB430033AFE02CCB130C0EACD0175D knorren1
529,714,891 *3628AE338D5FB9743A39FBAD707E923CE52511E8 MARYSINCLAIR
529,714,892 *36219270C8A4A48CF00C74F9E22EAA043D4F10A9 mathar.(r..fearless.mix)
529,714,893 *362626804C45A6790DBC0690FCDCC66419123A03 KOREY.KRADEL
529,714,894 *362A873E1B5723E9A0E9119D84AD65A84FD862F4 kravė
529,714,895 *3622DCC189978DA220FB2DBC2C4B2FA0B63064FF metaeditors
529,714,896 *362B767F4FD23C5D5A6B542F12A28222A5DD8ABC MICHALE.MORELY
529,714,897 *362E1EA55136C4F50871EEBA1A1FFD907D92CB90 LARSJE
529,714,898 *3628C6750E20CA2AD883B0394A8D11CB24008CFA million miles away (plimsouls)
529,714,899 *362BEF6E31B8902A0054E51358BB3A399283BFB0 MISA.WILLIAMS
529,714,900 *362CD8C45757A6B6321561CEB5FC06998FC15EE5 misoogsten0
529,714,901 *362A23BFB1529F2BF5C048E2C997290DD8E9DDC0 leahmalabanan
529,714,902 *362F65CBC701A5DFC46D4DE7C43AE7E44151861D mohammadriegler
529,714,903 *36208EC7F6112A755DF50EF728AA1CC326297FF7 LEMOSINA3
529,714,904 *36228DC36DE718064889AD036829731D6431469C molekülsystematik
529,714,905 *3625D6C7B8879B09217F3E377859900FC2BB65AC lenox-nauvoo
529,714,906 *362FA541968D691B7903824D3D6356340E0A68C0 MORGANCAPRARIO
529,714,907 *362E32A972EBFD4475A3D9DB63253BF640E78E58 MOUN+4IN33RIN9
529,714,908 *3624B3630D16E13DCD593F5F0C235B6FF066D628 [email protected]
529,714,909 *362C0BF0B43374C685BE8AB160DC237FD628B55E [email protected]
529,714,910 *362E4DB2AF85A79A3830E0EA00421F77A3108D3B MUSICFROMDUNVAGEN
529,714,911 *3625E4C342F7A747973EB0933AE40E424327DFC9 my2klove
529,714,912 *362D4B6D23DD94FB48474880FE513901CB696F41 LINCOLNCOLFLESH
529,714,913 *3627EB926523F5E037981A147FBB325E3C1D480F linds1nn
529,714,914 *3622C4C4B8CB2BDDD9C457AB65A5B79CC9BD4438 LINIJIM8
529,714,915 *3620B6257F4CBCBE52C151F2B04F2CF57762595F MYLESCRITTLE
529,714,916 *3621D994F415FC19DBD12FCA27D511BBD199AC37 [email protected]
529,714,917 *362217E819E55E86A9FAA9F2EBF4359328A1F0B2 NACSgas
529,714,918 *3622C92CB7EB2C3CD4231D96C71BBB3F4A5D5ADD NAPOLEON.DIRE
529,714,919 *362783C76BC6CED587BF01976FFFF3B6FD7ABB1B LONDONFILMFESTIVALNICKANDNORA
529,714,920 *362D5456468555332ACFBC0D314BCC11050754F2 LONNIECORELLI
529,714,921 *362BBC2181AB1CC7B46814C21EA4FB79D8D85E77 NAVEA25
529,714,922 *362FF4F4A3F02C19D2AE1741F67374B8F9278A6A NDSFBRJF2
529,714,923 *36295EF6F7C21473B8E4496E0610B0855DF71005 nedvalliant
529,714,924 *36269B36B21A3D695C275184499E5BC18599FCF4 lou-yanez
529,714,925 *362F291B84B0BDC640302FA7BB96E9C01A933105 NEHMN'SEN-ALTEN
529,714,926 *3623567945B40C2B139759883AE0B4AA4BFE433A netra-subedi
529,714,927 *362DF883D3106FE4FF9AC4530ED90BE75CCA4664 LUCIANOLAUTERBACH
529,714,928 *36285D8D3DC278ED6F34276F59F8DA8AA31A018B lucianoschlotte
529,714,929 *36211E5A7A638A570499221BF2BC6D50A11B7E27 newsdayarticle
529,714,930 *362523EE7D2265E1EE843D03779EC3D674094A44 LUPECORLEE
529,714,931 *362EE0C90A3C91ABF802777B0303AD0E39A520E1 lutherchhim
529,714,932 *362BAE85AE38418BBD2952D6C48267E4C7A4770C NIKIPUCA
529,714,933 *362B0BBBDB3B97CDDCCE5BC07FE05A7CB6FC8BE1 LYNWOODSEAVEY
529,714,934 *36203BE2226419DB50B29FA7D75DB3EA7387D94D m3g4l0pi4
529,714,935 *362982B04CD1845632E858B5AE67BF9EAEDD5CAB MAGBIO
529,714,936 *3624EEE2DF73A254B1AF62ABBFBBE6E58C57EBD5 NOORROCK
529,714,937 *362CA08D4681F2E6D4C2FF17242886BB37032D92 NORMAN.GUMMERSALL
529,714,938 *36246C43D7DF4915E5AA85AC45236AA66671AD6E NOSSAGEETBENEVENT
529,714,939 *362753298E56FD8F32053188A342FB5A03EE6BFE manualkovalaske
529,714,940 *36240E284E52FAA669781D45284E0A74BB4D4751 [email protected]
529,714,941 *362916AB1592BD69EA4A86E366040FC1D77F273A marcelluslakin
529,714,942 *362E2FF159CA80654115A3EF670A9F80F0154008 NY318SVG
529,714,943 *362078C8CB4EC6184C6476787749F247662B0170 marchazouri
529,714,944 *3625DE0C48788119F05A83F1559E14E007446AE5 marchecolonnes
529,714,945 *3628890BEA8EB584624D4EB07EA2502D1735E796 >< o~ 0~qp
529,714,946 *362E9243DBD74B741D0C00EEC905A89E6488C267 MARIAH-MARIAH
529,714,947 *3621743E617A41E51E8A0AD00ED2EC6022EDCBBA marianne-ancheta
529,714,948 *362541144C15BF638DAB2C33B441470A0017076E OBOECONCERTOINBFLATMAJOROP7NO3:IALLEGRO
529,714,949 *362D2B93A8BBE193CEFDCA2B400E2381A79E5180 OC34NOLOGI5+
529,714,950 *362F6F6B82D6B7AD7339E876BD84A48CAC3415EE OLDENGUYZ
529,714,951 *3629F334A2EFAAA723943BF1847DEDBE45B2D7DD matthewrangitsch
529,714,952 *3626A2D1902BF7EE90A8D22E41217517A159CB25 (>_<)[email protected]
529,714,953 *3628746A64F287BC11911A85A5C0610B9791FDCE maturandin
529,714,954 *362E600C9AAEAF32AB4042818D3DE6533CEC375A oottaegress
529,714,955 *362BF0F3FB4FC52EF38451F3CAC37D861C3FD543 MAX.FAUERBACH
529,714,956 *362DF4DEABB19D5B6EFBED68E43336AA1458D8CD maximogrinnell
529,714,957 *362E0153831225C61CD8FD34F233C0698ACA4848 maximohennis
529,714,958 *3621548BE2E97370EA696B7898997991461BE00F ORDINAN6
529,714,959 *3620573262F0BBAF0FD05480B3346CCE43BA830A mbconcepci
529,714,960 *36283043858F8E8EC9E302F5062F0644FDE0895A orere(tradsannicandrogarganico)
529,714,961 *36250136B262E45ED58BC9F60018BFAB3BC81B1A [email protected]
529,714,962 *362D109F8E274A65F19549E79C30F37673898ED1 medizinischens
529,714,963 *3625AB0653A4468AD27E3782C00A5E4693C89A32 [email protected]
529,714,964 *362B20B341451ACCCBE643EAA7F9AF602F6E5151 OURBACKYARDOASIS
529,714,965 *36218CD3954810C3A49FEC279E7556752918F596 mellangrädde
529,714,966 *362D8C69C0AFC1F533CD154F974ADD4544279102 MEN'S MEDLEY
529,714,967 *3625A28E2E5F66FAF710580FD41B900879B5B246 OWALLEYE7
529,714,968 *362F821497FAF716035343B93ECA16C812FFD227 owguyco46
529,714,969 *362FFEE0C8B0632BFE194641E7B7232BDF06C87A METALWORK.1
529,714,970 *36294494F6E974091333BD6E97A107F23EB7836F MICHEALYACAVONE
529,714,971 *3626C79FF221FF73C7AD1A6226E6E7234A791B6D PANIELĒ
529,714,972 *3628C50AD832FE1FE1DD614FAE2A9EF78BD0E2AA par+1c1pa+es
529,714,973 *362D501552A5EBEE65D75BE9439703A197AC103A mikeldolloff
529,714,974 *36229430684C99E6D8E79746E8A04F0DC44C4CF5 [email protected]
529,714,975 *362F21DE9AB3BE73DA53441F35416F2C701210B0 MILANPOLLINA
529,714,976 *3626D4E3EA2AC9F6DE6CB093D31F8627FBE382AA milfordbushnell
529,714,977 *3626DB23D8A5E78113A487A8720A7F6CB179FDC9 MILLARD.MINVIELLE
529,714,978 *362CD653978154E4F5A030CFC901CC0F074DD98E MILTONKALL
529,714,979 *362B523E278AF87DA433637D916A505B8CF65759 MIRKHAN, AN
529,714,980 *3622C7691E7EC0C9EA4657AE5862D77AA7C77D4E missububu
529,714,981 *362654902F7DC5CCD327267AC3ECBDD5DE134E61 MIUCCIO0
529,714,982 *36261EBA032C85CA5A89A73D70B215A7EC15B6E1 MIVIEW
529,714,983 *3629ED452C5E556D409579C8D8C43F6F1CBBB123 PEARLEAN7
529,714,984 *36231F238791CD5C56FEF3CE7E5B9D422AAC7D61 MMOUMITA
529,714,985 *362E39CFB43FD8D930C8B2B95963490EA4FBD81F PENDEJO666
529,714,986 *3625656D900C4C409838AE7DE35EF2753F3A47AF MNDLSSHN6
529,714,987 *36234FAF0D77B9AED8E37452865A422251AC33D6 MNESICS8
529,714,988 *362BB6A2A459FFD513C553986898F02E8F16096E pera.nacional.de.washington
529,714,989 *362D17CEA305D3AD5D2BBDBA59D7A0171F1CFBA7 MOEKKIEN5
529,714,990 *36211A2FC7EC4ADC6482A0D74BB5C5B16C44247C PETERLICHLITER
529,714,991 *3627A1AB6988D9E772F2D040C044B393BBD4E9DA MONROE.GOHN
529,714,992 *3622D365A31B61D577BCE54010E755202A4AC8C1 philnykamp
529,714,993 *362AC6F9BB0A9E3CE4ECD03600B740F24C7ECF0D MTLELIGE3
529,714,994 *3624B4B6E08A60C0429984E01AA9A65353A86DCE MUSKITS
529,714,995 *362A7C73975625EC3B31853A10C5F476D01D0A27 POLMICU
529,714,996 *36244C49B8D38FB7C239372ED34051C796CD7252 p>~O~oSploit
529,714,997 *36213FD634A1749A98BF58BE29F4A9F32A25C9A1 pq]n
529,714,998 *362E1F9F64243BC69DB0C5CC07D0620957421397 NAKNA
529,714,999 *362911ADB194D9DF60E7A18F95EE1E2312BDB33A prayer-for-st.-symin
529,715,000 *3628AFE0836EF1CD97B4639C8212CFDA09DAD48B prerogativeperpetuum-mobileerscacomprerogative
529,715,001 *3623D3EF236F36818589DFA3EB0C452E7EA7AC94 PRESTONMICHNO
529,715,002 *362F1D7D3E01513B2D6F29A1666CD995F30DD9ED NATHANSTREET
529,715,003 *36201A8992AB3ED5D8A34463C5E57BD219254C24 n-de-cabo-verde
529,715,004 *3620B383258E145A3178C0DF338C67986CEDD938 proespectus
529,715,005 *362BFC17E5ECA876243387E2ED7F5037F2E19C96 PROPENDED.
529,715,006 *362B3F9E7EE024BBE298738C1F96FBBB58DF3AB0 PTBADEMOCRAT
529,715,007 *3623FE7D4073F7AC0D80F7E30D776A796935B822 neringdoenden2
529,715,008 *36299402C469DEB43B1F27C5B02A97DADD728784 [email protected]
529,715,009 *36281F04B7408E24706DE78C8B5B105D387DD304 q#####@~0-~o(0_<)
529,715,010 *3620CBED4952D26BB8C7353A9BF4BE884592BBDE nhk秋田第2放送(774khz)500kwの大出力局。
529,715,011 *3623EC8AF1512C5D60B5BFBE4D2BCB46F7C75394 NICKOLAS.PENIRD
529,715,012 *362A420249A5440A569FDA5814C79B7CAEE78BE4 q===d.~o~o.uu
529,715,013 *362A71781D5608F94E5DC6824301695350A63184 nickolasswogger
529,715,014 *36252D5F280905A94AA23777104F2AD6665AFCC2 QD`~ `~ SPLAT!
529,715,015 *362A57A70CC041CCCBB8C7A60EA5AD005F0B8C44 [email protected]
529,715,016 *36293DDA92B8B9BCD2ED33CB611023D88CBDBE25 qp~0~o.)x(
529,715,017 *3625BF0179D8038A06C3BD9DCF1F74B6BB19F2F3 raabliefno
529,715,018 *3629CF044CC2DA1516F4DE915C1931C08CE32A43 Nordic.Folksongs.and.Dances,.Op..17:.The.Last.Saturday.Night
529,715,019 *3620F6625C68577CACD1213AA7E616E84DF0D1EA raechel.stewart
529,715,020 *3624DC55E568D8FFD5F375E4A11FB2B29844176D RAFAELDOUBEK
529,715,021 *36278019C75CF3977A13BEC516B21C1DCF3C9E95 RAMBLEBILTMOREFOREST.COM
529,715,022 *3623A44D153DE139E01659C0A5926BF81A21C411 NOVOSIBIRSKIN
529,715,023 *3620AAAFC985F3F0DC2AAF993F718A0D02C0D1F6 OBOECONCERTOINBFLATMAJOROP7NO3:IALLEGRO
529,715,024 *362D402261063153A99895AA7D912542773B06CD OCTAVIA.BIVINS
529,715,025 *362C2D8D0868F028CC78D29423B17715F176F3F3 RDFURNESS1791
529,715,026 *362563112A2DE9399AD8D968451C6587A8FB8031 rebelsmichael.
529,715,027 *3627C02FE7E2729BAA4EC51CBE562CD299D81A7E recitai
529,715,028 *36245F05D3F64DCA96E3193F8FEC1D5C59824214 renego+4+e5
529,715,029 *3620108DC9A7097C3D32158BBDC27414691F0620 o~-o~-q=====p
529,715,030 *362E4AA42BD450F6F95D9B851445CEBF206E527B rentinck
529,715,031 *362E957E6146E0740D1246D8F075FC7DEBFE5357 othaschlabaugh
529,715,032 *362D23DB53AE1D04811E9C1597971C51F172623C OTHERS-WITH-CONSPIRACY
529,715,033 *36258722C73E8F8F1AA0E63DBA69D4A2E26630EB p======>-~-`(>_0)
529,715,034 *36246C00A447F16AC876DD2CB1063C9C25FF8B67 packardzorro
529,715,035 *362A4AF7D4464FAA09D19C701B4B84287D857D51 PALMERMAHAR
529,715,036 *3623D766C5F05D4EB5FD17E49A73C5CE2B5BC954 PANIDI0M0
529,715,037 *362FF0372A54840B9FE25A37627EA06419819B9E PARENCHYMVERLUST
529,715,038 *362112F4358662891E819315EAD48D096635BA15 ROFFELEN2
529,715,039 *3626427B1EF65A222351FA3226B2EE5C8A038F1E ROLANDFALKENHAGEN
529,715,040 *36205CC57C746D4CE917D048752B9B15D3798EE4 PASQUALE.RENNELS
529,715,041 *362E285B1FC9511A313AA332FBD9A23F6242294B [ron-keith-dialogue]
529,715,042 *362F09CDB53ABB2B5C2B32D0B668425C786F45AF ronnietenery
529,715,043 *3626123C157DD8666C410FADF2142354552564C3 PAULO BOTAS
529,715,044 *362D7CF03F82C879936B8F92B455BBD2410304CB rooseveltrubidoux
529,715,045 *36251BD30E43A0CAF914B3535FBFEEA351F90F30 ROTALIF4
529,715,046 *36237169585D2A0A57B57659B87BC13D5BACE308 ROUBAMOS
529,715,047 *36255B84C77DBE4B9F1BB76934B0E3334197F7E2 royfresch
529,715,048 *362ED9CF9C64C446D7F25A3A1EE9C4D698F8CCD8 [email protected]
529,715,049 *362AF175BCD914A248D203A74A701C1D5A65FC2C rsa#
529,715,050 *362098259A03B4B7CA6063089F6E0F9F071CB637 rucar
529,715,051 *3624DE4177D5B22A619ECEBE8C43930B7A8D3C0B PHILACANOE
529,715,052 *36236B940BD865C3ABE8951ABAC9EF25ED6C913B pihlaistenkylään
529,715,053 *3622A079423E08D99A18ED4E7FC18413E21D7D08 POMERANZ
529,715,054 *362F8DE5F12106B9903D837A9C6CB595473357AB [email protected]
529,715,055 *362C702009A5DF2EC2DE345E7B6E0B940F1EBC37 pound-pov
529,715,056 *362DB4E710AFE1F0D02968E6A1123AEF6859563B PRANAV RAVAL
529,715,057 *362DBCE0FA498B1999998EE4D94794E0F85D967D P.R.C.CANADA.INC..|.CANADA
529,715,058 *362839A12F31FD6D1131341EEB235E6CF3E55DC4 schweinsbuiz
529,715,059 *362916FEED7BDCC3492ACEFEAD724D56A258A8EA schweiuschädel
529,715,060 *362D20CCF6E6B903ADE5B3DC71301873AC8D8D73 PRIVATE JET
529,715,061 *3626E5A3B13B5427F727B3D557F696017585662E producersway
529,715,062 *36284EA142695CD3C2E3CB32C88DB42323FBA160 SCROTOR8
529,715,063 *362F56AA53CCF39AB8B1C3EC9BDD8F5087DCAF4A professionalofficercast
529,715,064 *362DE0922F37F3C81A6A6011564210DEFF506AA1 scuba(amontobinremix)
529,715,065 *3620A72D9084517F3E73CEE0C47BB35CC56D35B7 proppibsw
529,715,066 *3620E8B23BA269E6EF12C4C7B6E63740529C76FF PROSSTICAS
529,715,067 *362D41722A83FC481F720DF48B76648C9D0FC721 PROVIDURA
529,715,068 *3621727990C3DEDC36978D140602546708A37E31 PULA CUADRADA
529,715,069 *3622805513BD29451CF06407B02E0D857486F0C0 PUPPET13
529,715,070 *36234086FE9037E9240C1C0E6A0CCEA551CF0A77 [email protected]
529,715,071 *362D811122B167886C22055F58D5D289EED8BF2F SESUENNOBRAHC1
529,715,072 *362B8335C56EED7A5D4A69475B4A1FD2D042BBDE SESUMSIRT
529,715,073 *362D3A821B6309975E0D651676D4588F47DC8293 qd.*.*.)o(
529,715,074 *36251FC5E99EB1F80BAA607506F0C2326B76747A qua$i-$uc
529,715,075 *3625D7CA0ED65C2C64AE9726F1FD9C2A59B21976 Quarter.board
529,715,076 *3621008050633B3F5CBEFDCCA14FF687050E1BC4 shelbyhotchkiss
529,715,077 *3624B89B215DA0A9C556B55205A9AD7A7E9B2AA7 [email protected]
529,715,078 *362197B2808824EE387E2995420F01AC4153DE3D rainertshausen
529,715,079 *36245C80B1796EC8A8E75E6D1B634300EE4CFA35 SIGHTENING6
529,715,080 *362ADC295EB1FF7F5173BD482880454A9DEC0B2C RANDOLPH.CAPRICE
529,715,081 *362732E492DB52648525A764C1F955FD9B5D4719 rapatriee
529,715,082 *362CB092F0EE8D8830EFE338341CB65FAA1E91D3 rcriront5
529,715,083 *362B48C5176D226E3A2A3B62C9E059384492E103 rea-ontology
529,715,084 *3623CB15563A087AEE394FE75AE7F93688DAD4F1 @SOC
529,715,085 *3625DE6B3D939C2B8C4BC632064EDD0886EE27A6 reignsmatch
529,715,086 *362693453C7147D27D1014798D18D0BD285F240A SOMECADOS
529,715,087 *3622B4321C3679BA2345338862BD11267D544E38 sony-chandra
529,715,088 *3622F302E7869D4089D4650D8144F7ECB737AE95 SORRETA0
529,715,089 *3628FB9E290C47A66EAE76750EDC5431551CC68B SPAENDERS
529,715,090 *362CB3329515502D7FAB401A306BA0AB5B64000F sparctrackerbsw
529,715,091 *3620288D41B0FAFFE0D738C0CEB58413EDBE9970 SPICCAVANOED
529,715,092 *362AE9BF6343FA58ACC9ACFC84404ABE32E147D4 reyah-magcalas
529,715,093 *362D3406815AA7EB3D5CF5B3E3F196D7E3ABAA8D splato~0~d###8
529,715,094 *362F5C329383BEC3BF92E5CB97F0DCDDC53850AA SPORTDRONFIELD
529,715,095 *36218454C350569DEABD96DE36D52175584E5C9B RICKYLOKHMATOV
529,715,096 *3626D675AB7589B2A16C77EAC1042898F5D17CF0 sp仍然是視訊製作的普遍格式。和betacam一樣,錄影時間都是s型影帶30分鐘,l型90分鐘。在625
529,715,097 *362953CBC13AB9A0CB9CAC56EF7B25AC407B1E8B SRENMILED
529,715,098 *36233648A9BA8420992B958D186C68657A0C8D7D rimontiamo0
529,715,099 *3626C19E880009BDD143D84B4BBEC36FF4EEFEB7 RIVER-(GET-WET)
529,715,100 *3623A9429B82104FE4C3C7DA05A32A105BBE2EBF ROBERTOCAVA
529,715,101 *362DA1D4911EE1398554F814455C554339E4DB51 robtnosel
529,715,102 *362EC50C42EC8E413327D96A74418A5A26CD5144 roccosamoyoa
529,715,103 *362D16B4C949335791AB518DEF82241E00106634 Rockclimbers
529,715,104 *3620272B19AB06D45260DB1A4989CC680241FEEF STE4DY.PI
529,715,105 *3624DC1462121A114049800E91FD875F04F4C764 STENROHYGOLOIB
529,715,106 *36267574FEFF97A5C39EA623CDC1FD8D69A76479 rolandoegvirre
529,715,107 *362A600887842ED43DFC377619CA8F3748CC6714 ROMANSTEENO
529,715,108 *362C348DFA1D18C3417218672E12804A528AC618 RONALDNAZARIO
529,715,109 *362D3D9549F4CF1F1A68B2B0994BEF79F790978A stewable
529,715,110 *362300B09F41102F75C26A04EBEBEDAE230EE74F STIHL
529,715,111 *36211BF5D280F25EDC0104A0FBF2A38E63B7C33C ROSCOECAZENAVE
529,715,112 *362066B3C9406CC163B826B0532098552C6BCFF5 STOMAPO[email protected]
529,715,113 *3620B7D467664B218DF91F656DE78CC558FE90F5 st one
529,715,114 *3620DCACA523D889051449BC1F36750A98CDDF5D STRAVINSKY: CHAMBER MUSIC (THE AMERICAN CHAMBER PLAYERS)
529,715,115 *362B925829238C8B24E5F2B77FF88D81902FFA70 study no 30 for prepared piano
529,715,116 *3622CDEB9779A84F706222ADB566033FD7341E92 RTUESDAY6
529,715,117 *362105CAEA5F30022481B93B0B077A882E2CA7C0 SUAPUKEEKAUNEUS
529,715,118 *3629641C288EE4C03FD1ED64C613D595914F4C77 rue592rs
529,715,119 *3620C5B22A91315A2D2007BEE6EC6ADE0FB656D6 RUGGEMERING
529,715,120 *362EB8FF4F566FD80BE64D917D679959E38AF46D RUUD1701
529,715,121 *362BD40A622FEE3B48D48E5F398C24C4BA237F96 [email protected]
529,715,122 *362652BF4B1B7354389210FACC19BF8D353F8D22 RYANCENDEJAS
529,715,123 *3628D4186C3D5DB5121830DD9332372238F13DC2 RYAN_COOL
529,715,124 *36226293494A896280C1884D55CE115C1C30B354 sutadasuto
529,715,125 *362CDC1D41AFA28026A8EFA2C16BEF26A3DBA3B3 [email protected]
529,715,126 *3629D723778A9ABD33ABD103F1BF647FF6BD5FF4 sy3ut9utji2c
529,715,127 *362C8845707EC61A485272EB936DFDB6A89C00F1 SYVIMPIE1
529,715,128 *362C77D4328E875B6859FF30DA7313558092F628 SAMOVOLJNOM9
529,715,129 *36216BA7D434675F0B30F05C3DA12C749B1AA12A samualwonder
529,715,130 *36236CD5821D0A2C0C4B98C47D5A5637D2BD907F sandyhadley
529,715,131 *362D65A82D8FC62A0B0788DD99F32EC666AEA3D3 SANTAHOUSE0
529,715,132 *362BF03D0928E7E0C824EBA233E0068AA8E5716B SANTIAGOZOBELL
529,715,133 *362CDC25003A514EF5ED0B8A2FD7D7F17490C615 SARAPAKISTAN
529,715,134 *362C8ACADA7766A71A46F9341FA71960960A371B SAUL.DZURO
529,715,135 *36217E2DDB192CEE0A2786E73A2DD5B401796C64 Scarborough-Fair,-Norwegian-Wood
529,715,136 *362C5117F194D3571AB19136B6C77765F93885A9 tara.dargan
529,715,137 *362030AABF76483C13F61C677BF550D13B91ED8B tarquituses
529,715,138 *36256C1EA1A7EE6149EAEA56FBAE5392720068F8 schoonerellenmore
529,715,139 *36248EE951B7B32491DF21E39DD1D44069E516A4 SCOTT335
529,715,140 *36243B8975CE7E6F7E98B3424C9A1D11223107BE T/DA
529,715,141 *36206E9D056A4EDBBF8C52B7C450C2D95D49C763 TEDRICKNING
529,715,142 *36279242CE1CC3310B401152D5F8DCEA972B7786 SCUT4T1ON
529,715,143 *36225747E7C56F819B39DCED855BA0B0C144235B SCYPHOSED
529,715,144 *362B5E3F083292A8116422E42707A277D15E2032 TELEFONSAMMLERS
529,715,145 *362665AD3C8E1EE5E066AB708C2F45F9B3F80FE4 TERESA853
529,715,146 *362DEC514383543D374A24B3103E055EE69604B8 SEIMENE1
529,715,147 *36201E8262AF191627315327A8A77041FD14819A SEITNAP
529,715,148 *362AE33CBF1775AB0295045773A7F0A0F22DC9FE SEMOOF
529,715,149 *362EE3D5D02E82E8051C2B21AC7C453B220E8BB5 thanks to that woman
529,715,150 *362BC417BAD1230114F9FA6C5E5E61EB95004813 SEVENTY-FOURTH'S/E/V/@/NT/I/'F/OU/R/T/
529,715,151 *36286026C27C34A7FD867CA847207D8538E5AD4E severny8
529,715,152 *362648717E08D108C3E40165C886635E7453191C THE DEVIL YOU KNOW
529,715,153 *36246F8D4C0ECD82178826C2619ABF6FF45D83B5 SHAMEEN645
529,715,154 *362D7C652AAF4E232AA726EBC07DF0A60A8957D2 shawnbarries
529,715,155 *36234FFA8C42CE70C4EF17773C32C763C25B9CF6 the.halibuts
529,715,156 *362CFF8E0A864B547E2BC28F21F2F68744278252 SHBWLCM1
529,715,157 *3627AD3AE8E94DE35AA7F8F4951D7C2CA80974DF [email protected]
529,715,158 *362D445040B94E3392AC26B4A96C1E1230B6C44A SHELTONMALTAIS
529,715,159 *362AD29B8F47643FF62F2071389F5DBA9BB5FF4B theodoretomek
529,715,160 *36274E3C9176FC7C90A0856399598B6244B8FEC0 [email protected]
529,715,161 *3620D37E3FBC54E654CE1F736D0737702041BC72 THEREARETWOTYPESOFPEOPLEINTHISWORLD..."~THEPHANTOM
529,715,162 *36227B2A1EB3E3FC0D247BAF52D250DE3D2272A9 SHIGEYUKI-KAWASHIMA
529,715,163 *362AFD79513910295DC0AE97FD3E28C6E2BC8B42 [email protected]
529,715,164 *362FC4F26910702DF2564A41CC5B1C2ED2792819 thestangetzquartet
529,715,165 *3624BF0E8605FC6576A4DA4DCC3BF520F2EB2FBA THEWESTERNQWER
529,715,166 *3620A8EF15A80D07FD6FF1530E35E2A47DF93748 [email protected]
529,715,167 *3625FD563592654179E677328F4B7EEAEC73257C sidbo
529,715,168 *362AB4AC4A188C5DFC5B433BEFFB51D8F7F46B61 Sindacati
529,715,169 *36221482B3340B8958C1A1011DB88FE7FD72F769 SIRIJAIN
529,715,170 *3622BE3B74D791C28E93FE6F13543F8C14C28D7A TOBIAS.GRIEBEL
529,715,171 *362A0B74942E66ED32EEDAB8FA9A3ED0F22157E3 toda12
529,715,172 *3621DF81E94261585D45A54FB865680065E4D241 SMALLERCAPITALIZATION2
529,715,173 *362B53A2CE304ECB14F9B9A2EDF7001127BD8A99 ”tomahawk
529,715,174 *362F263792C6F455B3A4AD02C25FA10B496FD2B2 TOTALCHANGE5
529,715,175 *362342C536F799EE1939F098DAF9DE3B9707D43A [email protected]
529,715,176 *36257F38A67C35FA5F0D5D2ED36FA51F11B8A956 [email protected]
529,715,177 *362D719F9E8BF4794CEEE9735D9986C997578C39 TRANCADA2
529,715,178 *3625FCF5712FB815E93FD24D8D5ACE4E93960949 SOUDGE6
529,715,179 *3628E36F6E85F60D47782D2C00EFB938A6C9E30F TRENT.SWANN
529,715,180 *3627E85B0A6F5D6B1718CC1485705E8A0F5F3A46 SPARROWT
529,715,181 *3624B957816A6D1F1A2BEA2DAB7D2B785B52D851 SPLAT***<-----8
529,715,182 *362168527CE89136CE629AC1F79E54541A9C0101 trnsstrzed
529,715,183 *362F2D5DB1A2CF6384316D269C4460B2D4E31F38 SPOMIENKYNAPAR
529,715,184 *3620B7B37B3B3ECC6038AF2FBE11953B403D5DE5 'TWASEENZOMERNACHTFEEST
529,715,185 *36228F1A9ECDCE763A4B5F07329A98F1ADB2A8C6 STAHLBLECHGEHA6
529,715,186 *36296FCA581A48AADFC9092F2E731CA8DB7FF493 TYLER.HOUDESHELL
529,715,187 *3628828487CAE94ECCB77CED9DF39E31A415EE34 stanihursto
529,715,188 *362D7E3EDC4A39672680A90CDEDAED590E005780 STATESEFFECTS
529,715,189 *36291D22859510CB403BCC55BBB2474E4DB41931 TYRONELESSMANN
529,715,190 *36277949D488C63EDD18EE5A9072B16E7AE12364 UBIEGLEJ7
529,715,191 *36235E7A35C12B392F006258590242090BC705FA UBRZAMO4
529,715,192 *362406C8132E52E20937EF519E6EA987FCB7209A U)DW
529,715,193 *362A9A4EAC5DC94BA67953A3524BA03D8AB2B326 UITVENING
529,715,194 *3625A4F9CC01197314E9943E905BA76D2DE7E3CA StinkyStuff
529,715,195 *3622657498F68B5E68D05A2A0F3FF78A2412275B studyno6incmajor-moderatoesempremartellato
529,715,196 *3623A2A215B187554498749D5CAED0B53A58A543 SUBORNER
529,715,197 *362E0196F9AEC160AD2D9AEB7E95A6A87304BAA7 SUITE-NO.-1-EN-SOL-M:-GIGUE
529,715,198 *3624A537AAB1DDB7EE422107D3E630378F4C8D31 SuiteNo4,Op151No52:TearsandLaughterforaBoat
529,715,199 *3627ACFAB5AFA1408DE56B9FFF84405293612174 USMAN.ZIA
529,715,200 *362ADF1899D1C95F1B61A7A245DD843F29C17583 USTATIAH
529,715,201 *362EB3312D20D614C653169134B6187CC83AD109 SWEETSFREDERICS
529,715,202 *362855B878A066737529CCB4BE5C82EDF6F3BF97 SYLVIA.LOKE
529,715,203 *362AD7FD45446454FAB14257C625392AA54EA508 SYLVIEFLIGHT3
529,715,204 *362687FCAE5D79305A9F2F09E9D0A4926A4A58CD valerie.cuonzo
529,715,205 *362BF336384317454D188E8EFE4D0655C6663519 VAN.BABINEAU
529,715,206 *3624E6AE0E6A72B9BCB113803F1A0924CCA98730 vb[
529,715,207 *362DC365BA6A7935321C6E3799C753DD01E2ECB3 VERNICCA5
529,715,208 *362EE4D89A4A6A28A9A4DBD6EB47C5065CAF71E8 vernonketzler
529,715,209 *36267572D5191D834B78195BDA6F04EDEBB98204 veroudert.
529,715,210 *3620ACCB11887343A147EE2E5BD41B1E60492655 TAPAHTUMAHORISONTTI:SYKSYLL
529,715,211 *3620E81CF8A0B513DD813283C78CC33EE4E9F256 TARLETON'S RISERRECTIONE
529,715,212 *362F514CABCBE8D5F946652835DF7A34FD064BAF vickyserwaakankam
529,715,213 *362CE43ED04F07EF1B48062BA8F0E4EFD11B2C00 TD01W
529,715,214 *362B6C351DB8DB3D9B4867B4B56839877102E1DA virgin 21
529,715,215 *362E8B1A771188C6CCA9BDE6B3B764664E221EA0 volleyvisa
529,715,216 *362C0DF78134D27B38A27497BC77CA58155BCBBA VZYZAA
529,715,217 *3625BE9C2429B4691FBAA33EF3C0C505D85B1EF7 WAHYUWINARNI
529,715,218 *3624905298ACA1B09B49229AC1D2C6C34449E4C7 THEOMCGRORY
529,715,219 *362DB3EB1096D9B5125954D61D9F33727EF13FFA WALDOGALYON
529,715,220 *36274B8F1CC319552411D086135120552109EF0E waldomckibbin
529,715,221 *362365D0BCDC3C104B7F9149A677CBED60981347 THERALPHSHARONTRIO
529,715,222 *36285C9BCC27EFB3780B938EC130D5983ECFC415 wallersteiner’s
529,715,223 *362C1902F54DC88DA4D6418A8F09588B0049B887 WALTONZIEBOLD
529,715,224 *362234B2EA81C2978B21A5569524000E4CE16CC3 [email protected]
529,715,225 *362307A7CAF4B4D1DB0CF4362A2F93D19A663AD0 THNDRCFJ
529,715,226 *36224652FB899DDD407C1F89223B78309E29F932 TIFFINYBBS
529,715,227 *36269C1EAC124CEFC42CF25E0115397EBA83ED01 WCOUSER
529,715,228 *3626FEAE661BB81EC0A16E691EB14D084B23B49D [email protected]
529,715,229 *362D8ACAF9E550CD6AE81A5F8FDDCF98DE4ADCB2 WEBUTATIONORGWWW
529,715,230 *3624A460E5FC6BB4B196C75CB86DBD23E82D4647 [email protected]
529,715,231 *36240AFD3F001DB229920C80ADCA66800136A14D weeler12
529,715,232 *3620893F4505285587C4052ABC3CE59F78237C7E timwiggin
529,715,233 *36226596C10DB4348DB616D6ACBFA7AD0C2CD3D3 [email protected]
529,715,234 *362A9C5F25487BEC1A6A27E3606DB3BA2FBE8691 [email protected]
529,715,235 *3626DEF96EA70E8F602F22E10CA7B972398677B1 [email protected]
529,715,236 *362F8042569CF2307A57DFFC42F93AE97D839701 wespaszkiewicz
529,715,237 *36200B38C013E5EE1672EA58025DB0895A6682D2 TOBIETHA0
529,715,238 *362972A8B217A1FB349B33A003DCC968957D45A6 WEZENWEZEN
529,715,239 *362ACFE45CBFC8484FA0E96036CD39D1BEC2F386 whenlovefindsyou
529,715,240 *362A79BDB17EB07432275217E0B59B3CC072C02B WILLIE.RENDEL
529,715,241 *3627D95341B4840C8E74BB3ADF3639603C989A6B TRAINING15
529,715,242 *362113B84F149FE86FF7E43C479EAA25A42B6E70 TRANSICIONES-PUNITIVAS
529,715,243 *36219C3F640DC6AD25E7FD6B9B2DD5CDFCC0D970 TRAYANNA WHITAKER
529,715,244 *36256730BC00433C8F7D5A091897E3D30BC80744 WJI12345
529,715,245 *362B03AF951F9AA434072AAE8A53AB34B5EAB4A1 WKLIST20090724
529,715,246 *3623C15A80764A710CAFB48424384072FC175344 [email protected]
529,715,247 *362F386C2880EFEA568A8E2CE9A37FE3D53EA563 WMG1987330
529,715,248 *362BA076F12E525FCDD953C527F14C6CAFCCA835 TREVERKAISER
529,715,249 *362350836F74A05AC463416FB0757BF040171867 TREVOR.NEDINA
529,715,250 *36241A86BB8DA16CCAB4174B374560425900E64B Triosonate.Nr..6.G-dur,.BWV.530:.II..Lento
529,715,251 *362B354EC9574F2E5E1AC8037FFED8251771DF1F WRATHOFBUSH
529,715,252 *362102CA9894DDF3956767A693402837400B89D3 [email protected]
529,715,253 *362CB46A73DAC0EF5FCBA4B480455B15E153D452 TRUMPETMAXIME0
529,715,254 *3628910E7E5E070559749E3FBAE945C31925F1F4 WWW.CINCINNATITEMPLE.COM
529,715,255 *362124B3786D73AAD1E8553AF76F828B00A83242 X[=
529,715,256 *3625FBCBBD498724A483B7AB3916C0F9136F443B T;WJ
529,715,257 *362BDFECE13723CF55DD857E2BCEA53928E69709 TYRIANESMITH
529,715,258 *362B5CA91C503F93B0776987B720EBC7425C426F tyronefoulcard
529,715,259 *3623DE414A55C8D1FC175E5C1BA359F13112939D )X(.O~0~D=Q
529,715,260 *3628A6109C5FB25666153EE5497DBC6432C20D28 [email protected]
529,715,261 *3623831FB80904706C9B2124D67549BC64CA3DE5 UDFRINGER6
529,715,262 *362B70492276F675FA3AF249E711E74D88525662 uexwsllg
529,715,263 *362440BDD24A6C1398E936E54CE5CC3E4BDCB5BA yingerlyn-buendia
529,715,264 *36231A249C95E7D5D6FFBE8E394D854207CCA0A3 YKSIKKOEOEN9
529,715,265 *3629A79B37DC0C6D896F51AA944ECB752FF0354C YKSNAMLEK
529,715,266 *3623EA00CA43BD55E521DD7F1A5A4372AD4A7944 UNPERPETUABLE2
529,715,267 *3629C036A484DEC85E4CDDB7E39B40A3BA9A8823 u%qg
529,715,268 *3629ECE1ADE8BC9F40C43F07EAF8F1326AABBCDE [email protected]
529,715,269 *362D1D251BA5DDA5FA80F15C588A9D4F6A1772A5 YÜKSELIYOR
529,715,270 *3625106D5D87D9995F4D2EAC45C04E2281366349 zamagugu.numzamo.gumede
529,715,271 *3629CF6761AC3588E6482A077E2EF3895ECFB26F VANESSA HARLEN
529,715,272 *3629678555F7D4617531965B7BECF731D82CF1E8 ZASENČEN
529,715,273 *3627379E6434014C15408DE933C41A4E52D60CC3 variato6,canoneallasecondaa1clav
529,715,274 *362EAFBA5E9905C182F52B9F9228251E03CF6059 ZEOLITES
529,715,275 *362B33FB3BFC5F78E0C600F9FB133419F7F348F7 ziad.sobeh
529,715,276 *362752EE712AC4CA240736E28D21F186F77CC064 VERVOEGINGEN
529,715,277 *362BEE943C846CBC09972F26D90062CF96006C02 zorrojared
529,715,278 *362BFEC8890C95D798CD74C92FA0E69E80005912 virusphoto
529,715,279 *362E579E253E8B88797189CDAD62FD6821B6E100 VONAWAEL
529,715,280 *3626E0A785CAF35F5A4214E8DC86A3275AFF2D01 ЈОКАЈИЈЕВОГ
529,715,281 *362204FD191392AAAF1F136EAE31AD6DD605AD6E VUORTAMAED
529,715,282 *362E2D9B586AC5557B947B2BA6491F845A032E43 ОГЊЕНИ
529,715,283 *362740DFD6B394E497C3B7185170E4B3FBD8945D vyvy.lam
529,715,284 *36213BBA5F1D3087E7DC0352839ACACA2268E769 ПЕЛАСГИЧЕСКИХ
529,715,285 *3620A0DC02836A771855B38784BCFDAE1F8170E6 wademacadam
529,715,286 *362AF2BBF4984D40F099A6FD4A1E4EFAE5AB29BC темпельхофское
529,715,287 *36238643E75364ECDF23B76B6E04A13EAE24C4A3 WATERBABESDROWNING
529,715,288 *362DC18EA61C6A9B8D5929B60884A6F36F9E5786 WB"I
529,715,289 *362759EDA41CAF54555BED2145C6E66F41032654 [email protected]
529,715,290 *3627569C13DE6818CC79E437DD7E3C06DA5164C1 [email protected]
529,715,291 *362019E7D8F7A5C58EEBB964816C2B2280143591 WEHME
529,715,292 *362A6B856E0F61828BE59E80C3A9439E59E5FAF7 [email protected]
529,715,293 *362DC0214078065D32B683F3663980133A4BF1AD WES-WHITESIDE
529,715,294 *362067E15FF2179529759D3E7C4B0933A2017273 WGARNETT.BRADBERRY
529,715,295 *3626B22F7882C9F537FDC6BEDC7577950D26FD02 WHEN-NEGROES-WALKED-THE-EARTH
529,715,296 *362E8331C18A7B108F1F6F8317A6ABE6F5AD297A wilfredhendy
529,715,297 *3627958109544B56A699B9D7E1210C307AF6C306 WILLIAM.JEANTET
529,715,298 *362D8CFA4621A0E4A087BCD2AC7D447DB9C2456D から西見付まで、東西13町1間(1447M)、道幅2間半(4
529,715,299 *3620D74CF2E3C956B6E2E7AE514D7ECCC4B87C28 WILLMISHULOUIN
529,715,300 *362ADB2A75636560FCFF6B3C1552085821A3EC5E willyfriddle
529,715,301 *36254888FD379E88ED4EEF51719EBF50CD7E1613 wiltonmarchak
529,715,302 *36221F84CEA0D53763E456BDBFA0C2333382B4B3 WINSTON.KINT
529,715,303 *3629B07C736F3949B667A50052BB7BC032FF6004 witheveryheartbeat(acoustic)
529,715,304 *3620030BEE0313CAE66AB8DFCA7C0E8462F637D6 WSBPANNA
529,715,305 *362216968B02E35CBE2E788B6DC61FB580595A62 WWWHOMESTEADCOLLECTIVEORG
529,715,306 *362CA3AD1A7C9657C05B7BD1E7A80FA545D88881 xaviervanderghinst
529,715,307 *362E433B44A785B066C5ED5AFCB2EDA75F34680C (x) ~ ~ ~<B
529,715,308 *362196CDCB7096DC882D55FDB2164734EED2ED0A xen080109e5
529,715,309 *362B6501619AB1A63C320DFFD5C83587089D4AEE {X}.O~.0~.<Q
529,715,310 *362E27FF6035A8748848A5D27EAAB20B05A72EFC )x(~`~`@q
529,715,311 *362D056CD1078BA87CA29CA93136A7466E5A9AA5 [email protected]
529,715,312 *362F3986A800DB9C93A644F8B394C658D0990B38 XV REUNION INTERPARLAMENTARIA MEXICOCANAD
529,715,313 *3627B6BA5A920259032B9AF5493D4BE7720B8DB3 XVRRFXKMFEZ1
529,715,314 *362C3DAE0E7B45FAE9F3249D61F8C545FF841A8E YDONELPS7
529,715,315 *36268AB40CE000801F7881B7FAD7B53090129B69 yeo.issouf
529,715,316 *362DE253635A80C1C88763CEED4B6C038EFB1CF1 [email protected]
529,715,317 *3621514B0E06AFC93F2595007141055433002991 [email protected]
529,715,318 *3621BFEBEA58C2F15DE3D538B6C46C8E5741A609 YHET.GABORNE
529,715,319 *3627DAE5A5A6727EADE182B02D0E075F306D291B [email protected]
529,715,320 *36271DE7A712FCC5ED991164B89B2FF1A84B786B yngve-ahlenback
529,715,321 *362B7133900C535644392A20FD8DD7612250B4C4 [email protected]
529,715,322 *362CB30007F1EB0015028ABB86D60DEEDE73391D YOSHI HOLMSTEAD
529,715,323 *362201EA8A6189B3088D34E09A6B08E6C6799DCC YOSSY.CANDIKA
529,715,324 *36235BA4018CFDBD5E084D6837A011CCEFC64269 YOURANGERISAGIFT
529,715,325 *362A1B78301C2C486FD70518A118D250C13F5B0C 069FATIMA
529,715,326 *3620BF5ED4095C56C64FD0B8A19A00B1C9156CB8 [email protected]
529,715,327 *362AEF278C709D10A2FBB909ACEFCC23E1DB0D9F 0THATPHOTO3
529,715,328 *3625ACF576FA574D06C64917EAF6BA48FC387B59 ZANE-KOSOVICH
529,715,329 *36276D17C048B457ABAFE12806D18A5B1CC3198A zar.brunner
529,715,330 *362A8A981F33BDFFCA9A8867B717357D79B4D155 [email protected]
529,715,331 *362C9B6073EE99DE8C94E88D434872C538AD3210 1165020 yosemite.has.been.offlimits.to.tourists.since.friday..
529,715,332 *362C77C15178383F01617794321C228EC1BAA9EF [email protected]
529,715,333 *36269511663A7AE82B0BE9DAAA7C11176F3D4598 ZEINA.JREISH
529,715,334 *362920C3F570F20EFE13127873B12BA34FA998D7 1239415 berliinionedelleenhyvinvihre
529,715,335 *3627791EFC7F54FDDC42B34D02437707026731B5 ZFRCMKTC
529,715,336 *3627D4A5513E9573F2DF65917AC7F8C69DC94697 [email protected]
529,715,337 *362F5E147A8177FCEE555C7961C9CF3FEEC204C5 [email protected]
529,715,338 *36297DE81CF68319CF90638990F0EE5849D243B6 13UJSQ
529,715,339 *362C9E8A15A58F6CDA0C53BFBB3FFD8FA4609997 ZOE-LA-BANDA
529,715,340 *362D406CC571111EEA3D3F882973FB42BFC128AB 1668950 HE VOWED TO KEEP TALKING TO POTENTIAL BUYERS
529,715,341 *3620B0322EA203A613DBB1FB8B40BE87D14E613F ZOTHEUSHARRIS
529,715,342 *362BC4EDE208A66D14F06AC5AC690E5534AD9500 176256 h
529,715,343 *362FA0DBE2E00D74B86AF3BB0A21E566DBB851D7 ZSKDSHLMM87
529,715,344 *362696FEAE3E2948C8EDCD8A87A9C4BD55939B94 [email protected]
529,715,345 *362646A74C37E3DAF78A85DFAD988C58A36FFDE7 zupezzetamonobookcss
529,715,346 *3629697D442800435BA7C46853CBE73E5981458C 194ELIJAH
529,715,347 *362F98A264CAC8F0938F9F71C982C105050E91E0 1986-06-15:.EAST.RUTHERFORD,.NJ,.USA
529,715,348 *362CD9F9915956B8FB9EB6337FEBD4F713967982 1989134 NO-ONE-WAS-INJURED-,-SHE-SAID-.
529,715,349 *3623664F78739B05F281266EFA9F587D30C89CC0 ΑΡΙΘΜΗΤΉΡΙΟΝ
529,715,350 *36223938C7E2E336A6EC12A3EEE797A2007DA8D6 1AVAUSPOTKUN
529,715,351 *362BBB62376661608B9EC2EEC3658392E6871910 БУРЖУАЗИАТА
529,715,352 *36226DCB1B28E243E16421E36F9C53695A1D083F врањеши
529,715,353 *362606F5E3F372B6B7D14A4A759FE38A5918E83A ДРОЗДОВИЦЬКА
529,715,354 *3628CFF1CF463D81822964353142CA204D3B0328 ЗАКРЕВСЬКОЮ
529,715,355 *362EE2EF9806E8A7DF35FFB031F2AEB80F4CC581 ИСПОЛНИТЕЛЬСКОМУ
529,715,356 *362C0FAF971D4C51E704C021745201CD96F90514 КЛОПИЦЫ
529,715,357 *3628497C9695E50CC6F32EFC665F1BDB8EC0EFE7 МОРОЛД
529,715,358 *3623351FBBE491C51E1177E1154DAE6F54A9FD2D НЕКӮКОРӢ
529,715,359 *3625DFC6FDF4133B986755E65CF85C782A5A6381 НЕРОБКУЮ
529,715,360 *362C7920550D8C3F35071B734985CD3F38A44E30 1HSYCHSTC
529,715,361 *362C4F3C1A6C165D15F83940DD06D0AFE55C2549 1-KALIFONIENS
529,715,362 *362103389ECD08A0AFC90D31CB0AA8BB1F6AEE8B 1.kalsitonindir
529,715,363 *3622EC403DBD59AFA78A6552E795D759BAE1108F 1kampagnen-start
529,715,364 *36272B2B2F0CE8F7D5249013868874AA02B01E0D СТОГЕ
529,715,365 *36299637D53C9A389C6FA5AD13645C4DC880B787 1 LUHTIRANNAN
529,715,366 *362640422F37373CD152BBEB3925C99EF76D59C6 ЭР22
529,715,367 *362A3E0A8F835107B23007CBA29A5856CF64B789 1OEKODORF
529,715,368 *3625EC54824EF72A7F18384499A1C7C2F602318B 1-pajuojasta
529,715,369 *3623BEE9C8163E8814B15675584C3BEA48D60D0C 1skiing7
529,715,370 *3623A255CBCBF42C6A9B9DD4CE74FDAC4B8C33C3 1WLGBLRN
529,715,371 *362CB7CB3A01CC3FB632187E42F71F265B1B37F7 2001年、npo法人「静岡市にjリーグチームを作る会」によって設立したクラブだったが、2010年1月に静岡県社会人リーグ1部の
529,715,372 *3620E82DFC67FEBE1C0721247901EB9E460E4D27 222layne
529,715,373 *362678DC73AE0396E88F4073EA888FD31AA89FEB 22LACKAWANNA
529,715,374 *362C69BEF86F98C9625BFF134EB0114D39ECD37C 2465605 SOME-,-LIKE-PIGS-,-WOULDN'T-WORK-.
529,715,375 *362EB73391CAACBC501DDBB2E96E93F7822B2F94 256486 DURCH.DIE.ERWEITERUNG.SIND.NOCH.PLAETZE.FREI..
529,715,376 *362FD16D3A9EE2F88CD0355C6E6CFC4D32B71CEE 257PLI
529,715,377 *3621084DB0587A0B55946CA16688CBBED6BD9D36 25BL
529,715,378 *3624CB9C48BAAEAE39F324BAAF820F51BB4D3B4E 2614679 ajatusj
529,715,379 *3626578D809DA3F129E2BF6C831CF2899A6AFC78 2624236 posti.ja.puhelin.p
529,715,380 *362BFF6A9DD4D464845365A2AB4FA222E643DCC8 263mathias
529,715,381 *362EAFA8BED0E7284ADE7341EDB0435B87FCBCBA 2APRIL1972
529,715,382 *36266490AB3363C51CCB85988ECA068EE74BC52F 2ilovewebmaster1
529,715,383 *3626323880B66CBAF70D929AA4F260453B968A27 2NMTBRST
529,715,384 *3620CA570068885DEB8DFA20C02FB6EBEA987C5C 2NORIESS
529,715,385 *362C89087FDB61A6432548E7AC9FBF85836CF913 2RECONSTRUCCION
529,715,386 *36251C0D4A2C9C012FD070C489FFFA4AD8238B63 2-RENDITESCHWACHEN
529,715,387 *362283EEE1EB5C861A50A8130B20E0920945E873 2sdpostulat
529,715,388 *362CB88806C41C27242EA0F500A8821C6AE0B0A2 31-recommended-classes
529,715,389 *3628AB40C6D214C25372EC1A923ECC26216BA429 340624 nichtdiefaltendermenschenreizenihn.
529,715,390 *3620CEB56E761624FAC27CCF06F9B36D2C0C84C0 38.SCHWEISSING
529,715,391 *36278EE7FE0F3D773A5F3B191C0BB90A71E629DF 3antiavoidance
529,715,392 *3629E8341E0B087B965F4ADBDF142A48F5E6DAD0 3bboctzg
529,715,393 *362670B0AE8254E97AF6C884AE777996F3BE87EF [email protected]~o.~o.)o(
529,715,394 *3629D504482A20481D9FC8D70F2F19175AE3B88B 040EDITH
529,715,395 *36204C3C13B67A5E65547D401C39C58156EC2BDA 07041435
529,715,396 *362C5CCE4C003AD03330A955BA1BA60944F97975 4 BAUSCHUTT-DEPONIE
529,715,397 *362E444DD50CB5FE76566DD75743FFA7D71C7D89 4BRUSHMAK
529,715,398 *362746CE58715A74037B07C38B1D24CC89FA1E83 4-ERISTETYILLE
529,715,399 *3623DA660562F7FDCA56C85E8582A1239E0DA145 4IGRE77E$
529,715,400 *362D19FC782F8180339C404C9B16F3F7D30D2372 1-08-1532
529,715,401 *3629E7AC76885915A8D7C258194195C3F50C485C 1112051 tulevaisuudensuojeluj
529,715,402 *362419A4467611443282DA2CCB6048F301D81152 4P093!C
529,715,403 *36226753629ADEE1EB754E2C5CC2B87726DFF294 4POTOMKIM
529,715,404 *362C31387AF0296AB4AFC7074737D939A7E915C1 1161192 lehdot-ovat-useimmiten-pienialaisia-.
529,715,405 *36245EB1CB8C536F917E5923322E5233507BD092 1189049 children of bodom teki pahaa j
529,715,406 *362CD3D7EFC19315DA0D0E4E62B27BF83658F2F6 4.RUNDMC'S
529,715,407 *3624340F0A0A8B7C39810F52EC9681779C9CF6BE 1229405 TUTUSTUPALVELUUMMEJAHUOMAAINARIA-J
529,715,408 *362ECF944F01A7ACF9F5E36901AC667FD684DB75 4SHEEPHOUSES
529,715,409 *3623D5896A80B6FB99DDE4AF01C4F63756A76A98 4SHRAPE
529,715,410 *3623AA3C117A12C9E3DA3A92C2AAAA53F3060770 4SYSTARTUPBSW
529,715,411 *362A9CA2A56F22963CA1C3BCF1FD2BD2C1F43C9B 4TAUSENDFACHENS
529,715,412 *362FB3B9C96450C2617E44A716ECC3D59978DBBF 4WYCHARCZEC
529,715,413 *362CE20ED12B9DEC1E66AA28508B3B186A13030C 1542771 SEMERKITSEEETT
529,715,414 *3622B3FED777FF91AE1D588AB7D045458FFDCC1C 1574259 devon-rexit-onnistuvat-aina-l
529,715,415 *36282294093F355BA8EAF973C8553A18E55D9A0A 546.KOCHEN
529,715,416 *3624A07A87BCEE375363ECD2D6A359CE1EAA7FFC 1715OOY
529,715,417 *362CF1E5A62F5277CA9A46E1A491E3E1CDF76711 17JUN1282
529,715,418 *362B99DCF49D8DCA52676059A4747FC3E89BB530 5BSWUSTACKBSW
529,715,419 *362DC8D35216AE2425F5D60E31587FCB49112C86 1989688 vasemmanpuoleisiin.laatikoihin.ei.ole.m
529,715,420 *362C0D2F609DD862C6AF10D843FFF83A9A72DB1B 1ALBAANIT
529,715,421 *36252D0E93968EE12882BE11C6EB871AF36B1195 1 APPELLATIONS-GERICHTS
529,715,422 *36238AADB71FC7D2ECB2143C445E99288BF0CEB3 1.CDROMMIKROLLA
529,715,423 *3624BDFFE6DDB479536279B926C841C757E47A5D 1 DESIGNRAVINTOLA
529,715,424 *3628884E91C9671418BEE17B7EEF18ACC8CF1846 1-DIYARBAKIR'DI
529,715,425 *3627BFD77E54F7DED40BF3552FA46E489054E5D5 5NSSMONIQUE
529,715,426 *36294510EB3FC8597FE9088CCAC0D99A1163D027 1-HAWESKO
529,715,427 *3628A7FD15B685606EEA6917D86BF515589EFE80 1.HONSAKER
529,715,428 *36236BCB73C533947D95B494F40E465682ED57AD 1-ironisch-klassisch
529,715,429 *362318CAEFF2694B53623E91CC0BA17147D2D23C 1KORONALENNUKSIN
529,715,430 *362BC99053097F13DB42E59DA32AF500A4808FC3 1KULTUSREFERATS
529,715,431 *3622E4C541C3685FFF75A91D6655A7C1BD638694 1NON-POLEMICAL
529,715,432 *362544A94D9A8C12F58E2B2ECE9E4858DA75D9A0 68BCC803-D65A-322F-AD98-020903C95247
529,715,433 *36202AD286D969E0BAD84CE132FEBFB6F522D628 1 PENNANT-STRETCH
529,715,434 *362745DAB85A87472A2BE682D69E90542FBB7AE0 1-pienkaupan
529,715,435 *362B5CCB63995A59144FDF065FC43A63281B0E34 1PIIRILEVYTELINETT
529,715,436 *3621CF319F60A5657D5D79E154370A2AAFEF275B 1 RADIKALDRAMATIK
529,715,437 *362E3E975E82D271294C376CD08B987BA5D8F97C 1.SWING-SWIFT
529,715,438 *3623B7A60D31733126ECF28196F470A700F679D4 1TERAPEUTTIREKISTERI
529,715,439 *3623BDE959F3A1A5414256DB453AEFFC7DFB231C 1.tsemppiloma-toiminta
529,715,440 *362656961FF384F5E0A0904755519371F157DC4B 6JULISTANUT
529,715,441 *3627B888C2C5DCCF32942F85D8CE53C72B374A5B 1uskontotunnilla
529,715,442 *362106A2235FF6767D937B1F1F1885DDC63A8B7E 1WICHERT
529,715,443 *36285338DC8BB4D23775A1A55707A2C80D878D5D 6semitendinous
529,715,444 *362BBD5393736FA860F845915EC37A019AF7EB80 6SNKIHIIHTOA
529,715,445 *3629AAECA855BA1A396D8ACD07DA73CD91447A83 20.panttivanki
529,715,446 *3622287341E7015143E851308E248542A422B2C1 20 PROJEKTIORGANISAATIO
529,715,447 *3621F2C4AED08E8AC6A21926548356DEFE09D089 20SKIPWORTH
529,715,448 *36281144118285BA9EDBB5C02EA6FBC4EF501D9A 6WEBSTERRUX
529,715,449 *362892017F8F65463F6C88957C50FEA4916DF06C 71JEREMIAH
529,715,450 *362DA1DE4C1DA113E97564B8FBF305E0FB02F4BE 23-VAUCLAIR
529,715,451 *362FE1C10671C5C008DB01CC128861ED088A1C08 2412947 beruehmt ist die coul
529,715,452 *362266F98B7F4FF13419E1936E08B39DEEC59613 248077 BUT.NO.,.THE.BELLOVIAN.ARIA.SOARED.ON..
529,715,453 *36260EAA40CA626E3DB5B8CC78E8DB9700BE73F1 7AISTUSTA
529,715,454 *362071EE4DA698F957CD0984B47050EE3291798B 259175 samoins
529,715,455 *3622348DBA0438652CD1A110B6C0BB09059C320E 2790659 lasermittauksella.m
529,715,456 *3629A85CB4B5D824D4F0D48D9C3F9E7897502BC6 7CHMYLOWSKYJ
529,715,457 *3624D61920227D85A417F969EAE2D2CD5DCAEBC7 2793057 vesalankentt
529,715,458 *362ACB4706CCB5FC74558DF0347CC460765AA533 284frank
529,715,459 *3625A983750F5173728181E5E6E991029BBEE29D 290linda
529,715,460 *36242AB8CE00ADDA53D5A0F928FE3A77EA4E717E 2.desinfioimisaineena
529,715,461 *3620BC55406FA5409CAD8ACFA6F4A5E254783E92 7NPUTBSW
529,715,462 *36239AE6EFD974445A7167805B6821FAEC276C11 7REPRESENTATIVEGOVERNMENT
529,715,463 *362D1AE12E6E908CEEDC90FA9CD84E5B8A17556B 2.mundhygiene-beratungen
529,715,464 *36225708060FA5CF919E07EE5E90C7E9DF601005 7smachterig
529,715,465 *362C44335CC4397D776725FEC78BC580C134BD6A 2PALAEORNITHINAE
529,715,466 *36265C54EB750B5232AA408C76F9FACCD5B12CA8 83504 asla ` yapamam ' demeyin ` yapabilirim ' deyin
529,715,467 *362BAD6FEB990165273C83C2C00E7121F5BF6840 3#####).~0~o.}O{
529,715,468 *362C6AB3F353F2A1FF7EEF15E9EC868F3AF8BFE9 87439 pirjo.kuhlman.muistuttaa.,.ett
529,715,469 *36218413D32761660EF6F2536C1889F50344CFAD 340177 CANKAYA-COUGARS-5-NISAN-CUMARTESI-CANKAYA-COUGARS-V-.-S-.
529,715,470 *362634276A2C3C93FAA467C9889FB647A4DD19F1 8ARELLECNOMA
529,715,471 *36242B5D40BEE192E0445DAD82056149DA34360F 8######B`~ ><
529,715,472 *3620DF95767BBAAD84DCDE194FBACF99441CA232 8BSWUILITIES
529,715,473 *3623C960A9999398FE90A99CC468C2DA5CD8DA29 3-bouygues-konzerns
529,715,474 *362B580D4C4105437FBCE2D5AF45538A0020D3CF 3BOUYGUESKONZERNS
529,715,475 *362F76CE2235516DB36E0DAF3698004233FD3669 8ERTRAGSGUETER
529,715,476 *362F2AE5B119911F2E2BCB837AA68E48B5477096 8FERNSEHLAENDE
529,715,477 *3622238560CEB4C7EEE597D34A90BF240299680F +3LLUR!C
529,715,478 *36256DF2D027751B82292E972EEDC39155E97E18 8]interfacemember
529,715,479 *362ADF4AF76DD85632965EDC88B8199A0CA491E1 3======p-~O~o(~_^)
529,715,480 *3620A8FCD97A79E3DB54963CB8871CEABD1146E6 8MATHPLOT
529,715,481 *362DD18CA53A101D72379E09392F03888382257B )8(o~.0~d------p
529,715,482 *36223ABDDB3F085E7EB763B7BEFEFE37DACF615B 3TH10P1AN
529,715,483 *3629388FB48921B2189F1B6B301E966713E263EE 4021216
529,715,484 *362B2600C8ACDDA31410A457E40CBE201B21A8F5 42ROUTLEDGE
529,715,485 *362C3161562485504D0803F629558A9BA5FE2871 430VAN
529,715,486 *362B9FA714540E2E0830FD4EAA77B6A9C2A0A34A 8riclitant
529,715,487 *36281EE3ABAE2CB211D73400016B21F61EF74950 4BINARY
529,715,488 *3629FE4B937038E812311BEFDFFEE181AAF68344 8valicavate
529,715,489 *3620461305575F7B4810AC4EE5C8A2579B65FD97 963016 ANOTHER NEIGHBOR , YVONNE HILL , WAS NOT SO IMPRESSED .
529,715,490 *362B9ACB48C498E8E6C1D0A39C5503D2A697E6C9 4METALLICCHIEFS
529,715,491 *36254F5406D8592B1F1D96937E345412753ECA8F 4METTABYLLE
529,715,492 *362AB3602F13614ABE0C39378B8C041CA534BCEB 4SELETIA
529,715,493 *3629F39F326DBCD816E6C0BF2E18A148D755515F 9INUADERET
529,715,494 *362B371A7478FDD25B339949AE9D12E8E473C23F 4TOUCINH3I
529,715,495 *362B7994AB70B92F5AC012BF4E4C12A703D2A152 4ZYGFTFPJDYB
529,715,496 *3627A29EDA122F69B6FD8F5C931D196E0257A304 516363 "-the-cheapest-chemicals-are-$10-per-acre-per-year-.
529,715,497 *362666B1FCC5A6AA798F7B20D2FF2F26F1EF56DE .53-33 ta .oped 89/81/3 namrenif >a/< .28>"_28_n"=eman a<>p<
529,715,498 *362A98CCDC3074A13213E8C8BD0BE75095DEEB7F 566029 WELCHE-SPARMOEGLICHKEITEN-GIBT-ES-?
529,715,499 *3622BC3BF8B78C58F5671056269C59A7CD380599 5ARVSLOTTEN
529,715,500 *362B3CF087FC78A2C4A81A5D8D070994387EC26C 5BACKSHACKLESLACK
529,715,501 *3629DF2D398CA880CAFF20CC771FE75A4992CE63 5BITTITTLETORMENTORMENTTORTURETOUCHTOUCH
529,715,502 *362A10D4FBBB7C7A65AB33B1F931D2586727D4EA 5BSWDEBAUCHARYBSW
529,715,503 *362D64948E78D9C61CC6335CF5A4A3C023FD01D4 a$?=$
529,715,504 *36252EBDB49A2D17B0202EC7F72AECF8449F5DC4 5ENILLETS
529,715,505 *3622770321000F836FE3A2DF204F941242758911 5IRREVISIBLE
529,715,506 *362E2CFA51D08C181644F3D174D2F2570AC1F730 a)3?n
529,715,507 *362353696155D66DEB74C43865120F27280DEA21 A.3ST
529,715,508 *362F202441FFF6B1BA364713C5D3B389E6989EE3 5PASAPORTABAN
529,715,509 *3629A5226FE3439123E8D647E7513C2B87299D6B A6WOK
529,715,510 *362993002DA198EF6902F174299A7F6185EC2AAB 5TRIDIGITAL
529,715,511 *362A8754EFDCA51824AA92460A626A1103DD194E aaa)_2
529,715,512 *3620D5B24B0FAA712C4E20390CE6B6603581AB29 AAB1(:
529,715,513 *362E7A6BFC4F82315393F562084BEE7FADD61AF5 6BEVILLIGIONS
529,715,514 *362EBAE6E3E319123CD65BEA8BFE4805D76AF5C6 aached
529,715,515 *362C92BF540618BEE220EF87D1FB5C9181D104CA 6BSWLOOKUPUNIT
529,715,516 *3625296F32CB21BD308D4711C57C09477DEF6B35 6BSWSHATTERZONEBSW
529,715,517 *3626F0B67DAB7067F0EFA59637A9C6E85A680D04 AAE=D&
529,715,518 *362064D3AB16C76EB28F8A295D0238A8A4537F14 AAE{O
529,715,519 *362C80BA21F71849272687233EA0569D3F13036D aafpoy
529,715,520 *36286277E1B5B160D5FB040A6DDE72D926B34C17 6JEREMYGALAXY
529,715,521 *3627C9AF78D4CAB87DC5B267E1612689BF04757D 6.lm
529,715,522 *362D8353EAD33FC1F16CD58811AC8116E0584958 ABCDEFGDEPECHE
529,715,523 *36245F977E8E5815C7062B725FF15338ACF889F8 ABETENER
529,715,524 *362437881378901D7744AECD477FD8391021F1D2 ACAPELINHOS
529,715,525 *362F0B24E5EF1A37862A3FB73EAA32364CC619B3 6SCHIZONEURAS
529,715,526 *3621D5C724C4286D2BB4635A9994CCAF49C64258 6SNOWBALLMEXICO
529,715,527 *362C8F47FAF77D52FB69DDA1860377AB20C92C71 acnrj
529,715,528 *3628E0A667D714B37DDFEF0498AF08A600F2D7DB ACROPETAL3
529,715,529 *36264D5CD50AE457386F7B114DBFBC647D1D17A7 6-ZIVILISATIONSMUELL
529,715,530 *362C7E5C5902AFD482D6927204E42F30882E3D77 706MARCUS
529,715,531 *3622F6664B760EC99AD221108EEECCA0985B8FF7 ADESIRE666
529,715,532 *362D4A5D7113A50DAAEE61923E572D205F44F84C 788ZOIE
529,715,533 *3629F6D41F289CE4A207446371685F1890662BCB 7ADJUDICACIO
529,715,534 *362D75259D585A8923DCC08784F565B59BF81B8B 7ALEGRADOR
529,715,535 *36203BF7EC7655CEF9BD701F404EF7568333F52C ADRAGTA7
529,715,536 *36272A46F0B89C82B08DCB57A37978CE6AA95C9D ADUSHHTAM7
529,715,537 *362B5F006D2AF8AB96D2D75CA194229B58B972CF [email protected]
529,715,538 *362EBAED6E1E172C26A069A045FE4337BD957DC7 af9c
529,715,539 *362944D1D75BB9181AA2AA00DDB049292255F5F7 afdc#
529,715,540 *3622D1D283C44FD0222B8035F1C2B1D8F744B6D8 7OSPORENOM
529,715,541 *3620C604ADEAF16E28F1DDFD80BCB6B220511930 A:;FO
529,715,542 *3620424DDD2A29CAB7B46E11806EA0B9CD390ED7 agdfasdgasa
529,715,543 *362612DD33A283C2B1F1B6157E046FD812888AB6 AGZHG
529,715,544 *362410510B8ADED04C5FFD3A26DEA3685ABCA2B6 80280B431E2003539345905DDC81A8D6GLASNOST
529,715,545 *3620363B313BCF7E48775BAF7091648E49CF0045 AiCt
529,715,546 *3627F972F7CE04BCED2D211482505BEDF756DF0A 8BALAMAI
529,715,547 *362DBAE85FD909B5C380A55E97D101CDF473CCDF 8BSWDEFINITIVENBSW
529,715,548 *362BD76D2DFA6600485E6F1EF90D8C6BC6563F9A 8CENTRUMBORENES
529,715,549 *362046E993A993BBEA7FCDEE8E4BDD0FBC0FEB29 8EPINOSIS
529,715,550 *3628E01A68D95E3ED1F05CD22390E17890C68E16 AKIMOTOK0
529,715,551 *362359F05A748185CDA6B2C1FD44420CDB08931C akkoulsa
529,715,552 *362696289E7604DB7491A74CC6E13AC14DAC8118 AKL5_
529,715,553 *3629D2D8908F29CA40B5129833F29037C3BCDAC7 ALA4$
529,715,554 *36273581CC85BCF7DEEE0DCB865B97EDC84828E2 ALBO!
529,715,555 *3624AC30A474C52581C1183BBE466127E640381B ALEKHINEBESTGAMES
529,715,556 *3622D8973A45997C956E61CF04DC730BC68EEB6C alfield020306
529,715,557 *362C71C3B2C1F4A0A6856D159E76886B8BC111B1 8p.*.*splat!!
529,715,558 *36217D0DF3844AD902B827FA00CBAFC4E584C955 8SCHNAPPENS
529,715,559 *3623474E47E6E13E6F69B38CD716FFF6C2579CCB 8SCOUTIRELAND
529,715,560 *362D366330B8444F258CB721756DF390434662C1 ALJC
529,715,561 *3623961909C8BF49E5B63C0B6DC486AA7F2E2A73 902351 tietotekniikan-hy
529,715,562 *3628B21D88509EB05DAE6904B0A8484DB8BA61F9 ALTON.LUCHESSA
529,715,563 *3626A2FDF3C21A2D040FEF700AB9417C48840F79 alvagindhart
529,715,564 *362EC567838EF19ECD9C6CC7673C9DF265F59D03 alvinmenear
529,715,565 *36249CB945C7905E8CFADB81DBD10CFB57DBF4F9 ALVINPLAHS
529,715,566 *3627350C58851C9AE440403D3FE712066C3FE28D AMBERABELE
529,715,567 *3620D0154E11A3F6E2D1FFB460D64DDDFCECCBD7 9CHAMPIONBARRY
529,715,568 *3625827C57A7FFE783D41E5D717980C3B2EF7A98 9CHVOSTE
529,715,569 *362495C0678E5D316FBF8F915806F50F73C2D713 amigaruby6
529,715,570 *36295381C584187800FA06580DBBA100AD792774 amr,s
529,715,571 *362F599672A8C1FCD2E7EF98EE5C24F94117B235 9GNINEGIETNO
529,715,572 *362F85DD69D6A217D9C46A3D116081273851947F analizagumapac
529,715,573 *3629A6FF6DE39FD77C2E5F55C1B9CC56D0883211 ANDREAS.CAMBURN
529,715,574 *362A625614173E30B84839CEE3E63B7ED87040AE ANDREWAALAND
529,715,575 *3627A836A1D8494958B7C2C71286BB1484A70A9D AN!F
529,715,576 *3624949D1B321DF6B8890A8E0286E8E152DB8DE5 AN=KF
529,715,577 *3625873CC77C846A34EA93C55607BDEDFB77526D [email protected]
529,715,578 *362AF5154DC53DD6925FC19E3ACB79004A3F7D60 antoniopaskin
529,715,579 *362650896872BC545461248BD32EBB657F0B29DE a2r:c
529,715,580 *3625F1D8B888B3F40EBFF0A66689C240439E4920 [email protected]
529,715,581 *36223798FCE476C0B95B2DBA2FC600E7265D95F6 a8f
529,715,582 *36235E412D4431FC0F918EC3A87ADE5653EF9D79 a#8ob
529,715,583 *36219F1CE06D02357BC4CFC2D16F80C755279E38 ARCHITECTONIC6
529,715,584 *362C94E0DD691E8862767015B488F08500377A7B arliedemory
529,715,585 *36253F362843D81FD807D7139E9635A1791F0BFD AAC9PZ
529,715,586 *362DAEC555196E33AF1D23B0EEB03CBB125707C5 ARNIFORMED
529,715,587 *362F18028EF3C4FE25240E0C8A96D93EB37BC46A [email protected]
529,715,588 *3621F4FA519DD045AD5B49A20A6392522781F640 AAD2\J
529,715,589 *362B65E57AC9C4E41F3CE632452432C17AF3B664 ABEL.GERARD
529,715,590 *36251966119174376C9B5E26FBE30CF9E3633EBB ABGEFUEH3
529,715,591 *362FF94375A011715A4D3352CAD2C64FA48587D1 ATBFX
529,715,592 *3623F06F2DC339EE7CC3A61ADD84D2DB81DB93FE ATMのうち、オムロンのロゴが入る場所に
529,715,593 *3629FB665815DA75CA06CC95242E78C0E8DC0FCF ab?ya
529,715,594 *36218A4D274D82C46847EE1CCC3CBE6F7850729B AB_ZI
529,715,595 *3620444B1E5DE2462C95AE219925ED88BD664067 augustinecapito
529,715,596 *36265BC47229E6CBABEA57E8F24DB2A4BC9D0AC8 A-CITY-WITHOUT-SUNSHINE
529,715,597 *362E3306A7B24BC73AE547877F614E668673305C act1-scene1-intestacheavete
529,715,598 *3623033AE4CD87FF18F16F739EDF92D32EF5A26F avl#2
529,715,599 *3629B4E8E8791EF140ED669263A2A9439638E320 afwezigheidsuren
529,715,600 *362870B8C460DE06535877C0AE5CD250580F8CD6 AGP5M
529,715,601 *3627E30354E172116E80E5B4F26711C9A8C51D32 B7VIY
529,715,602 *362205E01D3BC9E58F84889F4150B5449E499999 b8/f.
529,715,603 *3627AB52D237262244E973B7D6BA92F3A3BC7750 ALCOHAULER
529,715,604 *362624CD41E3AA534BB66295BFA92250E717A797 BBIST
529,715,605 *3624A6E656F7DECCB610C73A5929615053DE9739 bc!m%
529,715,606 *362F079EFE876E3D10DB5D4DF017BC6A5CE7F865 ALIE1024
529,715,607 *3626E5009D174BF54AA75462BD59EEE27B02B3A4 BECKY-CREW
529,715,608 *3626D59E9C5D6B44D4BB2D0A62AD2A297597752D ALTWESLEYCRUSHERD
529,715,609 *3621115A57BE42A5FF1DC3B92BF9AA2D77736E28 bendwiththewind
529,715,610 *362FBEF10E93804626991FFBE10E4E158503249E BENNIE.KATHMAN
529,715,611 *36227E3C0B8E5F307D98071A065788F10DDECD85 AMIHALCA
529,715,612 *3626E1B75DE7D06CD1D9D606268AE49219083C6F [email protected]
529,715,613 *3622FDA74FBE261D268070CD1D65B51F75B08478 BESBRUGGE0
529,715,614 *362BD553AC49DAEF797BFE269000A9008EB6907E BESQ=
529,715,615 *3625AA9C01B20A9821CAE0F60D46AD8E28C2C275 ANDREW.TILLOU
529,715,616 *3627CC2ABE5E6415A5CD4F71CA7455515C6EB782 ANDROGYNEITY9
529,715,617 *362C69886AA025E6847BBC0EC0D4F745E1178D5C anna.weiss
529,715,618 *36200765B491118B6284F449B81B760F43DC7641 ANOGYLOP4
529,715,619 *362E7BDF38FBB6FC8D7717048EE958C10566AE18 anteropygal?
529,715,620 *362D90AA97D24A32C8F7425A7A395074EFB0D3DC ANTONIABERTOLAMI
529,715,621 *3628B5AD147974CEEF6A3D489B14B1BE007594E2 antoniamericle
529,715,622 *3628BF9A459AD7A933F49FBCB82219BDB45EBBB5 ANTWAN.ARREAGA
529,715,623 *36273CA12149C24FC437C56D4929218C93F5F614 ANYTA3
529,715,624 *362E0CCE92C4C32B4BDA314AB9AAFCAE6F37B392 bj8:f
529,715,625 *362ED5A36947BB87D180042688E360197B9DED94 apfik
529,715,626 *3623D19E9CF69484F520761C6ACACC14FCEC682B a(q8x
529,715,627 *362A3C1DEB5178B7D59C4FC3E1BC56560237C214 aq9vp
529,715,628 *362F18CC8017ABE9EA0935B11E49584AD37B1E83 b=lr%
529,715,629 *3626C24D0E6E47C0839DBA363C9805123F7190FB ARIANNECRUZ
529,715,630 *3623F72A63245E07278FB1319D6E31DFEB000C93 bniz8
529,715,631 *362F2D66F1A1713329168CC29921C4206D56A3BC ARTHUR.DEARY
529,715,632 *362ADBE9F2E5CABCB1F1AF6AEF29FF96CD08EEBC [email protected]
529,715,633 *36258DA84913787D03BC54F3D1117E34DBA12784 BOOKER.VANWEELDEN
529,715,634 *3621D76AD5E6AC100FB5562EA437E46E9F241EF2 BOOMERCOMPAQ
529,715,635 *362DB59661EE5148CCA58D698FE4233D1F0FA312 ASSAULTSECTIONS349
529,715,636 *36240168326C4BDC3AF9838C1829AB0DBA8793CE B----p~-~-(0_<)
529,715,637 *362DFE3C646D65C3F8A4F72897602CA19C0DFE0B atana
529,715,638 *362648806F8922DF415B306588DF13B463CAB85F ATOBASTATIN
529,715,639 *362892B2AD01FEDC0530EDC227C2D5A55F0AB5AA BRADLY.WICAL
529,715,640 *362B21232475B4B6EF8A19F8C63C9BAB8FCCD6B5 brandi-dawn
529,715,641 *3622C72AE56843E59D5D79BB054C471F32BA6BA8 BRASAOUFMG
529,715,642 *36231E74869DC0DD4F8AFCF275AF1B66C31FD4C1 a(u+m
529,715,643 *362CD90110CD9389BDB54198022619A3B1737380 BRENTSWEARNGEN
529,715,644 *362C565B18112B347B42648A085E21B2C76DF04E BRIAN NOLET
529,715,645 *362B7B471FA11819734F6D39A1ABA9FF073DAD41 BRIDGE-LINE
529,715,646 *3626DAB31BA03F16F5CAEF079C011CA7F51CC700 [email protected]
529,715,647 *3624601084CD3BB5889890BFB0DD6E55229049F3 axy42
529,715,648 *362C0ED8784077B1039C37B24A4FBB851A1E855A BSCFM
529,715,649 *36238F84E37D266136A6963C60170E0D8422AB1E BSWDISILVESTRO
529,715,650 *3625618BFBE61A0D97ED553CAD23D98CC69605A3 BSWFAQSBSW
529,715,651 *3628795B45AE96F45D922BD3B1AD40DAF0C43E93 BSWLOOPTEST
529,715,652 *362C778CD2654FFF827391629955112233892A09 a』本多広和・服部誠編著、
529,715,653 *362CC3F0E2ED98D1DB450F2D43F49F21AAB3F922 b8=?c
529,715,654 *36224F71EC9FB5F6CA2C7212F7B8ECC7107E3129 BVI1L
529,715,655 *3625BEC32D529A87B9F0C0FAA153708333A330A5 BALISORENLIGNE
529,715,656 *362BABD271703EF12C4AA1C1083B0907855AF325 BANDIEMAN
529,715,657 *3625EA8D3CBC3612EF3EDD9227F6B2148D426E94 bapyk
529,715,658 *362CFD3562E74A455F75BA71E78A249999320453 b-b.~.`.(0-0)
529,715,659 *36233F6918A3C825EE16C16A52362DE91C34D88E C4$$I4$T
529,715,660 *36287A1A3435152030DFE8DD3CF84ACDB6CC2E42 c_5u%
529,715,661 *362295E29C4CFBDDE28CADC8CC705065B4193007 B):C
529,715,662 *362830F1F28D409B1EEB6F2BD63877BCAD0F9000 b+df9
529,715,663 *362C1CA4F06C05D7B7928165F1A7F3998F41375C [email protected]
529,715,664 *3621654DB81AB4C79AC5C5F3BBDE923D63424A80 calerifo
529,715,665 *3623AF223D5FE8F2AC2A7D615A7525BEE3B74FDA camorrist.
529,715,666 *3621314C224B8015444E36DF639962B33800168E BERECHTIGUNGSZÄHLER
529,715,667 *362A59E78650224F43B0B79098A418BE2A8E727C «bereitet
529,715,668 *3628E6C2227EE9F7540B74FCE482FDD761B053C1 CAROL.LEOPOLD
529,715,669 *3628FFAC4046FCBE895681A6E5BA6E99A194A269 BETHYBOOM23
529,715,670 *362FD32BA5BFA38E9724C93878118A79FA3CDA76 [email protected]
529,715,671 *3627049F37AD3E5279FC8BDDCEC13394645AF13A CARYSALANO
529,715,672 *3621B0A626C974D0CF5EB2649D73805874B70C11 bgbbfme31
529,715,673 *36250445833AD4808A40243206D5699EE441EFB1 catmaybes
529,715,674 *3628D918A7C190AC49A4350992DE29F7512DA6A2 BG/GC
529,715,675 *36284A10B80296FBC6B79493F7A08D451514064C bhj?,
529,715,676 *362C8BD68116C343CDFD6DEDA17C204CC99D62D0 cc8km
529,715,677 *3620F23C1E57D8679A2EE1B67E9AB1373C0170E4 bibliothek中に収録された。次いでチェコでチェコ語訳がmistra
529,715,678 *3626A58E6F521A9CC27DB6C347EB2FC56CBBC215 [email protected]
529,715,679 *36263882F067FC6285B867B68B575245263E52DE BJHT&
529,715,680 *362D836DE0018ECADB94D8B8BEE363EDE7065D78 bj%x
529,715,681 *362835D8655215AE87638DD79E54FE6DF6595C2F CESARONE
529,715,682 *3624912D7CCA7F966BABC27221992BE60C9E4FD1 [email protected]
529,715,683 *362E5E0621FBF75B46D1059B2FF10BD2E7003B0A [email protected]
529,715,684 *36243DEA1E4C823B4D12F957B98C0FF93F251F8B blepsis3
529,715,685 *36202E0AB2D06014E0D5382F959E0B46975BACB8 BMEU-
529,715,686 *3628BB47737EA3258A56441CEB9435928E8AE60D CHARLESHORWATH
529,715,687 *362F41894A056C14D4DF780E3DD6884FAEDCB87C B"=NQ
529,715,688 *3620AF3CB255814E4635782CC9EDA8236333761A BO9L9
529,715,689 *36218E8FE3FD6769EF930C8F2E6D63FB1938CE69 [email protected]
529,715,690 *3629399E7AFA9E939C3B12BD7607160A8EC8AF53 bog_turf.b/A/g_t/[@]/rf
529,715,691 *3621003A4482614A690F43AA089D6DBFB5692174 boisrogeaises
529,715,692 *362305CBCB6858545332473B8CF47CF74CA0D840 CHESTERPOL
529,715,693 *362095FBD75BE4691D2434E204E15EEFF97074EF CHIKEVER
529,715,694 *3625A31D6D4C5A7DF8BAFF886CEB79E4E0AF4979 childrensbooktrust
529,715,695 *362AC0E030A5A082DDF69E500ECC17864826222E BOYDBAYAS
529,715,696 *362409A7E20D2BF573652789FACEEBBAB8D3963F b$oz&
529,715,697 *36275B44945BDA351BC6170BECD3EFC6691AFE3D CHRISTINAAA518
529,715,698 *36221AFBABD06F0BE7C87632083CA64F7404770C christopher.j.harrison
529,715,699 *362B216FF33E060CCEE6E1D8A3CEABDA6E1663E9 BQKB,
529,715,700 *362B8E855F412D54E3D82758F99AFE9B5D8BAE54 CIRCLIS4
529,715,701 *3620046FE182C12A3D5A01A97CBBDC4D77FC3661 C_JIR
529,715,702 *362289FC714601606F89CA266A4C08212ED84AD1 [email protected]
529,715,703 *362387C37B743068298C955087D39E4CBE8AA708 ckrop
529,715,704 *3620EA46FC41A5718A77D2AAFADC7885A5C4F178 clfwq
529,715,705 *362C7A453067DD442799FED2F46113A7592053D6 BRYCE.FREIMUTH
529,715,706 *36287F5336A70F4EBA2183EA3C0D314F85D55FD3 BSCFM
529,715,707 *36281C91EC9732A498FB6472EB347E438CBB8FF9 BSWGHINNBSW
529,715,708 *3626EF779E38C94538743A09BFCF4DA105DBA446 CMR42
529,715,709 *362A31A0668B7A6CB951289715F19FB4B0569BAF BUD.CURCIO
529,715,710 *3626781BEE9D70BB0ED9B3B37F91D7AD8E2FCD42 buesiella
529,715,711 *3625E2AD26067F0134BC74587529DCCF1E817E3F burlgremillion
529,715,712 *36234CD3D671262591F55301E68171D69F14C944 burmek
529,715,713 *362BA548277675FA2C8EC4A31ADBAA3A11FD5C90 commend4b1y
529,715,714 *36230A7C758A00849EF646D20E82F2798B8998EE bw0gl
529,715,715 *362DB2D6F8EAC10A33ADB2E06C1EA8BE49F2C307 BW+LI
529,715,716 *362DCDBD43C763F3909018C649788AB9977563E9 BYY5O
529,715,717 *3626033F751718AC465227E7C79ACA08BD9B9926 c04rs3-fi
529,715,718 *3625906828137DD0D7B42F030F768CBF25172373 C5g9
529,715,719 *3626B08E831338D0CF7340308899838095F633FA cabrez0
529,715,720 *3620FFE3268D1C7631A60E76D836B4962CB054F1 cristobalbailony
529,715,721 *362E0E9296811CD6A1F548795F510A39F3C6EAAB cah-kangkung
529,715,722 *362F1F981795A72F058A15605E6FDE88A07323A3 CRMN41N3SS
529,715,723 *362E5917BA81896B530763986984C661DDC1674F calvin1965
529,715,724 *3625F89B0AAF972FDAAA05E9538AAA5741A1FE1D csd77
529,715,725 *362EAEED9CDA497AB700276FBE32AC1AA319F51C CANTORE8
529,715,726 *3620FB25E6DC2C62DAF8AD8BA960D8AD35A68470 CTTRM
529,715,727 *362CEEF54243DA9E538262B6EFBD1ED63E3A4562 CARMENSLATKIN
529,715,728 *3628B74B381019E318E24E3977CB78417289E850 CUT.THE.ARTERY
529,715,729 *362842928742533D1236F2C604CCA3D19ABE9E4D case--looking
529,715,730 *3625CC1BED94E42A1E02BAC35AF3DD72AE99CA06 cza=+
529,715,731 *3627F389134A2096607DD7C42FC2A44D29E0F64A CАЛЕМ
529,715,732 *362F578FFA4F8611D1C684BE2E7ABB19504E6622 D045A
529,715,733 *362F46702C2F372FA24AB8F5EB448B229B6B09D4 D354GU4RM314
529,715,734 *3624A6F885006AB8608749F8495E762A61C0EC0E D38AT1NG
529,715,735 *362B6D45E3D614E96B63F7B54C414A06CB385C75 d3spit3d
529,715,736 *36253239F35ACFCD58F0CF8D93D2834B21727948 CELLULAUVS
529,715,737 *362DC996C5E962548F4355C8A97C11992472BDA5 CESDM
529,715,738 *362056C739336A8DE8B2A919A3AF6479E12AF086 da8u
529,715,739 *3624092D539ABEAC32305F8BA3040C90DC017FDF CHARLES HAGGART
529,715,740 *362DC56381114A7C4F87EA51CFDC1C8BAB23CDC4 DAMONSCHUETZE
529,715,741 *362A4E987A3AD340AFE67B8D5EAB722246DA3760 dampaal
529,715,742 *362B03ECF819F85619B02AE0AAD22670F1378D00 CHERI-PEREZ
529,715,743 *362F0A00F260942FD1424E085AD5DE99AD152F09 chfdk
529,715,744 *36283A675EB9C8237A9F14DABC8DD55CF2C6F1D5 DARRICK.GUTREUTER
529,715,745 *362BBCA08EC85C12673A9DCC67FF92A649D93D27 christopherleemoon
529,715,746 *362C4FE4F2075B0275399B07E33E10E3978E1348 ;)*.*.*.d====b
529,715,747 *362A6939D08F9E024C8A68079C1AB26924EA239A d&b7;
529,715,748 *36200FC527ECAB53DBFEA770046387682302C1EF DCRABELO9
529,715,749 *3623CFCB1D2B084D2B875C039787380472E0A8E2 CIV.V
529,715,750 *362616D004E46DCBEE390C4F66E444E38F463CEE d"dk
529,715,751 *3626AAC3E4531DCF962F7454F5A643ED0022A1F9 DEANGELO.MORANTE
529,715,752 *362A42D3D4FB9ADA441092196762F9D2AA55DEEA cl/8,
529,715,753 *36274FA05CDE78F7043B9B2860C41A3FA01FAE94 CLAIREDA6
529,715,754 *362E88A365F1D1473B8319680CD031F2AE370359 [email protected]@7i0n$
529,715,755 *362A2CB1073B630E9111F9BF96EA0A2881DB71F5 DENISE GUERTIN
529,715,756 *3621E253AC9ABAD0555543147C119AEB36FD0EE6 clintoniwasa
529,715,757 *362D55B02D4E03EE4EC9C7C0B5872A389EDC2B88 cm!;%
529,715,758 *3629950AD8B45B234BBCB9E61221C3D67B3F9DAA DEROGASE1
529,715,759 *362336B1505A7BD64ACB7EE5413B41E7F272215F dhk(r
529,715,760 *3621A538327D28A72F9E45C4B733269152B17D30 dieaideas
529,715,761 *3620A723AC4AB907363993B25C66427BB0E10515 DIEDELIA1234
529,715,762 *362AB3A6394D64E4913E78485EB6F5D0B6C89B5E CONTINGENTIAL7
529,715,763 *36252E1ED5B003E2D941D262BBEBDD6507425528 dinobartles
529,715,764 *362D1F8880CD09F3BA5EAFD2FC1950FC6CC450AB DiplodocusMatingCall
529,715,765 *362EDB010197C89212978412A1E018EC9E4F966C C=+OV
529,715,766 *3621B7E7E01CC05BEC84851B2371A2B3FB8DADBA DLW_
529,715,767 *3621888099B7DDB9D8D2D115077BF5D7F1E328A0 CRB(I
529,715,768 *362DA45D26C2715FFB35411412D4E0C43EC4ABF7 DOI101086319438160
529,715,769 *362193DDE98C43478AC94B89A380F3251AF38AE7 CSENDŐRÉVÉ
529,715,770 *3624E37F237B33026DBC0AD5BE0919A5A46AEEB7 DOMINGO.SESSOMS
529,715,771 *3629BB4CAED375327380201170AE6E05924C70F4 CTJEWELS2002
529,715,772 *36245EC5DCE91AE60E9F1AE5D3FA2F5AFB11E8B6 donna.currin
529,715,773 *3625B745B03C6AB064CE047885B30B66F23AD20B cts;
529,715,774 *362E4941632D640DE247821C352E80DB93175432 dorseymedved
529,715,775 *3623E6B51810C7914D9DAB65B4CBC2152089ED93 d,+pg
529,715,776 *3624D410B58C90F6695BF02552229E3F70D894A8 DR6JD
529,715,777 *362606280FD1298D0190510DB6B0AC62647515DE DRAAIJENOGEENKEERTJEOM
529,715,778 *362EA9FD886E14C570A50885C87C5FED52058E1D cxpt0
529,715,779 *362D91F5E488C4482F0139E2CF68DB69B1CB7C92 dsl2(
529,715,780 *362F1EE9C243F8E68ED2E08DEC8380B6C2EFCEF2 d0_4e
529,715,781 *362BAC7DD02E71383344ABE6A9B23DD66C1AA539 DUSAPINPASCAL
529,715,782 *362F6C22BECC7EE46219C3C86C1AE1AB5C6B74A0 dustinfalu
529,715,783 *362E78ECE09886901111281F504559145E361825 D=UWH
529,715,784 *36287C23779454E6B8096067E303B7FB01B81B6F D87LOJRQOCOM
529,715,785 *362B186B325A3C70C2511AF93F9332AEF2002EC4 D8FTS
529,715,786 *362AA4F25F208438699573E167D003A342BFF715 DYSMUTAZA
529,715,787 *362A221ECB678E0258D83891D488777F294D4A08 DALEVERGA
529,715,788 *3626061266E581D20A7C699709328B7F59AA7706 DAMIAN.HELLUMS
529,715,789 *362124E38B5328053F7CE0764F2AEBA5ADDB48B2 DAMPBÅTEN
529,715,790 *362613A5568872C0B02FAF6E881075C6EEA47A37 DANIELLE MAYA
529,715,791 *3620E7CC52C40962DE161DFA37B0E7D07F34A7FB ECH
529,715,792 *3629A862D1B865A203DCDC2846B4BE15C5BD01DF darrickkiper
529,715,793 *362023F655F42E7CBAEF027AB1D56DFDECF03CD9 darrickroner
529,715,794 *362354A1025D79A619B913B161B602FC28BDF370 d+a:s
529,715,795 *362BE681A5681D660B5E44972D6E390D44D13963 EDWIN.WAYCASTER
529,715,796 *362482D074F92F1131B63646E6351843230EC68F davidbanford
529,715,797 *36203735AEDF69B69E7F392E5778896B090E9FE7 efuhh
529,715,798 *362844D23A9E8A5F5995D3F0A02B232D39C649C0 EindeutschesRequiem,Op45:DennwirhabenhiekeinebleibendeStadt
529,715,799 *3623843A7B68395BB984679B7B1DCCFCD2409EA8 dda4a996df6a36eaaf1a6b5af01dce87
529,715,800 *362561BA290120C3BC9B714056565521FE9B82C4 d$daw
529,715,801 *36266BBEA81CA68EF06A65BE03351514649D84AB eldenmeinke
529,715,802 *362CE09D81F5BDE2C7D3437934C5FDE89D4D501F [email protected]
529,715,803 *3625D612DA91919E5861761F62E7957240DD7DD9 DEHISCARETISQ
529,715,804 *3626EC6576429B62850891737CCA8FA6518FB20E elmerianacone
529,715,805 *36225901D3C927B21CFA266AFC7CA93B54024A10 DELMER.VANHOECKE
529,715,806 *362ECF0F44E953E19CE641A457AA323B8A6D768C em)de
529,715,807 *36202585E2115D51572B1223D7B2DAE4778525EC denniswerth
529,715,808 *3627AE599CCD550B7BE6DDCE1A02B0C5F2AB1C9F de.,q
529,715,809 *362C70127D8B4D239B26E200C1AAA4B1CA1B338D DEREKSEGOUIA
529,715,810 *362A80FC03DA55759F0F06529C5E12B32E0B01C5 DESMOND.DERING
529,715,811 *3627479D4BD843755C3DDE8E467F82169CC75B12 enercell4
529,715,812 *362B2582986759BB731C89C923E5DF830C50DB35 DEVOLVN9
529,715,813 *362B9B1BF939D2A6FB0B1C19AAF2C25D43937962 D:F6!
529,715,814 *362336FA24A6E84E039B9573B65F83C88E2B63B9 erbebenopfer
529,715,815 *362053BAA31761EA6CA4E2770D30F3B688AEC2A4 DISCROT
529,715,816 *362D8D8733B37F30872189654388831409DEAC05 DISTRIBUEERDEN5
529,715,817 *36263D1E6B01C6623BF674AE7FD4C42B354DEC0A EUNIFIER2
529,715,818 *362A972193D77AE6636FED6FEAE6553A85F77450 eventfolder
529,715,819 *36243154D65B1E1302B7FA7E72AB23200614AE27 eyscr
529,715,820 *3621858630B5C8AD56633D58B7B9A3449A9C807C DONAL.K.FELLOWSMANCH
529,715,821 *3629694279D254586FE4A02DAA14354F33529B3B FARSANGS2
529,715,822 *362EAB919AEFFDCACA3CEA38E27E921C5524149A donnywolcott
529,715,823 *362E0AFF77DBBEBB516D256C9EA1A492E04779DA fee-fie-foo
529,715,824 *3620AEF55A1BFBC45B25FE242F42E63393AD4CBF [email protected]
529,715,825 *36226A507DDC0DD47B38F25CB2C4570A4BC9CE07 fel
529,715,826 *36285C37BC7D53EF4D4AE53E59C49FCB4DEAC3D1 [email protected]
529,715,827 *362760504B40BF5C080D799AC92FD11F6EC3C7CE DoYouHaveaMagicPump?
529,715,828 *3629F545D4E1123EA6E45E82D3EBD7F2A4D67E41 d_+pb
529,715,829 *3628CCF2B26E95B0B6008408C42157FA1A6E1CB9 draft-ietf-manet-smf
529,715,830 *362C431630FEF90611D047EA20ECE48818A9B16B drewsasseville
529,715,831 *362F1660CA85090A8F83E2BE49A64ADB47F6C02B floydamato
529,715,832 *362FCA4F5D378A6AA04CF2E210E4C22EC4801169 drowning》을
529,715,833 *3626AA31C2FB53DA04F40F3090C225BF102678B9 forfairnses
529,715,834 *362D224673A09DBB1129CFBCEB29C5FFD87C5FC6 fpjlrgm
529,715,835 *362DA915D4BFB29407C76722DACCFFDE8F308C66 [email protected]
529,715,836 *362CD7BE7718BD2C0908EC8B0CA3831224757827 FRED GRILLO
529,715,837 *362CDB65644510E6E9AFE80858D847B3C66CA059 DUSTINCAGNEY
529,715,838 *362A9DA7241C7697E3D3D92D5ADA47A412C40CD4 french-impressionist-piano-music-(feat.-piano:-cristina-ortiz)
529,715,839 *362D50744CECAB9C26282F5291065043806A3F04 FRESPRKARINGS
529,715,840 *36277D523FA0C2D5F34AC31C10CA29AF25017B86 [email protected]
529,715,841 *362D1B8FACD6711E6CD4F56B9ED6351B518BAE87 FUCKMYAS2
529,715,842 *36290EFA3ED66B9D0F46B0EBE7E02CA08DFF3C7A DVDA#
529,715,843 *362023CFA72F82F3A0AD2356D79B9DE6E0BEB5D0 DV)JX
529,715,844 *3623C5AA85462A3F42209C30C60A3A976E807E49 [email protected]
529,715,845 *362CA7BAF948149C6011960DDD7AA967E4EFEC81 DWB_
529,715,846 *362CF01D41F7DEC6711527BAFE680EF5DBF2B8DE G4Z3T34RV05315
529,715,847 *3624D13D873E75FC94809FD69E18DEA86081C38C GALECOLARUSSO
529,715,848 *362FF7E07150A81E17CC57ABD29BBAA33152A0FF dylansidles
529,715,849 *36270137ABDCAD5A137DA2784705BC5993732BEC [email protected]
529,715,850 *36247B8293543DDCEA7848C843D9FA7CC9BA9AD1 GARTH.CEARNS
529,715,851 *36289DC5C6E36744FFE3359520EE5F7770EAF653 GARY.SWABY
529,715,852 *362A2ECC4CE002134A4B3019277ACC240C0958AE easier37
529,715,853 *362515A4D01CA8B1FFDAC0337C76050415A65677 ebbtidemoon
529,715,854 *362A9B151D6B1AD00E30473990A054C46C9CE572 ecf6u
529,715,855 *3620A6BF99837EA08DF09338EE442C7C23E42182 ECH
529,715,856 *36223278E733672C9FE7C102201D6D311937A2C6 ECROULERAIT6
529,715,857 *3629693307D345450C24D9EF2D93F67CEDFC09D8 GERARDO.RENNELS
529,715,858 *3628895E2015ADF27ED7A5E5A96BD7462EAFE2D1 gerardservatius
529,715,859 *36264CC2FFB7F930203B47330B397F75F484AA79 EDWARD.REDD
529,715,860 *36273CD381DE863EEE7EED200699E259E6596F47 EDWINSKINNER
529,715,861 *362A42652BBCDB6E8AF4BADDE1D63016034EFE86 [email protected]
529,715,862 *3623F95435F5CE442856BE0F211E3EBA0369D454 GLBSBSW2
529,715,863 *36210F52CF1C6D3A68498E2265DA00DF1255C7E3 GOLEREMO4
529,715,864 *36280E47C09BF7FC5EC5BC63152319C81D05EE73 EK8_
529,715,865 *3629A7B2179B53406D742D63FBCC68B3F3532FD4 [email protected]
529,715,866 *36210300BFB0C332908FAD957B3E524E964D27A5 greggcarras
529,715,867 *3626353E069A489B464215387BFB56CC191AAC02 ELLIOTTPLADSON
529,715,868 *3625ADE82F18CF0A60578F8EEF9B57CE678C95DF ELLISVANBEBBER
529,715,869 *36280E76F09A4A61333D834EBC4E3E97A8A7BFF0 ELOYFARQUHARSON
529,715,870 *362F308D56429B20A80C44CE0C1DB7B9FCF65401 grnews
529,715,871 *362D843409CAE1DFE0958CEFC6D0C829087F9694 ELX9
529,715,872 *362C591EEE7DD8AB7F40C67A94CB41679A3D2F34 emersonkubly
529,715,873 *362677DFBB15CB4FCF9FFD1E7A5CB5D549092DFF [email protected]
529,715,874 *362417051455D144FDBCD0B03DBBC886BF5D86E3 EMMANUELCARRINO
529,715,875 *3622F256E68F9DCB29F337FFA52050242AF3B08D emqeckas
529,715,876 *362EBA2B61C8A5130BF2A9F151B16F29E650D3E4 EN6898203232
529,715,877 *3626214F48DF77509180BF315B34DDDBEBBF8B37 ENAJENADA5
529,715,878 *362C94284801261B24148E2CBFBEF8DBE34AB3E0 enchenji6
529,715,879 *362389F482D4B8A4D4E10E3AC89076F4D1382809 ENCHOIRIARTEIAS
529,715,880 *362693E14103113F5F3A509AFA5CFC16D08AA4FD ENCODAIS9
529,715,881 *362C4556655304916D3318DABE7267421FC4D867 HAASTAVILLE
529,715,882 *362A6885E94BD847D1CC313D9F664B6B86844A8D HACKERORLANDO
529,715,883 *362BF5B6CD68E9D52607376B5D594BDD0DF36248 enisco
529,715,884 *362DDDF6F19EB8DE200EC02AE5B9715CB4B2C17D ENNOUADER
529,715,885 *36205F83510D275B5160BC60E2DF995A9CC0BC43 enochkiss
529,715,886 *36205D19CFABCA04F2B896CAFE0B80BC7306EA71 ENRAYAING
529,715,887 *362AFF47FB15C8A88322365620CD87ECC678FEAC hannah.morton
529,715,888 *36216EBA6DFE010AB5CA953BC228501A29366FA4 HARLANSILVESTRE
529,715,889 *362F4676652CA908ADD2CA74E2E7504A3965A9F3 harleydavidson-electra-glide-standard-review
529,715,890 *362A3253A8F95133695B10564ADE5F578407F2FB ERASMOLEVETO
529,715,891 *362F3D6A58D2674703D6E496441FF4754895831F ERECTORS
529,715,892 *3622BFA76B13C7428212B3512198DA5182933866 ERNESTGREIN
529,715,893 *362BFA4088274ABB337B974EE02CFB3B2EF7696D ernestozeyer
529,715,894 *3625854500074C5EC996697C9EDCE82F0E27B52A ERNIEROUGHEN
529,715,895 *3629C0A1E281FCAF381EE874A17F0047131E92FF HEATHER.STOFFER
529,715,896 *362744EC80ED041B05D39654E3E2F8DC404FD7FB [email protected]
529,715,897 *3623DF9CD294512050E70A8A84FF61E51CFB2318 ESFACIEZ
529,715,898 *3625ECBE02FAB1FE49CBB432490465CEC8685EB4 etdan
529,715,899 *362A046792A4A0D7A79EA73B963CED44F2ACC396 heven劇場
529,715,900 *362CE52998FEE085CF8B2697BBB0D7548F8BA29C EUB6
529,715,901 *36210773F71437F1CF3A5DEB178D27A9CB296485 euwvogel8
529,715,902 *362F6C21157B483A78CB3125C9CEB04455C99AA1 HINTS2006
529,715,903 *362869F6FDE8E00098F33C23A77049B7B2C81990 EVA!LEYENDAPERUANA
529,715,904 *362C27DAB2C1C9B35CCCDED81FF5416BB38472D7 HIPOLITOIMBERT
529,715,905 *3628E12A0DDCE2A04FD0AFF3029FA5D100222F3A EVEBEVILACQUA
529,715,906 *362A151104BF3241F2FF183024423156897597DE Ex32:AA
529,715,907 *3629A811C70F153F0BD074B39903A7D5E6F7A71F ezekielstaffon
529,715,908 *362735DA982E45AF23491502606243E7DD826E91 HONOTUKS
529,715,909 *362C2D38D7221C2071FAD9A7D1462DDCD912F9E1 honour roll
529,715,910 *362E9A3D4372C8E2C8D80B229A8E4CFAB9C37308 HORJUVANA
529,715,911 *362B49E6670ABAF64A446A13F214BC63D6B4AB78 f7xt
529,715,912 *362B496E6748CAB479FAAA885FB5622B904DF3BD FACULTEITSKLEUREN8
529,715,913 *362CEB189173AFEACBDAF072DCE13C99CE9003FA hrfstdgn6
529,715,914 *362A889E3680EFAC0A5D1A4D9121ED99A39B8023 HTTPWWW.ANDREWSTRONG
529,715,915 *362E9F946FECEBB5C553EA69BEA5B61322C2BFB2 [email protected]
529,715,916 *362B6442D39D9B6FB64F49602B3175AEFCDD751A HTTPWWWWORTH1000CO
529,715,917 *362AE29A6265073CDEEFB03E8B330E6A77D43483 hu/d
529,715,918 *362EEB71912FF3F648E9499EBBD73FBADC39ABD7 FERDINAND.STANDARD
529,715,919 *36221A9236708F2BC1128627B99EFED52D0017AF FERDINANDVOTE
529,715,920 *362C5179ABB9349112603A973D736A91EC17C171 FERNANDO.DEMARAY
529,715,921 *362DB33EDCD2A46B0390086AEBD10EE625B85431 FFIEHUIS2
529,715,922 *36243876A324D2EFC0CA548EB9C5D57C73EB2C51 [email protected]
529,715,923 *36293145F53ABB14D4EADCB1D7A56E15D172DECC HYUUGABLACK
529,715,924 *3625DDD2E8D453B1B9B1000F2901898B7AB266AE FIELDSOFANTHENRY(PETEST.JOHN)
529,715,925 *362FDB3CBF37C4491FE6F5EF5AA3969C974566DC FINNBARTLETT
529,715,926 *362F7DEBB1D4AD1402F7358D005D621858323C3F FIPYNPCCWJ
529,715,927 *362BF6E5B6C0DB9DDF6D5EDC082213A0BD1F8A46 fksuakl42
529,715,928 *3621B8E0BB07081B77AD2BDA2BE708DC3A4FBF57 If-We-Want-It,-It's-Right
529,715,929 *362A9FF079C1941F0BDD18FEC5799348A3054F35 fmhfjioxg5phqv0i
529,715,930 *3627659F0C15E9E405324B94A2D03B144454EE9D FPSLPIRO49
529,715,931 *362FC1D2CAEE8B45B5DBAF5B14E005159C5CE4EA FRENCH-RUSSIAN
529,715,932 *362F01525D6553EEE5E9A7508B3E8D7AEB181221 FUCARINO2
529,715,933 *3624D670F6C5031814305EC9CD3A5E22500FEF32 Indigo:-Women-of-Song
529,715,934 *362837AA7B82A8D8FACEDA952933139345EB4267 inewscrunchcomwww
529,715,935 *362BE5466B80A7C8E12D8C75F495656EA7AEA4D2 G8}N
529,715,936 *362F088D416394C510385C3447E149875A8F52D3 GAMMASTRS
529,715,937 *36271704384358CA6A08B0533CFB763AE7798D03 [email protected]
529,715,938 *36237BF62BBD573A43C7F52ACADA862D7B9D5F67 [email protected]
529,715,939 *362DB3C8354B8F4007724957D72F5740F9E4F08A garfieldsquires
529,715,940 *36225EB1D677DB12E72E6C5F960751ABB8FCACC2 garlandriebe
529,715,941 *362D0187E969FE5163A2732797F37322775BD35B garretcaldera
529,715,942 *362702696CBE668187281D8EEB6C30AA1286B67A intro dulce amor
529,715,943 *3620A037A089EDF4833DEAA76CC8705C41785E03 IRISRUBIO
529,715,944 *3629AC782645480CA54DA625B3D528268388865A GERALDO.VACCARELLA
529,715,945 *3622D3BF8722BFB4A1BB33CE5C400461A707508A GERNIECE0
529,715,946 *3622E5112E5C301A121ED88C7055A78800A199E9 GESCHMACKSGRÜNDEN
529,715,947 *3623EDB09EC3F16787629B080CD5748B88E9258B giscardin4
529,715,948 *3625684BC714D0E2771B12D47A9F996937802085 giuseppebanyas
529,715,949 *362F1FCEE8CF9D1BA23EC431108FC1C51FA4A345 globalfirebird
529,715,950 *3621C44FBEBCA617161310F35FE1F2C757CE0BED GMMLGCL4
529,715,951 *362A8154E92A1DB0620B018361962447BE7ECF75 GNITTEB3
529,715,952 *3624CDE695FD44B53E2C1BA9493425C90B95A410 jaredpriess
529,715,953 *36286EC152568BE7127D46F947DFDF50F512A1E8 GÖMBLOMMOR
529,715,954 *362ADE1F07EB4616036BF7541AB0B21F67DADDED JARROD.WIGHAM
529,715,955 *3629D02548831720A80782B651B20DC680868DAE gonzalobacon
529,715,956 *3623FFCD35D1C18A63AA3CDC498DA9BE4B21EFE8 JARYDCHETTY
529,715,957 *36281F0E62332F20FB6D9180B0405580AE199F28 [email protected]
529,715,958 *36263F9216F45D8B8B0A0C7FD348583789E99E93 [email protected]
529,715,959 *3625BF9B41115F281A11BCE177B34C3DFC5AED8B GRADUALTED
529,715,960 *362C6C9F604AC9546D866BD35FCFB695378FC2C8 gregmicroed
529,715,961 *36275C4A56A86DD6F318103F2C3BBDDA9C008993 grootmoedige
529,715,962 *3627A3C41CD9C4EECC60F89424376897843E676D [email protected]
529,715,963 *36266F1EE24075F86CF81562E29D86A54002A800 [email protected]
529,715,964 *362504A4FAA91020CD01C5D4059A043459EFC684 JILLWHITE
529,715,965 *36207D44BBD965DD60619C0E1F436228C80F52AE HALLELUJAH(PART1)
529,715,966 *3622478F79FFCAB325A9E11ECFA742FC2407B317 JOAOCRISTOVAO
529,715,967 *3628A44D6185BBCCE6ACF4597C72FB2B2B8621A9 JOEYWOUTERS
529,715,968 *362DB83A9C542C4D432054CD9BB9214D7DB93F7B HARRISONRAVENELLE
529,715,969 *36254845B7C07879F61C20CB6DC986256341ABC6 JOHN.CHAVARIA
529,715,970 *362B314CB9C423AC84BFC08F9F7600BB71C09A16 johnny-dance
529,715,971 *362CE89DB916939C57988F7C9FDFAD9D8AB9F4A9 [email protected]
529,715,972 *362F632ACF2FED0BBDBE3DFFA7749D1A175470BE [email protected]
529,715,973 *3624AF15E2E8D2817A3359F13F758144E12768F6 JOSHUAORITI
529,715,974 *362AE8F4CEE4E0C2341363353E01DF5D5549EA76 jp^"
529,715,975 *362707C550AA550B363EFF7CC9FD155194B2FA78 HENVAGNETIEZH
529,715,976 *362DA1D8E12BB78B0D95413D869C416862100A92 herbhalma
529,715,977 *3627CE23EB8E7F0C6153C2FD2ABE7E4D05D246F5 JSERBEN
529,715,978 *362413301A55F860C844489BCE8FCA6D72F38D3C JUDSONRUNDE
529,715,979 *3624E1BA9D20F0FFF5BC3DE42F310A945CE7E9E2 herschelsewyerd
529,715,980 *362ED1CDB2A24C0D80C29FC4AB690E74BC837FEC juleskolstad
529,715,981 *36248E5CBDF8A13BD3B7116B0F198C23C6718779 HERZ.UND.HERZ.VEREINT..INSTRUMENTAL
529,715,982 *362F8BEB618500F4FE60FB1E19E6DAF6BC5464B4 juniorgiarrano
529,715,983 *362FCD7A1311E32B54FF0C5C15DC3678A63D1641 [email protected]
529,715,984 *3623B408700FD7D3D85DF839487250A48E2512A9 hl67a510j1fxza
529,715,985 *362528A5F83BFB1EB131B459B96E60565020BC49 KALTINANČIĄ
529,715,986 *3628D2BFF5BFA9BD49F98BFC21B764D4B0033A34 hockensmith1
529,715,987 *3629D9DD2FB149026B1D19F23CB3F4FA7C391089 KANJYA
529,715,988 *362A61D2724CD3DC9F18435CBCF73877EEE06F76 homemary0
529,715,989 *362277A779ED19E0FF77487EC71A477D699AB42A Karwij
529,715,990 *362C2342EBA2A9A4838C1096E602C073537EEC9F HTTPWWWGETITDONELA
529,715,991 *362C26A45F4EC34A42A452F253C9C6A354903EFC httpwwwikmeorg
529,715,992 *362C9AFED319DABA5F6786F73AFD54BE1FE6944D HTTPZOTZBROBLOGSPOT
529,715,993 *362A975DB997209D28156CD95C9ECDCF6EBD9B50 huntertorrie
529,715,994 *362042BDB7AEB993BEB78B43BB2141A2B4144E98 hurbbs
529,715,995 *3629E71626F2ED392FE359EE55C4F72147327FE0 KESHAWN251
529,715,996 *36263AA516665A830A55C606EF5BB89C0DEEA0ED [email protected]
529,715,997 *362DA5524DA55583FCA6A269B6779320FE8551A1 hypotactic7
529,715,998 *362DD6FD8292F094EC7ECAE4492CE8D766C8CE91 IAMGOOD1
529,715,999 *3628A659ADC9EAC5F26680B2C20C3FE3D569FC91 ichi shinpo
529,716,000 *3622EEC3B3127C694A04D64AD5A6957576B7B2CD IDON'TCARE(VOCALANDDRUMMIX)
529,716,001 *362DEA99BCF3192DC4207D1926FE39F5A0F11A93 ileikiss5
529,716,002 *36261A3FE555F391AEA1F8FD2DDE8768A4440531 KOSTÜMDE
529,716,003 *36208F721D2D89EBC8C6F4AC361D3996CD63AB1D ILOVECHRISTMAS1988
529,716,004 *3621CD478446213B483895154EE21E34533A5056 kraigvitkus
529,716,005 *3623C19CFB48C69EAAA7D14A28C10B0E05699FED iloveskibum1234
529,716,006 *3627E43D827AFAA83A2AFEC4F9EA7399D5280FBA iluvblah05
529,716,007 *362CA6BC1780191BBF176FB5A96251A5FC96D88E INADS
529,716,008 *362278335E8DC3E1DDC5ACAC0D62B09F6B853129 L0T27T0I7GB
529,716,009 *36250B77026288B9A3F5B4C4A55BC907F54DFF66 [email protected]
529,716,010 *362D0A2D2B226514AF5A96BF04766A1169FBAD75 INSTEPS
529,716,011 *362352ACA43E4E49C890EB24ED4A2D4239EE6134 INTERSECTEDCOMWWW
529,716,012 *362C3C857F349B1A381F170287EC421C7188BEBA landtagsdrucksache
529,716,013 *362C8611A685F771BBE5C44D1FA83CF13470156F LAOI
529,716,014 *362B7138330EE854DF66D05C74E9371DF3F02C54 LAVERN.ARGO
529,716,015 *362BFA5BC1937B0428A309386460CD83284C240B LAVEUVE
529,716,016 *362D80FEE80390DE3521DE947D9D1D1DCAB61C0B [email protected]
529,716,017 *362869C6DE323A35E875F3EA141148A65BE9B3B5 leemimms
529,716,018 *3626C506112598D2DAA898A746109C88A82C4FAA [email protected]
529,716,019 *362D955EA35CC0FCC4C1C304F63C3187910FBFE6 [email protected]
529,716,020 *3624B18E93D6D7FF49E275F459C561A54D0313CC j8.5
529,716,021 *3620FDCA49CE6FD982E020EFD5309DEEC1419BC5 j9h~
529,716,022 *362E79F30CE3C8ECEDDF3E769DB930FAF0B8FCE5 JAMEYLOSTROH
529,716,023 *362F8E71EADB22E0E083C0AEA95FAA45C91D9BA4 [email protected]
529,716,024 *36268E5AD0613EAFF3FEEF47602C2FEFC6E7021F [email protected]
529,716,025 *362C320AD35F1A747098DC8880357575C2853A32 JARRETTGORHAM
529,716,026 *36236A24E9621CD8AAD62E5EAFA5A26F6E9CD4F2 LINDSEYHEISSER
529,716,027 *3621E6B4A399314EAAE889984C4BED307CFF7F5F javierlalande
529,716,028 *362DBE85EABFB7559A0FC714512D45AFDBBAC1A0 JAYSON.MOFFETT
529,716,029 *362C98E957F78C0751F37B077A668FA4B1238BC8 JDAVISESQ
529,716,030 *362685C9F5FC3DAE0CA586FD15C1E6AA25651BFE LJEPENKOM
529,716,031 *362A48930ABC1C0FF4007CCE9FE0AB86D3E4D1E7 JEREAURICH
529,716,032 *362EDD72D581B06B4E9F3EBDD9C572CD0C07E043 JEREMY.CRAZIER
529,716,033 *362B89A77F6EFEAC35BC68EF4B45AF4B8288E947 jeromymedell
529,716,034 *36217AB33124A30C7D4A05DD860427D1D180762B LOGON.SCR
529,716,035 *362D468B55AF14289B96FA55642BB7D5F9FDF7E4 LOISDECKER
529,716,036 *362879C1188325D2A68FDBB4D090C9307D4947FB JESSE KWOK
529,716,037 *3627B865662366E94BA7E59842A0A5DD15B29E37 LOPORTOS
529,716,038 *36217760376082DE3578533C951CA6000944131C ji
529,716,039 *362C507C25F22C16886A95D29CD6FD36E18111EA LUCKY.QUEEN
529,716,040 *36217598F71494264A46A134904C1A612CEA8DBE JIMIHENDRIXMUSICLIVESON
529,716,041 *362562DEDA0A646751362C37CCCC6C3F9B543EA4 LUKE.HOLDERFIELD
529,716,042 *3624468E5276F2227195F0B2F9A925A3C64B43A3 [email protected]
529,716,043 *362B7EF0BD1CC12BC55D2FD2F39842AFE39CFCA8 luz665
529,716,044 *3623CF70EE0E22694A45932570FE2354E7A054C9 [email protected]
529,716,045 *362B752FF23D530E732FB1F9BDCA803A9693AF52 joe.klima
529,716,046 *362A7E11BDC15AEB48D8C44685C9B8325EA503F1 MACKVANDYNE
529,716,047 *362F340BC24985C82E11536205970C0B27152126 JONATHONHELIE
529,716,048 *3620DA08DC43CFD17ACEB62A4137102C3293524D magensäureblockern
529,716,049 *362BB56613AB49BE0E1068CBDD4DFA8E1B099E0A JORDONTOVMASYAN
529,716,050 *36259DF7364BAFFAA822ACACC8FF679DED89ED2C josefkrauss
529,716,051 *36278449954A68E4267D985B12019DD25FD2C2AB jose-kike
529,716,052 *362E2991357D3ED2014CF8DE7112D4B597C7CAF6 josephchanco
529,716,053 *362ECF4A83D500F3600D7A1666627AF68E9FB2C1 mannfilmsllc
529,716,054 *362CCC29886C3FA4CD9F2F86D409CB28F4A5DFC5 MAPHIXAT
529,716,055 *362275287B8A9EBC5DF196DC8219292F46C219C5 JULIANKOLDING
529,716,056 *36281FAE5608FB443E8A8064588ADEFD2B93BE44 julien605
529,716,057 *362650038DFBB7F75A76E79FF0FAE65BF201114A k[:|
529,716,058 *3628A16BFEADE08E2BDDDAC70C199C4C6A3DF002 KADESHIAE
529,716,059 *362E88FC0F326C315C2F6BE5619591C1F6FBC872 kancelarskе
529,716,060 *3620D90723CCC17ED3EDE6B5625D12704D11B35C martingombos
529,716,061 *362520051A335D067FBA5FCCC588EA7BAC9290FC katabuki7
529,716,062 *3623BDD230B9ED0387E646B159431D4C35E7D974 KATPADY2
529,716,063 *362996600C7A7FFFFF61A297628CE4717DAF2908 mattlorange
529,716,064 *3625AEDAE40E2FAFB661E46127855A8939848C0C MAURICIOROSI
529,716,065 *36205A1C66014E9D51233260CE6D09F870FD43A5 KEENAN.GREIFE
529,716,066 *362024F73E8E60B9F18CF6CEE3A63E23EC1C9C7D mazda1test123
529,716,067 *362D9E932A8269676B9D3B788403A3263CDE4268 KEITH.ROBINETTE
529,716,068 *362FC37CAC844DB1EEBCC5D0874F17BE4FB2796C MEDAL-FOR-MERIT
529,716,069 *36275225A5EAF5710128342A80692C09E5617690 KERMITSTCHARLES
529,716,070 *362C9B49135B1A64475F6A49FB5AF7D5928A5206 KEVIN MAGGARD
529,716,071 *3623A7C84D9C91765873F1FA099D8A83F9EB5797 kevinotomo
529,716,072 *362DC76931D2F665FD2C56DE1878F3B78370E842 [email protected]
529,716,073 *3620535709714C457D5767B475E28FC031B126D7 KIMBERLY ALVERSON
529,716,074 *362392F6D3C2C8B7B363F8E64DBA531AF4EB959D Kind-of-Guy
529,716,075 *362901870017CDA538AA76D56620069F4B1F402C KING.LUU
529,716,076 *3622574BCDEA46CD47863C88B1F858D96DC8381D KIRBY.DARSI
529,716,077 *362D461097A2FB6AC50B5384B3777E2E585366D7 MICHAEL-MULINGBAYAN
529,716,078 *36245D54FB71198CD660813350248E0F9E3E9151 MICHALDIVALERIO
529,716,079 *362DA57F689EC9465FEC8FBCE5E08913ECA7A8F8 KITTY BOWLES
529,716,080 *362405A671F2001F2DA1F3016F68851E0AC8EA47 KJM6262
529,716,081 *36249E54F1535E2A9C9A040C14FEA2B964D4247B miguelwehbe
529,716,082 *362A78504A569A0643E715BDD29CA95D3EF507C2 KOKUYAKU1
529,716,083 *36258984D09519240C9B014931086449CC5E6577 KQ'G
529,716,084 *362B421730BC8847AA2A45A7E609899981B649BA KRAIG.LEACOCK
529,716,085 *3629D441989418F3DCE9B78B66DD56BAE2E38BF2 mirfieldshowanimalclasses
529,716,086 *3622EB70763A96E4AA52A626A226E31B7EF30820 mirmir12
529,716,087 *3629CB803FCB26212EBA2531ADB59B12DAE32016 KRETSCHMAR12
529,716,088 *362E7F70E780A36643E03116BF95842D6A48CEEC KRIS.KRAMMER
529,716,089 *362148CE41C6EB547DF6C24EEEC08F714EB9AB0E miss_pakipot23
529,716,090 *362A2153CD7A635FA3B28398DF3CCEA2D1004CE3 MIXSPRITZ
529,716,091 *36227B6260844A82D5F0EEBA84A22DA8433EEACA kunto-susilo
529,716,092 *362D1EB645523EC39720B3426F0E85F3D325F7F6 MOFOPEFOLUWA
529,716,093 *362F3310BABEAFCAA8F9AC80F51440375B9761CA kurtzullo
529,716,094 *362514768526C79FF0064FBCE751A3D8EB1A9479 KURUBASED
529,716,095 *3623C1C800E2884606991BC124122D4BC6B0A653 L159677
529,716,096 *362A0DF9FF72510720AB4DF0572C92310255629C MONA-BASH
529,716,097 *3622A9C207172A31F5F6E35C3DA22401810E4B9D montewoltemath
529,716,098 *362C78226E8695E070B703ED98ED04C2FBBB6989 MONTY.VASSEN
529,716,099 *362FF473B3D593F7A019EF740B9FD17FE2A70119 LA.JAUCA.ALTA
529,716,100 *36261E9C9A44FAD2A42074A03ED0A8F4E622D45F LAJEANEI
529,716,101 *3623BC560FB8632460977623664B3D4B26F62FE4 lamsan
529,716,102 *362AB0DD19A5B0385B610778A951222712E98663 MOSHE.TULLOCK
529,716,103 *3628530BA6E69A7FC2F48227C4CC678D5395ED08 [email protected]
529,716,104 *362F148B7C8887890938B9668CBA4695E645C83F lapchart7
529,716,105 *3626002BF8C0005A3CF2EC94A89AC74F1A3BEE7B MRALAERP7
529,716,106 *3624A19C6090E81B3E6A78A8FDA21FDCA616D4D9 LASSTAAL4
529,716,107 *36218199663C001640E8B93FD3F244C0BAF137EE LBZ4KD
529,716,108 *362CB06CCCFFABBFB52A4B233002EF769C44526A leadandgold
529,716,109 *362B023BC2E5B13410C6C080DF09E612A5B05C0B MYILOVEU86
529,716,110 *36241E9538B62435A80C0A7E37A70C58D3A91B8F lelandfrascella
529,716,111 *3627663DCFD683145B1798AE38227843A4C67343 n0nd5crmnatn9
529,716,112 *3626ACB4FEF28F66D9AFB797C332231383884247 LEROY.MALSOM
529,716,113 *362966E5CA741136591C440B286CC5195528CD99 nakasha1
529,716,114 *3628E828DEE10112D327C76AC36A492457D797C9 [email protected]
529,716,115 *36230691BACA4D3B83647A741D819415128C77AD [email protected]
529,716,116 *36288A13CB0BFAF403BC54D0A32A2D1AC580F0D4 liar:-the-best-of-the-charlottes
529,716,117 *362A3BA4DF1E6836E658CEB880F7B29CBE6B58CD liberation.dub.(feat..bobby.blue)
529,716,118 *362159D0F81D301C0626AB51EF2E17783B40BE5E NAVIGATIONSLEISTE01
529,716,119 *36283ED40C62A31FBFAC15F500D24CD560E7E937 NAWELKURA
529,716,120 *36268183A1B9C9C129D1AC3A92EAD867F3712A98 ncc1701edward
529,716,121 *3621290A00D00F8EC9FD6BD0ACC0FC55A9DBDB14 n.de.terminal.de.carga
529,716,122 *3620D583528A1D8F951221E067E6756D3F2809C9 [email protected]
529,716,123 *36218AD5433C65EA29B530B6B6544AA4240D7CF7 lionelgulati
529,716,124 *362B36A4EA62FC387DFC27F2C0BB6083C90E34C5 NESAZENIED
529,716,125 *362E7AA1433E8F3120148F460315011B537C8499 LITTLEAM1
529,716,126 *362434F91E0DD89B4EB32C4A40464458CCB11D97 [email protected]@$tng
529,716,127 *36240D1657B0486CE13C1F67FC511CF8005F86D3 l\]n
529,716,128 *362DCBE3A715B7E41AF07289DE209E6002884989 NICOLAS.LEONOR
529,716,129 *362881B4C5C48A91E9FDF9A887FC669CA9480A08 NICOLAS.RUBEL
529,716,130 *3627172D29840485B2AEBC375343771D67EA7E87 nicole-higuera
529,716,131 *3623F92E6621A8CF5443FD5DC06A406B834CDE1C [email protected]
529,716,132 *362FC81494892872F2DDCA8BBB04850A371ED880 lotus255ps24.7kgmwo
529,716,133 *362646027BAB4BE46E735712A94D2AE398DE45D3 n(!nj
529,716,134 *362E891ACFBCCCE1F969D43B2F8F9C47BFD723ED NO4INFMINOR,POCOSOSTENUTO
529,716,135 *3628B4B6E001C0DF6C6D41310883567582F6AA78 LOWELLENDICOTT
529,716,136 *3623583F7647124C413388FABADEE031F7855AED nomitsubbing
529,716,137 *36298DA907A025528C0EE865C398C8B35A37F942 NOUCAZ13
529,716,138 *362FD770AADA2EF19FFA9B865F1B98022528B563 LUX4+ON5
529,716,139 *36261E7FA488AF0C6ECCFE00C7EBBD577DFD1B63 [email protected]
529,716,140 *362AD9E4DD8BBD5A98946CEF55A94A8957D6B87E ntherFischerQuintett
529,716,141 *362A754878A284C24B329C6696B7113113FE41E7 lynndeslaurier
529,716,142 *362247FBD2864BBF782078402059514403E29FE5 NUMER0L0G15T
529,716,143 *362A77A113CAE671C86DADDA19B5E86493BAB1F3 [email protected]
529,716,144 *36200A29791750CD4A0BFE492162806DA196D15F M2WY
529,716,145 *362D5803A38B4417A1372653D54BBB2F37B5CB51 O5CLL4T3D
529,716,146 *362CE9B6ED55AC7AD19D0499788E20029803995B MACAULEY7
529,716,147 *3629D6485B562452EECFE53B24EC8233BB0DA11A MACK.HIBBITS
529,716,148 *362E9510DA845AFDADBDFB2959C2FAB869749F8B ocabethel
529,716,149 *362D538E87F7FAFC04DD3C2EAE8DDE5E1605A6ED Mahumppapappaoon
529,716,150 *362D704718E20216DEC0ADB7BB8061D3FA865967 ODVISELO8
529,716,151 *3622F5326851ACEB5E3AD44929DC38BADD816DAE [email protected]
529,716,152 *362730F807E0BF06FA2EA43AF7F85498D858304A MAKISUPA0
529,716,153 *3626B000A4799A527E44293DAE852F47023B0905 marcelojumonville
529,716,154 *362CA9226552A4B49670F1B718C8793E77B7CB00 MARCELO.MCCLATCHER
529,716,155 *36254BC1CA1C840B078C224A8216D358D6005C65 ongemunte
529,716,156 *362C7D73AB7180A5F7EE32D5B6335AD1A40218FB O->-<O~0~Q===3
529,716,157 *36230CE6C6EEAB4E1E96D014CF8949BDEA930226 }O{ O~ O~ DQ
529,716,158 *362BC5AD2272A36434504ADD04E06420D9C6680E OOSAKIHIROKOUJI
529,716,159 *36208C1A6EB3B593C3CC95C75D7175DC4CCE0DE4 MARKISITIČNIH
529,716,160 *362E823D063ABFC54EA318B6937A119A57C9B9F4 OPTIMIZATION-THEORY
529,716,161 *362FAB52EF4ECD0DECA8BF8001CB5D43C7E17F81 OQA8K9JE97
529,716,162 *362B8C37E874E7218308EDBFBB9D6D4BA01ED5E3 MARLON.SCHUYLER
529,716,163 *3624923386D92A0CC779D5E194A84A0BE18B65A9 MARQUISZAVALETA
529,716,164 *362844994600CC4CCB6FC8967ED9CD05922E8862 marsha.brennan
529,716,165 *362F2C00441EF5CE225D7B4F1B04F119048E89F1 MARTY.SHELTER
529,716,166 *3628765B137B4BEF36B8657BD3C3558D014985F5 matcaballero
529,716,167 *362E55143013CD8F1E41D630BA47A32D009BA409 MATT-MACCHI
529,716,168 *362CB696EF1CA44E46B2DA26AA9C7ABA9104A674 P0NT14CS
529,716,169 *362586B57E07B58A01A44B7CACF92472F00FF4B0 PABLOAISPURO
529,716,170 *362E9699936B7EB011297A824C029B301AE28FE6 MELANIE SISLER
529,716,171 *362B942893E0598500B51D1258437B3500ED2149 melmccollum
529,716,172 *362F9DF77B5C8ECDAD9BD6C6028875D66BA1AC20 palankins
529,716,173 *3624CC279E71D6DC863F50AF2F735987A1515C43 PARISSINOU
529,716,174 *3622AF187148F8375EA106012306D9A7CB9C0243 PARKBEDFORD
529,716,175 *362E26344C0D9666E641EFDAB2609AE6A52EB767 METSLEEKED
529,716,176 *362E80BCF7A709C64E5E5C163270E65384EB7C92 M*;F
529,716,177 *3629BA1D747B1066D88288488D6102FA3A10D0A8 [email protected]
529,716,178 *36292E0F066E3A199B9CD1780683894636E57EE4 MGJV*18
529,716,179 *362BD075C761150713CFB70D4FD292C9D4363A1B PATRICIA.STEPANIAN
529,716,180 *3622B7A809C9179FBAFFE75017DA2B4DAC680C10 MICHAL.BINK
529,716,181 *3620A6F4EC82919CA8FF19BF75A9E0AAA35A91E5 p###b~~~><
529,716,182 *362353A61FA16B0099716BB2D2C41904774F7C46 pdeliver1
529,716,183 *362A49C94D1D5FE18DC1424464AFFF4907FD27C0 PERRYKOUTRAS
529,716,184 *362257C0218DD09938A5E23D0D54AB9EB329EC77 PERRY.MALASPINA
529,716,185 *362E86081EECD3C2274F44821D3DD64195333545 MITCHELDEKORNE
529,716,186 *362EE08481A2D1D3E9025F085B13E0BB066E5E07 perversmų
529,716,187 *362334400C4F4DAC95A4F33F21458F2EF134CD99 PHILIP-GILLEY
529,716,188 *362DCD74AD91AF29DBFCE22C9A9A719912C980C3 phoby.
529,716,189 *36230B6B5D3B9D27AA686827175BCEB3A74FF0EB pitada.de.tabaco.(feat..carlinhos.brown)
529,716,190 *362A1ABD9CB178F2273BED50C93579F3C311A781 moonoy6
529,716,191 *362EBDB610ABA7375DB60B90B091EC5AF790D15B -platy a: platier platiest
529,716,192 *36250F4FB1464EE50901376728B94925DFF36B09 Plodge
529,716,193 *3621920CCD08FC811059C781636A6C4E7741880B p[n[
529,716,194 *3629D8DF83C7C2EA0F8C82E5BAF5B8EE7CE1CF07 MSPBOSSES
529,716,195 *3627FBB358BFB321FD3BAC736CA552D555B48A1F porfirioschumer
529,716,196 *3621D0C07078544D652240992B02CAAA9B477F28 [email protected]
529,716,197 *362C64EAEFD2F2BD2062D4D4DB76EA04095B9263 p======P-~0-~o->-B0
529,716,198 *362F40CFC61F9E06B3C652F9746FC17E37DDBAA7 P--P~0.SPLAT!
529,716,199 *362AA4FC02139EAA07813429B9E8E4E121023F3C myronschnader
529,716,200 *3622A6E80EF22A4029F498F9BEF47BAC0B9DDE04 MYRONVASSEUR
529,716,201 *36242D2F8E8BE34515930B0170595518C6BF470A MYSTICS
529,716,202 *36254F9C894BCECAC5B01F77B352BD1EF3EA9CA8 N{:)
529,716,203 *3624D274636F626E7FB80B04F803B11F7257FFAB preloadable
529,716,204 *362C655F7D1594B967E2D81D5A7E655A48BBCD7B nairtsabala
529,716,205 *3622128CF02EE9DD2ABABC8DCEF7A24AD114B786 prodejch8
529,716,206 *36232A70D2A6DECEB2F930A5DA76EC046DDEFEAD nasa[email protected]
529,716,207 *3629668D152BBA350C171F813E7442597CA9582A prosinec6
529,716,208 *3625B32FF15749300B2DFB820F50B9A62C9DF1E2 ncrrptly5
529,716,209 *3623167C76A4F2AA10272E0EA84AD981C80F2546 puppyz269
529,716,210 *362CB874E65AAC045B2E1751925903292E2E26E9 NELLY-BARRIOS
529,716,211 *36282CC4B23CC373687260CDC65864A9CA737171 nemadam3
529,716,212 *362E7267D57AE20DF186F722737E1A5746E8FBCD [email protected]
529,716,213 *362BA9954F0DECCE62C2EE187F52CA3E7ED2DB0A [email protected]
529,716,214 *36296800A302C4A9C116698AE93E8E9C19F3C438 [email protected]
529,716,215 *362D2FD54816DC6A0B85CD831919812EEDCFE130 Nexus.Starride
529,716,216 *3629FEEF8EB8BF5FB77C6D35E9C99F235772E051 NFEREAL
529,716,217 *3627EA7EF07A9E114E82EEBDD8EB5E933A405138 ngstclv5
529,716,218 *36209B8D04093E614F7F90A1D7EC7A43D047033B NICKEUSTACHE
529,716,219 *3627A1860122CE52BC21D85C9DCC9F9DF9601B0A nickrecktenwald
529,716,220 *36227B68A39E49D10B1830C20F73688FBFC8B8DD nigelbuggy
529,716,221 *362B38FB66293D3B9142422ABD3855071CF3D63F questionability5
529,716,222 *3621E7DC9EA026D8A1B8CACE1B8ABCA612D85FA8 NISSV
529,716,223 *362C215A9A0D14981A0EB0CE90C05B568ADB5831 @R80URED
529,716,224 *362F5A3A8913A0388CED2B93E8E15CDB572E3CFF NOCTURNENO.7,OP.27NO.1INCSHARPMINOR
529,716,225 *362AFFEF0DB318F6C5E26840F7E6D78EBE8B3E6F RAHAVOITTOANSA
529,716,226 *362DCE772E7C6B06C2423881446C136F8295CB62 RANDELLARRIZOLA
529,716,227 *3624DEBCF84C97B0044E7451988C3BFA3BB804CD RANDELLRANG
529,716,228 *362050B02353216DFE9D3B016853BCE9F1423293 norrissitto
529,716,229 *362CE5818FEEE294911253E1AAAFD0D96A422225 RANDY.MORSBERGER
529,716,230 *362E7B987B2D6DF34F51761CB460C3E8ACD19ED3 NOSEDIRY
529,716,231 *36290682683984AE77C033558E472D6F477D0D37 RANLLOIAAN
529,716,232 *3623BCBE2490AD8928D241ECC6E529D8DD2179F1 NOTEVOLMS
529,716,233 *3623BB489448F0E1AA4E67EDDE5A93A333D697EE NOTTOOHELPFUL
529,716,234 *362F3C548C42D1F9746205CD3DFBA8580545FAD8 nrngdnd6
529,716,235 *36280EF72615351AE431F4247346EDDE44279A4E N RUIZGIMENEZ
529,716,236 *362576DB46C8C9E89B88A471C5894CF8863FF089 nuit
529,716,237 *3624D9F237064322AF7D2557AD1AD9C613DF6D01 NWRINT
529,716,238 *362E61E03ACB5C9CF6AAD10041ABD7B0121A97DE }o{ [email protected]=q
529,716,239 *362033FED77352F04C83F9699D9B3BD279254761 RECORDのコンセプトは「ミュージシャンの視点に立ったレコーディング・ソフト
529,716,240 *362E47561941D062C67FCCE2AC369B6B6248C296 recurrentlayerneuralnetwork
529,716,241 *362F06618F78E5AF97BDD4675540064596B0FAA2 REFUGIOSCRITCHFIELD
529,716,242 *362D6398A8E9ADDE8339CD626238ECEBC8D52FD4 REGIERUNGSVERWAHRUNG
529,716,243 *362AAC437E9BA62A1AF1BECBFA1F7E29E2841319 [email protected]
529,716,244 *362EEB8F1AC1E9A2441D91CE0ACBD35E223EDC12 OLUWASEYI-JAMES
529,716,245 *3624EF106B0C5250D4E149018F56914434415361 RENDERT8
529,716,246 *362B2C03F51BED7D0BE657CB6682F470986DC22D REPOURVUE
529,716,247 *362058DB6453A057ADBE79FD91E78890C1F02C68 on.the.way.to.barnard's.star
529,716,248 *362FE45060C9F8943FACC0A4D190D3DEF27BEC9D REUBENHILDRED
529,716,249 *3620B415709E99C00ECA50FDA97BAB09B6A39B4B OPNONA7ED
529,716,250 *362EC9443308657F377BA0EC9556DF58887672B5 (O_)(===Q
529,716,251 *36217B46CE66E3F4F4B045349B4551CECB05FFAE REYRKESLIVS6
529,716,252 *3627FCE6750229AE0A333D6BF6CC208F98A834C2 [email protected]
529,716,253 *36217E21B0EAD3A10087B6D77D81F92992810AEC ORLANDOBOSTEL
529,716,254 *36242AC8CC9DED8BA67BC0486C2AA822EAE9F9BF rhettziemski
529,716,255 *36231A0271FD8307BF047C0210DDE93934F9159E RICHIEBOBSEINE
529,716,256 *3623AD9CAAB548CCC3E94775F8A447B3A3791043 RIGOBERTOSUKHRAM
529,716,257 *362D7AE6DDBE7CCA94990D8C6CB8BB73D8367731 RILEY.HEINEMEYER
529,716,258 *362EF1277AAC96EE3499406311B58D36036BFA17 OVERDRIVE4EVER
529,716,259 *3628C421509DFE56D18CAEFAD42097D3F3A96321 OVEREMULATED0
529,716,260 *3624EA1268DC90A3850F7F233E9F8B582103D7BA RISE UNDERGROUND
529,716,261 *362B404DC7CF64796EF36CB565213C70101FB743 RISYALEN
529,716,262 *362218FCC99B76FBDE8C1BEBF7E2FD4A0E43E394 [email protected]
529,716,263 *36257F62D425D68C4BF09C08B9A017F568AE259D RIUZBB
529,716,264 *3629AAEDCF9FFAD609AB0487A0E8A69077F41375 RMACBROCK
529,716,265 *362997C91A592DE2E7A1A771B3E0D81D804984AC RMCHEFFEY
529,716,266 *3625165FA44537312B4FC98898C71DA23A084FC5 ROBERTLITTLEDAVE
529,716,267 *3628958457CC6EC6826894D81A7A02475FD98067 PAAVILLISELLE
529,716,268 *36204076DF3D53784029D257B9734670213F7277 PABLOGENSON
529,716,269 *3626D01F05F7764AE0B05B46EAECE967AD63434B rockykaawa
529,716,270 *36252EDABD55B0E71A56349A9FBA8ED38AE131A1 RODOLFO.CASTREY
529,716,271 *36236F59C24B93C85D7F0078B6ADBA42D55E11D0 PANKAJ RAJKHOWA
529,716,272 *3621748740D8E4DF2D832B393939BE627C35FE9E paroles d'espoir
529,716,273 *362FE78F8E9A3D0D03675CC810DC514CD783D84C RONALD.ARCIOLA
529,716,274 *362DCE1F78E87FFD0158CFA37476E1561CBE6DB6 ronaldmcmullen
529,716,275 *362916B5278B1AA8E0DA15AA3603BA503461C4A4 [email protected]
529,716,276 *3623FB6E023F6EB746CF4AB670762F1ED7DEF3F6 ROSCOESCHOENEMAN
529,716,277 *36224F0733879DD632EECC778EC61B1693324454 PAUL.SAUTTER
529,716,278 *362197AF45457DB656E3D49D2955388E54E20CBA rosensteinbsw
529,716,279 *362D717E551AD0F48F069F9C4C7A2E4C4F9701AD ROSTENKOWSKIEGO
529,716,280 *3624FD7108F748EF22F29708A6B78B9D1AE283EC P----B~O-~O-SPLAT!!
529,716,281 *362E76BFD41A122DC169FB3AAB39C01D2B86FD28 PEDRO.KAETZEL
529,716,282 *3620741E8E8F7F6DDEB8E27C075F6F5641AF5257 [email protected]
529,716,283 *362ED4FAB97F6BD969FD785E45FF457554580642 PENSARAMS
529,716,284 *36231DBB0624D7DF741AD26A841C23FD4E04E88C PENZIONOV
529,716,285 *362D2277255A27F3048EAFCBC4E5F7017F3289B0 RUEBEN.CINCOTTA
529,716,286 *3624612F5E0A5B4174C4F7B24853A060EEC8A200 RUGRALIF
529,716,287 *362519AC7A614F759A3AEE86D5152E28B7B1D10D phi」,縮寫為hi
529,716,288 *362CC5A976B8EB9BD7E2C7CECF98BE6083C7214E PICOSPAN0
529,716,289 *362A697FDCD91E7CFDC2A09FF561A5C766678D3A PINGUICULA68
529,716,290 *3623A4F726520CD9D14AEE4B11A1AAAA8D6AA60B SADEYEDLADYOFTHELOWLIFE
529,716,291 *362BC7BF84100F95C3D24BDC39343D1DED5A4D5C SAETABICULING
529,716,292 *3620555D2C5252CA8410E76AE9F43EE2883643FB [email protected]
529,716,293 *362B06EA526CC4D793852C26E4D7F74AE92D5961 pllk
529,716,294 *362E0121EA40BA1BD4F94053B6E0AFFCC9F8F305 SAMMY.SANNER
529,716,295 *36287D8ECAA705E0580943201EC4FEF1427D5537 saniamishra
529,716,296 *362C9E861BFCEDDB41497886E4E1106DAEEBB8EE Power-of-the-Equality
529,716,297 *362ACBFE136FF96C6D9D5C6CD6983EAB3A8AEF65 SAULFUSS
529,716,298 *3621614B619A4CDF3910A72ED5F27BD43A20F9F3 PRINCHIUS
529,716,299 *362BAFA8CED46AB52736F06834F3764C956A0275 PRODUCTIEDEMONSTRATIES
529,716,300 *362FBE97AF571A22BD44F871E75C0DD963DFF765 SEAN.DEWEY
529,716,301 *362A1C0587E0612675D1005895216D1C48011AB0 PROVIDER.H
529,716,302 *3627A77E753BE9DA1013C8D04550C2F9097C7CC5 PSEUDO-GERMANIC
529,716,303 *362650D8E377DBBE69645DFC529C4DE8F066F545 pwN
529,716,304 *362898C9CD5B10F7E0F785493A170D5A8B5DDFD2 SETHGIANTS
529,716,305 *36201103F41EEBBE80A370A54FCA1CB89A786570 SETHZIONLEVIE
529,716,306 *3627C17B2C9ADD5D5AAE3ACBF5AB247F2BD952E3 [email protected]
529,716,307 *3621445C5E3C15B36A0F25012D9EBED40ECB74A8 q==d`~ `~ ><
529,716,308 *3624229679F676AB3B0883E595EC520BE6F02F3C q###d~~~(o_)
529,716,309 *362AE40BF07F8A89E7F4066F8173CFDFD8A8A3D1 [email protected]
529,716,310 *3622B6B89BD907622B3D826EE657CB34BBFFC001 [email protected]
529,716,311 *362A6790B0586022EE1B22A38F31E60880C9F36B [email protected]
529,716,312 *362BFC4F47F5D16DE3A9C49F57F70E3621EFC793 SHAKY.PUDDING
529,716,313 *36225607FC7AC32C1F8979E03C138EFA37AE86D5 qsb;
529,716,314 *36210111B37846A8299FCE132FFC1904AEF89F83 SHAWNABATES
529,716,315 *362EC833AD833A251ACB6623C1D32B14D109672C SHAYNE.HILLERUD
529,716,316 *36252ECB7F73AFEBE675884EF7590E3FE2CDE84E quinnjoshua
529,716,317 *362247EC9D917198DA778789EB8510B8DDCCFF80 QUINTINRANK
529,716,318 *36244149DBC8510CC7606969332BD9DC6ED426D2 QUINTONADELSON
529,716,319 *36223C2540AB913FA8F8FE444F8017600FFC9BF5 [email protected]
529,716,320 *3626002739AB7C4751545AF0F4B42A26B658650D she darks the sun
529,716,321 *362D2249A665E056E03FE9DF76FF10DFE332B2D9 shonanderlik
529,716,322 *36275EEA844B5B6EC22E98B4E72335112577D61E SHONRESNICK
529,716,323 *362C46D983A2AB1577F92318EC740B6DFBC19315 RANDALL LANCASTER
529,716,324 *36240CFFA273A88A367AC03518B0709E68A19776 RANDOLPHSTUMPFF
529,716,325 *3622A83508613A520C3C88A6A17729095604054C [email protected]
529,716,326 *3627629968A44DDB25634F585B6B946D839202DA SIDNEY.ADAMIS
529,716,327 *362683190DBAA2AD45A6526D8F5CD876F402E2DE SILBERSTIFT
529,716,328 *3628EF0EAC8EC4D121E4E94938E05A4A23733619 [email protected]
529,716,329 *362F2282778D45E41C250C252BF3EEAFD4E8E4E2 REBOTCOYKRAPS
529,716,330 *362A0A597A4FFD59F8953889CB6A0FE1AF43F4D0 RECLAMEDUMPS
529,716,331 *362664E8232183B4597E2774CB1F5742A2711586 RECOMISION
529,716,332 *362BEAF4D40EEA0DF3356E9621CB676B9A0CAD22 SKOVANCH4
529,716,333 *362C15EE2E7C442ABA39523A99B156298E7C53F8 REDIETIS7
529,716,334 *36212D1EC1EAD23EDAF5C0092752F345789A4317 SKWGUYLQNOCNPL
529,716,335 *362835E20112A43A5EED2AB980AC155F2CA12C96 SLEEPY.SCIENTIST.#1
529,716,336 *362C0F2C55531CB91BC19D548FD97DADEA013924 SLEKTENS1
529,716,337 *362EAA7B54C84EA593A11E3858F1B42884CC5C9F sltchcks
529,716,338 *3627DFD661BC8CCBBA437D6A7A79D1A4CBAF46FA REGGIESZCZEPKOWSKI
529,716,339 *36278F2F403A266B94F9ECE6610D28332D7095D1 REGIMENTALTA
529,716,340 *3628CA1F2E5345B88E6404913EB953DAB5685043 [email protected]
529,716,341 *362BB77719F642710222045906CAACE4B2E91109 .snirg-dna-strons-relxarT
529,716,342 *3621E8CD669887B0EEAFF2EE6D846540DA2EC2B2 snoresinrete
529,716,343 *3628FA008604A0AB86C8D6CC1E90048350DA7EEF RENEAKA7
529,716,344 *362D7B4FB92DDE16FE2B21085753BFDDDFC18E5A SOCIETAT DE CONSUM
529,716,345 *36254A5A69DF8CE219B889B82365B4F7D7BC0763 SOL.PIH
529,716,346 *3622A43941A16DA9FB237A58F70CF4A85A46DFEF SOLUOPOL0
529,716,347 *3627ACEDCB79AC21260DB64B4DA55B654A4D310A something else from the move
529,716,348 *362F5F8BA9DD3B1DD6F5BD54D225395B30D73313 SoundFX:Musical
529,716,349 *3620A3B8479F6F6E0330C1B1E7DDC4C4108A9D85 SPECIAL)」が存在する。
529,716,350 *362C903B013690914885C1D42E844697E06D6EC9 RICH.GRIGOREAS
529,716,351 *3629A4AC4DECBC71C9DF0428127CE8C6CCF8EE93 SPINNAN5
529,716,352 *3627C17768C28F76CB4BC3AD68D98F71817527DE rickgaglione
529,716,353 *3625E2DCAC1F9D020AA58DEC174F6544A921C2AC SPITTELSEN
529,716,354 *362C0ACA7E93A911CB54F1E2130ED4EE0F23EA2C riekie
529,716,355 *362489B5094CD7D41F3769E25918C3CD771CEE99 RIKE-LIEDER,-NR-17:-DER-G
529,716,356 *3626D3B1900678F39D0FE2BC8EC6DAEA1C4140DC RILEYCODER
529,716,357 *362B1261C13D64196BC1BC8EAA7064E48BC68322 SPREENBSW6
529,716,358 *362CCD76C45A844A844E3A4E21007DCFF96DEE92 srinu.losharam
529,716,359 *362836E15C100D3FEBFDBE554094B0284ED37E6C ROBIONUM
529,716,360 *362B6B99BA79DAC44A257B93A1D695069AEAE9C8 rockwellstreetboogie
529,716,361 *3620EA0ED101538C5148F50605BE3E8F562E5684 STAR TREK II THE WRATH OF KHAN (MAIN TITLE)
529,716,362 *362797538D94ABEAC11BE74FE3BA9827035546E2 steel.rods.bruise.butterflies
529,716,363 *3628E4BC9C1E60E40F3308A06980263E83EE188D rohrpostkleber
529,716,364 *36263E78B28468581D9E92BB47A28E5BD8CA9B6A ROLANDO.KINKLE
529,716,365 *36229DFAA1B7EDA7CE266DA8D1EFE1C8C9DC20F8 ROMAN.BERRAY
529,716,366 *362F1F5B55ACA6418D2F2E5252C4C877D9CF6EA2 STERLINGJANOWER
529,716,367 *3624EC1D4DB7069638800A00737B6005C7716D61 STICKGLANCEGLANCE2
529,716,368 *362CCE89B1DF4CF24DEE5AAB703A0312760E27D1 RONALD166
529,716,369 *362B8ACD31FB1B42BBFD58400B8FA76E7A22D5F9 RONALD.MCCALISTER
529,716,370 *36267A24E8E09758E8C159887583D1A1256C77B1 RONSHUMWAY
529,716,371 *362A7938E3E8333588A3DF0C9A5AC67018D5ECFB subhasri-vidya
529,716,372 *3621A779A3887D8E6926DBFA4052CB6DBFEC6A31 SUBIC8
529,716,373 *362D4445E43C314C67FCC705B8D8525CE9CE1724 [email protected]
529,716,374 *3629C4DC7209FE262976AC829A5D3AF190A5EEB9 RREJATUH0
529,716,375 *362B2A5E6655217E831EF4118B644E74DD485355 [email protected]
529,716,376 *362A18317787824524D6B9E883342E0F9E56E1BA RUBENSEIBERLING
529,716,377 *362B7BCEDFE708F79D18F88D7FB7C703F5E9A3B5 rühse
529,716,378 *36285E892F7FAA7E2BE0F43D7935966F76652B5E swatisamant
529,716,379 *36289F5257BA5D696000FD55B8C84CB47D8CA157 SAILINGBASF
529,716,380 *36202FABD428E45C06A43633E6327BD0D3FBBDF1 SALDARINI9
529,716,381 *362250438C9B3564670E133318116CC7C19790CA =-SALEY09
529,716,382 *362F50B776E8017DE568C3B8CF24B604B8E268CB SALVATOREWONNACOTT
529,716,383 *36255AC3FC46121BF3162111D01B2F8F9135C845 sal-vizcarra-schumm
529,716,384 *362C3F348F109064FF2C2D9D48AB16B167F3A683 TADZJIKIST
529,716,385 *362B7CA5FE283B7BC548537FC4255FB32366E93D SAMLIVSP1
529,716,386 *36224EFBF069465EB0ECBEE1D8EEF0CA297C2E12 taittiriyopanisadbhasyavartika
529,716,387 *3629F3F37570C24F503F266720A68AB360309DD0 tale4
529,716,388 *362B029339B2012A10670D7B59E15E34F1547678 TALKTEALY124
529,716,389 *3624BF15C2F6C0DB68DFB19FAE87D0301A09FF37 SANTOS.NODARSE
529,716,390 *362420B17EFAFE7258D9D2F33BC4CE0E9A7CE937 Tanz,Mephisto
529,716,391 *362D165E9BE979D4FCE88FDE8EB6D9261E901364 täydellisyysaksioma
529,716,392 *362787D6B99D0DF6557E9C1EF1FED431E4BD3013 TEJYVIETYHPORETEHBREHIJJAHDEEWFLUGEAGLA
529,716,393 *362E94DD903CC325E7D2FF65ECB4A37908D8B1AA SCINOMENMS
529,716,394 *362DF8C5A5CD6E1090A191034F4DD9860B96FB55 SCOTTALISAUSKAS
529,716,395 *362653F03193F291A5F6D6A083655A0281E82577 TEODOROSAFRON
529,716,396 *362345C32E31ACF9D9B49A2DACAF6B4E7EBC4F8F SDIVISOR6
529,716,397 *3628B42A3BB338436D2DB5B0A7447B738206A42B SEAMUS244
529,716,398 *36209D0A30E32022F931279264ABB0C4BBACDC5B test1groovy
529,716,399 *362F5BDF292C1BBCC0CE55359CF52A72C1819E8D SEGUE: SUNKEN DREAMS
529,716,400 *362FF80ACD2FA1351400B65059AE8D4B7A2D4A72 SÈPARATOR
529,716,401 *362C6E6B6EB56148406199E53B448C5F6CBED5AA The-7-Chakras
529,716,402 *362F8509792A0B204DFEDEC98F0F2B03BBF34C4F SEYEDMOSTAFAHOSSEINI
529,716,403 *362F2026EE2F4E58043BBAFC8A8D0CAC0A691DBE The.Hate.I.Create
529,716,404 *362726B36E3F46EEA57C66E3BB1A081002355741 SFAVILLASSIMO2
529,716,405 *362CFC78B8928AEE9022FE82E8039ED6BC3B20E9 THE-LEGEND-OF-LAPUTA
529,716,406 *3627A51994FB139268624BA494EFB698875FECEA [email protected]
529,716,407 *3629A2F61A8E197D44937791F08845A29F640AF0 shashidhar-pawar
529,716,408 *36256E865C8BB8D1A42ABAED5F9264C7A667F91B THE-SUNDAY-TIMES-EP
529,716,409 *362421B7B9DCD6DEB4AB584F2B5D4522AF769A2D SHEBALIBRARY
529,716,410 *362E2AE847FE31157DFE23EDE06A80C1DF802A20 shefat-baishakhi
529,716,411 *3624428BAF21D281177DF6652A2D3E7816A6060E thisisbigbrother
529,716,412 *362193BE12EE0D76CD5B54E6B16450125BC65166 thomasboers
529,716,413 *362F001E836A361069C516E9EF4BFBBAC303D9F6 She-Moved-Through-the-Fair-(long-version)
529,716,414 *36220B499E90DCD988493D9AC30841312F66E71A thorsena
529,716,415 *362F5C3E18E35EAE2E2BFC09DB41D116E7E2A552 sherry.knopp
529,716,416 *362CF7E275535374430FDC20C1B7F91EB4942573 SHOTGUNNIKI
529,716,417 *362683169CFB8E61D027F0B227EACC3926F128C7 TIMMCLANEY
529,716,418 *3620243AE51C0FA8CA3D85C27FD799017539BAF4 SIATTOLVES
529,716,419 *3625985F278ADD31C4B5FCAC8CC8D15AD9763B75 tin-fernandez
529,716,420 *36214BFCBF760E18E4B1E06CEFE9D1A8561C374F SID-PHILLIPS-&-HIS-BAND
529,716,421 *362C227E582E274B1832BCF4A0D21815E64F1D06 SIEMBRAS0
529,716,422 *362E7644806BA56D30D5ED9E51E978E8C0D49EAD [email protected]
529,716,423 *3622659A291DF4EE4EB63F859ADCFCF69241D34F SIMOS-CHARALAMBOUS
529,716,424 *36279490D57BCC1C05320426BB1ED9B5EB1A7840 todo-lo-miro
529,716,425 *362868DD8398364819A4B5BE843340930B51E5CD SITNACREM1
529,716,426 *36245C1879032E57A99EF5DEAE99B981552C2A80 [email protected]
529,716,427 *362F5A0FFB0AC41DDBDC500BCADBD7FB5537F61C to je fi
529,716,428 *362881C615BDDE2F6DCA2CAAE1A7EF1E35BECB3C tongues1
529,716,429 *362707A74A2C13CDDFE4E1ADBF6835C2873AD312 TORPEDOIHIN
529,716,430 *3625A8C3D35F0915BF0810FD62A41B8F134BDB11 TORY.MONTJOY
529,716,431 *3623DCBAC15F330F340079BC85DD3023E16BAF2D smallclothes.
529,716,432 *36256A1BBF2F1846FA3169B8C72AD8D057F4A577 SONDHEIMV
529,716,433 *3624F6147E1C6C1839D50E0FBFEC1C43A1181C2B spaghetterie
529,716,434 *362AA37AABD8D8E0853115A9B98ABD4168FA6FD0 SPENCERCREVIER
529,716,435 *36293D43019C518799FB91CE24A159EDE9D1A69A splat!~<###b
529,716,436 *362253C67CA563E70A0523B1C530D835107BBB4F TUTU.ABEL
529,716,437 *36239597F55852F2595339B06627EFF59B32CF4B twentyfif-ffo-generals
529,716,438 *362204034E93D3C75D30F67D2221917000AF23DE SRVCS<BR>DMNSTRTN(41CFRCH201)<P>
529,716,439 *3626001B3805D06BA5BC172719E8CCE5E0312868 SSENPMUJED
529,716,440 *3620D85300E5D6BA4DB88570BA289F411D3593BE SSOBK
529,716,441 *3627286395593E6CEDC226EDF3A01CB262BC2482 “STARÁLFUR”
529,716,442 *36268CDDA23148F2D14A33749A61E64DF4ABB4B6 udbundeting
529,716,443 *3629A47E2B4EC708E7E26473F103853C3B609A2F STEPHANIE-KLING
529,716,444 *362872B54D803BA3D36389A7067C39CAC363C2BE STEPHEN.LACHIATTO
529,716,445 *362DBCB12F157F7AA9AC99F7F78A0D3EBF2273E3 stephen':'(spreadshandoverhisbaldinghead)'wigs'r'us!
529,716,446 *36205E7D739799D15B6520824AB185C3288092FB [email protected]
529,716,447 *36285E85A1D054AB2D17CC7CA053342FB0E31E06 STEPHTOXIC
529,716,448 *362112C3C937A02F557BB6E3E99BB46B00C3D94E UMAIRA.IBRAHIM
529,716,449 *362E52A72D9CB45DD03DD7EB85B16E9ABA109CFA STEVE.TAPIO
529,716,450 *3624D307123AC8FB75B325C88C4D55309A8976F5 stevielip
529,716,451 *362363A0287AF88225AA87E8D68F9BE81D8EF8BD UNHAND
529,716,452 *362D0F5C651934782690A01BD66E7EBFED0BE846 STRAPPADO0
529,716,453 *3625D157B0DF055870210B0B175C9117025119F2 suillage5
529,716,454 *362DC9B68B3B5D189F06D225C972E780491989AD SUNGEWALT
529,716,455 *36249BAC63FD15473609FD7B5B0D7E1D0E4E55E2 SUNROOFEXPRESSNETSUNROOFEXPRESS
529,716,456 *36283F4CDD26B3555422E6FFBB4D33DD4A4D0F8F [email protected]
529,716,457 *3626B1FEAE0E7CE6FAF27AA49DD4B25C748D3B84 [email protected]
529,716,458 *3625C9B01B3FD7C7D2BC266FEE2035A612F4FCA5 UYSONSENO
529,716,459 *362B6C6BE8EFA4C4ADB4AC6074ECD4C46AC58872 SUTNIUQBSW3
529,716,460 *362E6C516EB05B043A1BAB4D2C2514B34D3909DD SUURYAAVITIS
529,716,461 *3627457289A1A7D562939AED93B902C3136B7701 [email protected]
529,716,462 *362C2951F754F551B40DF3853E2679EFBB2C901C VAKLAHXES
529,716,463 *362772C8C3248E9651B54365DE6780FDDFF5004A VAL.MULLALLY
529,716,464 *362148F6C20CA6DE7646B8EEAC1C67454493A8C9 VANCE.WOODMORE
529,716,465 *362BA3CCA1BEECDB035958531568117EC9927D3C VANESSA{
529,716,466 *362AB684C60C92EBA962DF193AB6674A9F0107D2 VENANCIO ROBLES RENTERIA
529,716,467 *3623BC470197D6E93A839F28FC9763ED22BF7A2B VENECIJIETIŠKAME
529,716,468 *36266504CDE0BBBE6DDC39D0E0D29F9F061C508C TAIWANJOHNSON
529,716,469 *36280BA420F1AD2AB69E4F2686E5E09C42648B89 vermontdonald
529,716,470 *362C325467A21BC1B14574F6CDBB4D122CA744EA VERTISHC
529,716,471 *362A4815ECAD5DF1F074FA938D94CA50251164E7 verzegde
529,716,472 *36240F58831BA7B8E4C8950AD24D794C53CE54F3 VICTOR HINOJOZA
529,716,473 *362481BE15CBAE36398A5ED63C637A0B3642E1D0 tard3n0i$
529,716,474 *36212F2179B0A3614FB0C898B86E8805449D1CCA villanofar
529,716,475 *3620347DB28B13E99CFF95CDE181D9DB79F674AC TDT?
529,716,476 *362DFD55150746D4EA1550AC9FDE80697C49DB0B TEQUILACHICAGO2
529,716,477 *3621AF693E5CEDD98235B5A7914D832C5785DE19 terenceclaridge
529,716,478 *3622E264F8A1304CE80A0E7D355891F822D03ADE vlado.la
529,716,479 *362738AEE74502C47D0E4D090ABD15A379A1D53F vlet
529,716,480 *362445056EECAB8ED124BB405AFE7C634BCB131A THATCHICO77
529,716,481 *362D7D098B357A9D6ED89556EE94FDCF1A781BFE VRIDNINGENS2
529,716,482 *3623FE67DA94B9ED62A0D141DED93F52126187D9 thebigchicken
529,716,483 *3624A1FDF12516E9BA7742A14CDF934DF75397A6 WALIFANYWA2
529,716,484 *3627B4CE5CE2315B1A3C67F348DBB543022C6E10 WALTON.VAIS
529,716,485 *362B1E4DABAD71301EEA7BA43EB989062D09A318 THESHERWOODRING
529,716,486 *362D37AE1EFA824AB1CA4D9BB2A00C508648E83C THESHOTGUN123
529,716,487 *362DF256C7F050BB6C375835CFC3C0DB2B3B4AEA WARNER.DONOHUE
529,716,488 *362955B3D9C1243FFB82E312DD2B79761F4862D4 WASIAMAJEED
529,716,489 *3625D32BFCD30761A08EA3D2F7A990E423929BEA Water.purslane
529,716,490 *362537E2E37D9AF9FB141D9BC4B3F0B62C98D316 WAYBACK
529,716,491 *3625562CDA62AF8F491F1DE89E80F1669E2882FA [email protected]
529,716,492 *3620B6F6148BA832610A235C5018463815F43F77 tilhacer
529,716,493 *362DACD2AA7CCD6A9F65941AA2D2224E12E49524 TIMMERDENS5
529,716,494 *36243B1E5D81EC34B823F3456C369E5CD82B30A7 timmycarey
529,716,495 *362E6F38A6C9820141E8A8743474FEE7EABD1437 wendellensey
529,716,496 *3623340AEB36ABBA36F6A7D7979D502CD5908B77 WENDY.CIEUTAT.WAYLAND.SMITH
529,716,497 *3624A8E58ADB916C4EE44BC3C3D40E20CEFDC683 WENDY COULLING
529,716,498 *362A62DDF45AB66007DDAA153C33650BCBE02914 TINANEWLIN
529,716,499 *362066E39CCBEEFF85F29DD437B3EDB5824E1C97 wendy-sypher-banker
529,716,500 *3628D4D05692DD031EE082B2935174D612556081 TISHIKIGS
529,716,501 *362C0C8B494E52820F3CC3E3225BB57CDD48E6AD TITANKRONOS
529,716,502 *362DB58CAAEE229DC31C98DFE01540905A4BBA31 TMYMEMO6
529,716,503 *362BF86CED6A8380798ADB4C8750F60FDB35027E wesleyastheimer
529,716,504 *362CD3400C2CF44BB0465664138DDCEDB2310ABB TO.BE.IN.LOVE.(MJ.COLE.VOCAL.MIX).(FEAT..INDIA)
529,716,505 *36287B07700B42EFED4EF9F7CF87800C97F8CF26 [email protected]
529,716,506 *362CBCEB18BF16F9F9ABBC460A16AB98ABE98244 TOBYKANAI
529,716,507 *362DCDFEAA7EF5E05A3076D6496E45BB8076017F TODAYFROGSING
529,716,508 *36224D2F9B895E86CB3699D993991047764DCBA6 TODDKENNAUGH
529,716,509 *362B5C67E1CEF0A07E927540B5A22AA109D7C5E1 [when discussing courgettes]' "i like sweating my courgettes
529,716,510 *36266F828CA013FB0452DC38E01B0E1854A6ABBC TOMMIERAMSY
529,716,511 *3624E11255D4CD9604442C634D711BC414C984E0 WIKIMAPII
529,716,512 *362CE2863C6C5948305C2F720C276EDB9436DB83 willardshelly
529,716,513 *362DB0119262FB803D3D7E27DB3F5119B1A36377 WILLIAM.LAURIANO
529,716,514 *3623E8C0F5BC5BFB0051CE152D43D7066E9C5011 TOWN.39
529,716,515 *36253B9F7B521E6FDDA7C484E325C5550DCB0DD8 WILLIAMWINARDI
529,716,516 *3627C2EFA6D4D8793F217316605D455162AA7275 williefavaloro
529,716,517 *36230A4A39ADD3F1AE556610B499A801F5AA596B trafegoed
529,716,518 *362C769D3C978F4B60B9736D6C3A9FF5840B47AB WINFRED.MOZNETT
529,716,519 *362CB952616B8BED9D163967415CD49F8235C21C [email protected]
529,716,520 *3620AE38333FA50FD49296F8EE6D6ADFF3FD020D WINSTON.STONEBRAKER
529,716,521 *36293FEDA3207CB394836C957A4E8EB5BEC2BCCE tremaine-elliot
529,716,522 *362EC6C8C9FBD141350AC39D3664AA03D5AF4AF5 TRENTOROCHENA
529,716,523 *362DE268862AD8E6CFAB877C61D1FDBE3FFC79AB treurmarchens
529,716,524 *3628B00637B664FCB7051130AFE512091463A107 treygodinez
529,716,525 *362895B7DC01399938D3A67D652AA31FF82AD5E3 WMANGER
529,716,526 *36220C2788EEEF0602C549FC99934407D3BE08CC [email protected]
529,716,527 *3626A8BB2229583FAA5CFF97AFE748335A4F5826 Trio.Sonata.in.F.minor.TWV.42:.f2.-.Largo
529,716,528 *3629BD8C1B846746305CE9FE74B1D7F75FD7B77C TRIPSINA4
529,716,529 *362D41A0E130291673D91FBC26C221E5F5EC7E35 troydeatrich
529,716,530 *3625878458D8C225E6BF79F3F1B092676B914B29 TSESOPMOC
529,716,531 *362EF435F05DC4F6EE440F4152A156F74D3E9E0A tucamoraes
529,716,532 *362147D25016A864D9A6EC2CEC0F47C8405BF693 TUONGDUNG.LE
529,716,533 *362841BCF91AD5692AA4EE46F93FCC1C8A797B6F turkeyhazel
529,716,534 *3623EA2B87DF4CBC6970AB758D5EC062C85C03E0 [email protected]
529,716,535 *362CF9984EE930200FFC5A8D2DA6383F17ECE463 X1PHOCOST4L
529,716,536 *362B938C63FFCD564E45530B1938D706267B317C tvuacuk
529,716,537 *3622E4DA437FBF069D08B61568CEB1D8D32CAF99 X+F&P5
529,716,538 *3620615FD71001E74E9AD19C4FC066B682E4E853 [email protected]
529,716,539 *362ABF539B6696B7ED594A2CB19440110BD566EB TY.PANA
529,716,540 *36292DF9A813CEB8CC8EAE93D5D4AB73AF65B647 XNKO
529,716,541 *3621F12291CCFECF8A506A919821809B93144644 XSEXIBABY55X
529,716,542 *362C81FE6B52867649C78D893EA6810B331DEF7A XYFK
529,716,543 *362F9690F29508836A6437BC3616F2B4730C8C92 UMAGOYA3
529,716,544 *362C91C1889238FC442421DEE28E01A959100A06 yashvika-ghai
529,716,545 *362C2C1A87E8559F2B7CE36164D3419F9DEDCF45 universalmusicaustralia
529,716,546 *36297BF59EADD617DC0875190C49477F0DACE1CA [email protected]
529,716,547 *36220C642B4C34E7B17160B4037B78F9295AB617 ykhvdlo4
529,716,548 *362BD8B60167C2A0A67C59211B762B499C2FA183 ustionato
529,716,549 *362042F70A3ADE4253C1A0E4877A7115B6AAD9CE UTERQUES
529,716,550 *3626E43EC5CE1F9032FE81E57CBDA8E201791F56 [email protected]
529,716,551 *3623631DBF2C1EB17D36E627987BADB1378CE3FD yungkia7
529,716,552 *3620C2F44D8B98A0EEEBE4146A9ED56C04800224 zahid-naveed
529,716,553 *362445EFDCA12870EF0B45DA4415723003602877 ZAHRA.GAFFAR
529,716,554 *36229E5E2657568FF541D9641D221B29C24776D6 zaius-goulet
529,716,555 *362E4F2483B94EB3FA7276AC53749F582658A601 ZANE.AMMERMAN
529,716,556 *3627F8CCD121280D324A2E81086EA1E98CD20DD6 ZAPOWIADAJACA8
529,716,557 *3625B93EA5DF945C839CA5B76FFA6E602024CC07 [email protected]
529,716,558 *362F6E6BA0430B315D09D398EF8F1ABE033AD99A VelhoParente
529,716,559 *362CE9C83806D505349B09877EF237EF57F23ED0 VERNON.THREATT
529,716,560 *362E2B7639FD1D95E2DB1F6DCCAFDCC34C2C22B8 VEXSICCATE
529,716,561 *3623A226B255D95902FBA8A3CDB4658957BC1C8C vgjournalists
529,716,562 *362B0F88B746379CEF47B7600800DBFA6A1449B7 VICKPOLATIAN
529,716,563 *36254500751C7CF3FC97E0C85C0476476517BBBA ZINKSALZE
529,716,564 *362E74FC1E19CA9F31531B7DBCA434B9DEF1C9DA ŽIVLJIH
529,716,565 *3627450A565B1B97F0A5C546C2FDF0EA7579E6EB victorwareing
529,716,566 *3628BEF4D47E19ECAFDED2ACAC194E52D6D01999 ZUBIYA NAZ
529,716,567 *3621950F19E20684E8DBB948E61D013EFBEFAB62 VIOLATIVE4
529,716,568 *362B6297626ECB30F7740010C95A60B2E62D86E1 vivien.maunders
529,716,569 *362E6E9043F2C7383929EFB724A4B39ACBAE7336 ἀμαθὰρ
529,716,570 *3620307A58D18CAA1AA8D6395E6201C1402F5D03 VOETENSCHRAPPERSESED
529,716,571 *362B985B77F89B0A36C33EBA8830E519B158C01A χριστὲ
529,716,572 *3625794082B283502AEC83246523D71616141D31 белянские
529,716,573 *36285692F26608DD0530E68CE5CDCE50A7D6DDF9 ГОСТВИЦКИЕ
529,716,574 *3626E424B074BBBD71ABBA17901EAF1793AF5C08 WAFEEKJAMEL
529,716,575 *362BD4AB613593FEE61976065F9AD8B4EF182F12 лимирски
529,716,576 *36252D1E66326892A8A6554F7D1204845353BB28 [email protected]
529,716,577 *36216AA736509309B5ADD3E4C26E92B9147E6B87 НИМ“»
529,716,578 *362899AEAC9290E1D14E7C3A8FFC692099F00503 WALSHAU02
529,716,579 *362FEEFDE9A264AF891C89F0AE90ABA3369A7F7D WARDBERRETTI
529,716,580 *362FB4A2D9D791D7751B70FA25B7FBF5580D6518 wardgribben
529,716,581 *3621EB7001BD0E0D5BD4D7E84362B7C70E2CB89C ТАРАЩЕНЪКО
529,716,582 *3627824BC66A34F3B97A34647F6D1D327AB50B81 wasifaliali
529,716,583 *3626E9E1BAE20CD032F11B41EAD27A2D60A61FE1 watschenbäumen
529,716,584 *362D7558BD4D77577B10DBC39CD1C7367CC1C94E WBULJAN
529,716,585 *362CC3848A8F22C6A4A8649DAC2B3C6F9F9E3D99 バリ以外の場所も溶かすため、大きなバリ(MAX
529,716,586 *36215622E61A9683A76DCBBE32283351EE021D90 wendy.cal
529,716,587 *362B85EA38E74D4D4E1F0049B0DB51BE01E43798 協力:化石オートバイ SUNDAY TAKE
529,716,588 *362FA629A420870A6EB645280573D5454E7C023F からの履歴継承の無い移動コピペ。GFDL違反の虞。
529,716,589 *362786B83A3C7B6034FA52C0DB3FC4420B72A87A wilbertbleichner
529,716,590 *3621DA63BB199EF7AAA3FE328073CEF4864168B4 wilfordbutz
529,716,591 *36252580C0FD71A8CE04864BCFBE6BEFE75915FE WILFREDO.MARKIN
529,716,592 *362DAA54F820F18B134C25CF56B19686FC7BFF54 第4回サタデーナイトパーティー討論会を記念して制作したSHOGOの特製カード。
529,716,593 *36273108051104766F69668D089552544525B083 WILLIS.BESLEY
529,716,594 *3622FA6D1610413398B50DF74922BB2076C26DBC wilsonblazek
529,716,595 *36250446CF46967D640E81885089A7FD2E79CF35 wimb
529,716,596 *362D5537CF730FD7B3400D4B527BDD421FC7BFA8 [email protected]
529,716,597 *362687041FFC8FFDE5798EA1C3BEDB43BD4A9437 [email protected]
529,716,598 *362C3F962055ACAD3C8F89641CBFB199D823CCA5 WWWORIGINALPANCAKEHOUSECOM
529,716,599 *362C3098F9F0D5955E42E69783AAF91EE099D558 wwwslantedrecordscom
529,716,600 *3628179F674B6666FFD8382A7EF38B0DD10678F6 XENICA.LOPEZ
529,716,601 *362B608FE0255A462DBCEB4608E83AAF2A69BE09 XFRDBLZZRD
529,716,602 *3624DE409EC492524D61DF7806D046FAF9803C74 [email protected]
529,716,603 *3628D7B44DAE9A1B369B972BEDF57DABC10F792E [email protected]
529,716,604 *36241D9B90FE6D8339FC19AF51A27DA9B216C8CF [email protected]
529,716,605 *36244756840DC96578A0CAA0D74D7EE14D8E4B04 X%N%W
529,716,606 *3625A9B6F0E61B8405E991F1E5B69867823D54EB }X{o~0~.d---B
529,716,607 *36283D1593A17A828033C2E0DE8E385A4BFBB041 0200000000akr20100725025900074
529,716,608 *362B78F88A2C8D918B9DD9BCC5D84F46DCA0042B 1129 М
529,716,609 *3627E31B0AF1A0D948361CE05FD45DBD4056A4AD 1170866 " WE WERE DELUGED WITH CALLS FROM TRAVEL AGENTS
529,716,610 *36295FDBF763EF9AE0409702958BA6316D8834EE YEHEYASHARAF
529,716,611 *362165176505A60CD405FC15BC3BBD62BC66B9D5 YENSKY.BELLO
529,716,612 *362A50D3476D766DFE9FAFD70671BD73F8F64393 yeoh-chai-hong
529,716,613 *362D1C3368686E2409D2538080EE7A0B993DDD2B yessi-silviani
529,716,614 *362742D0B9403DC713CF54B888A1F8D97EEBB66B 12311165
529,716,615 *362B8D0035869C62D36DA8147DB1B1983F2FBF19 139JASIAH
529,716,616 *362446C7D76FA0123BC6A53DCE7DD3DC8BE117C9 141340 kuoroa johtaa jarmo kukkonen ja s
529,716,617 *36262E74ADB0494404577705CDC2CE0ABE126C8E YNR15638
529,716,618 *3627DC452BFC70A06C6BB7D5EF95AD72C44B768D 15KOKONAISTY
529,716,619 *3626F88D0953FB4DF4001F1C0F150244BC856F3C 15nov1550
529,716,620 *362ED918259550891C55B262FCD9A86A980DB5D6 1775564 itse-h
529,716,621 *36235BE7111E075C076C495E6920554C3D344976 YRARBILNOITAGIVELGNILEVELNEEKYDNAD
529,716,622 *3625A68D46DEA28398E011758E4B2794EC546261 YRUMRRDO1
529,716,623 *362D7DCAE11DA75E5F22AF789CE7771B5B7956F9 YULARNADYKES
529,716,624 *362B62FEF73D11AACC2207A89EA5A3C866187765 YUVAN-REDDY
529,716,625 *362E86B73CAA20F5D107E245D94B677529C37E30 1ABORRED
529,716,626 *362701CF72F8893B857A746457E6DB42A472E745 1apte
529,716,627 *362ECBDDFF64043E30CCCE32AF91870CB63D7913 ZABEZPEITS
529,716,628 *362BF21FF3A95131D76BA524171D283D2A05F56B 1bekaemfpung
529,716,629 *362EC94DD732AAED75814C1E1BB7F0C608C004E7 1.CUVALLARIN
529,716,630 *3629981EB6B19B528630DBB03BD011DC6CDB2183 zak.lawton
529,716,631 *3623203D951BD6F68CFC60C8473D235CEADD553D [email protected]
529,716,632 *362D701F07D37A498C2743E97F104EA60BB950EA ZHANGXIAOHENG
529,716,633 *362AAE4AD51BAF0BBBC0196C90B77C4168BE4C6B [email protected]
529,716,634 *362B46F9A5EAEE27BF4A2040F6063B7B50215861 1-KAUPUNGINVAALTUUSTO
529,716,635 *36280E04F9E79C3A3AC6E4D0D8C986465C08956A 1-lehtikojujen
529,716,636 *36283A14955DB0A3A2BE30AE46FD7EAB7F4E4519 ZIDRIGNOVPAGARA
529,716,637 *362034B18636F78C92BFC8EB2C3BA73A4A316F72 [email protected]
529,716,638 *362FBD0E06422266063AE7085542BCDB9F289A81 1muovikermit
529,716,639 *3624545D87A1689B0B184614AA46A3C720E94D12 zoetouma
529,716,640 *362A564820049C8CF8E9B36F5A443CC88F0C198D ZOMBIESPEEDIED
529,716,641 *362BA2DB0CD06B3FD2A9B066BA5F4E710D936C2F 1.NON-VERBAALISESTA
529,716,642 *36240507581DDDA68E2AA1785521BD3677CC0993 1 oelfuerlebensmittelabkommen
529,716,643 *362CAADA3F557B7C2F624EFD808BFE37A440AEFB ZVEJOŠANA
529,716,644 *3628E7B7305C293BD6B6D367B32A8DFE05DC3875 zyad.troy
529,716,645 *362D4512BA38998B23DDAC8814A8B9A955A54D98 1STEET
529,716,646 *362E7D2302BD9EB4A193BF08E68EC8C0A9CD84C8 ΛΑΓΑΊΩ
529,716,647 *3625BCFEA679F0165C6833374432BB827A1B0735 БЕСКУРНИКОВА
529,716,648 *3626ECE089A5F365AAABAA7354538A692D66DF92 1wacken1
529,716,649 *362A863350BBDB94EC2387480537937019FDA701 ГОЖНЕЯ
529,716,650 *362DE18182BA5637E3506E2DAE046CC406019A79 2010984 MARTY BEKLAUT KIRK , BESCHIMPFT IHN ALS WEICHEI .
529,716,651 *362439CE4513DEB69A6E043F6239D011B34162B9 2311579 MEGENGURG.KUMOSI.MY
529,716,652 *3627D33EB496CD2A7E0F0163D3CBAA75F4640CC4 233.EINDEUTIGEN
529,716,653 *362197B6F86E61D90FD8CEE6D69BDE9C5B46479D 2525666 ENSI.MAALISKUUSSA.VEIKKA.RETKIKUNTINEEN.L
529,716,654 *3625E41781F50F856854F658BE98B44529810C02 2539944 sollteeresreuigraeumen?
529,716,655 *362C317364AEF3D1654C2278683826ED9311C21B плегман
529,716,656 *3622C4AC79A1CFCC3CC654035E9925FA94F66ACD розгон
529,716,657 *362A23816B379F147DD368A912920E3D3B0C5CEA старушкі
529,716,658 *362C94BD90D5AA0364A4405C4500D52C7780CD3F ТОТ ЖЕ
529,716,659 *36224BE81F632B715B8BD7F340AB2E34C40E3B4A 2.bildernder
529,716,660 *3622D259977B2C9B755AC514FA0C5BA5B9DB85A2 2boersenzeit
529,716,661 *3625F61A1EDD7D1CBA954618086C8BB9582D0296 2-ESITT
529,716,662 *362BEF56F915EBFCCF0339ED74683F9DC37237B5 2finanztv
529,716,663 *3626DFB99247C498CC314CAA6C0AE84FBB6E18A4 2GOTDUOTN
529,716,664 *362AA75F62677434DA05CDF993F938D647EF4ECF 2.nidder-seemenbach
529,716,665 *362EAF5C1813DF3DDBF907728EA3155EF9D604F8 ,张靓颖发行首张个人专辑《THE
529,716,666 *3628973379A6A5853491A75EE0FE55DF1189CC1E 3.1.4.LiFeCYCLeaSSuRaNCe 6
529,716,667 *3626865B6620496EE7ADFE2FB46F7CFF20A16E6C 389228671X
529,716,668 *36298DDFDDED9B3C16BDA9957E9AAB64C4B07810 3AQMMTHA
529,716,669 *36239CE6DA2DBE36A0F3B69110C528B19045DD51 3.AUKIOLO-AIKOINA
529,716,670 *362EDE210243686E53F8DA132D32EFC51A0709FE 自動腳踏鈸(AUTO
529,716,671 *362A620802E30AF2932551117666CB86CF160EF9 3december1663
529,716,672 *362E7C6259A4CB1AAFE2892C998A8FE88B5B7444 3d.~}o{
529,716,673 *36290C763A71A3622A6142B2F3D7C4744B2DFE26 [email protected]`~ `~:P
529,716,674 *3628002253414396BD125F189B8B93D72FCFBEE4 3####p*.*.3B<-
529,716,675 *3623641DB5C1975B4CFAD190F7EE4B116ABB1064 3PROMETNE
529,716,676 *3626F448563B6C21D5873E83E7B6118496870596 3->~ ` SPLAT
529,716,677 *362105B37CC046A1459414634499B0847990A489 0MYANNE6
529,716,678 *362F58F4353B400A0C2CD337CDB001D89D6970C5 (0_<)[email protected]
529,716,679 *362A8380457578457961D72B8147A284D4E01190 3-VETERINERI
529,716,680 *3622454FEC73DC26A3C40DE1FC679C929C968888 0PBYGGELS
529,716,681 *3620602063D24BD244FA504848D9E884FDB57CB5 420704 JATKOSUUNNITTELUSSA.JA.TOTEUTUKSESSA.ON.EDELLEEN.PYRITT
529,716,682 *36210D8914CC90D6A869E03B6F440B849D17E33B 4.BEUVE-MERY
529,716,683 *36247F28F51E42A84EC947F16F214F4B45D3E3B8 1286215 WAS-EMPFINDEN-SIE-,-WENN-SIE-DAS-HOEREN-UND-LESEN-?
529,716,684 *36252988E327448E4C929B8F1AE1D64E64F29AD2 4MAROKANCA
529,716,685 *3623403CCAF9BFFE8633CAFDE6EFD24674B75C28 157938 andereleuteverreistenerzogum.
529,716,686 *3621F3D99460DB68214A5262EAE8A30C4F6BE0B5 4REECILPXE
529,716,687 *362411EC4B1827143769621C4E2356363D4D2244 4SHANTYEN
529,716,688 *36240FF666BC3BEA840C10D38FE39CC3B964E5B1 1802755 normalfarming,ranchingandforestryareexempt.
529,716,689 *36213FF06272E286BB0B6745DEC7012F27BD8BAD 4theknoll
529,716,690 *3620425BEE0A22FA40BC2D5E11977D8B5BAC9B41 1CADASIL-HENKIL
529,716,691 *362965DE7346AC4A40507A13C75F7DFADC2914CE 5ASSIMILARIA
529,716,692 *362384CCD79C20B3FFE50BC87A3FC6817571A3E8 1 DEGENEROITUNEEKSI
529,716,693 *3621CEB7C3F3A949D56A4FFC6FF8480BDE56A104 1DIENSTBETRIEBES
529,716,694 *36297FA29B81F861AAA7A40E0B19B98D4D063A58 5BUCK8
529,716,695 *362F8815DC57246051B2273EE02C164F60684958 1.HAITI-MED
529,716,696 *36288AEB5D8454D5A465E68B4282A7DB64D91479 5GONGDOORBELLFIRE
529,716,697 *362976E110B570031C51C4495C513A7E5AB28AF1 5HORIZONTALTOP
529,716,698 *362577C091977CB91C05095D1C608D335F855CDA 5KLEINGEL
529,716,699 *3628B348EB02BF6F3C3688E76680630C44F5B2E0 1.kivisalmenkatu
529,716,700 *36275EB2522B234177FF3033A6C0C593A5C6A27B 5LADDIEPOOKIE
529,716,701 *3621A0115FE10E00ED2F96FD1F59172E2FADFF56 5 luottamushenkil
529,716,702 *362EBD11FB30423DDA239274D4F2348327195751 1macintoshk
529,716,703 *3628CEB9BF2D93D4A4F2BFFF37669AD9E1A9E294 [email protected]
529,716,704 *362F96D1D805ED90A5230817EB75BAD59B8CFA22 5RATUSZNIK
529,716,705 *36275C3A6950E8AEC8DA342A4138279ADFA0295B 1natural-seeming
529,716,706 *3626D4917370BA3A0D153F40B0992D13155515DE 1.NOTSOTHINLY
529,716,707 *36289071907447C0CE21BF956628A18C9E2C5C76 1-PANKKILUOKITUKSILLA
529,716,708 *3620F1FC3E84A257C1BBD4813713202BB5D9ECD9 5SPRKWRD
529,716,709 *36251490B72EE0F77D6BF260DF6FEA08E0207B9F 1.PHOTOTECHNIKSHOW
529,716,710 *3628BF7176EC16A228352C39085316C718F58EE8 1RALUNALP
529,716,711 *362C299F0BE1D09CFF845DC4FD148B5016ADF1B6 1.selbstmordpreisende
529,716,712 *36255E257804A03F5C09596A6C6C45C6DB9C6235 1synkronointitavat
529,716,713 *362FA998549504620D5847ED905F437E27A8F79B 688248 erdogdu.,.yesim..
529,716,714 *36275F546B9956FAA55CE38FEF8F15DECEA6B230 68D8A7B6-A0C2-3E54-9D06-A8D6A1EE1457
529,716,715 *362954996E3F40A0300484C36630926F878EC961 1 TEORIANAKAAN
529,716,716 *362AFB1AE4D22A1F86BF443E52FF0DA0BA5435A1 6BUNDGRNSERNE
529,716,717 *36232875E1E783A243BD2598EA9EDACD688CFB85 6DETROITCASSIE
529,716,718 *3624FB3505FEDB8ABC51266B5341A150FEC98A5E 2008560 VANHOJENKASVIENS
529,716,719 *3622B0F582B08C2770618904B23567D23F6C58DF 6iamclaire1
529,716,720 *362D6D2D1EA7E5A15117914746616FA5DD98225E 2107078 TVMAKSUHALLINTOKER
529,716,721 *362D608F24E2888310FFA181879CA5DB94D47A00 6LETSROBTIU
529,716,722 *362D5A44B0A87B0BDAAC569758409D48E8EC98AF 2143768 VIRHE---ERROR-404-VIRHE---ERROR-404-SIVUA-EI-L
529,716,723 *3628AD06235F7F058CFC3D45800A44C57C4FCC18 6PRESELJAVAO
529,716,724 *3620D73D8286056AD251927BD46651FA7FEC21B0 2465313 IT-CANCELED-"-BABES-"-AND-"-AGAINST-THE-LAW--"
529,716,725 *362A87187A4D65B3693E2DCB26E9CF23A6926C81 6.YATIRIMCISI
529,716,726 *362CD41988B6DB8597E0AC0DC4A96D9D9E028FCC 6YRAUTPMU
529,716,727 *362DE89105CA8EFB0E8FFD8711DED4E4BA3FE897 7021583
529,716,728 *362FCB9F22F80BE383FB0D76958CDA1841E8EC9D !2712ac
529,716,729 *362EC2FBB89A67A0C5A9AD021F16B4CDFEBD9D37 2937872 consider-the-new-york-city-bond-sale-in-june-
529,716,730 *362DCA90D77D7EA4FF09E7FB90D38EC9AA6AB2B1 7ERATRAUQ
529,716,731 *3624A63C1F6ABB11DE34DA85889D5F2C1D324BE7 7ERKSNNIU
529,716,732 *36253707A0B8A3B7801065CE964095446CB7ABFD 7ESTEEMABLE
529,716,733 *36220D2EDE4C4347485AF308C4C24BC3B64AC053 2.chogyam
529,716,734 *362A8D6FB1EE9126293D2A3EE95A4981F273247C 2DIMERAL
529,716,735 *3624FFBB08A662BE4D374DF2886FB0709EFECD8F 7IALONGO
529,716,736 *362782110F40AD962D4E00FA1746B4A1E5DD9466 2.hisayuki
529,716,737 *36236770529DE6DEDB5B756AC01BD72EFF3C75D4 2-KATTOVAURION
529,716,738 *362CC83D2E4FC0C95647591A02FBD18D71299A85 7NKDNMHNX
529,716,739 *36227971BEE6F4E9BE3FBBA8C0158D8F50B0A07D 7plastikkugeln
529,716,740 *3623C2487671DA08B6226D179F331162D72BEF34 2-olabileceginden
529,716,741 *362F45677A9A76BA45579879DCF8447273574D4C 7RDARGBSW
529,716,742 *362605B0D3D51E50F816A96097348624B587716E 2S18
529,716,743 *36227B059197CBEF0D7A49D51C622A1478599228 814POIUYTREW
529,716,744 *3629DEF768D415F7EA6DE363EE956D3495BC47CD 821181 STAKESISSA-HANKKEESTA-VASTAA-KEHITT
529,716,745 *36229672CB1FEF66433614458A16EDE69DAD69EA 33.point-scoring
529,716,746 *36276087F6BCD8CF8CB89A87DCCBBB274A5ABE32 }8{*(####b
529,716,747 *3623FAAB64EB96965D130B08A37ACB28476FED8F 3===d`(><)
529,716,748 *3624CDC38F6117CDA764F631AAA13C224FE02444 3ILOVECHRIST
529,716,749 *362B428E7419062E034F82308E0CFF88860DF068 8IHLEJCMPC
529,716,750 *36223FF9AC04D740F06629E7B78B1308C0187083 3###@~O-Splat!!
529,716,751 *3624CF37444722D56409A7F8033773F8ECA5F0C5 3====p~0.~o)0(
529,716,752 *36259E4CC5FD03A2CD8F7FEB88541714F447894C 8NRETTUMD
529,716,753 *362DF7C8D888A7F18301EE61EDF294EA2670B5DC 3zebulon
529,716,754 *36239A3AE931EB434C8DDD513DB491B55046351A 4ASSENOM
529,716,755 *36287A1A86542217CF6DDBF9C4431A99C909CA39 4EFFLUVI
529,716,756 *362C7A8CBDECCA98694B1A3AE980C63BED8FE767 8TVERCOVM
529,716,757 *36227E2BE7A44BBA1AF93B768E128C43775E3AA8 4IAMWAYNE14
529,716,758 *362FB606CEDD5DFC923D815FA0B468B20409ED54 97VJ
529,716,759 *3625F7FE22AF27751D1300EE0390E637D37D3B08 4R1M4SP14N
529,716,760 *362DEDBACA211DBF8FBA23A6DDD5223069D9A2CC 4SCHUPPENDE
529,716,761 *362A268717FFC0497474E3785FB2CA87ED4297C3 4SHUTTYNGE
529,716,762 *362D19BCF1D38B02E0EFD5A9AA6A38C5056D4885 9FUCKMETEDDY
529,716,763 *362BC940D735B297A6C1E91E39000E8116E27A7D 9HANDELSKAMMERTAGS
529,716,764 *3621C29F6D666B39A486C80B7C435F95EB07A183 9KASIRAN
529,716,765 *362D9C9A5B06025B808445A238351D952DE39B4B 9MASTENTOPPEN
529,716,766 *362B92EECFEED513D7A35753C84E4E97C9D9AF48 9OG1XIE9GL
529,716,767 *362B6303FA4EC9C57DAA6353E1B51DF2CF03953D 5683wolf
529,716,768 *362EA895DF68190D5AFEED16F1A0FA58C2E50495 9SEBAZTIA
529,716,769 *362524DB0C34E873A4F518B6D308BFA75B7747AC 9shipments
529,716,770 *36223610574ED9D186BB576373FD044E4A127228 A06=V
529,716,771 *362C242CFC92466F8086C9392A249DAB99C2FCC5 5iamhammer4
529,716,772 *36260FD58B098731A73EDF0A7C99A5B60DE932DC 5OVERSKIRTSLEDSLEIGHSLIDDERSLIDESLIDE
529,716,773 *3626989E9B36B7C3255DAD6E40D4F116DFC0E44A a!63n
529,716,774 *362827ED185A0FAF9BDA1A37274E38650E9BFCF6 5TASSOFT
529,716,775 *362CA9379AD6630B40659A638A5E46FC565E8F18 6071337
529,716,776 *36247659D32213EB0426974C7C9B229607EDECEF aaaml?
529,716,777 *362806E41436AEB1283BE57B51A84176EA56D7A9 6BELLCITY
529,716,778 *3622D9DCEF1850CAFC87C3FFD9C25461C4EB669D AAC<"(
529,716,779 *362772F6A37FF347BDF2191E557765D4ED74E983 6cardioids
529,716,780 *3623C35CA93162F723ADA88CED1474BDCA041B57 6GROGGIE
529,716,781 *3626BC21A49E6398EF41702B55704458DFABDC54 6HOMEOPATIE
529,716,782 *362D6FD54D0AA189E0CD67E54CA469A4A3B93E5F aamurukos
529,716,783 *36239B9A15CF08B8884B36A99F26351E8D4D6180 AANMATAANMATED
529,716,784 *3628A3EA7F2D927839D7926D7883CA71D1444641 AARONBACY
529,716,785 *3624843854085A544F2DEE519F31DDCD9944A496 6LOSSIGHEDENS
529,716,786 *362AC6327220EDD4636292390AA916062C70EC89 aassb
529,716,787 *3628A9AF345FD244830B3353D1B7A0D001A47065 abg;,
529,716,788 *3621649F52C4F8A879029DA9BCDD043C58BA3020 6UNGENUEGSAMEM
529,716,789 *362701CC44ED7B60381EF69B785553307BEA36ED (6XAAA
529,716,790 *36267CDA5828E7231B3FF013CD5B2341C8FBEEDC ACCOSTASSI
529,716,791 *362740EBE25DDA2497DEAFAF28D1E677C208720B 729aldo
529,716,792 *362EE1569DD5D21712D6F33B6EF3349647F14B02 7ADAMPOPEYE
529,716,793 *362C5C6621FD32AF8F85B51D1950C9D5CE24652D a day in the girl's life
529,716,794 *362612D4CB3C909636473339006AF981E0AD6D54 adrdx
529,716,795 *3627A7255CE8820C6275463C12FF05F83A8892B9 7KULMAISTA
529,716,796 *362B2980DB7087B0C265933C182CA47FCE5F41BD ae6um
529,716,797 *36267DE241C891C467B76274C25A3043A50C9D80 7NNTRLCKD
529,716,798 *362A4CEB58EFDE9F4DD95BB33EF2BF4C3F3CE12A 7PANORAMIQUERS
529,716,799 *362725A4B4A60C288BA34765C41099373829F03A 7PLHROFORIAKA
529,716,800 *3626F85342D7F51B3E6B44E980B3A0EA4BF8547D 7POOJARI
529,716,801 *362959BFCEC1CBEE8A2171F8EEE0453FEEA82F34 7PRUDOVA
529,716,802 *3622AA5B7C1F32016D122E074D5B0497DA655D08 A))FE
529,716,803 *3620AA699C095030EAE3CF8470A1C5AEF2FA2F19 7UTAHIIN
529,716,804 *3620CDD14B82B8E9D1CC31BA6122AB845FEC935A AG\F
529,716,805 *362DD6F9EDA8C9645BED2B10F7B91697240769D9 (~_^)***<---8
529,716,806 *362705764DC2694676E17D483FA7FF377B9497BF AHT+B
529,716,807 *362A578050D3CC25D1653EDD43C3070757EB82A4 AIXIG
529,716,808 *362360A32283B22ADB6D26146F1385D6A8B9F409 AKKD5
529,716,809 *3625F5584C6C98F268BE5E9CE221967D5A605F66 8HISOWNPERSON
529,716,810 *362C43670DDC7583B72EDF1476480520AD77F68E alainadrias
529,716,811 *36280DEE9CEA0A89CD35E4015E9EBDC72665673A 8MARCELPASCAL
529,716,812 *3626EAF8DDAB56E06D89A7245D326A739229E88A 8MAUGERMOMPNBS
529,716,813 *36220CC31CB50A09716E363F3FD0FEBDD05C3D84 aldeneskin
529,716,814 *362FF50ADC5AFD889241AAC465EB4355A9C620AD 8==)~o.~o.3b<
529,716,815 *362381623381E68795F827E14917A1C19D47343D )8([email protected]
529,716,816 *362544083822EB59C4AD83ACF6F32D1C44F5F2AE ali.gooding
529,716,817 *3624CCC92EC05BD188F1CCAA8447CC7B1277BBFF alix2589
529,716,818 *3624DD8BFF562D2D79EB81F576EB0D7D1D31904D 8UGRADILE
529,716,819 *3622EB89BF2A086C81626A47DF537A95C2AB134C ALLISHON
529,716,820 *3622A58DEB9F7622D3E05C283101F7F129C4DBA4 915CASH
529,716,821 *362B262A5600C0E68B1C3899BF7F0857962A528B 955083 DENILEBILIR.KI..
529,716,822 *3629A1355872453D8B5ABBD10AE6E9209473668A 992571 MILLETVEKILI SECILEBILMEK ICIN BUTUN YOLLAR DENENIYOR .
529,716,823 *36262DD215EF4625F728EF2F22DE79DE4F761625 ALYSSA.BRAILSFORD
529,716,824 *362F6E2F8860727DA7437946503558CA187D00B2 AMBER.IVIE
529,716,825 *362B6F52C017A273D6CF8F591C457F75810A3709 amc8%
529,716,826 *36285B67079924FD6E51DD7BAB0E7C6CA702606B 9FOREPREDICAMENT
529,716,827 *362AFC6A143CB8C1A87B2F0DCE885C5C27ED6446 AMOS.VENTRONE
529,716,828 *362E66261171513DCC5A49ACBF0C22E7F804EACB amp0000000000020692
529,716,829 *362CB07D4A82BB8CD1F0A5F496F1A661AC8A7BC9 9NIINMULO
529,716,830 *36203CB5FFED56204400CCF50921130950E31FA4 ANDREA.WOOL
529,716,831 *36237F950B9C8946E967AA7B779B1D787AAA7B78 andrew-gouche
529,716,832 *3621A4BA8D8B451F595C499E5891A556B7E20F1A 9SCOOTERDONKEY
529,716,833 *362B3019ADBC2042ABE092D13CF6CB60AA2568C3 9SNEREBEOK
529,716,834 *362180E70857936FD0523A675123774D44791D8D 9UNBACKTE
529,716,835 *3621878009732B1F7B099FEEEDC664AA13AFB597 9unhumanitarian
529,716,836 *362AA8B5F958434E406DAE9CF1201F3B5DB2C0ED a0i_u
529,716,837 *3625B251AEA9B34D18F792B70D5187B3A550E150 antoniobyles
529,716,838 *36299BA8BF78ED9B5F1956DB4F0846FC9F499E11 anx7i
529,716,839 *362FB29F6995F8D3FD895AD76E08D295B1E652F8 A6I?W
529,716,840 *36280E580A6DB8CBB9AAD229A55CBB38188B6FD5 A7R:4
529,716,841 *36257F48C6E58E5DAB3661B5C9B0985E95304538 aa(#
529,716,842 *36269CE493ADF815FCCE7CD4BDBC279C66029FD5 AQ3NP
529,716,843 *36275966285E1C3F824742789DEE8C75DB17FCA0 ARCHIEFERRANDO
529,716,844 *362554D7ED0E76C1F6F609B5338ABD68BAABF519 ARCHIVE_OPTIONS
529,716,845 *36209DB5ABE30E0F180047AE485FA9A4837256BD aabhi0
529,716,846 *362CBBF1838031E71640E8C7D20E2A780863CDF2 ARMEY
529,716,847 *362A5834B4686BF9BD5337E3C3652EA40E10AAD8 AADWZ!
529,716,848 *362F41F2F75D5B59223A4746267E39D3173639D7 AAMQZ
529,716,849 *36223DB6687DC177BB586780AEEEE74B4D8EB0CB ABCBEAGLE7
529,716,850 *3624B9A00F5C909BF3EFAB64BCEAB7DC53B24EA4 ABJBT
529,716,851 *362BA2315002B773CB760A5301CD1AA236A13D64 ATHLITIKADIGEST
529,716,852 *362D669362373A0FE6E186A679662667228799C0 au$7ra1an
529,716,853 *362D10BA66F67886686F548AF45E61EFDCAB5371 A#C$K
529,716,854 *3623F38F1E452D75F346926EC40CB2C3178CE9EB ADM1$$AB1L17Y
529,716,855 *36212072C86B5B6F2AD199FFAECC79E5DCBD300D AZ#VX
529,716,856 *36271DD710FAB132E918FE1C3457C33068C456A6 aglianoterme
529,716,857 *36210F3A0954ECF36D86B8DAF7B57806B3CC61F7 ag!wr
529,716,858 *3622908C7111DC886122C430839F50A7BFC7BD2A b%9y)
529,716,859 *36285BE5E743E7364B220AE2F0CDFAD19DCC4104 b+a1w
529,716,860 *362F2CE2E9734FCF40DB43639E86593B00EEA66E a-_j4
529,716,861 *3624DD9E476EEEB718D3144A4225DDD9BEA93A94 AJEAD
529,716,862 *362C695C8EB0439A7AD211CC8B4D10EFAB9E7493 AKGW8
529,716,863 *362B5E6FCD6D5CAF5969321A6AB75007E7DA5D1E BARBREY3
529,716,864 *362F349FDACD549387880AD4298BE31F2B18C316 barijugo4
529,716,865 *3622CF7D4564F4304EBC9CA057859631486189F8 BART.ATTARD
529,716,866 *3621A6F2F01FF707A5037F28488D87B80678A583 [email protected]
529,716,867 *3625DCB267F9B9933B9A38CB69F24F63ED737790 alecbeckem
529,716,868 *362505480C33CEEBDEC976206743A6AA7C52B93A BATZ20007
529,716,869 *362B1C5B1FC1CC7C3B19A3E56DFD4F4962A66215 BBKUY
529,716,870 *362CBB8F0DAA301BDA0143F63D2B50200EA2DD7B BB.~.`Sploit
529,716,871 *36263206E91DD4B23B6EB31C44470B089CCB5808 b#ctg
529,716,872 *36226E8C0AFC76528A0FA156E2C9AB66954DECFF b#&d8
529,716,873 *36241F8FB920811483097FB82997BDD8217EC7B8 be1ez
529,716,874 *362DCFBC9BC6CAD65642FBE26B1CE6686F53007B BENECRUDELE
529,716,875 *3624FEE7FBFF6674ABB8F11DE418E35521590083 AMOS.CANONICO
529,716,876 *362C6E9226AF46421066AAF283D4EED9A2D65660 AMRJV
529,716,877 *3629F2E2A163E4880FB180B4C48811D3A6ED7CB2 ANALYTICAL GIVEN TO GETTING DETAILS
529,716,878 *3623620074F94869DD252E6111A848E459AE7475 ANC5
529,716,879 *3628BC901D97DB0488940F5DBF93D8244E107843 andrei-kadar
529,716,880 *3621214197EF04B5C77895B6E4484DB7F4B847CC BETTY.FRIEDAN
529,716,881 *3623588F11A57D8BE6889655BA0A019EAB9B37DE [email protected]
529,716,882 *362CFCE751C57A25BD697A2711105374F9A6366E beverley.jacob
529,716,883 *3624CF8FA560A3D7BC80D380A68ADEA534FAB16F and-still-i-persistcom
529,716,884 *362611C772FBDFA4E6AE24F552C6D11F25E6886F A NEW PURPOSE :30
529,716,885 *362CFC90CC7F694FBC0879CF054BFDFDB51026D6 B(FK5
529,716,886 *3626D1ABDF071AE2447595A59D428FE521BB12B7 BGf+
529,716,887 *362DF592A1DC99FE37F58A5B0100260220381418 BH4G.
529,716,888 *362CAC5F9392E2834FDF541D5B3A891CD3978A4F biannual.citation
529,716,889 *362A64A378956B5B14E106D6CBAF603950412BFD BIJTERTJES0
529,716,890 *36230DCDE84569951F1985D6BB60EE1749A2F3B5 BJU9C
529,716,891 *362BC680B5736DF67AF68522F01374FF7D10AEAB bktv;
529,716,892 *362EF12F1C86E6A79CC3F0DD65C3E3FA30B722BB BLASPHEMIE-KUNST
529,716,893 *362E3C0A41B3D0ACB01BCE250FA37A2B54804296 AQWB-
529,716,894 *362E57F1F82634D8EF3A51C51AA29C4CB40BECF6 ARAMIYO
529,716,895 *36296A10A4937F49AAB64D7EBB9572B8E5EB352E AR=DK
529,716,896 *362C07A3A5D51BA345E6C3963CFC8C7B35AD338B bmd!d
529,716,897 *362FB8B9CEE4511106FFE16B415D9AAB56C8DDE6 b?$nd
529,716,898 *3622EC735EA1EE1B309094C9B0E4A765D2A60BF3 BNPSK
529,716,899 *3623378ABEB8656B833B7C4ABB2C53B5A9EA5326 BNYO!
529,716,900 *3625C11CC0F2DBAB83FFBC95A8C03E01AA821DD8 bogx
529,716,901 *3621722CCAD7C0916AC610E67B7D566A53461AD1 [email protected]
529,716,902 *3626CBC9374A8515DDD03A8A954415B0C6D2FD99 atenuou
529,716,903 *362916CEF039ABE108804D37FDCB47604CE6AB93 BQBV)
529,716,904 *362A3B09B23905878CA19189C13A6011C4A87CA5 BRET.CASIAS
529,716,905 *36287077BF3358ACD86D7906DA7418D277C678A9 AVENHASLHOS
529,716,906 *3622295759588D13F548BFA6C740969FFAAF4DE7 BRIANKERSEY
529,716,907 *362B48C27DA87534F3D55FC119DAE841F471EA91 BRIAN.KORTH
529,716,908 *36296B76339C4A1EA6400D67C6351FDD51E0D0E6 brianna-martino
529,716,909 *362AA955C7D0350F0A8DEC339EE54549DD16D742 A;VY9
529,716,910 *3623F9893B638EFDA8AA3E0E6C598309018DD889 BROCK.TEI
529,716,911 *3621ED95DB73061C47FFA21649002105D9EB593C BROOKEWIGGINS
529,716,912 *3624C4F67FE9B4607B044AB765027683350828A8 BROOKSDECECCO
529,716,913 *362F2D5B824D738C6EDC729C5364122B2F0F8B22 ax1.?
529,716,914 *3620BADD6B8DE2F2244E73CCA78182B839CFEDEB AXOUG
529,716,915 *3626B9C709E999F2D01950316F5BC0DD5D3DC056 BRYANTSPEROS
529,716,916 *3623FDA666A7B4B4191901218E428EA1DDBF8201 AYORTUH
529,716,917 *3620C785FF1662548433A37B176A36E6E26C1F24 a_zc&
529,716,918 *362F395729DE776DAD08576D35179A85B9CE1BDA ^!b>
529,716,919 *362D2C1EDEE4BF91EB504FA1FB58EEF11EADDC3E b#0cn
529,716,920 *362AF983AE78BBD59FE7D750F560DDF67C0D1294 b2=
529,716,921 *36231C4FE7AD25998CB9C89DBBBF670985171C5A BURTON.SINKEY
529,716,922 *3621655D12CC0CC8956FDB1EEF332349FCE9C8E2 b6!k7
529,716,923 *36276933FF69FCFFE796E2699B4BFB0FBD5C6492 buttonnose(live)
529,716,924 *362AC5550F13C9E2FB24C2B4DF1230E2C028E671 BA551N3T5
529,716,925 *36272F9A3331109B512E3C406FA7ACCAC95BA95D BAD,
529,716,926 *362679499A62C8B626B3C6D4B3430E4C989792B5 c#&:_
529,716,927 *362CF3351AEAC418B89981DD88268F4724E1EAA1 BARATOVITGRUPPE
529,716,928 *362E180D5A9F15D60672563E954BA1641C5F42FB c0n$ecrat1ng
529,716,929 *362DE9D0F3583B6394FD8C1E20E815CB38EAB52C b;&b
529,716,930 *362A638C9622435654A91B151370D414E199D88C C4SW5
529,716,931 *36234319D3B6D0DEB3E984875D7FA42EE49B29DE bbta
529,716,932 *362E40AE702DEFB8051EBF0C52C7A42BA004F392 bdmb:
529,716,933 *362A2E69D7DEBAFDA0CB1E524FE1FF3ACA49971B beauponter
529,716,934 *3627A878A910E876D8BED4F1DF1EDAFBA19D759B BECKY.GARNETT
529,716,935 *362AB0AA065BFD3B18D555698CB5148C3501451A befeoll5
529,716,936 *3628CCA0AD7391006B1EE9196BF76E439289A9BA CAN'TTURNBACKYEARS
529,716,937 *362082F90A6B240601D604A415AFFC583D605478 BENNIE.BEHRENDT
529,716,938 *362DDC4036ECA1194442B8A73BD63F6200E72656 BERNHARDWEINEKOETTER
529,716,939 *362B16836FE48A2729CF82B9D6F47539754D79ED berryconsolazio
529,716,940 *3625E9119A30C4158C4DCF9494F332CF1FEFEA22 BESUCHT”
529,716,941 *36229537C50B98BCB2E847FD5A75900B690F7D61 carrollblinka
529,716,942 *362B5C462B6131337D5EF8AD054E0B0F6399400C CARROLL.KITCHELL
529,716,943 *3625C7AA6C024A16B3222765CDD057CC9EF0BFFB carrollzatarain
529,716,944 *362A681077759C766A8B63CF39F9588106696B12 beware the fly
529,716,945 *36223D279A2C6FDEF314D6328B204AEDA673DA0C BFNUVFI3
529,716,946 *3622596D1B57D9BB49894B5037B25B5FBA6229A7 caz#
529,716,947 *36276124EB9A88DED45B23AF5705CF5FDB728C8C C{DJ
529,716,948 *362C89AB7C4E0576AA9266D9492B1C209DD0E260 cechs-rugbystyle-headgear-passes-the-fas-safety-test
529,716,949 *362610F64C919DCE074F6991551284AAB639A031 BivP
529,716,950 *3628872EF8A264B98F3E7042B549199918018370 c;e=w
529,716,951 *3621529CCE45E62064DC259618FFDF2B5B875D0B BLLJB
529,716,952 *362770A5ADC80210E1677E38CD7038CF6FA35E97 BLUESNO.16
529,716,953 *362D65A692CDDD26B9632617CFC9BD462CC42024 CHARLESHULTS
529,716,954 *362FC6136DEC2E52CCC8E6D3229F475D1206B444 CHARLIECLIFT
529,716,955 *36217EAB47136FF279CD67808F6E325E4B75972B [email protected]
529,716,956 *362C68F2FA11BC38C82D016A27B44ADFCEB29771 chasevanwyk
529,716,957 *362B8285D01C2D9D41C8830DD320720A33EC24AD CHEALA1982
529,716,958 *3622785912C9BA4A931057195F791E2D9914CE09 [email protected]
529,716,959 *3629B3265E56234898165614F5AAFAA8A7DFB41E bobumbalough
529,716,960 *3621332B33BB8FCA5FDB352996F7CEF115F927E4 CHESTER.WILLIAMA
529,716,961 *3621F72225F88C66F9F01FA6C9DE12780CB25C93 CHETSCHWANDT
529,716,962 *3625569D1DFEAF5129D85D17198EBAB280E73B9E CHIABWOOTR
529,716,963 *3628B6BEE5F4480DFDA8046A7D3C62F5324412AC CHICKANAHM
529,716,964 *36263A3DC12A119FB604B4870021C2AC837945BD CHILDRENSBEDS.ORGCHILDRENSBEDS
529,716,965 *3621284C0317A3EC51EFE4ADCF574BB2AAA9A7C3 china.mountain.zhang
529,716,966 *362F72400723F6E7C561BAD9DC7D13B1D6D475A9 BONNEVIV2
529,716,967 *3623E9AE5D0E9091215F822BCDE836FC11B572B7 [email protected]
529,716,968 *362F67F217CDE7A0BDD91E40AC56850C746A5B9B christawessel
529,716,969 *362FE065313EBDF0DDA9E3E33A8B28BE2FB58F41 CHRISTINE.SUAREZ
529,716,970 *362AEA361AEBD2A554E64B9DB5FF183EA632D0F9 bp?ft
529,716,971 *362AB61871E332E60E1E81C3BAF3B8B96E965923 CHUHSKZES
529,716,972 *3624C20B3F43859E0AB5726ED5EAA95323A07823 BQO-M
529,716,973 *36220296AED255CB7069B838372B5E0DF94F8F8A circumsinous3
529,716,974 *3623E10C422867B85C07EA6CBD082DC1F10347E7 CIWJB
529,716,975 *362B0177D506A06BB3F7B95E0D667448518E0B15 CJE6N
529,716,976 *3628E0CF7E2161F6B365A4057F6E9140E89201C2 CLARENCE.DREWNIAK
529,716,977 *36222DCE555FF8981DD73ACFF3B840B1A3E406E2 [email protected]
529,716,978 *362103F932F5B295C2CC2B0CC8D3A4611A8AF5FA BRIDGETRUMPET
529,716,979 *36262FE395BD710D1DDF9EFFBF8FBCFF2127E016 [email protected]
529,716,980 *362B3B4D2CE7967E80922353F06A7AB4EBC7D7E2 close-but-not-quien
529,716,981 *362C6F920632F202C441CB2AF3E0A60ADA99725F CL)WR
529,716,982 *362B8456D38A7A981089D77552BF3D2F2A485441 cm_h.
529,716,983 *3628D8F75E0475300DD4A8760A2B2B3D17014AB2 BSWSFGETFILEBSW
529,716,984 *362E3CC2383B3DFAACB9C7AD1813346E05806BBD BT"DO
529,716,985 *362A4C3730D1331887E7037781C895F2A4B322F4 COD.U
529,716,986 *362DAD623D96214E48F4B9BBAA0066D6DD15C870 [email protected]
529,716,987 *362709575A64D420E51D5C339F8DDDE3FE64C9BC cold-turkey-(live)
529,716,988 *36266A314C24444E5B8CDEAA2EC52ACF188183E1 BUNNU3
529,716,989 *362BF56890963B7EB43B21635DEAFD84B0535897 BURL.FORRES
529,716,990 *3620A0A40D8CF36A56166E1A254CAD877C939114 COLOURABLY7
529,716,991 *362D81EECD854B76968791FF3653D4C06BB2F84A COMMENM
529,716,992 *362CAB64F662D2D56A116CDBC1D90E7B38DB6203 bv!bi
529,716,993 *362261980104EBA399E9AF404AED465D3CB83B2F bzk9k
529,716,994 *3629E01EED7EC9206002E758E0C6EBFC3F0D27A9 C:\Program-Files\Business-Objects\Common\28\SSChart\3D-View-Angles\Square083da
529,716,995 *362D0DA127D8ECB06703F197B288F86A7A754617 C:\PROGRAM FILES\COMMON FILES\ADOBE\HELP\EN_US\PHOTOSHOP\110\WSB0D89F96-4755-44DF-8969-B9E8A9BC5EE8AHTML
529,716,996 *3628D02498E7F0DE617A7A2B56EF7D55B9239894 cqd)8
529,716,997 *362DC0784DF9FE9E49CF219D6BAAF05E990E6D9E [email protected]
529,716,998 *3621F9888BAD1CA6A914BB210E615FEF0CED7B63 Cr;"
529,716,999 *3622D0089F4B39D75B4E301010D04627D6ADEFE6 c=7fl
529,717,000 *3625AAFE28B55A1F61D3A3D30E62C72AE6882B85 C7XQB
529,717,001 *362C9F2D3CF616EE00DE62F6F3D572A4ECFF415B C%=A8
529,717,002 *3621267CCB8871A2A59D2056E2DDAB217D5D1D5D caleb-lovett
529,717,003 *3628DCD4E8D7EE33D2A4049677BDBBD25565BDD7 c%svo
529,717,004 *3627194C3B691F82E055563F59B1BFE233C053FA cameron'scapers
529,717,005 *362A03F5557FD19ECCB4093A47956365FD87DDBB CANTAME0
529,717,006 *36235BC6BBC7FE80CC3496A911AEA36024315CE8 Carlos-Arturo
529,717,007 *362D17C62FE28EA0D8FCE9024A72A33A1E76D67D CARLOSWALTMAN
529,717,008 *3628A998F4434563E9F19992DA72D73EEB80DB6B CAROL.STIEL
529,717,009 *36276AF405B518E906A75EB94062C78CF8537F82 c#vvv
529,717,010 *3627D0D2A25FDF0659A2DAA7FCBB7E912E5ACC45 CASIOHORNETS
529,717,011 *36236EFADA6AA87FCF8A2CD6E71C946AF3AB7886 CYRANOABCD1234
529,717,012 *362D6753CF34DAB3A964BBB381D684055FDACFA7 CBZD
529,717,013 *3625FC4D4346EF7386F692613C11B1B9981EA5AF cc#r;
529,717,014 *3628E63A9C083FB25E496F0DB3E6F7299B19FBE2 c%dc!
529,717,015 *36288937A4342FB6EC20FCDF4DDD3DCB7A61D733 D342250
529,717,016 *3626F8AF9690C50438DD2A7483F432925D2267E8 CELESTECOFFEE
529,717,017 *36295B6C56B19876B103335FDDB5775F127BCA21 ceratorhine8
529,717,018 *362CA6A344063F1C7CC1C38D15D8AF951B0C5789 DA_IY
529,717,019 *362335E9EEAC4EAC52D4F01905184D8DA7995995 danaemberlin
529,717,020 *362478882FBAE871974E1EFB299282F02DCF7A0C CHARLIE.LONZO
529,717,021 *362D0090E8DDC01772E2274584D762AE0D443964 CHARLIESMYNTEK
529,717,022 *362ADF6F7B8D6A08C047735F82811CF8607878C8 CHAUCHING0
529,717,023 *3622B1C8A66B04A1A53E507ED3125B2DE4BBF99C DANNY.BILBY
529,717,024 *362C292E7C77876C875B52BFDE35A21F36A6C78D ch(ec
529,717,025 *362E14045B43ACAF3A326CA6F3E9E6934FFF90A6 DAREN.AUTERY
529,717,026 *3621BBDC281589C7A272F576C91648F3E5012176 chfdk
529,717,027 *3626A7FAC0E78B621482F0D99B1E981125ACBD0F chis$
529,717,028 *3620994D6F83A950683A883AB2F5282334726B3E DAY MORAN
529,717,029 *362DBD7423962D9BBF610B871D807D3B30F55343 christopherrussotto
529,717,030 *3621D119391F55111BF94C800B9C62992FE6A929 DBRK0
529,717,031 *362B5510F63540D2C14272B0802F8679B2F9DB6F CINDYSTRODE
529,717,032 *362FECA873971FF76BF3276192809AFC0C9B46AC ci;o7
529,717,033 *36235FD23C34501DB47C89A5A670C01966329CDD DDUDUDADA
529,717,034 *362D4E7F3599EB64F06CC8EFD18CBD9193E9ED2D DD",V
529,717,035 *362A2D6FFA7B61ABDC26BA86D879F244D5B620A6 DELETE.COMPLETE
529,717,036 *362D98B5AD9D550DEE474BD9A9005A49F603368E DELICATEGIRL
529,717,037 *362BD9F5090B8DCF06377DDD3AB4D198DD6CAD34 CLIFF.LOUGHERY
529,717,038 *362D2282B722200C8C9EFE320B3769749ECEC548 DEN2H
529,717,039 *362961DD07ADE9C1380A749945F3AD0FF9D820BE dengarns7
529,717,040 *3626D2B32C21C08F6494E4B0A450B27BCE9F8A9C cll(w
529,717,041 *3624948E33A79D8DF047521E8DCCA3890389E563 DERBANEN3
529,717,042 *362A3803DE5258853B2AE5C6DBF630C417251340 DERJUNGEMANN
529,717,043 *362E9BB222F09F024862FF0FD22D5EFB002992E3 destination(dj-ramonecommix)
529,717,044 *362683FD1FB0E6720971E2548B140F4006945E75 CODY.PICARELLO
529,717,045 *36267F3BC9339008ECB7A4BED94135F2E1443B3F c!_of
529,717,046 *362EF9AFD6E6535849EF3DED0F6C4FFF94167993 dewittgothard
529,717,047 *36204CD6621747EB1714F56A7FD3AFDD4C439FB1 DF8,;
529,717,048 *362AC1DE25ECF296C28E81523BABACDD7E41BFD3 df&h7
529,717,049 *362E848E55CA6CC810487039E8696BF6594EF138 dg-rv
529,717,050 *362143A2A53D7F326F2CC206DC6CB3B149F47330 [email protected]
529,717,051 *362A22A8968C99D75679DDBE44A71FE3FC96EBBC CORNELIUSDEPOLO
529,717,052 *3623F76BB0B2268686629E62B7FBB6E98CEBCF40 dictive2
529,717,053 *36251BC17951E40D9EB1F62985F3EB342D0C31A1 CORRENTE(COURANTE)
529,717,054 *362722060DA658A76C6443F14BC394CD46D6C76E dih?
529,717,055 *362F1D4764C4E2F14A28B5919B2D2B3EBC81570A COUNTRYFAIR:60
529,717,056 *362A2331315A44352BCA14F071C9D5E5F074769E DIPIKA.CHARYA
529,717,057 *3629AB65E951B0CD7DA8C9E1B1BF5C23DAF32B18 diq4t
529,717,058 *36264669DD76C2DF787FD5213FEFB2039F22CD4C dirotti4
529,717,059 *362E83D0B6BCF44F9E5F77DABC925971D471DA72 c:\program-files\microsoft-visual-studio-9.0\vc\crt\src\wcscat.c
529,717,060 *362486C3A3CEFF814E6281AAD8B5BDF2E2DAA67F Cp=U
529,717,061 *3623DD6E5DA71834F23629568E31EC1C6FC309D8 d,-k1
529,717,062 *3624621B3AACD1E09D254310EC392AC29CD62DF7 cr6l
529,717,063 *36222EF974322AB8FFDB50459A7E66027B69DB26 dkg#!
529,717,064 *36242F8B4F846B7EF421A2EB1F041D3E81337BCF DN%5
529,717,065 *362E2C0DF43EDC54957217A2AF778AD0210FF1E1 DOMINIC.LOB
529,717,066 *362EC7FB3826CF75223D19DDF1D6A5C2373D6FAC DONALDFEURTADO
529,717,067 *362047F7F0432375F6502E04861D9C8A6EF08D77 Cut7
529,717,068 *362E5962675AFD3B08311FCA47C531D2675B4D1A [email protected]
529,717,069 *36283C664E3535494849050829A9331A0DD1D4F7 DORISILVIA
529,717,070 *3625B15E8BAA6A9A8E2D08B16C17007D88EA8760 dosahla3
529,717,071 *3629CA2BC8432A2E9D3414462B4F038CC89F8C74 cyranosampson
529,717,072 *362B3ED9806E784C382D547B16172144FA8D925F DRA6-
529,717,073 *362FA71625AE9D20226114582D48D3A15DABECA7 drover
529,717,074 *36239760133AF41DC004FF9EC465723FA93186E4 d.4(4
529,717,075 *362F5D61A2B58401E325A4F8033E994D905BE084 ds8(1
529,717,076 *36238437EA96664EEC98F2670BA7E91DA34F7D1E DUDLEY.WENDLER
529,717,077 *362C67161A27A7422C32B47AE0AAF80C712FB7C5 dadeindicatesarapidlyscrollingdatadisplay.
529,717,078 *3622F11C93BEADED027D4DD0861F5FEFF6B6BCE4 DA_IY
529,717,079 *362F476C67F20FDBD26AF06559F2262D4A343804 daltoncomrey
529,717,080 *36279FCB21728A8D3C3E7E14F5585D1D0F6170CC dampaal
529,717,081 *36291B3B62AB1CAAE2DE7BAEBBB4236617219E3E DANEARREQUIN
529,717,082 *362DE0CD25CE78C02224761D0E4B2F2673B5C3E0 DANIEL.MAHAJAN
529,717,083 *36223B637485BA938E1544806B862D1CF8B3BF7C DWAYNE.BUGNA
529,717,084 *362E34EB246ABF435361E8EF42D0E68E212102AD D,WB
529,717,085 *362C8ECADF9253B579C385BAC867F4B8D0BDCC17 d((y2
529,717,086 *36273684D7B6B0AD8E9668CD50E18BF057013788 DARON.ALTO
529,717,087 *362E945D52757FE9BEFF8CA7EFFB9E5FD883CF58 darrell-chen
529,717,088 *362260CABEBF181C6E87F1DDF64368C8DAE4651D *e',
529,717,089 *3620C9E5AFC4DB04E43DD34C594F204FDC5668E9 DASWDTS6
529,717,090 *362678B331627E7386A8DF06E2D83BCCC13F6890 earlribb
529,717,091 *3622BB5E8016C6349D4B948E0CFF5EFC1BAB3A6D dbfu4
529,717,092 *362EF43213010AF261447CAF52A7DB424866EE83 EDWARDOGRIFFARD
529,717,093 *36288593FA8890C429F83BAC63DF6A97D264AA60 DECEMBER1308
529,717,094 *362F1BF145EE4C758B6EAD55E4132B6862C21CE5 [email protected]
529,717,095 *3626D08A466886C045B05415693CA7704C9F854B EFO
529,717,096 *362626C22AF18ACF0DA076B52F2E8D94DFE1D3A9 EG1H
529,717,097 *3628DCFD07754AC0FD206FE5BD39D305E55402AA eine.insel.mit.zwei.bergen.(frau.mahlzahn.mix)
529,717,098 *362FD884FD5AAA0768E8BF50F685FDE7CA4A785D e-(intro)
529,717,099 *3620E571AE1254937E5F029DC1A548ED1AE1E46E ei,(w
529,717,100 *3620AC3B7F32981D9188AAE327CC2E7FDB50CCAA EKC5811
529,717,101 *3629BC14A1AF4BA265D1630C7323C0F6BD9C229C EKCISKEM
529,717,102 *3621908AD2D66746CE2AF47474879887F1C5894E DEPRECAR6
529,717,103 *362FAABA19E622B06F8509CE0A5BDC339DF6B825 DESMOND.OSTERHOUDT
529,717,104 *3622EB4C2369CCDA7FDDC52D9B95BFE5C7AE33D0 elliotthazlegrove
529,717,105 *3629BF47890C249B7D118246EE6DA9F8F6ED2494 ELLODNOW5
529,717,106 *362D2A7AC061C24A97A4C7A7E3511C0151A6FE5D ELLSWORTHCRESSEY
529,717,107 *362E0CCD8BB7DC82F01DDC55FC636B48B6A15D5B deweyloeza
529,717,108 *362175D9446C026DD1F62FECEB937C1BC0B9C25F EMBEDVT0
529,717,109 *362158BF624178EB3547D04BA46219C830A71C7A DF-UD
529,717,110 *3624449AE0B5447689DB5A328A041DB2E082A739 DGQW
529,717,111 *3629E724C489BF9B1DC27582E93043DD5E75D272 D&H;
529,717,112 *362922A74AD9BD86EC87D8B00E8E0DB587D52657 [email protected]
529,717,113 *3626A3DCB9563D00CD508CFB9226EB28F60B2761 [email protected]
529,717,114 *362BCA6D22FA7424B47FE5401298720F52CF460D ENFILADE
529,717,115 *362D427275F26020567939C802F8558AC95DEEF7 dillonpesner
529,717,116 *362FDB9FF42695D4B9BA1B342E2B26334F4514E1 ENYJNOBV1
529,717,117 *36213F3019CC8E437646CBF09AB01C176144B6D0 er4nu
529,717,118 *362291CADB85CDD3525FD9D153DA7F2F69408739 diw%g
529,717,119 *3620738CBE18AF874C0AB2118BA3B2129F75C4E3 ERIC.NEMETZ
529,717,120 *36238EF3A2900C37AF5CA89A42F352C638DEF363 ERIC.PAULINO
529,717,121 *362607726EC878D570C76E835AD0E88676AE37AC D=K&B
529,717,122 *362EDA812F64A7F91ABFC0FFAE6877A20DC6FFFF DLQ)4
529,717,123 *3629AC9CB5EBACFAAEFBC6B617F4E57E7ED5FA23 DLSTJD83
529,717,124 *362466A5E874B9F6710389A7F8B3FE2CF5475AFF dm32l
529,717,125 *362EE581FACD357B90A239D189E215F3C813A81F estufera6
529,717,126 *362AC1BC8B9EC1D912825A556C203558D7DA2D9E dnflglld1
529,717,127 *36211638DBB2425875EE1B12EED4955E31915218 dnq;c
529,717,128 *3625F01FC4143AF4284A37AB2B1654412BFEB0BB do)/b
529,717,129 *362FA393BA35476EA75BD786F8585ABE7E6AF670 eurc(
529,717,130 *3624345365A95322AB946338A7A6E5B5CFC5CBDC EUSEBIO.WHITFORD
529,717,131 *362EE33D3E4915E85E3CFB5BA45F3D80E705BD47 EVERYBODYISASTAR(INHOLLYWOOD)
529,717,132 *3628981449BBEF1784E6DB04C133CB6282EEF9DD [email protected]
529,717,133 *362CE4009201F535230E75B23792170A8655031E [email protected]
529,717,134 *362305CD6D4ADB80FB8F30D76950C9C6FD4789E1 EXASPERATAS
529,717,135 *36233040B73F5C410A2D604DAE0100ED69C75F05 donnyplue
529,717,136 *3622F50111DB9E505DA226F9DF2E3EC9B3396F7C EXPRESSYOURSELF(SHEP'S'SPRESSIN'HIMSELFREREMIX)
529,717,137 *362055CED8A918C7587C5CBAD9559D298A4FB607 DOULAINS
529,717,138 *362C344779B9493B4A33CAAB21D3F0F067888058 [email protected]
529,717,139 *362FA1D2BD1C27087777E53A0854E72F6589B630 d:p
529,717,140 *36211E7BC26F7D5381798C7FF65A1A24C47FBC4E dplts
529,717,141 *36215F994EDF01B16E35F75245AB0C47A012E3C7 DQER=
529,717,142 *362A0170728AFAAC084133940849422E5F73479C favredisease
529,717,143 *362CC035EC673CF35B6C2EF6D62EBD673F166012 FAY-AL-M
529,717,144 *3622C3672112A27EF0038A47CA5F842F596711C7 FBANDARLIPE
529,717,145 *3620D40104FE6A79EBBB5D8CA571C5B9F771ED55 [email protected]
529,717,146 *362E9FF4BFBB30DD774A76992478E458ECBD7DAC dreammovies
529,717,147 *3626581387FC7628F35B0F44DAD8D1DFF1D1A251 DRUCKPRE7
529,717,148 *362D526109522802FF5AFF878D30EB3795C86288 DTRRM
529,717,149 *362468D9B9ECDAF5B6D812F055F36A05F0357BE6 First-Sip-of-Coffee
529,717,150 *362E79E5E3CCB60E8A88700A49CB3E3E46F48D6B [email protected]@813
529,717,151 *362CD5915C608DCCB95CA06159AB616CA7669651 DUEOQ
529,717,152 *362F9CEE0E2DED41CBD20E2E230B3E34273C43AA fläcklusern
529,717,153 *3625FFE5024CBEF26458330B9120565505682BEB floydtanikella
529,717,154 *362E66B54A4173E782A1D15BD65933F61A36B9E3 d?veg
529,717,155 *362A1BF69FF2F0744A27948C4BB9F665E91B4101 FRANCIS-GAINES
529,717,156 *3626E887C1ED205515D0FAC38E17D6193D491E3C FRANCISROMAIN
529,717,157 *3621E15EEF4E7C2B24F299791CEEF7245638FAD6 FRANKLYN.OTTOSON
529,717,158 *362FBE1E66A2F9B7C0AF6C611CEBCA0D21D8A2C0 freddy-bravo
529,717,159 *362507AC12E998EDDD69E1479F5072AFF359F368 fredericresendez
529,717,160 *36202E071D4D89803A1E00A3135D689B457C5A7F [email protected]
529,717,161 *362BB8F23635BE5C5018E5194576EEA3F2E42428 eaigaleravoltei
529,717,162 *36219A4B6DF147C1EAC238F0A4C66477963BC986 EARNESTMILLAY
529,717,163 *362296F2E0F344B870E54E5D924F4C993FC16DF0 EATWELL8
529,717,164 *3628AD5A6ABA500A002DAACC197684236BE61C9A EBN7S
529,717,165 *362E0066DEDD1F95CDC234D133BFCDA5F511A090 [email protected]
529,717,166 *36290CA9A04CD79F49FD99E6F884E705AA903F97 EC.W
529,717,167 *362E614DA826349E30AC97ABAAC5D7148043570D edho-
529,717,168 *362D486FC3242490C700E07AA8AC5DDEEEB8780F GAILGOYCO
529,717,169 *362574EA94D36A45D5AB45CED97FC8D892B61E49 EDWINGONSIEWSKI
529,717,170 *362AC38BA35BD0028CFDEDE0E4D3E3F1FE2555F3 EFO
529,717,171 *362314F80B4150D9337F02782CF29FBAC84C635F EG1OO
529,717,172 *3629BB2440F61237D5D09123AE39DD2818DD74C7 GARYHOME0
529,717,173 *362E4CD3F547B2C6365F2ABD817AD5F7B0393A99 GER12MAN
529,717,174 *36203DED025D44D09B1ACE3635461B8B733648EC GEWCARTAS
529,717,175 *362B1B1419EB6D9151134104F4BD15327D1E2ECF ELLSWORTHLAUGHMAN
529,717,176 *36290AF3F6E6B498A0DA481E503CBAA2E1C5B05F ELOY.SOOKOO
529,717,177 *3624C626BD144993729AF5A108673C6D4DD610C4 ELROYMARTHA
529,717,178 *362A8ACB158EDC3DA98B1D5CA8E7CD6F9F896F89 ELTONSLEMP
529,717,179 *362B535B0316FDC64DF7931A87B2142F2CDCFA2B eltravalengua
529,717,180 *3621921B2F182DA15740A4B079032BFB65000F4E EMANHATTANX4
529,717,181 *362C2F2022451A4C587C7971E1766B9963C33CF6 GLENNCASPER
529,717,182 *36256056F79180ACB28457B2DD9FA9865D6A4533 emilegepner
529,717,183 *3623939B671F4BE82D8792A5D0C4F21BAB3428E4 EMIL.SCHONS
529,717,184 *362ECA5C464BA0E2DF19836AB326E93689C22DB8 EMPIRE.LINE.(DISC.1)
529,717,185 *362BBDE3B94636BA3E5DD6A3738D5FBE2CB604DD enheavening
529,717,186 *3627F1266FBB1035308083972953F5C10BE74C4E eno.4
529,717,187 *36232DF0E480E35F93F18DBA1C9E53C9B451FE7B enyv
529,717,188 *3626692C44C2A5A8E080A6EBF24F3363203F94C4 [email protected]
529,717,189 *36284FB2B37CC15C8216367135D610BA02897996 GRENDELSLOT2
529,717,190 *3629942CB23104FC19C3D2CF88E638ABAFAE52FF GROVELED
529,717,191 *362A30AFA5F283DDE32B484B6C3C2EED7BE04551 eqq;m
529,717,192 *362E189336138C74128E1125DBBF5485937E3CB4 ERASMOHANCOCK
529,717,193 *362769072E0D1495FC341DA87A011BC8C53EE9EE ercorgauwww
529,717,194 *362FD5A04248F063A96686E38E300D26B9747500 ;G/ /+]T\ [/S ~= ]TNUOC$[TUPNI$ :8
529,717,195 *362B242380F1CE82927A646FA9F1E3F138E53AE5 ERECTORS
529,717,196 *36208027A2555150A857BEB1623A84FCDDE7DE22 GULFBREEZE(SASHA'SAFROSHASHOZMIX)
529,717,197 *362065EEC147B39245E0424EF1C4F8A4C15EB647 GUSTAVO.DIBRITO
529,717,198 *362F2E5FC67EE79B77A5C215AEBA82F06F302CC8 ERNIE.WILKERSON
529,717,199 *36283AAB2940DE5C9DBFA48B7F9E55DC02CF2B99 GUYSIMMIONS
529,717,200 *362DD0794DC8BA32B103B116A43AD6D928370049 ERUYES
529,717,201 *3625B54B4C533FC970360EA9EDB8FE33DC86BD35 escj2011
529,717,202 *3620DBB946A58A385231265A03AF54F765F7A06C h4bit4b1ene55
529,717,203 *3621AF33B5F5FE8E0351297ABE8DCB25FDA5CCCD estebanyoungers
529,717,204 *3628228546FF1E53BDAEC7CB41B020BA85D33279 ETAIDIFF0
529,717,205 *362BB6B48965ECCD43515B70C2E93A40542B2394 HAKANNORDMAN
529,717,206 *362405CD994431D44FA6AC5A5770A07DE45BC271 [email protected]
529,717,207 *3625AA14BA2D67CAE18868B810BC57F3A376DCC0 ETTEKUAL
529,717,208 *362CED4E0B49FFDF7A9FCAD57FD14D7FC451896B hanna.edberg
529,717,209 *3621D8475569A73263617FC71D43C3F7FC2ADA45 EUMH
529,717,210 *3629EDCD5731B3F093A0F8AE5FB5896A48A47553 harrisonwartchow
529,717,211 *36223E6B82AFA8D6EA26B95B6BE95151039BCD0F HARRYNUSE
529,717,212 *362297C98285E64B4D0C2D1565E7CDC1B6762502 hasan.moin
529,717,213 *3623FD202796D4BA209D666D39DA1ED777BF24F6 HASSAN.AUSLANDER
529,717,214 *36202C2169F01396A5FDB963927F763C5D834055 EXERCISE.THE
529,717,215 *362ADD985B4C1597D0CEB144FAC5DB1F5E7C415C HCIEALAP1
529,717,216 *3628386F5A353916E611B5083479331215D857BD eyscr
529,717,217 *3626DC158AADA8FE859EA9BADF600418505EAB41 F1U77ERING
529,717,218 *3621AE3C86EDE82BB1201D56795EA420F5E7354A fabiansibley
529,717,219 *36218C1B3667557088E25B0BB2ACD9CC2138FA0F herbebsw3
529,717,220 *362BCBC859CFBB6317762803354BCFB24B878C87 HERE-COME-THE-80'S
529,717,221 *362DF7EAC2DD42EE25E3E2E23EDCB617106D0A54 HERIBERTOGEYMAN
529,717,222 *3623378444FE802595DBC2226C942EC9ED283463 [email protected]
529,717,223 *3624331FED573D658A6C8525B18165075D23273E [email protected]
529,717,224 *362C9D9C51B04498E7651777E0216D0A70F96D76 [email protected]
529,717,225 *3625A6234CA560C801B2495C30F9967EA9B84C45 FANTASIA-AND-FUGUE-IN-C-MINOR,-BWV-537:-II-FUGUE
529,717,226 *3622E7B1D609F086A3A4C9D04BF557EB4D6DA5A1 hesham-hammouda
529,717,227 *36298471428D6CBC2DC3AAEFB5388EA73A84190C FAUNAND1
529,717,228 *3627252D0FBE9AF86251E2362595D838A31559D6 FAUSTINOIGTANLOC
529,717,229 *3620CCA557677E8451A5D11FA921E852E341856C FAUSTINO.SERVER
529,717,230 *3626E29561BF8CE3B8CCBF32B7432CF10A50757A FBTEMP7
529,717,231 *3626AD681D94A14D7BF800742655F289C720FA92 HI039365
529,717,232 *3627884305FCE7A84F09A4C3DD40336F1B84BA6F FE110W CR
529,717,233 *362CE60AB3F6C0C1AAC845114F42033B5F628C16 FEARPALS8
529,717,234 *362D02736678EA44EE554DFFF35E747B5D372F5E hiramlawlor
529,717,235 *362BB4A848A178827889E76718F798F0C7162A2E feltonpurwin
529,717,236 *36214041D8D03542786C084F91013492DED860B4 [email protected]
529,717,237 *362812CC720449C9A360DACC2C387E5A0A2936EF hladky12
529,717,238 *3629459E1842270D269A148C9AD699284FE5547E >?hm
529,717,239 *362110A066A9B223EDDB5DAAD3E54FF069C8F941 ho
529,717,240 *362297ECEA7CE16964FD78D5237EA400D4E00BB7 FIDEL.PIZZITOLA
529,717,241 *36248DCB61A7255A99341451D9C6A020E938719B HOLAMMINING
529,717,242 *362E6D41037C8EC20442F4A07B8A4FB1ECA08121 FILIBERTO.RIISE
529,717,243 *36205A7618CB586385932CE7D9AA604BFDAD7D23 FISTGEN
529,717,244 *362C499978D48736223B70FCC1481354D9A23ABC FLETCHERSHOWALTER
529,717,245 *362E68CBEDD6E87DF724E4F6638CCB8DA78ACAF7 FORETHRI5
529,717,246 *362EE99D50F043934226094B5C06F9DC9BBDFFF8 [email protected]
529,717,247 *3621D3DAC744D9A8494E169E3E2A67357914233C hubmaße
529,717,248 *362503403D07736F804D469FC4DFF879CF835138 f>{q
529,717,249 *36224A42A1658A268A8A5267C7D91B33DD71D431 hvemka'detjegka'
529,717,250 *3625EE458DB49A97E23E7DB671BDA38780FFE408 [email protected]
529,717,251 *362DE226626D71A1757940728E9ABE5AC3943706 [email protected]
529,717,252 *362A4F6E5CE98396784ADB4628934C9F99F5B30A FUTERIEZ2
529,717,253 *3629545D9D61C650CC44A2FD829BF25BFF910541 galevanderwood
529,717,254 *362BB833A59779F7E50CF8715CA90FF2B4098F96 ILOVEAMANDA17
529,717,255 *362EBE633CD7EB8DFF332FA1A1953903D82C8E13 iluvblood12
529,717,256 *362F0E11D11D0E4C10849DB776EC4D1158A08EF0 IM|:
529,717,257 *3629D8B01F1B4C4E6EE1F524DA956C9F1CAC73FF GEORGEOSWEL
529,717,258 *3628E87575892CA402622B82706C9EBFC33E7E5A ghapelied
529,717,259 *3624C7DEB8931887CCFB9EEE22C6A26B043882E4 GIREERDESES
529,717,260 *36268DCDD280FCDB14C438774C980D9923517F2E GIYIMDE
529,717,261 *3628A632FDB84EB3487E6D531C376630D40A4244 GLUCOSAN
529,717,262 *36214E6741C5E4AF9E68A127876897D4B5DF8003 isntg-dett
529,717,263 *362C8DC026610876EDA0EEC32D8E394A1F10E953 ISP-IR.SUMS.AC.IRISP-IR
529,717,264 *3621686FD6D7936D1D9986E9A132896B69576B8A GOT 2 FIND A BETTER WAY
529,717,265 *362A7B6A56CF864EEB80AF0ED60C5F1FC0B36E8D IVENSKY5
529,717,266 *3627B095729A1FAC768FF4DD29F086B9D7E5C144 GREVILLEA2
529,717,267 *362CEFBECC849DEE5E998557CA6B1E6D10C192C7 GROVELED
529,717,268 *36236C89ED24AF2ABC04FF5C3567656C28D9E5FB jaenachmias
529,717,269 *362C8899F2A0EBA28219D5026DAE8DED418F757E guadcoastwatcher
529,717,270 *3629E8B58A625386347E1EFABE0508876956FE24 jamiemcphee
529,717,271 *362F8C609E1EA6EA00E4EA64E9F908A550998C3C H116353
529,717,272 *362B3B0B9DE0655EEEE4C4160CA87FF990920839 jarrodpadlo
529,717,273 *3628CB0DC4C10638729A43C04FCBF0724099BE81 jarviswartman
529,717,274 *3623D70E6CD5E1518514A6080B853D45855CAECF JASONESE39
529,717,275 *36266C7EA7287191E741FF52DF28F81980241F2A hadar-bareket
529,717,276 *3622BAC9D2A0D01193520ED72BE9AC2BF84DAB99 JASPER.SCHELLE
529,717,277 *362934DBE7A7FCA813B898CC34C995657782FC52 HANG-ON-TO-A-DREAM:-THE-VERVE-RECORDINGS-(DISC-2)
529,717,278 *36257B48D0A0C186A65C17D147D32BAD4A56FFE1 [email protected]
529,717,279 *36289BBD024546EFE0AF300DA975D6FAAD4B88CF JEFF.STRUM
529,717,280 *362575CE59784DE019FE0E47417FAE16A9DE919E [email protected]
529,717,281 *362A20971EF2369749C31A78DFFAD331BC5769F3 jeremiahmiller
529,717,282 *3624F7CBEBC08561A20D7369C7710094EA654E6A hautalanmäki
529,717,283 *362673819BB4FF01F075D2036FA1AB3AE36392B8 hayra-alamet
529,717,284 *362738319A2FE91739DF09CDD77DEE3645B34062 jerrycudjoe
529,717,285 *362DE499BB5580C4C719527BCB7E906865E3B108 headboards?
529,717,286 *362EF05A9824171A713F05A48A33EFFC443E25F5 HEIKENTÄVÄÄN
529,717,287 *3627CCF29BEA0F3BAE0FA22660659225AEF5512D ji
529,717,288 *362D4C3781EBF8C4E5626EA2EADF9ECCBA119414 HERALDIKKOLLEGIUM
529,717,289 *362E725AA6A0588C14613BBACF33E494DE74D718 JIMENA25
529,717,290 *362F15A2AB4AE1729442EF73680CFC4AEE33B751 hermnos
529,717,291 *362A5BAEAEEA8F5942B3934EB8EBE441B4F525B0 JOANNESPROUL
529,717,292 *3622B920D8B52EE3EA96B89C08E2391D7836BABD JOHAN-VERSTER
529,717,293 *3625E5F4A117148462F44F73BCA7AE2BFC870053 HIRAM.GUSHIKEN
529,717,294 *362D9AB4030E40BBB1790004E2AB9550995177F1 johnbornstein
529,717,295 *362F0EE027EE3CB13849F93B15EDC485CED79446 [email protected]
529,717,296 *362B88A0629DA7633CCEA7E44B3CE84195510242 HKALWANEY
529,717,297 *362F39FA33FFBA627C3F6567BFC1F816E4A28643 [email protected]
529,717,298 *3629025528E4A15B39F106D38ED648A1F0D28246 ho
529,717,299 *3627653C7BBAC3B72D7B6005934FCB6F42101682 JOSHUA.DOBLER
529,717,300 *3624F273D9DB3B32680D4E33993120A326CC95F6 horacedurnin
529,717,301 *3623A13B3CA49C4A72E1AD379F3FD8E0FA1CF861 horaceterlecki
529,717,302 *3628EFCB66D4C827DA72BDD9C89FF7C08C43596A josiahdepriest
529,717,303 *362EB584E695406D4F62E2959D4B37EFACB92A40 JOYCESURINA
529,717,304 *36249945C501C13EBEA3AB540782A72ABF48377C JOY.M.ANDERSON
529,717,305 *3621FD98812EAB4AA8273EEBDC6334D4C22991FD JPENDARAKIS
529,717,306 *362AFD6549800EF6338AD263D76B810B3ABC7407 hoytressel
529,717,307 *362EA7E82E11A02BCCB0D4014818A064E2DB9BE0 JUDENFRAGE»
529,717,308 *362CCC31F7CD06F6D3272C23E4DF9325EE223CA6 juh$hiun
529,717,309 *36214F5382152F8B7699231ACF9D5C8F01F1EA52 JUSTIN.GARTHWAITE
529,717,310 *36253D5B20B8ED02E24746E12931B1D6E3D7082C HTTPWWWHSUYUNCOMVE
529,717,311 *36206F1C347D8D6922FCF369BD4F8D3A57AACA2D [email protected]
529,717,312 *3622453E43D358FB9B5DB838A954AFE921CAA48B HUFNAIL
529,717,313 *3620ACADCB22582C42A2F5DC2A945CE13E8474ED [email protected]
529,717,314 *36292835A99FEEE20BE891CD4E4D3DC8F948305D HWXADVQKK3
529,717,315 *3621841E3D601F28AD7EAE4B5BFF1307A5E5EF6F i-ain't-your-fool
529,717,316 *3626226840BE133F4FC9A3368CA4F19CC94CB42A KBALANGITAO
529,717,317 *3621996864E7BC364A34FE477CD2DD9EE6FAF137 IAMEREJ
529,717,318 *3620C0081E63038933A7EF1CB28A908C08D31453 IAMHECTOR10
529,717,319 *3629231CCAA431C1E941D6B161980130AC87A130 @K+CU
529,717,320 *362FE91A84EE90FA0B3949B4448BA2B80ED3AFEF iamjohnson26
529,717,321 *362FDDF9376731352B729B00C3F4E5BC2CDB0C21 KENDALL.MANONI
529,717,322 *36224395023511E711021744DF039AAE623BBC6B ichio
529,717,323 *362D0C278A5BB198982FED28896769B27F32C3AA IF I CAN'T BE POOR
529,717,324 *3626C8F984A95BB9F695B23148470B269106E8E5 IF YOU MAKE HINAMORI SHED EVEN ONE DROP OF BLOOD, I'LL KILL YOU.
529,717,325 *362970051AF8FBB8CA3BEA375FAC91246C5B0822 KERN74
529,717,326 *362B35524590A61D7100E31D3758D2C48EAD9B90 KEVINKUYPER
529,717,327 *36231A3D42CA963F7C1D0E0CA31AE575A5021684 khalil.rantisi
529,717,328 *362130BF0D0EC78AD6783BA9C3B7F6938AF2738E ikspanen2
529,717,329 *362033D316C701A80B15EFDE9F63C09536197251 KIMBERLYPALMISANO
529,717,330 *362282D056B06512E82A9E8395EAF78512E90919 king1
529,717,331 *362F1EFB4468FA174D0CFE203218F64E31FDA3CC ILUVCHARLIE152
529,717,332 *362FDD6BF41DD972B994C971F90746B4885A8672 IMAGESYSES
529,717,333 *36288091728DF121ECB50A88E2DF05C7236AB2EB KNKRTRNING
529,717,334 *3625FEA4A65D6F33B856A38F5CE56D0978CC91E7 KODIAKBRAUNBÄR
529,717,335 *3620595B9B2341982FC288189EAE8A7BEEB0B328 korra-oli-kuu
529,717,336 *36235CD334615347B0261EDA80A1820128775014 INFOPEGGY1
529,717,337 *362CE36BEA4A8B537D034BE042EC8FC20A8A72BB insmeten4
529,717,338 *36237AAEBB22D2BB467EB43E587DF97D359736BF irbranched
529,717,339 *36286F5858FC22D9F3084981E8B48C385C918257 kyliemariejones
529,717,340 *362C9168B85513410B4301D2182FF73159DB5D64 [email protected]
529,717,341 *362F1772E143A61FC87A947BE3DBB163FEDCD41A ISHAN INDRA
529,717,342 *362BDC3E5BA7313C53448A49C02CE6AA01022351 ISIDRO.MOGOLLON
529,717,343 *362A66FEB27CAB4FBFC723AC1001D3CCE4E49429 ISKR
529,717,344 *362DDF8A6F9B268F249A2CF6998EEFEDA61649AF lacymanigault
529,717,345 *362CBDB423A42F4C8E96E5BADA4952CE134CACA1 LADERIUS8
529,717,346 *362E0ED2E683499604DCEDC02A33736E365E7C91 J201190
529,717,347 *36216FB33DB8A05A451C1E2DF93A33D6B509B9DC j3nn3s
529,717,348 *362B47E0363311E6512B2315089BD44F1EE45C46 JACKSON MAHONEY
529,717,349 *362CD5D1378E0AD9B09C2677A4F6949E72DA639A JACOBSILBER
529,717,350 *36250F1206BA2494839609A54BDA2AB57BC3EC1E LARRY.THIELEN
529,717,351 *3628CAFCF1DFAA6CE61BE07FF52FA9656B22F0F4 jaecoach
529,717,352 *3629E4D9E55F2705B2F7AA34046CBBE4A176BC11 LAULULIIGIKS
529,717,353 *36248841ADB137D0CDDEDB8AEE350BC655D85801 jakezeidman
529,717,354 *362A1CAA20FE1060FF92A64E4389FC56B16719BB james-grantham
529,717,355 *3628BEED98B08DC5A932775831A6757F327C32E8 JAMEYKLINGLER
529,717,356 *362FEF29E76202511BBB24EBAE3672736285233A lawrencedewaters
529,717,357 *3629F779EA33D4E1EF492AF902A208215C1C9DBC LAWRENCETOPPER
529,717,358 *362FE71670424B5D1617FBF710D3ADF718E03E56 LEADINGNAMES
529,717,359 *362AFA5D59CA92F888D488A1B6E9EEDBEE94CFD7 LEAKYING
529,717,360 *3627B6F5D4968C5970B8DB2E5F8C2A0CAEE693A8 LENARD.LOHRMAN
529,717,361 *362F1A7AB244F170F44ACF7CA46950A03D48C687 lenmonarez
529,717,362 *3627AE7042E63F90632DC1C8DF530C67566B2286 LENNY.FILLHART
529,717,363 *3628D65E3E5141686F9101DC82042A8AEC9FF56A [email protected]
529,717,364 *362BC718A24F9667FBCB8EE4B19520CB635BC3C3 JEDJACOBI
529,717,365 *36273054CC868E572700604345B0A5DC8FE23DAB jeffrylengle
529,717,366 *362EDE099749BB4AD2C6B355CCA8B17D65844243 jehannelisondra
529,717,367 *362288184A4998A45F01317F3E6134CE934829AE levation-in-C-minor
529,717,368 *3623732C30EF17733CD6504D461CA25F5F52B566 levelsaudio
529,717,369 *362B966689E2A7D58834ECA94750B8631F887CC7 [email protected]
529,717,370 *362F2499A9B1E7872A3F9EA991D8EAFDD70BCE8A jeromyringhouse
529,717,371 *3627001BDF7566979AE1BA7DFD7BA76D89752307 [email protected]
529,717,372 *3622AD307AEA78B0DAE8F60960132D5B14C170DA jessehanmer
529,717,373 *36291B1A3CA9B7B95EE2D0BC4905EC79FFD5808F LIBNAHN0
529,717,374 *362A7AD98F1ED95B332ADAB36878BB20C0743197 JESSIE.DEMOREST
529,717,375 *362AC7353C0489DB6EE6F31D21B3120C091935AA JESSIE.SIGWART
529,717,376 *362E2F4FE66838D66F28B5821F8B2898F39035DE Jeuxd'enfants,AfterJanacek'sMoravianFolksongs,III
529,717,377 *362B4BE3FF30E5D70296163F3FBBC6165DA3A236 LIKIMPIÄ
529,717,378 *362D7AAECC9F9820557AA838C70ABD26E6DFD493 ji
529,717,379 *362F1E97E183350F285BA66C7E83EEA942C3E397 jodie-otoole
529,717,380 *362E870B054A74E76C60C8E5709EB0A77E4DFAF6 LJRFPSDFN
529,717,381 *36208BAC8796F43B993B01F9C570DF12AA4956B6 JOEL-DEEPAK
529,717,382 *362B87E882628B02A1EE34FDDDCD5178E8FDA68B [email protected]
529,717,383 *362E5F0B80608D1BB3881F59781D1795AF56FADC JOHNATHAN.BRILLON
529,717,384 *3622F390D428C8F85D7BAED0AC9050C3460E5FD9 JOHNNYHOLMGREN
529,717,385 *362D1ADC3C4608BCBB826142D07A57E47B38A6B6 johnquezergue
529,717,386 *3627AB854277A3CC3595A794F129869010FAFA3A [email protected]
529,717,387 *362CF21A86D3FADC7C682C975A6684BB41C2C74D LONNY.MILTENBERGER
529,717,388 *362A5BEF316E14075A1C393331F78A70DC3E66B0 JORDON.PISICCHIO
529,717,389 *362776488B5905AFE9760A2FAADDC379363A79E5 [email protected]
529,717,390 *362289287096645051372735A8E3EE531B9E8909 JOSEPHROBB
529,717,391 *36258C89F29318B4C2C0066251256E408D4D7841 JUAN-MANUEL-HURTADO
529,717,392 *362E5ACD017C1E859A8E1DAFF6B6A384633EF23F JUANSTEPHAN
529,717,393 *3625D810EF1769BF55A22D61ABC93E880E75EB17 JULIUSBYHAM
529,717,394 *362BDF83EF6F3C6DCA226AC90979C19C98C2F9C4 LUMINOFOORIELEMENDID
529,717,395 *3621A2F562F37AA5A8B5CE7ACEFA25C3AF956B1C JUSTIN-GIFFIN
529,717,396 *362374E1E4BD314147C4F8D5B46F99EB877262A6 lynnhaven9
529,717,397 *36201B0CD60778B3ED22F44E69EBF5EC2F42CC8B MAC.WATTERS
529,717,398 *3627AF0400F515F5753385EBF24CE18EE5B3474A karkoqe2
529,717,399 *362B82DCA3BE84CB159CBCF002B6D7FD43C3AA4D MAHMOUD-ABD-EL-KHALEK
529,717,400 *3625DFC67FE529F3A0CC6D8A33D53E79A9A32A8F mailmancannon
529,717,401 *3628ECD54B78A3D75A075E462D3336D033C510F6 MAK>
529,717,402 *362FB61971C563DFB0044F697E5EFA061331B318 MAKEFAITH(FEAT.KNOWLEDGE)(12"MIX)
529,717,403 *362636D46E535330F881C7B466721CD479671132 MAMOUDI9
529,717,404 *362E8AF4E00A18628AF9423A84B870A9E88D0721 KELTON-MITCHELL
529,717,405 *36210025D3D8BFF68BF5810776681F474C403750 kengityskoulun
529,717,406 *362A261809AACEDA757919B654D831BD3EEADA72 marcelogugliotti
529,717,407 *362AF4DB2C6542EF4351BC8AAF2227B989FF8A36 kevin mccoy
529,717,408 *362CD55F4CCA6EE7FBA06FC5E5074CFACE27170A MARINAPETKOVA
529,717,409 *3621F6CFFB1CCFFBA9551F709A8C9F7A3D2A7DEC MARKUSSHIMA
529,717,410 *362E3B57E183D7853940E4A5B017CB7A8BB25E6C marlon.apigo
529,717,411 *3622824536DD9C4EFCACCB448A2BCE31696A6667 king.arthur,.act.v:.your.hay,.it.is.mov'd
529,717,412 *362A3A26E39C2B9913A7375EAAD4F136DA4C847E KIRBYJORGENSEN
529,717,413 *3620BF30C25E447C56B7042AAD76B3251612A381 martinbezak
529,717,414 *362CB7643AB50B80C021446605D561361548AB12 MARYANNPALMES
529,717,415 *362ACA94F251E9ED88936FF4AAF8374F1C5A0372 MASON.JOLISSAINT
529,717,416 *3620A756CC96813E338C16B4EE9CD4898BF805B0 MAXGEBHARD
529,717,417 *362E7F4147588EE334A4B925B5784BEC2E37162A koppelaar?
529,717,418 *3626568E5437AB6DF966442341C3E92011331C70 mayronjus
529,717,419 *3628F848F0D4C978186E07CDD6BFE04E61E9C5B1 MEDEAPLUS
529,717,420 *3623473BE1DFE1D5DD031E80F86740D4A89D4DC6 meghaahir
529,717,421 *36278FAECE560C83819DB09450B37CCB5E0F9248 KURT.BOILEAU
529,717,422 *362D90BC07322FF81D1B26EB7FD7ED008F3D14D9 K#"Y
529,717,423 *36259993105CA411C408C73F1EE1461114FFFEDC MERLIN.CADORETTE
529,717,424 *362FA104CA08710F5A6B9A4F396F18D225815907 metaphysically!
529,717,425 *362238C07F3AA4A87E44FDFB607035FE29581700 L52884
529,717,426 *362F46A568B5DDDC2961DC086B245D10A4EDA348 l}}a
529,717,427 *3624EF2CD1F2F4282618FD0A97C1ACBD417C7968 MICAH.ELCOCK
529,717,428 *362035F9F17A815BCDB610022E9C1BF19489CCCE MICHAELMUTHER
529,717,429 *362B65565B0EEA591BBB22D9077CBF7ACF39F59A MICHAEL.NENN
529,717,430 *362AD1580DFCD59E20086F3CC537E51C33C4758D [email protected]
529,717,431 *36220FD3148D63623E0D7814D5196F67346632C2 LAMENTER
529,717,432 *362309B5CE056D888F3F89C71383AA199CFC9E4D MICHELESANTI
529,717,433 *362690FF2B2538619911CDE3F6F55EAB57144728 michelle-kohut
529,717,434 *3621D60FE82FE5952B322F7CFC76D6D9AB993CCC MIDDELKLEUREN
529,717,435 *3628328F97AAA4A765752D7FDCF0446A3301CDBB MIGHTY-MIGHTY-DIPSET
529,717,436 *36276AC9218CEB8EC0A128DAE4149C3FCC0DA858 mikedicksonorguk
529,717,437 *3621F21165528E7F4CA14B13FBBDA63430911FE2 LASTCELEBRATION:DSPTOHOREMIXESBEST
529,717,438 *362421668D43B0836417879BD40DD92D56306530 MILFORD.ZUKOR
529,717,439 *362940397ECC5DC3F6320B7E5867FF73D278AF83 lavantra
529,717,440 *362CDB8DFE9F67C4ACFE75622AFA4CB4747FFAA8 L'''AYERS
529,717,441 *3629ECCA48313C2550960FBA115525A75298B520 LEHRFTÜHLEN
529,717,442 *3621CF69490EE92771913077622FAA5775F5E142 [email protected]
529,717,443 *36270D18BE2DC947FAAED76C4DEE5B7BC62CDD36 [email protected]
529,717,444 *3624571E95B8E3A918C1F92D532F6D92BB75B120 [email protected]
529,717,445 *3627FDD8E4C6FBD2D08E5E16F4A897CD6C630B59 [^M|KE^]YEAHHAX0RMETOO
529,717,446 *362849EAB4AE2D3D0A9B6F39DAEC07B882D29CF3 LEONEL.SCHWULST
529,717,447 *362C8653775003753EA620120DB297BE63C9AEF0 [email protected]
529,717,448 *362647E0EFE926CE656D8BCE311769278987EB75 MOHENISH8
529,717,449 *3621524A54BE19B13A27B9831BE7B1C4E420578F lesterbrilowski
529,717,450 *362B4DDC50E6B5D2E4B9FB59F53404A008BA9340 monkeyloop
529,717,451 *362BC68BE8C22224524909697104636C8BABDA9D levipiersaul
529,717,452 *362AD75136FC974B14B0C8A2432F167D0F5EF002 MONTE.KALLESTAD
529,717,453 *3623EDAF5C3AA1A79097DE5FCF5E4706B34BA892 mosespepperman
529,717,454 *362CD6E9E32526C3CC4EAE6373E2C0FF3488B965 MOTHERJACKSON
529,717,455 *3625D281E515C2BDB6E0A96FE3963B63DCB03A0A lindseygalvan
529,717,456 *3625DCCCEA40DE40349587EF2B92BEDC860B7B35 @#muse
529,717,457 *362119A7A7E4EBCD74E1109CD712A3E730676877 MUSKITS
529,717,458 *362AB589F50EAD3E69FB4BE28544974A9E203714 @LIST.=.<LIST>;
529,717,459 *362502F86547584807E610A719EA6BC88A8CCB39 [email protected]
529,717,460 *3623115A3216ABCAA0ECFC940D5F877B38B27CDF [email protected]
529,717,461 *3627CBFE0A60B60BE33F3BD61717FC94FAC6D51D LKREICHMAN
529,717,462 *362624CD3530B8BD6B05C7BD93E675C3D3AFE75D LMAGLONE
529,717,463 *362A071AAB4343CEF1B001B9D19070D0B7E80B68 mysochkel
529,717,464 *3629888C3D168932F66F1DA9389176F1F04910D5 NADINEPAROBECK
529,717,465 *36257C9CABB8DF5126EEBCA4FF2F5D2A280B31C9 NAKNA
529,717,466 *36290FAAA5ACA44531337E31DC0DA1940906FECB NAPOLEON.MCCLAUGHERTY
529,717,467 *362C3344CCCF4A102373DA931738895CB6D1717E LOSSIGHEID6
529,717,468 *362E472DACC52DC43D3335C62C87E6F47087D414 lowland.forest
529,717,469 *362298889FD085E5A8B4ED9CC99186113A3DCA29 [email protected]
529,717,470 *3625C225825C139CFB9AB685DC58AE794D2BEDC5 Nchfrn
529,717,471 *3621E0E167A98B864E2D7F25ECDA07A1E160B71B LUCIENPIRONE
529,717,472 *3627A235324E388A538E6283ACBCB0E4FEA11DCD NEAPEL–ROM
529,717,473 *362DD6FF609EE983EC494D22DB7814A393886A18 nelson-atiencia
529,717,474 *362B1DC4F90C7937059309D21569389C036E0094 [email protected]
529,717,475 *3627B9D6254ED8C9B6F3AA154169ED12352A5198 NENOZAMA0
529,717,476 *362791283CFEF1113AD87EDEF60B56F00FDF1A28 lutherguerrette
529,717,477 *362809C1EBDED2D5775FA4CCB9B6D8F6B55F3AF5 NEST31BBS
529,717,478 *36291BFF52CC58C605514A966A17F262F38A487A netakkah
529,717,479 *362BB9B5394B037AC40B5FC55C85D718C709B26C LYLE.KLEINER
529,717,480 *362C4C2C79711C278940783E4271C43E97F7728A lymangowda
529,717,481 *362809074A762B3990FAD7CD7E9AB8E165786222 LYMAN.MACNAUGHTON
529,717,482 *3624CFD98FE6773D909D69383BC50F5450CE058C newsjk
529,717,483 *362C1640765A561CFC87C0C9622B6F0A12ADC8F4 m3t4t4r5
529,717,484 *36254E7CBB02EA15B7E33FA26AAD5BBB90EDFB1E NICKY.REICH
529,717,485 *362E296E583828442D781150E840BD34D8492AAB MACWALL
529,717,486 *3624FD4413ECA707BBDBF7F69E1A5EED59FDB410 [email protected]
529,717,487 *362DC08D7D9650CD868B20EBF8E538F2F655E797 maehirak
529,717,488 *362DA05FE845CDF01B2859BB5900392D3E54FFE7 no.CLEOPATRA Youlie
529,717,489 *362275D93A1BB11BD1BAC6C59B55A77E5366D66C MALTASES2
529,717,490 *362159C5E8BDD056DC04E6609F0227E1946F19BA NON-ANALOGOUS
529,717,491 *362F52171ADB932F43E92E0B034373C2FAF66078 MANUTD3
529,717,492 *3629C22C38C3EB1BDC316BA6DF3488ABA8495190 marcoshudnut
529,717,493 *362BAB77DB6632725A5728F622F5EAD759B2D83D MARCO_SIMAO
529,717,494 *362F6BF7302ED1D3310B7FAF8944C3D42406ADE3 mario-castiglia
529,717,495 *362FCAAEFFE3EF99BF05540718DFBED44762DD65 ボイスワープNTT東日本
529,717,496 *362885BBA3DD4FF279D313E6E7C13EA7B3486852 OADJ
529,717,497 *3620174871E00F414C0FD706AA66675F376AFD67 marxisis8
529,717,498 *362CD707448B1E0E2AFB6213A06A70F011264F67 MAUNO'S-BOOGIR-(INSTRUMENTAL)
529,717,499 *3625CF10D000A73B8968888623B1820B3F145F82 oiznunna7
529,717,500 *3622F4F35CBC409A198905F879BA2D96070C4798 [email protected]
529,717,501 *362A5B64B9D3F0CA9D1BFC26796B937F2E906982 MaximKotkov
529,717,502 *3627AF134E8255F20E5DA814EF24ED0736181D96 omarperla
529,717,503 *36226E6690982C61ACD3EC6A16C637E00AEA208F [email protected]
529,717,504 *362F08F1550DA87B7B360F72445280B20DE9D82B [email protected]
529,717,505 *3622ECDC0BB3CD2A51D2A93A68A10E0D6415561B ONYO1234
529,717,506 *362CCB06551DD30CCA767591045E0775451F647C MEGANPERRONE
529,717,507 *36207CD414F9DDEA94F5F24C7AB80F1BB5CBAFB8 MEGRABPUR
529,717,508 *3625D722F5AC5240F4880ADD139107567D2F454D orfana
529,717,509 *362059E0DD56770DD5F67E7491DACFF3B66A4F02 MERLINBLASZ
529,717,510 *3620793D17B7673417D69FA0E5C18C5703B37719 [email protected]
529,717,511 *362CD1E8B4B19F63448B08C5261434CE243F66E1 MF|;
529,717,512 *3621949258E9AF2DAED4C4299CDF62F9B92F8319 OSWALDO.WILKOS
529,717,513 *362931E33A790EF22E2A640E6F9B9F9272358C16 OTACILIE
529,717,514 *36261A7CE969924BEDC928561E8768E34237CB2B MGRULKE
529,717,515 *362180E5202BF918FC0ABAC7D0EED8574BB31061 MICHAELTRAINING
529,717,516 *36213163397B6547AFF0FA0D22D6FDBBDD0EA9CA P41MO
529,717,517 *36268EEE9C076BA1A1AFF6BE5A59109C8EBE6081 MILTONWURZ
529,717,518 *362F0FB9ABDBFB364CDCA6805E44F81345571507 mindestauer
529,717,519 *362D4E9BF952901291303A69CA64D9E53BFA486D palmergronvall
529,717,520 *3624F80A532DAC8D447F8AFD9E156297F3EA98FA MISSA IN F-DUR, BWV 233: III. DOMINE DEUS
529,717,521 *362E3E0BEE56F7B2DAD51B120B8E9FAC243B7C08 M+KBAA
529,717,522 *36299C82BCD99EC800F827958F892E0B7AA9BD89 PARIS.AUTOBEE
529,717,523 *362E7BB9CE4E4E29A345D47827E27AC1D96FB0C8 PARKERSCATES
529,717,524 *362D9283A2900DE566496F1C3D878138C260001D [email protected]
529,717,525 *362F2865D4FEC86A99F6931A6F7C2DF5F050A335 PARUL-BAGLA
529,717,526 *3626E5E07869D06FD6C3CF0EA8F722E782BFF0F3 MOCYENOH
529,717,527 *362BADD5EBC37B133632A0423ED20F6D3DDB9AA1 PATRICIA.KLEMENC
529,717,528 *362B4DA870162894C4A86239718F6809973AA940 MOHAMMED.QUIDER
529,717,529 *362FE472A30510927550D73436880BA355271954 patternsnotpeople
529,717,530 *362F88C7B66315A9A0A42032B777BB0D442B9802 mono+hes+
529,717,531 *3623C933B6E28FF05F9CF815F60CAE4202A9B4AE P-D~0~O(O_-)
529,717,532 *36204BBFC1843AA9CB6E00AA5A01C249CCC1D3D7 PDUSGOVMILITARYJC
529,717,533 *36238C26C708A2419DC6C4BABA7D5B8EF196F960 [email protected]
529,717,534 *362835690B028B010825EDB3EF9FBFE7627B95AA MOSESMERKERSON
529,717,535 *36285FB5C9571DBE7CB0E4679D9C23DDD8AC56C2 MOSHERIFFEE
529,717,536 *36267460820A7A8CD2E61EB2B22657980BFB2ACE peshk4r
529,717,537 *362E73CFFF5B63ACF9D093EAAC484CB72D56997F PHENOCRY$7ALLINE
529,717,538 *3625E6DD8D9FD6A699A3A243261DBFC05F196DD2 PIECES-PITTORESQUES-5-MAURESQUE
529,717,539 *3622F15961CDE79072A443236D1468031F898D56 music-relocating-that-louvin-feeling
529,717,540 *362ED437164923F551712E6D478254E1BD5C284E plsaintcsairedega
529,717,541 *3623D539ABD9FD7A15B14522CE53F4E5E5E3B4AB nadachuru
529,717,542 *3622FB643C75407A5FBBE4B73122AC61F6E656BF POREYB
529,717,543 *362620606AF74A97CFE1FF7461AD2F476744166F „NARRENTAG“
529,717,544 *362881EE4A0F76D99D8C9849DEC7483C04322EAE pos7v3ly
529,717,545 *362AB5EF842BF12B78A3C5142BDC1156955B1984 pp~ `
529,717,546 *362D2261D1A37995F814BC24A8F188D6A444189B PR3$3NTAB1L1TY
529,717,547 *362877AB1E598F164B5C5D386F7C19A01D5E5EC5 neat.neat.neat.(peel.session)
529,717,548 *36239E8427AAF1A3E80869375F475DC70B34AB36 prefakitajpwww
529,717,549 *362B0E8AD4908527FA7AD236F83D0D57C675CD04 NEIGHBORSANOTHER
529,717,550 *362B54A7299599E4412CAFB3EBFCAAA30DC198E0 NELANOR3
529,717,551 *362BBA0E26734D7334046839E736E4E0D30AC8CC NEORGANICNOST
529,717,552 *362338356011E755EB74576F8537CB0A17CF0D7A NEUROEPITHELIUM9
529,717,553 *3621AC9E0FEECF1AC9C8091B649F020DB7CC8D59 nfl-history
529,717,554 *362FFC680D27213F135F62ECCE35CAB128CB5880 nice.swan
529,717,555 *3628C91EB40BB605F084C9DB118688B006EF6B9A NICHOLA COX
529,717,556 *362EA5DCFB4161D68AA6B50325D58CAEEF7FF943 PSTLBLLY4
529,717,557 *362ED96EA6852BFF3DDFC20ED8A4342947626DB0 NICKY DUNCAN
529,717,558 *362B345EBAACC8B25F97149FA6F6CE73FE5BBF5A NICKY HARTLEY
529,717,559 *362F050F8765518686E9475E771C5755040E44D4 NICOLEANIMALS
529,717,560 *3621DB8581BFB45AD067264EA7083158AF4C6CF1 PW,T
529,717,561 *3625BF6C5AE7F04B38B52751CA0FCDD96FE4C837 NILSUNDCLARA:ICHHABDICHLIEB
529,717,562 *362A1725957FB368D41B5E1B87338BA6ED413D86 NNPHNTCLS
529,717,563 *362C8C48BAD5654C7764263745570360EAC87957 QINDVJEÇARIT
529,717,564 *3622E085CECEF3B20DAB6CA1BDF886969861FB30 Q->~O SPLAT!!
529,717,565 *362CC6A714F71F71DA9BC5D21B641C61B3D93DA9 q======p-~o-~o>-b0
529,717,566 *362CADBE6426D5F5B419A48113A8EE5F1A454793 NORMAN.BURKHOLDER
529,717,567 *362D61FDBE6D52237667AE86D756CEF16DDCB612 NORMANDMOBERG
529,717,568 *362604511BD6C43FC3E671B3FF092865D7811580 [email protected]
529,717,569 *362B2583EE0355758D37CAEDA11EA21BEDF77DD9 norrishim
529,717,570 *362170E2AA95C855D27DE225096F5A48BCB2E63C NORRISVIGIL
529,717,571 *362903921B6B980F293B76BBD25E852BA3981560 NOSSER66
529,717,572 *3629C5ED8AD71B1847DCA334A643F46550299EC3 [email protected]
529,717,573 *36272F444921BC42FDF811BB8928E88F1DF22342 quiem-Kaddish
529,717,574 *3629F44EA7B087C8654DED3EECB8760A1E339F14 QUINTONTETERS
529,717,575 *362C14A4702FFF96FFE8A16D3FB22B024CA1A8C3 nsteten7
529,717,576 *3624C6B322479508A9F0888B80BF79961E2406EE R{*
529,717,577 *36247B89AE0884C5F980B4951FC2346F4F3FD54B NV(U
529,717,578 *3621E24394E353F153CDB62B0132E1226B179523 O(ABAA
529,717,579 *362D43771A2774CE2C990A35236FEA4C96F7E520 oaky.miller.and
529,717,580 *3620463DB19B97140C5A83BBDDDACEC4EE5D0D15 RALUCASTEPHAN
529,717,581 *3626B7393AB112B5A21279B335125C59E91878C0 OFFENHAMMER
529,717,582 *36298C57350285AA2D8EAE72981EFEB16210D333 oio?
529,717,583 *362E2BAE665D34809049EB2DC911AB21D2905D4D OMERROSBORIL
529,717,584 *362116571BB1AB368359F4A1EBB474919175A960 REAKTORDURCHSATZ
529,717,585 *362378A6271FC2581D23563556719EF667B9B094 REATTEMPTED?
529,717,586 *362B607100D7609A05492F82720D71FEFA8F326D REDLED SPLIT, VOLUME 1
529,717,587 *3621A68B7D07EA87DB35B7C401508ADD3C4C50E8 REED.KNUTESON
529,717,588 *362E1B0F70729118C43C7922017097F2ED8647D5 open-up-your-heart-(feat.-louie-austen)
529,717,589 *3622DA701B10E198CE22F56689A146C042287A91 REENEDERED
529,717,590 *3628415B2634B7EC9BA48B1866ECADBD5B756626 opmaco3
529,717,591 *362965D9801F6EADC81538937674D265408BB1F8 [email protected]
529,717,592 *362BFF9E29AE3E0A816F4858EF9EDE109B9E2F22 REIKIS
529,717,593 *36282413533558D8FF87CC989E0874600053D133 REMO.BACK.(SKIT)
529,717,594 *362839C2C36BCCF0B03BEFF99179354A45CE28DD OWENFAULKNER
529,717,595 *3620B11CB23DF8CEB38132FF0DB5DCDE4C6C5DA6 REROLJAN
529,717,596 *362433D908ECFA023721783E3EB3B64EF905BAE2 RESTRUCTURED5
529,717,597 *362997B41E0B960385E200D45E8001B445BD4A88 P0RPHYRIN
529,717,598 *3625D49ACC2960018090E49A19549C5E744BDB80 RETTOLUC4
529,717,599 *36296CA95BD69BCF4FC1AC6CCD9B6C39DACC534F p2\
529,717,600 *3628A81029F99FDF85F1903321160D96C3F2B5BE PAC*ITPLUS
529,717,601 *3628FFD4FAA70A7CDA407CFE3091CDACA3B7A3F3 pariscollis
529,717,602 *36240A8B1ED7DB639A30C3D87570A769B1F7CCEE RICOPINEDO
529,717,603 *3621410E8B6AE0D8136319F8B1A0DCF245163AA0 RIDE (TI
529,717,604 *362E2A0430CB4A4A212805FCA6FBE189FDBDB372 riederlaud
529,717,605 *362A31EB1573CF9050FE2BF4C68DA7ACB77C2198 PATRICIA.OPHUS
529,717,606 *3627BA7CFDEDE847FAE68F018F6D4912AD9A73AC patrick.cananea
529,717,607 *36231BB8E6C544809752437DC1E14DECAA15FF5C RNNNG14430
529,717,608 *362BCB3A2C429DFAD14E975F4E421DB149D05B31 [email protected]
529,717,609 *362B517BBF528A188A1581ED3D20F3643FC2E7C8 robinjilek
529,717,610 *362E6E43767EB2A2F60C81A247C061201689E802 ROCHELLE LOGAN
529,717,611 *3620BA181F9E03178E79150299E6877B0A8410E3 ROCKY.SOUTHALL
529,717,612 *36211E584D9B5AFAEFF2C1C5298E4DD62ED52008 PEOPLE LIVING IN SHADOWS
529,717,613 *362D203D5D29FE27287F26A2DEC0B421C7893722 ROGER.APERGES
529,717,614 *362247D14FC2EC003243EADC5C032094A832A95D rogerdumes
529,717,615 *36237C1F06D39E92427DC46F7D390CE8AECDA210 pernambucostate
529,717,616 *36253786EDA4A9DDABEA39A1A90061F4CC0CDBDD perronkaartje
529,717,617 *36206CF7E934A2D076CACB662781F88A14F1F448 roytrausch
529,717,618 *362AB5468161175472AC3F1C554F954F09EA4C8A ROZ
529,717,619 *362FC3C29100102D93417C11D85276ECCEB49C2D PMID19190809
529,717,620 *3622EB9800263D3F4DB0FF66CD29ECB23F4C281C p#)~ (o_)
529,717,621 *36265150022D91EDBF7E4A123DD9DAA8386ABBEA p###@-~o-(^_~)
529,717,622 *36298061EE9944399F5279946D577A6679CFEDFA RWHZQWCZVQZQLUED
529,717,623 *3628C4346510E95F5872CC3017B5832416F90141 posmoh
529,717,624 *362A79FA395A62718F4553FDA26516CC62F55019 POTSMEVANJE
529,717,625 *362C7029233060F5D23A87A06E21C4F4883183B0 P######P-~0SPLAT
529,717,626 *362BC87E4543239B072654D67E1B9278054E0068 pr3$3rv4+v3
529,717,627 *362B8FEAC7D80C73B0C08949A3FB026CFB7CF4BA sallydada
529,717,628 *3628F35E886ADCB0B68CFD8840883969CE72B7B9 PRAKASHCHHAJER
529,717,629 *36281A9D13E2AE84D71587B04E4D499AB7F773E3 PRANESH-CHAKRABORTY
529,717,630 *36238E0DFB185CD7AC38420CB76B3C05786DFEEA SALZBURGHING
529,717,631 *362CE7EF264F1D62F50BFBC91BE0923B189783D8 PRECIROSA
529,717,632 *362E29FDCF4943ECAD60B23AE398FCEC23C85193 SANDRO:E61728E835DC43D2B7BB0D18CF0400A8
529,717,633 *362675BE30C117430622ADBEAED003282E8A8403 PRISCILLA.CORBETT
529,717,634 *362425538CA74AAE01EC581E3E9F5680DF4576A8 pro100pro
529,717,635 *362728A007F80C80A8578AAB11834CAE4F8902B0 SATURNFOUNTAINED
529,717,636 *3628D76F8B2B315114A78B05CB05DAB3CF2051E8 SBORDONEETAL2005
529,717,637 *362B0D5718CC66228104AA5882E9AB4EA75F50D8 PUMPKINEUGENE
529,717,638 *36246A42CAB9630FDB2097DB384257BAB1956427 schmuggler/ns
529,717,639 *362F921EEBCE3498FB0E38264FA0261BA149096C SCORRADO8
529,717,640 *36274B36105482239C29FB2931238F72FE3BED6B q------D`-Splat
529,717,641 *362346323EB824511D2FC210F3C5DAFBA7F11CBF sea.fishing
529,717,642 *36288A06A524669293D7702670C59AD02D32645F SEGATNEG3
529,717,643 *362B5DCDA8B2F08078C501B5BD6040655A2BC8A9 SELBADNEF2
529,717,644 *362B7F8A742F505BB425D06059053CB4C02DFA65 SELLEERR5
529,717,645 *3627F392EBD924A036F30E60E985735DF00101D2 QUINTIN.DANTE
529,717,646 *3629BF2B93A133C890B92E74705B5A346C374CD1 sensificatory
529,717,647 *3623C191E5D828CC7535101DABBBF4478E611C22 SHADOWLAURA
529,717,648 *362A768D13E722A9570DF942255822E19C987508 ramizmohmed
529,717,649 *362E5389F45DAD6241582B91E5C5613EA714FB06 randellcapley
529,717,650 *362BE5BA0C690D169C315B41B0087F73D6BB192E SHANNONHOLEMAN
529,717,651 *362EF838877078AA9D96416F7E18BAEE3E390DA1 rayong-desambiguaci
529,717,652 *3621003ACBFFCDD505FC8DD94A99C911BD1E11E2 shither
529,717,653 *3628C477BEE5E99C56B78EF56CF4CC79775965D3 SIBI101
529,717,654 *362219F0D34501DE4FCEC9A8D088CB8FD76B6B04 rekesha4
529,717,655 *362A3E2CDD889FC9E405CD611250A2274210FBCB sinfoniadomestica,op53:ivadagio:langsam
529,717,656 *362D3D77EF1801ABC8046D92B14C7D046BE7C7AC RENEKCAL8
529,717,657 *362CF6B34F64E0F30D39C9236DEA56CC47DBF978 REPRE$EN+A+IONAL
529,717,658 *3624CF25AC0443C3D349D99E7ECF3917DBDB296B [email protected]
529,717,659 *362E40127EC140C1FC9609BEC678EA815F85409D RESPERES
529,717,660 *36291A292A5A06004417B2F0BF087B12D1469D06 RETTOLUC4
529,717,661 *36290EC8522F990E96AEA6E84C1342038C786A21 SNREBRAC
529,717,662 *362E810B1EF10598A740184454A3C776100B21AC SNYAMDULAM
529,717,663 *3620ABE4C2286787BC9F0D536DD162A0C0F34E6B [email protected]
529,717,664 *3623B9111ED225DA03A9918B4E8482A7057AF9AE SOLOMON.TRIPPI
529,717,665 *362B4E06A8331A033205FAA570C8C8E223A3A2FA some-advice-(skit)
529,717,666 *3621DDD07ACC9AB3F927C01D916FC12B876336E5 SON9F3S+S
529,717,667 *36286B724F4C2841C43F3F93EDB25B7F1DCA6133 robbienelon
529,717,668 *362F0FD2CA6A8A5551C4A80C7BBE21E025A277C8 ROBBY.ARMANT
529,717,669 *362668373DD4D3014F30638467E6B4AC9E8EAF83 ROBERT.BONJORNO
529,717,670 *362C678A53A6FF5E13949DF6667F5EEE7270AACB rodmandeadhead
529,717,671 *362B0BEE19FF4ED091DA793D220A74F052D94E81 ROGER.HOYOS
529,717,672 *362FB9D26BD6B497C241E9A0CADDE54684106ACE spnlss:
529,717,673 *3623F0BB3A5B54B4650225A397F05D4E90372832 ROLFSENTA
529,717,674 *362F40FAE7B40F7B81638A68B59253B0E98FFFD8 ROMANTIC-VIENNA
529,717,675 *362740E66CA511FDA389D1DBFFAB4225E919B80D +++SR
529,717,676 *36297595667DB58F3A8CC4671DD19B3F76E2EFAB SRBCSN9NR
529,717,677 *3622A558558C9034ECFE689C99146A08F6BC68EF rooseveltmcmillian
529,717,678 *362D1D725CE5300965D0C3491F736558BDFD0F8B SRETSEOPESSA0
529,717,679 *362ECF1EA87C4ECBA8967A0A48F5553969FBD531 SRNGBLSM
529,717,680 *3624F619BE69BFECE491486B2F0C0F795F7DEA90 ssenrodagroto
529,717,681 *362E5F145BED22660F25931368266E64635301F4 STACYTEET
529,717,682 *362BE5C739A9033EE60322633B7004140546FAB0 Stadttiar.(feat..Luut.&.T
529,717,683 *362F4767088551A5287072D198A1EA973DBCBAEF ROZ
529,717,684 *362831FD9DD7C0D937BDD4E35D3FC4327DAE157B russell-leary
529,717,685 *362C31A6C4CE2A69A0E0F4D0DDDE1A5EDF30D576 stewable
529,717,686 *362F5497BDA7657ACB26FBB7A2845D9C16410E2F STIKKES
529,717,687 *362D65AC7A66DD6AE68D63FC1B9EACCC498AFEE0 [email protected]
529,717,688 *36202BD873E0A1875CB707EB6A6493C265327CBA SAGATAVOJIET
529,717,689 *3624D9AF3522A98F0AF9FC6CCB06D68CE16592BD SUKKERROED
529,717,690 *3621118DB5A85CEEE10B8158DBEF21DD2BF8B121 SUMEDHA-KOHLI
529,717,691 *362D5B95BA0E5B5FE7433C3FBA1ACD98F8FDF6F4 sandyscantlin
529,717,692 *36280778D33E6DB04FA55D86D901BDCC515AF7A6 sunvirtuallab
529,717,693 *362FDB488FE264419418DE444F2A29FD1FE78AB2 SUSANNE310
529,717,694 *36256C1C9AD78ED0444BB3CC8D7EC9F3511B56FC SWANK4ALL
529,717,695 *3626623041DF57B80E311D44FD77AEF10EFC1CA1 swatipanday
529,717,696 *362CBA466D8C5C9EACCEDCBA8017BBD153B995DE [email protected]
529,717,697 *3622E9167C006EDCBF6F0F30E15AD5CAEB22F100 SWELLSJRDGT5
529,717,698 *362161AB049FD38C9D04391F7FE0B7278B558E96 SCANDIATES
529,717,699 *362D81F14E0DE9A662534918B9DAFA581D420022 SWONGSINSAKUL
529,717,700 *3620732710D1500836D481B1B19DDC02AC8C6896 S'XM
529,717,701 *3623C248BD0ABD6FAB9D625A06F6637599F0F3D7 SCHLCTHF
529,717,702 *3623C9E6BFF4BEE8E7F6AD2D1D37404D3A3037A0 SCOGLIONANDO8
529,717,703 *36286684F3232316BD9BDBA93FCCE65CAB3ABCA6 SCORRADO8
529,717,704 *36244E043D5D1414DDFA279760C2C9033895E085 [email protected]
529,717,705 *362F250F25319535598082253C0D87FDC1990053 sealy's
529,717,706 *362BFB99E859182318D068DCD04AE9225618CD0D [email protected]
529,717,707 *362AEC27D8CA4CC0ECEB300819C03A16CBE9E7EE talk99244193196
529,717,708 *362FED4D0FFEC842FEB0D4FE77F3A0D452A61052 SELLEKSROFSDNATS
529,717,709 *362AD1A5A1AEF8373DE954D81794A0D06897E301 TALKKISSIES
529,717,710 *3624A749B39887602D66617BC17D77F8513EB853 TAN369
529,717,711 *3620EBC5299E46F365D79FBE405C0CAF75362517 TAŃKOWSKI
529,717,712 *3629DB450BC9CA00C83FE0A84E58869C66F7204F TANNERTRANI
529,717,713 *3622E4F0910481209B81A3AB947EE69769AF4E91 TAYLOR ZALEWSKI
529,717,714 *362D465652D15D94DAD797DAD96BE444785AF4FC TCPIPIBSW1
529,717,715 *362444684C2A6CE59D1671537135FA6D7DD7CD58 TEDDI-PARKER
529,717,716 *362CF3AE7C66BFC9355338D3D64AED09C8D57536 [email protected]
529,717,717 *362CCD3E681B5887BED3A7FCDD375306D6862529 terskei4
529,717,718 *3626FD7B97BF3A9F6E1F715A0522029C346AFE1B showing-out
529,717,719 *3623ED01F7E364CBE1B69A1FA761AD72ADD51D58 SÍIHEN
529,717,720 *36291FA1BC10AF1F24D946A16C4C1C762C7F955A SIMBOLINO