List database


# MySQL hash MySQL password
458,260,001 *2E8E33A2B4EC248BEFB247954E60989E5B6DA7B1 RATNICKE0
458,260,002 *2E8AF7754C95B203A7FE6E2BA5D33AFA8DA68CE6 RAYMONDBARCELO
458,260,003 *2E89369E5DA6B3D6ACD81D49C7FC2952969958AE screamerseries
458,260,004 *2E8E053006627ABB35B3087D9468500EBE3868FE zahymenashe
458,260,005 *2E8D22F71729D9382D386DEA1D9846DABE245A5C 2801214 h
458,260,006 *2E809710E67B4C7DF28F4F60E543CD4B66FA2764 zehra-hatipoglu
458,260,007 *2E89D804BFD15BD0FFE3891895418E7544548DB9 ZELTINGER9
458,260,008 *2E86EDBA69B397AB5C36B8C9F502EC81EA6F4D6A sélînonte
458,260,009 *2E8608AF7668B0836C4B0B7581EB0FF26B56AF0E regimencitation
458,260,010 *2E8EA0EC9B02057B3D0A566BCC6445FAFB970C65 reginaldcountess
458,260,011 *2E86F3A0DBC0C07CA2C69823BA88F40C75BB07EB SENEVEY8
458,260,012 *2E8D2A5EFDBFBEB531E6493A51004470DD1AC08A REIDGRATER
458,260,013 *2E8AC050142A3569AC109804E6993C4786D68E65 SEPP66
458,260,014 *2E850241F02C70EEA8DDFF15EEA8DBF3310A25E7 serflike
458,260,015 *2E8464639FB960A7582B0A8DBEC9DCB276B5318A sergiofringuello
458,260,016 *2E87A735C8DEBCB91E8F93DE10BD43101D49A56C [email protected]
458,260,017 *2E87D235CC8F7595FDBB54E26CEE36036E404D95 REJDERMAN
458,260,018 *2E80EF92B989A6CA6308971E15496E2B801048F1 Remember.Me,.Oh.God,.for.Good
458,260,019 *2E82991F2BF4B4D381ABC425894BB04E17E3FCD1 ZHUYELIANG
458,260,020 *2E8950C408D1552482559E5053FDC1E18021E09E ZHWRTCA9
458,260,021 *2E881892EB04E444CA6476EFF3CE59F81CDE06E4 ZINNERAZAHRA
458,260,022 *2E80CEAF8DDCC8A15D56CD2259AA0ADE76C2F13D [email protected]
458,260,023 *2E87B96FCC23587EEECD705A5D9900124621D474 RESA-MCGOWAN
458,260,024 *2E84B267BF4C550742D26BB7413842A1A13DC9B4 [email protected]
458,260,025 *2E8A9B3166BB6AEFAEEC3CE41B24C27158039201 RESTAURIRAJU0
458,260,026 *2E812D8117583BE59554E3C6908EB42C8ED695B0 2PMDAVIS
458,260,027 *2E898EB49C460EADC6EF839B2A284E808DEE8E94 ZUNT
458,260,028 *2E8EF0D9B8D9C31C66E46E90EC91D28507638830 2-renitec
458,260,029 *2E821AEC3FA68A8AE0851571074EC77A22D95E5A seymourbloxsom
458,260,030 *2E85B80D9E17A10C609F85646F2E849232E322BF [email protected]
458,260,031 *2E837ED3A304ED68DF5BAC22FF009B17456D5F92 2SHUTTLEJ
458,260,032 *2E8F414BE980BC01E695A8949E3B401C0DFD9934 shaastued
458,260,033 *2E83F9F1E83EFB98B2E6C2857DBE20FBC91CCD2B shakesbeer
458,260,034 *2E87657CFE32F5D3AE50B950456D205E5D8C31AB 3==>-~0~OSPLAT
458,260,035 *2E8E80A3540C66EE769E312D2A1589AD262A7B76 39918 friendssayhe'sanall-aroundnicekid.
458,260,036 *2E8CF10E56333DC328AC37647E52E40C3ED99C23 μερίκασ
458,260,037 *2E83809F09BC8DD02E46FD177D00418DCC32850E SHAUN.SHELNUTT
458,260,038 *2E8D19571495D896787BB3FC8279232133FB5E84 SHAWN HAIRE
458,260,039 *2E8183B7A9D00E61AEDA2EA2CBD6745BAD56A328 [email protected]
458,260,040 *2E862F8BEEB6079E98BA57C80F05009F0672EDDD ΦΡΈΝΤΡΙΚΣΧΑΛΝΤ
458,260,041 *2E80D61C00BCD7FA87D365763E85EAFF0669CE3D АНТИСПЕМ
458,260,042 *2E8C8397AB75A9EB3FC9E399BFC778EFB3F8862C АНЫҚТАЛҒАНДАРЫНА
458,260,043 *2E8B17A1D7E2DBA739DBA2440C08074685951239 3FRAMANA
458,260,044 *2E8201D5586C36B3E68D22DA560C8E54A07EF8A6 shekiamcintyre
458,260,045 *2E80561D1B843758C1760BA07159B8592D4FDB46 витезите
458,260,046 *2E876036CECBA1CD4F36B964C918C4B850F4B039 драгаљско
458,260,047 *2E8DDD86F4D009433A7AAA413E8E168B6B769726 ЖИДКОСТХ
458,260,048 *2E8F87EEC22C68F94446F7A812B27E53CC1DB65F [email protected]
458,260,049 *2E884603D45DE6A1FBC84330A9102EE250BC3529 rironses8
458,260,050 *2E8F874F1FB58B510A17F49F9D0C6BEADF8EE17B RJDEJESUS
458,260,051 *2E8BC0C01E5F0F422DDE2CF0123FB2146B0B3821 roadshop
458,260,052 *2E8B06429C29036B1E64EAC02EFCF0109CFCF9A3 ROBERTO.WINDROW
458,260,053 *2E8F9B92DEC828B466538E16E7BBDA4A7E9C9EE7 rob-firestone
458,260,054 *2E82A57F29D0A59D33EC0E6F69B758918888B109 ОТДЕ­ЛА
458,260,055 *2E8C538BDB426C555D76B5F96AE405D5B3AA9894 ROEVWADE
458,260,056 *2E81D9625D99BD152A4D8B44CD6585A422089E95 тему
458,260,057 *2E8E17E51A37DD96E725C7E39AF8928317179204 4-muddetinden
458,260,058 *2E8D1618572CEF9AD3FB2ACD4F1B457ED8DAD758 sleepyhead2
458,260,059 *2E83D9B10734C4537CE22C3CAFC1500FC3731F15 4SUAONNVFWVND
458,260,060 *2E84B06738DBD27F3A21C4CF0A35C100F8BAB0C0 ROZDAVAT
458,260,061 *2E82FAF5F507F176C90A612E072249A06E4BFE6C 577024 tilintarkastajina-eiv
458,260,062 *2E8ED7126F59C7CA91A81D89A5F8585B95F3E8A9 smpnmtc3
458,260,063 *2E82CB273F9D07BFE54C2B0F7AA8DFE972F3F7F3 RumstiBumsti
458,260,064 *2E896556EAD82BE7A40219B7246753A9862D03D6 5DADMVWHVDYQL
458,260,065 *2E8803C77738D5D6A1DDEE4954DE01F73A96D0B6 5DONNAWHALES
458,260,066 *2E8E39021D4D5D3FE1F368A10620D6C5CE920F39 rusttijd2
458,260,067 *2E817F8D911772AC9F5CA70F0587BB65627D2D60 S4656440
458,260,068 *2E8182540BC8AEC9D50D091C15FB55BF05F273ED S4NGUIN4RINESS
458,260,069 *2E89CDA5F76E05564DD887B0184B398167687A0E SAAHIBAA
458,260,070 *2E8541EA50C7BE783E9525AF058965EB0C9C43D6 so-you-are-here-again,-shadow?
458,260,071 *2E82E7E2DC06AF5D061DD11B19287D71CDB7B51F 5KNETCH
458,260,072 *2E855C6CCD41037AFC1C673513DDDEEF19EBC3B1 sadchic29
458,260,073 *2E81E3D83191407448E7E81AD72FE47BB80C8019 5STUPIDQUEST
458,260,074 *2E8196F5BEFB3AD97BF4531590CFF548140D15E0 5SYMVIWSOYN
458,260,075 *2E830DDFA60F15B0880A69B725EA10F76038739F 5TENNISCHICO
458,260,076 *2E8EC99B921A2B907E1C11C22E327D9C9AC0246D 5thenisse0
458,260,077 *2E87726627534D21DC4BFB0FC122FDA1EF35B780 SANTIAGO.SULIN
458,260,078 *2E86F9E4F9BB3EBC91189DD776CB4577EB4616BE santibanezderesoba
458,260,079 *2E87E73EB8B66FAD9E5520B5505D366557EE0183 5WAREZCINDI
458,260,080 *2E834D0CC4C53121E04083A2AF4F64D2B516B12C 607-kysell
458,260,081 *2E84F93ABCA627FF02397BA3FA9559BCADA771FB sploit ~ ~ [email protected]
458,260,082 *2E8E9AC07F23C9ACBFEECF752FBBD10C4589A01A sports.central.(30.second.version)
458,260,083 *2E847F5091A8263AA23206BE5DBA0CEA9A39E294 SCHMETTERLINGSDECKE
458,260,084 *2E8A1E52F5B34DB488FBADB1C8A1C77AB3A2C17F SREHCURS
458,260,085 *2E8D5965DD78970E9D87EC2286C6AA01DCA869AB SCHNEIDKOPFPOSITIONS8
458,260,086 *2E8B39552214B3FCDEB842671DF0354B8D35F444 6ENENDOCI
458,260,087 *2E8473EA304873F71233CB0264A711BBAAA2134D SCHUTTABFAHRT
458,260,088 *2E86D34E3F3120315503F33B7914AEAF5CD16E22 [email protected]
458,260,089 *2E80E7B243BB36DE3F4FC8CC0F5641CA61F2B4E1 [email protected]
458,260,090 *2E883E7D91AAED34C2AC3EB9DA5F08607F2381D9 STACEY.MAYS
458,260,091 *2E8E46F91C1910C14AF3A6809297B7EA7499C951 scotcallejas
458,260,092 *2E8D74C76307520029E86085355F7555A428887E STACYCINELLI
458,260,093 *2E86A28AA17BFBA5BF7040F35CABF943960C6DBB stacykar
458,260,094 *2E849A065913E11B99BFE91DFDC7FB8EBC36684A scottteets
458,260,095 *2E8488723A18A141FC0FC13ED1DA1A8BD53FD46E scuba1y
458,260,096 *2E88DAF0121010CB6476AA2874D295F27211F4E6 6.matbaasInda
458,260,097 *2E8A1131595FA6B95A5EA058CCCFFA8E14F33E89 SEANCES
458,260,098 *2E8E6C79CE2B23595BCEC34C8A000476664DD328 SECTIONINPROGRESS
458,260,099 *2E8404C8ECC0B7C70D44181C980B63393DDD15CE 6PRILOZENIM
458,260,100 *2E8F30DEF03F09126B9995E80D64DAB8EA580531 6PROPAGANDAMINISTERIUM
458,260,101 *2E8F5E4AB60FEDE5261B1DCAD5E46A108AA0065F 6RUCHIRA
458,260,102 *2E80BCAB1C1937BFE2FE6FEC2A5EC94C12128779 STEPHENGOODING
458,260,103 *2E8E269AC838A6DF3397B4DE49F32532BE6E741A SELAOHS
458,260,104 *2E8FD02FCB7D8631FA8813D6B5AC35E5ABCBC43B SELEANIAED
458,260,105 *2E8EC99F0C36A3FD954D788D2A42A71DB49223C9 SENTATIONSFORMALISMUS7
458,260,106 *2E8BDA6E5F607426F0D8249DB565C2BDF85F2851 6TNEMESSIUOFNE
458,260,107 *2E815066E0745995D39C74A5B366E566FCAAD6F1 STNEIAREPICITRAP
458,260,108 *2E80AE29A7BFB11CBAA107225442A5CD4A4C0CB5 SERIALHYBRIDSAREHERE
458,260,109 *2E8085C0B408658BFF51FC712C7A09EF98D80E60 [email protected]
458,260,110 *2E8414C73DA7FAACB5B6E4F99C278F11561E3DDF {6W
458,260,111 *2E83165D8BB3D93C12B1CFD4155B82D0B023537C seth.buell
458,260,112 *2E89D0DABC7159C3ACF0F1717C5C6C2523337C28 [email protected]
458,260,113 *2E80B75223780C741A29B7FA34C68167140C1B82 SEWHTRON7
458,260,114 *2E8B8B009A09BCE9B7BE2427C7090AD2EC6BE785 SEYMOURKUCK
458,260,115 *2E89D095988982C7BCA2AFFDCC5B4894724B5157 shannonkidner
458,260,116 *2E81FF6FC7921823D6124CF1FB10B72613B14DC3 [email protected]
458,260,117 *2E81D4C25E114BFE0B6F79E5CA0EAA105D0CCBCE [email protected]
458,260,118 *2E8EEDD6A7128778F3897F132AD006767471DB35 SURCLESES
458,260,119 *2E8AC86EEBE054F9D96C7FD32B72D96EAA1BCB0C 7 HEDU
458,260,120 *2E86B22DB365F2838193DB117DFAFBE683B5C5A7 7INWINDLASSWINDOW
458,260,121 *2E828B6B6A30205A18A27F876781E49088EE7BEF SUZYESPOSITO
458,260,122 *2E8C9A635B919D7E5DF43EF94C1438DB9AC71115 SVISAI
458,260,123 *2E8CB39B70CB1904941223DFC5729B515D1567EE [email protected]
458,260,124 *2E8F905CBC9027400DB511537E5DE647BE409F2A 7midnight8
458,260,125 *2E89CE2BDBB4C05D688D5D25F576D11E879F1E73 7NEJDROBNEJSI
458,260,126 *2E8D8BD7DC6CE02AF191B131ABB65FFC873B6F11 7PIRATEMACINTOS
458,260,127 *2E8E6442A7988972BBFC66E279EF706031D6D7A8 SYCHRONIZATIO1
458,260,128 *2E869003151C6A3BF28D29764A3E5CA1D96B9F25 sherry-segal
458,260,129 *2E844656E56D18041F3801DEDD43EAFC44F70406 [email protected]
458,260,130 *2E8D73E8DEC9DB60BF64BB088778CAE79422D61D SYROMYATIN
458,260,131 *2E8836C230F89F5F6013206887D450AA72EA4630 SYSTEMTIGER7
458,260,132 *2E822F8977A1E7D3F9A06D94B6559F4687710A09 7STAGNERT
458,260,133 *2E8DFE628F05F15EAB30C3D35EABC914BA821F6E SHOOTTHEBULLFIGHTER
458,260,134 *2E8815802D848D409D4FD1A02BCD80A242966794 7TAPHULSJERNEN
458,260,135 *2E8E28E9C6AB3152900ACB1DD4497B9011DC160F t3chn!c4ln3$$
458,260,136 *2E8F201BD0E98D5182225B070FBF0FF214DD476D TALIESIN’
458,260,137 *2E8581CC8B7385E880844430CD4184AD2B997335 895046 UZUNLUGAVE20M
458,260,138 *2E8B5A76500DE29892A68F10D02250FF2A4E4096 8ARMIRANI
458,260,139 *2E8D1956E4AD04318409DC7A5B458ED1BEF6348A 003LUKE
458,260,140 *2E8CBA6573EDB3E0DDE38DE1D363BCE785F83755 [email protected]
458,260,141 *2E8AD4DDD8AE604BB55D5508331F70D33D540D1E SIERRA SCANLON
458,260,142 *2E8D28F214AC29716DA89CB1025183D184394429 sinfonia-in-g-major-for-strings-and-continuo:-i-vivace
458,260,143 *2E8B026A1F41B81C9392845AAF38343FEC3FBC1D SINFONIA-NO.-7-IN-C-MAJOR:-II.-ANDANTE
458,260,144 *2E85B459DA0F8CD954DB5903E09E55FE9D04C687 8KURIRERNAS
458,260,145 *2E84AC6E6E9EDC29B103FF1C2EE6926C956EF999 SKCINKCIDEC
458,260,146 *2E82CACE20AC844A0D9DB6245968635620278958 SKINNASS6
458,260,147 *2E860B9CC87DF76E5E46C3A950367A14D1D41C92 8--P ~0 ~O )0(
458,260,148 *2E89EA585C1AFF9161FD0DDDCBEC4715628F155C 02CFAAAAQAAJ
458,260,149 *2E89AC20BCAAD4D5D23B0D7FEF8DB1AB91CCED9B TAMMY PRINDLE
458,260,150 *2E8067688D7144DD1F71C3DC58CF8B29B3A3D383 8.RIEXINGER
458,260,151 *2E8441EC365B6D2921A5CA8515775CE934732946 SLIMPIC
458,260,152 *2E8FA2FC5CC1A6726A241ED1D46FFF79894DB5E7 [email protected]
458,260,153 *2E8EF4353D42291513F21F649B8C38B92FA9AC32 8SIGNATUREZ
458,260,154 *2E84368C54F898790C982F8B1EB74210C2556707 8SLIEWEJ
458,260,155 *2E83F4D3E86BA12F433BF9F09D14D790690B9595 8STANDARDAUSRU
458,260,156 *2E806333CE4746F87FEA5759873CC43DB3316807 082KEEGAN
458,260,157 *2E8CEA0F939582ED4F69D44384233F674E262615 8TERFLIJK
458,260,158 *2E8821581BB14E431079856262B1BF68E4C7FBB2 8WAJLEDBA
458,260,159 *2E8089AE9D41F4FDDFCF4609E4BC96B75A351BB5 0account7
458,260,160 *2E81DAA133FB2312534704048244CD767742B1CE 909193 madde 34 341
458,260,161 *2E80DCC6DC0B98A2FE4D5DE23F9FE743AF08810E SNOITATSKROWS
458,260,162 *2E82ECC7F852F338870764DE7A433D71DECC0F1B tb4gd6jbhoy5ved4eb8hpp
458,260,163 *2E858CEBAAF53D5656101A047623E8717D00870A TD{O
458,260,164 *2E87E6CC4D9F30FE6CBDC0B1885333E32F61E23F TEAU DU LIMBOURG N
458,260,165 *2E8EDFD3D63766465391596A6125DC7705DB9DDA technographically
458,260,166 *2E8787481E1F21C8E1A2E3ACB0985202E1E10B31 TEOFANIÍCH
458,260,167 *2E8D1F0A06463F5419FF604C2B2BA966FE8F9912 11121011
458,260,168 *2E890762CBAC9FA5A7501A720ADAEE701395E9B5 1:1247
458,260,169 *2E8425BC62BAFFDBDE075A59B53EA9B370DE7B8C 1192048 suunnitteilla.oleva.p
458,260,170 *2E8C376AE1E3834A0BFF38A7560CAE0F88B91248 terribreedlove
458,260,171 *2E85FC0D7C5B9FA25CDFC5A6A1AAFFC144059FBE SOPHIA.BAILEY
458,260,172 *2E8ECFDD3165178EDADAAAB3300AECAAFCDED9CC TEXTJOACHIM
458,260,173 *2E86EF158FA294D765F4DAB4F3B963CC7712B0A8 TGETALES7
458,260,174 *2E83EEB47A27D65EE7AE5D27629608D113B8887E 9kersouwkes
458,260,175 *2E87EC506E3DAA618E4663883683BC7456A4836F SOUP-OR-HERO
458,260,176 *2E8DE0A1FBFCA8C0B6F1B03724D173E4A2BAADBD sparrows.point
458,260,177 *2E88CEA5D98AA711394B077E3261F7FBABCA8A39 153ALANA
458,260,178 *2E8F15E88A18CECE250F65F9B60B9C1BF23E8554 15jul1938
458,260,179 *2E88B664EDBF085D489A4FF655FF9E7DB2245694 SPOILYNG9
458,260,180 *2E89E74AE5A0AECEC9460DA77D3E479290B245C2 THEMINNIE2004
458,260,181 *2E8E767262B4733BB6728E2967CE9514080DC8AE 1667 OUTRAGE
458,260,182 *2E854FC0A899E24CF58259D62EA270A11E04A36B [email protected]
458,260,183 *2E8EE0F7E2F5B6795BC197C8854F8B8095521C13 SSSSSSTAURUS6
458,260,184 *2E8BE82A1043A6B886855C9D7BE9BEE0BD2B18A5 ST923504
458,260,185 *2E8C3A2221CD3B9A3792AE7290A16E7E57E6C629 [email protected]
458,260,186 *2E88387987AC649CC151BAFAABBEA7D1659DFE28 a1w4)
458,260,187 *2E831D4537E0EC09F570A07811C08C90BC530174 a2t:f
458,260,188 *2E81E6AA7B355B24CAE2C5950965E1CDEEF883B4 a3qaa
458,260,189 *2E87CDDFCD8547CDF1659A8955217C7554BE4631 STAN-LIEW
458,260,190 *2E81021A6AA12A41454C3CA2772E3BBA36609F5B a4t$
458,260,191 *2E8A95E1B48AE92C58D80F0671B730564B89DD63 A-6O
458,260,192 *2E8F7F7B45274C51F7CDF2E873AF54B9F7215527 TIIMOLOD
458,260,193 *2E88E67F445D245A0B36C07CC0A99A50246DD5A9 1.EMKILPAILUSTA
458,260,194 *2E886ECFF2F6398B8C213FCD56E535D5697FCE1F STR34MBUF3
458,260,195 *2E802483EB8666554F6821ABB4D5ECDBC238584D 1ERZAEHLBAENDEN
458,260,196 *2E82C502F41F7B2B4F044BC29CFC2754B426E186 TNEIARITNESSER9
458,260,197 *2E8493A5D3C58A78300EE36FF91A7B749D3CD261 TNELOSI4
458,260,198 *2E82532DCC14BDE80FDBD591971054869624221A 1-F-MODELL
458,260,199 *2E8FFAF1DF4242A4289842A172DC7924418F0C39 STUART-MOLLETT
458,260,200 *2E86100CEF3D2515F58171A9C80DDA2E27129BC8 STUDSTUD3
458,260,201 *2E87031DF5A7604DA24C63858B17575BA16E5B9C ab_iq
458,260,202 *2E845B302563BBB03BAB728549CFAC0A6FFF1083 TOI.M
458,260,203 *2E875798F28E7CC58F2449442AA3DE5E2EB8AE93 AB/U;
458,260,204 *2E8088113FFE0FC9510F9D889C9FC34EEFF7083E 1.opel-haendlern
458,260,205 *2E8BEE24B131462899E0D59D821062CFDAB1C015 ADALBERTOCOURTS
458,260,206 *2E8703C759F1ED6271833075CBC11C588A85EB06 sviridov1
458,260,207 *2E8C8A85AB676614830817723BA5E761A859C343 aDDReSSiNGCeReaL
458,260,208 *2E804097A856D694F20E251598012B1624A29761 1-question-though
458,260,209 *2E8336ED44C74A06A5CFDB0254EC35C738CC1C7F 1SEROP
458,260,210 *2E871A2D0255ACE613CDB2EB6756AB360890DBEC 1suvaneubau
458,260,211 *2E88C4CA8CF8EF46836D5A8B707824984F039A20 AEKAPUTRI
458,260,212 *2E8418050BF9EFB9CA0E22D68B9BA777EB2D540D AEKST
458,260,213 *2E86629B4B8287852D856A9BF510CC9FBD7D5B88 AF9(
458,260,214 *2E84EE6FC39132015C4529E1EA25204251B54BCE 1.WEEK-SO
458,260,215 *2E8F6158A37C0DC9FFAC521323E3FACE8A8B6019 TALKMLAB0757
458,260,216 *2E89FF6798104EC91D5A834428DDAE97E71B55AF AGt(
458,260,217 *2E8026D1A68C42A3081BE44879DEFD68CF5C63EA TASHASPOOKY6
458,260,218 *2E8837883DC66D9027340418E994EBDC6FE6D600 <A-ID="E69E151"-NAME="E69E151"></A>
458,260,219 *2E8A1FC537125B2F5483F84E9025A63556F51C72 aihsaka1
458,260,220 *2E88A34B627A15977A91421966F1D4AF442C7C9D 2365886 LIS
458,260,221 *2E8ABE5660AEE556A646EF89D61D53A64E36CD52 AKKAELMN1
458,260,222 *2E83905DDC31C898FF3149979AC8D9B379A56714 TEQUILASTEVE8
458,260,223 *2E8453D7BF5F520F30A4A4CFDCEC0C4B3F5D724C TERATILLMAN
458,260,224 *2E8FB01554B5A2737B3B5C329B5898CE2C29E8F1 TERESASHOTGUN2
458,260,225 *2E8BBC7FE6BFAFC79F764C11AA5D76B5D316EF12 TERRIBLETIGEROO
458,260,226 *2E81FD878E9EF748CEF2A83A11C748397192F958 2DIRTYHAR
458,260,227 *2E870082DECCDCADB1089BFBE893763C10A53FE3 ALEJANDRO185
458,260,228 *2E815F11C268A6038A1A3693DB8DD52D9FBB84E7 TFARCRAWNRUTAS
458,260,229 *2E81F9CEB7D667CFA64DDC96A23B85670446A089 ALEQM5HMCBQIFF
458,260,230 *2E8CD823CE9225B06C7AB6FD15C786C328716BCE alexandersigns
458,260,231 *2E8C3375F516D6B6F78667AF5AB0AFC5CA8B0FEF >2H/<>A/<DROWEROF>"8.2.RDH"=EMAN.A<>RETNEC=NGILA.2H<
458,260,232 *2E855A174C0BA736B9CAEB7F1247CEE07BCE78D5 thatcarol76
458,260,233 *2E89C19B7EB84FFA383E88E841B7A6C46BDA102A algardianrestraint
458,260,234 *2E8E48A88E047CF9682428F717048D27242F0F0A THEFLIGHTOFTHEGUMP
458,260,235 *2E84FF985693F3B6A79E455259390435A4C47D1F ALLAN.SALOIS
458,260,236 *2E8CDEB1974944CEC254F29D1A108E38B789C551 allertal1
458,260,237 *2E87CE50A8D06883562305953ACBE1C3B6F6F94C ALONSOLINCICOME
458,260,238 *2E82F52A59FA90C30B845ADC5D678DECBD39471B 2.maunum
458,260,239 *2E86E912BAEA1B8A58FB4EE900384A4B39F1D0E3 AMONGTHELIVING(FRONTLINEASSEMBLYREMIX)
458,260,240 *2E88894E6FEA4F7537072D8ADCB26EAE18AFB730 AMPLIATA9
458,260,241 *2E8C270E863C06563E4FA17193D3C91AA0C178E7 think-ink
458,260,242 *2E8C0461F3D9068F5DE663B2AF25661A6746F189 Three-Places-in-New-England---The-St-Gauden'-in-Boston-Common
458,260,243 *2E83F5D6775A7A697C51E392387A7F3865199E45 andreapanarella
458,260,244 *2E824302A7BBE5C937626391326CC48FD43C5E46 TWEET-PAUSE-TWEET-TW
458,260,245 *2E8BCEEDC92F21CFF101F5BA9D541C6013B222E3 TWEETYBIRD
458,260,246 *2E80858C4EDDF1F24F69698F576422B03DB5BC11 tyleracfalle
458,260,247 *2E87CA748520B58531143BAA13D0C858487118E7 tylermoreis
458,260,248 *2E8DA317C05C049C67D8ED195A941F234D6153F0 TILLGSBETALINGERNING
458,260,249 *2E8792685F6326A71B9F726F6BDDAD64A366038B ANIS3-P1A
458,260,250 *2E82038E75961CF08CF04E330C2A4DB4D93710CB [email protected]
458,260,251 *2E842205086C8F8FED98B966F1762B5E91FFF7A3 TITANOVYCH0
458,260,252 *2E8B44E5F1FA1751DBA4AF09AA42D83704185196 UEF-EUQI
458,260,253 *2E87DB7871C5F20D0CC55824A89A878D4920D710 anthem160linnu
458,260,254 *2E8C56C3E0264F824744A9BCBA007FF1F37E401B TITUS.PATERNITI
458,260,255 *2E831368FAAB2A22402E77BDC35E4EA48783A7AA anthonypicher
458,260,256 *2E8BA1B28344FF774288E7E55A48B9C6083246E7 3-ARBEITNEHMERGRUPPEN
458,260,257 *2E891CFF70E9A9A5D4593982FF91CE77ABB88F1A ANTONVANTREESE
458,260,258 *2E8359D4C70E9633340344DF32AD697E23AE61B6 TNIL
458,260,259 *2E82EBC4A34578FD0054FDB2BB5A5F7BDD0AC0D1 3EUPHYLLO
458,260,260 *2E8BE98C88882B9DCE863C34104391725253A484 ape,h
458,260,261 *2E83BDC0A8AF57B16E8BB9D496C491F27AD37E2C APLASTAMIENTOPORELEFANTE
458,260,262 *2E81975F212CF36CCDB07E98C75AA1EDD091F433 APPROVALNONAPPROVAL
458,260,263 *2E8F3D681C696BD4AE52D739681692081D5A6F8E TOPIVKIN3
458,260,264 *2E8021BFFD91FA78FA4AEE4805104F14A7C09A30 3paranoyaya
458,260,265 *2E8362673889E189B7D0F9F0F71F66F2494027B7 3P~.~.~)O(
458,260,266 *2E89AD735EC0A4D3E723F61D2B2B0DEB75D2A04B a=qjx
458,260,267 *2E87C84508C9D0D75025006F84DECB4CA246A0C4 arlengreiwe
458,260,268 *2E8A48167F389A4CBA3A14A801F11E1DDF194DC0 ARNOLD.CICCHETTI
458,260,269 *2E89548E0B3579BC9AACDDD2374716C8E7033B3F arquicad7
458,260,270 *2E8E4A0DAE09E4A99C8B2E9CA777A3954F608786 4BAUPLANUNG
458,260,271 *2E8D4CBC3C527201DF97ED0E15533105FDB357FF arttl
458,260,272 *2E89290E870C4D7E4FF79D1D7C0D5A9A5B63DFFE asfsv
458,260,273 *2E80220A61D14DA1F282C36B96B7F0721222620F 4JUGUETEASEIS
458,260,274 *2E820E74A002B819C8591360F4EB5EA74F15B8A9 4KRYSTALSPEEDO
458,260,275 *2E81E7F9F44C3815A4B8E51FDEED9FB558BDCB54 ASIF AKHTAR
458,260,276 *2E8712D4F2F848B758286266236C329906728B67 asjee
458,260,277 *2E8127E322FD6A2B2603CE3C32B87A1E4CB9F300 TRUCKSSTARGATE5
458,260,278 *2E8DFEEDB119283EC6EC94BC5B43A9AF2F23D394 TRUDGE, TRUDGE, TRUDGE
458,260,279 *2E82D33B8B320E57E0AA5925B7421AF704A7453D AU61Y
458,260,280 *2E8FA9BA4EA4EA54511AB06D8C20A14DF41A44B3 unquarreling0
458,260,281 *2E8234304034FEA70AC5D2C77B5D2802D2CD65EC 5AORGPEED
458,260,282 *2E88D1CC52478B1B208CADAF25CEBF06DBA72927 URUZ-(STRENGTH)
458,260,283 *2E871CF1CDE2CF66474C816045BBFF7FF3423863 USAIDSBENEFIT
458,260,284 *2E8B9E7238CEE5329708C15261B7A8EAF22079E4 5DIRETES
458,260,285 *2E804FA33566688FA630DCD2FC9AD812FAF2999C 5EILEDNAB
458,260,286 *2E8FE2FF27E8318C42DD360ECFA38019910D128D AVIVONSED
458,260,287 *2E894C57E10F59BBBD27B96FDB0FAD6DC0E7E6E8 5HARANGUEADDRESSAFTERDINNER
458,260,288 *2E8045ACB03CDEC5C850207FE426BD9F84726640 twice.as.nice.presents:.urban.music.festival.(disc.1)
458,260,289 *2E8C184D614758F5320023AD5CEBF8A368F5BE2B 5inductie
458,260,290 *2E825D4669D9CD166224D641E52CF647883C5B84 TY.HUMERICKHOUSE
458,260,291 *2E8D74EBEE7241AA803C4BE41A9BC6211ECF6F95 5LEATHAM
458,260,292 *2E8C685DB7B58FD93FB58499700BA050547C9238 TYLER-OLCOTT
458,260,293 *2E865FA88A0B562531FA73579F421C4494DE127E AW_(T
458,260,294 *2E8BD39125931DA532F271C4F984EA5E88971976 TYSONDIRR
458,260,295 *2E88BC56A914ADE1AB8A8C7150B7EA7A65F16F48 ay"t
458,260,296 *2E87E879910A3F71FACF7FF59F2D632ECD8DF366 azewt
458,260,297 *2E88A165AED67305EB86CB1F5AC610752DE42BAE 5REFLIKER
458,260,298 *2E8FB22BA2B2C868BD21F7D2C40A4809D1408C97 [email protected]***~0~o(O_-)
458,260,299 *2E88E25A247862D58A11C5E9F0B22FDAB4A7E64C UZBIBALO3
458,260,300 *2E881465761F46782F894E807A7AE768E2C22ADC vamisaib
458,260,301 *2E89A84CA2212A79DE80F198C80A92A4F4C6DE69 b9he-
458,260,302 *2E8CDEAE0E2C5CE733BAC0D0430C4614E46FE67F BagadQuicenGroigne
458,260,303 *2E805F45F0C7E9FF06D27CAE85A0A254FD06FA3D vectraracing
458,260,304 *2E80940FB96823EFBA79BFCE7F88CF6C9CEC6BC2 [email protected]
458,260,305 *2E8C49906B96919A8514F8E6FA96CC1421F952BF 681666 mUzakerelerdemevcudunCoGunluGuilekararverilir.
458,260,306 *2E833A10D1F124145493538144E31AF201D35E41 6AFLEER
458,260,307 *2E8171AF455537B62CCE89833ED5C87D44423A98 [email protected]
458,260,308 *2E824E1A0062BFA2F2629941096EEFB032862FB7 6ALLGUAIT
458,260,309 *2E870646349510A3D2C0505979FA04CA4F8D7564 6-BERGLANDES
458,260,310 *2E84B22BE95970CBBD26D39156A9C91BE412AF5B VESTAIBSW5
458,260,311 *2E8A62A0A7512CC226565E6ABB9A671C5EEAE450 UNSUNG.HERO
458,260,312 *2E8C87F7E26BAFF0271E797A5365E12A1BEC3CB6 VICMAVIS
458,260,313 *2E81BAC69C6945DB33548EA06CDF9B0128E18018 UOMTOLIP5
458,260,314 *2E88E5600AA01E1ED5D7BF584285EB3BE2005C61 BASISSAL4
458,260,315 *2E873E3F56AEE85699B6A00A30279B4DA2415031 VICTORVIGNY
458,260,316 *2E84BEB5C8AD450B08ECB5A157007487845E8D49 VIKERGENERAL-JOHN
458,260,317 *2E8F7B0A231594741A49F4374631E52A72F895A8 6ITOKITA
458,260,318 *2E884540523AC740BF0A1BCA165A318BB45A3600 6KOLLEGIO
458,260,319 *2E8A8C5A6576256C3F0FF8E40636F9991A058B3E VIRGILSEMONES
458,260,320 *2E89E4DB992C5A0AEE298AB4C69EA58BF1DB3F66 USMATHEMATICIANSTUB
458,260,321 *2E805CD7AEE87AB3F6B02383ADF051278EF41333 6REPARARAN
458,260,322 *2E8A673FA183329E3D909ECB3E5638285CA98A32 VLZMSLR0
458,260,323 *2E86262EF6D312E5D1FE010893C0FB1DFCCB14D9 B##D~~3B<-
458,260,324 *2E8ED02721E196D0957E5223E9A696CFCB415197 voorbestem?
458,260,325 *2E8DC083BB20EB95D39263EE557869FB64A2C726 VRCQONIXBUFF
458,260,326 *2E83AB036ECD4283A39A2C890868025442F5E661 71804c0cac0ab9e74854fc3c27ddee53-ag7loup
458,260,327 *2E8BE5EFC2D9EF1D07F5A4112D1ADB1F94194BC9 74434 tadI sUper olmuS
458,260,328 *2E88B6657EE710A4B4D766E138571A7C5CB23A2D vala.6.1
458,260,329 *2E859A1924DDE14BA56AD56EA0DE048C3AD81367 WALLYBALTZLEY
458,260,330 *2E85C8D69BF675BF57087492982BFFBFEA512CDD WALTONKIENER
458,260,331 *2E82F047223B6FEAC34D20B3E50BDDCD2D5826B7 [email protected]
458,260,332 *2E86C317FCAEDAE398691D3184CA1B07F525F976 VALLI-TSALAVOUTAS-ZUBULAKIS
458,260,333 *2E8B5753F5566DB312F2E01E280C903D895CE3AF BENNIEMORLAS
458,260,334 *2E8CDFEFC613086E067D2C8691A3BB631E5BF359 7EKLUZED
458,260,335 *2E8A2F07ADEEEE3D0B1416A21A47F089C60E44CE VANCE.URQUIDEZ
458,260,336 *2E8AB100C41F97A02D8A28B2A8F905EB00D8C47A vanessacorporan
458,260,337 *2E824D35658F35CEC061A67179A591518B193A2B 7ILOVEDAMMIT2
458,260,338 *2E811C6271A5011C7B3E6AB26744FB0506591609 BEW
458,260,339 *2E8C9B64E441DD7CF6CA2C5C9DDD57451348D226 VASIMPSON
458,260,340 *2E8C5190029D57975874C5E9086012233509E0BB 7OLOGICHE
458,260,341 *2E82202AA24C0A91061DFFC9AD68C3091A028F74 BG&+U
458,260,342 *2E8A00DC9AFEC076B5F1189C9A0DE8008996BBAD [email protected]
458,260,343 *2E8ABD79E00DFB5EECF19DEA3F643621115A909E VERN.SPEELMAN
458,260,344 *2E89ABC47705C7DDE1183DE64491A4B11B345E5C bhw:e
458,260,345 *2E8321CCFB3A44D02BF7136B8CEB860975310680 BICUSPID
458,260,346 *2E89F29E80012765A2583EE7BC663BAD1C72DEF8 7UDMATRIKULERINGERNES
458,260,347 *2E80C8A562532B31C7FEC2854CFAF4A243B94171 b(jr.
458,260,348 *2E8D5370A9057874254E08E2F331EF569156E815 WENDYMAVER
458,260,349 *2E8A51B7C11D2550B100E3F2629C9F86F877B233 [email protected]
458,260,350 *2E8F51972C3F07F1C23B6C0C532C2E4275F79D5E 8.ALLERGISTA
458,260,351 *2E8BAC822E78D894E2E0C87DED779FFEB8956A9C 8BAKEMAN
458,260,352 *2E82AE781BBC6ED7BD430B2D9E64CFC6458E5DD6 WERNER.WINCAPAW
458,260,353 *2E881A8C5FEAA9A31EACF2BE29B99CE8993426FD VINDYANIWATHSALA
458,260,354 *2E879BF5E8DAA4C0740863755C5F5129004BC765 VINKOPOLDRUGOVAC
458,260,355 *2E85922C6B693D7BC3DFBB7A2E4E390B47042DCC vladimir-teterovsky
458,260,356 *2E805385FDB8D23E0E8A43BFF3ED52ECABCB96F3 BMBK
458,260,357 *2E8AB150C2772A39E5FB9B4CE1B73E1280D20E10 willehedstrom
458,260,358 *2E817CB8C2FCD6B3C654DACC81578600C12F20BA 8NAZIONALSOCIALISTICA
458,260,359 *2E877B6D44F4939731002516430F0ECB44994391 VORBEIGI3
458,260,360 *2E86692E91079CC34626B75B4B58B720D54EC59A VRLNGSMST
458,260,361 *2E88547DD79165EFC44A48AE2016AEAC7B0B3339 bobbiie
458,260,362 *2E893C8856EE372B4FEBA0FC55DC7527D0E4C077 WILTON.LEVIE
458,260,363 *2E8C02D4358BE35AA264E5C11E73759D2AD2541A boc0m
458,260,364 *2E836DBFF30A196AB9F327B48C06A671386B1F73 bookerunterzuber
458,260,365 *2E8DCE8600E3481486FDE1AC88FB3BB2680D8AD5 8TXEFEBTJBQD
458,260,366 *2E8AECB159D45BF727AC441E86425291097A4D2C 8WATERHOTROD
458,260,367 *2E8D98E02F6E34496B3F4A155B44F8BF18715FDD 8YLSUOULFILLEMNU
458,260,368 *2E8C847AACD5EA08C26B07A33A8F9CA1A7BB05D4 WSBFIFTH
458,260,369 *2E899E821E7087FBE64F9FA4DEA626A81A7EB6D7 924737 ETENKIN AMERIKKALAISTEN KOKEMATTOMUUS HIDASTI ETENEMIST
458,260,370 *2E81DB7C681EC3D14C661CDC1A55BDBBEC2ECE3E bpew!
458,260,371 *2E856370BDADF083EEF730783BF2259ABEFC8C4F wwwgoodbyepicassocom
458,260,372 *2E8B19C2459D97E6DC72277526528182274C641F wwwhansardactgovau
458,260,373 *2E83EBDAD7EC5D65247DE9CD4E853BC70D44275A WARREN.DUTTRY
458,260,374 *2E80A56BAFA719378E03C1C722EFCCE9EADF2630 9ARCOREIH
458,260,375 *2E8C2FD34A5A2E156118C04C85137C2F2921F114 BRANCOLATI
458,260,376 *2E89139821F2A923462FECB67EE3C0826F6C0036 9brachen
458,260,377 *2E8306A0FED8CB12F4A1B3F095E848E2E7F35D0B BRASSMAN-2004-03DELETE
458,260,378 *2E8FC67EFBFE31D9F8057863D2DEFA550925A28C wyattbitah
458,260,379 *2E8BE69B1180E206C44E80C541BBB3C9F2B2338A 9COMPARTITIONS
458,260,380 *2E8B51503B3280DCE938A39A85396773FDFBA660 WELBOURNEM
458,260,381 *2E8C7B824BC9AD490B432B89CEFA0AA9CB950441 9GONOCALYX
458,260,382 *2E8A957660AF12135732EBA56A5CA3756230E3D7 briceboeding
458,260,383 *2E88AD59E0E4E1F58E5A6D5346F7149E1095FCB9 XAVIERFALHA
458,260,384 *2E8D917E1CF6B20934D9A2AA068043341C935A18 [email protected]
458,260,385 *2E82FFBF4036408008EEA1B5BBA822F57E5059B3 XFH1WJTPN29R
458,260,386 *2E86804AEEF6C640F25AE5F35F97AE248B51CB33 WIKTORIAWYLECIAL
458,260,387 *2E8CBA07F8F35B10A507DED8F7F209E2967938CA BSWANDHEBSW
458,260,388 *2E84A68733B48A8D32EB36628ABB6DFBACD8DED5 bt0!b
458,260,389 *2E8A0C0441EFBF971653E5FB5C549DD052830342 [email protected]
458,260,390 *2E83E9C9A25D33F8F86EDBF8D26BEC963C1E0CCA XIAVIERWIJAYA
458,260,391 *2E8E1060439BBA88FC24BCAFAFF998CCA289D4D7 BtZa
458,260,392 *2E8468FA06E3B850BEE6B63DC06836FC4250C8CA xsniffers
458,260,393 *2E8EFC2F3EF94882C395C547EB8AE3FD145010FC williamsmartines
458,260,394 *2E8E565A995381A42C9C786E74333B44F66C2CE5 WILLOW.CREEK.COOPERATIVE.PRESCHOOL
458,260,395 *2E822206B2AE4F9592F13922C3D78C7A6761FF1E BuS1
458,260,396 *2E8C5F7A0E4E6E6EFAC7D5CC85FE37583B10C9DC XYNK
458,260,397 *2E8EC903A0D007C3785F8DF3098699CD23BE83B8 WINGSILLE
458,260,398 *2E8E3D7BC10F0E80E434E6EA537B275FA94ED66A [email protected]
458,260,399 *2E8163C511C99CB45330732D1E8521CA228C00F0 BWYSLEISIOL
458,260,400 *2E8F9A6488B68FC3C88509A9B0AC2CBBA137EA24 [email protected]
458,260,401 *2E830AFBFA218548E012A8288650A5CE48CCBD5C [email protected]
458,260,402 *2E81419D501A744AEAFC0AED99B8EA31F82A870F yasankh
458,260,403 *2E8B726F52B1A5EB74D25BCF862C1F80B3FE0ED0 a4w(
458,260,404 *2E8B1CF368FFC2E31D1BCA59372E1D2C634CDE5F [email protected]
458,260,405 *2E894246FE7D2DD261C867FCCEB4F79C9D18CF8F aa0bc
458,260,406 *2E8C7F9801F4186AEABA00C4E814BE1941692BE7 C1M%
458,260,407 *2E8D85227809803F29951B5138EFC86F78E774E7 [email protected]
458,260,408 *2E88BAB92452BA7C3107A8758CD81F1F1C1FB82D WULEONG
458,260,409 *2E8E7330B860A87D922044C548B4E88105AA535E c2epm
458,260,410 *2E8C81F7DE1AB4D23B1FAAFD2129B76C1F38ED91 WWW.ARMADASWIM.COM
458,260,411 *2E8A9A7069EF1C94138933ED7E6D44163BD981EB wwwbrfukcom
458,260,412 *2E837AC4FF347A177F49713E30ED76C14DA28DCD WWWEPOXYCOATCOM
458,260,413 *2E88C22F046AA2E1121610A31ED42FD719799520 wwwrhodeislandboatslipscom
458,260,414 *2E83530D1E66FA85CEEE8FD2BF86BC4EFB4CE973 C7BUU
458,260,415 *2E8F1E0E3B9321B9CC19BE171BB4235E9D8396AC AACBI]
458,260,416 *2E8E6E0CCC2FB3742B383EE7C71746F4A3502D0E XÄROO
458,260,417 *2E884A350F84E80AA88064FD0A436C6A134BEAEF XAVIER.SORCE
458,260,418 *2E8DFA79C1BBA0EDA0DCC9C8F1AC1828F92350DE AADGM/
458,260,419 *2E896B96AAB74773CCEFE414771DF9993C897CC8 YPOLOGICED
458,260,420 *2E8DC46F5C57A593F6C2D9895EB0221DA9E356FA C9SP$
458,260,421 *2E87616F7B6F1575BF6F7D6F03A592D8AA76084A YTETSIH1
458,260,422 *2E8CBE1E6E5E1814E8C11880C522D55364B53E32 cab"
458,260,423 *2E82ECFC80EC11C2E4B882E77829E4F8E542CD74 [email protected]
458,260,424 *2E8BB0335F75C5AC2C2667CEAE75920D44B0E4D6 CALFAHORA
458,260,425 *2E8D40E0BB863FD64FF5D7B4CB590AC6479A545F aanscherpt.
458,260,426 *2E878D4E31F86A9F29442D47421EC4FC8DF24119 XTMPDIRBSW8
458,260,427 *2E8A6437E1C737A5287A945E3A728DE06775C4DD [email protected]
458,260,428 *2E83803B039E23C1F6D10F8676F950EFBA48456F ab7^c
458,260,429 *2E8C4F122B70F10BD10ABC4C073C965F78065CFB YANETHAVELAR
458,260,430 *2E89D066E860C7FE6756865A3DF7B0AC3F22370D [email protected]
458,260,431 *2E8D3937232DBE684434986065EE6859C2681A2C ywotxee3
458,260,432 *2E84DE65117D7C4315918AA24B7C61211D355242 YYUANCAFE
458,260,433 *2E88A800D7D9152B53519AFD902F55BAB2F0AEA5 CARL.MEND
458,260,434 *2E82CABF1FE6A1E0CEEB53DDB07253A665A3DFC8 yasdutnaini
458,260,435 *2E8E8738DC1FB81952B1A5BC9C7597E4609A103D carmen.koellner
458,260,436 *2E845AA465552ABF129E91EF6FF30753719C2E8F yépresentations
458,260,437 *2E892B0B44E56CF3938587BC6CA9E4142F8B3921 zac-wickstrom
458,260,438 *2E833761A88BDE980BEC8DC447505A0D38986BDA abzugrenzened
458,260,439 *2E88339051E9019B5F70F24F6CB0487883A71C22 ZATOROWCÓW
458,260,440 *2E84740A3A3070EA9B0E52023ADDA3521BBD52EF YMPRISTRIKO0
458,260,441 *2E8872275060B3CED98743ADEDDECB0701709AF3 YOBI.FIGUEROA
458,260,442 *2E8FDBE6E402FF317D432338A64C17C389B802D2 zh)aaa
458,260,443 *2E8A4118304B6AFEF86A5DA77B76B35BAD9CC51F adebowalem
458,260,444 *2E86B810DCF982326A00BFE81EA5C9B669DBD768 Your.Head.Is.Reeling
458,260,445 *2E886C29F55F8744CE682779E055F9097F78B5DD adoi.
458,260,446 *2E8A5871EEE9F35F9FA991B59BD99BF6F22E34F2 YULANDIE OOSTHUIZEN
458,260,447 *2E84C59E9552F9E612B7ABF68A541AB31A1FC2FA CDBGG
458,260,448 *2E80DC533A37E5CDFF332FFB16779D31877A0A04 [email protected]
458,260,449 *2E814D69EA742620FCF9E140427708BAD08BC881 CD$KY
458,260,450 *2E89F570AED57CD78FBE5C51872103C69995F4B4 YUSUFU-BASAYEV
458,260,451 *2E839BC8BAF4995F0AFA69B264E7B58B451604DB YUWARAJS
458,260,452 *2E8399BDD1DE206A36D4DF77A846AA26A50DFB98 zach-blow
458,260,453 *2E82FF7EE351E94FB47E1BC5E23DFCE3D4A7134B ZACHERYMACKINLAY
458,260,454 *2E8D426EBCC624BBFF8961B0A6B84E3A86FA0066 C!DZX
458,260,455 *2E8B01CBB6946F1635FBEAFD95798F6BB594C642 cedrickjenifer
458,260,456 *2E8805D34F5FAE4D904AB4ABDEDB73EAD6C8623F ZAI.ZAI.NERY
458,260,457 *2E802A6DBD0ECA01AE03C4EC2F6A2DC17970E947 ZANE.NESS
458,260,458 *2E8C20FCDB5C22F4CEF74AD2EC1F83F62F3EE4D8 CELTIC STORM
458,260,459 *2E8136A280867F679B8F6A09D1F2E2737CD4A806 CEN4
458,260,460 *2E81085CA317A4095464602FF0B7296F6F501698 ZEHRA SOMUNCU
458,260,461 *2E8BB8283035E0DE4623AA983CEC3E4E0C6E01D4 [email protected]
458,260,462 *2E86B313BC9DDEDBDE5780C753366966D5590346 Z"QM
458,260,463 *2E83A86D9BACECA5A237D2D7F9EA9AC53666CB4F aeuji
458,260,464 *2E89AC2ADBE7551AA3716F39A09D18F8AF8BAD55 agnirekrs
458,260,465 *2E80A1408728DA0155A48F7C5CFD2C2FD8268F6D charliegrifin
458,260,466 *2E8F56416B2A3D0D0DC8A7B2C2AEC8EC3EE76080 [email protected]COMHK
458,260,467 *2E86D38E9AB125DC080D0B66E1C5A78C9E8E186F CHEMAOTROLENOMAS
458,260,468 *2E810BA562EA3563AD5250C5E959904AB7593344 aib%j
458,260,469 *2E82E3FBF4C825BA6824CFA927C96608ECA50F8D a&j4u
458,260,470 *2E88597C4F3ADD394E84F2C154177F5FB5062236 ALEX.EIMERS
458,260,471 *2E8A427627514CBF6FA61FC160531393BCBB2F7E грамонд
458,260,472 *2E8B1A821A07CF88EA7CA99711623395D87D48A5 ИЗПРЕВАРЯЛО
458,260,473 *2E8DD85582F24DD759AD381B1B7670C22EAB8F9B CJ3AF
458,260,474 *2E8C01F0D7C620BE3597FE9E0E361E8011F3B384 ALLA VITA CHE T'ARRIDE
458,260,475 *2E8AD709F048F6E9015705811F8FBF1001B8E52E Almost.Alive
458,260,476 *2E806CB504B66DDFC0DAE4F738FBBC635ECD2E4C CLASSAK
458,260,477 *2E8A716ACC4973A6250F5E58AEB63716CD2585C9 ALSPFMQK
458,260,478 *2E81C3A43D4AC74F9F904D53504E954B9C4D7ACE CLEMENTHEJL
458,260,479 *2E8137C25EE92CDF0DD747516D3292164070E91A clerical order
458,260,480 *2E80AD4118AE2AC44B0248B124DD495FF89795B5 AMQED
458,260,481 *2E83D9A939522801834E852E4314B996EE3612D6 ANATRUC6
458,260,482 *2E871AAB106A16406298E72AE60610EC07905B46 commilitorum
458,260,483 *2E8740B6C6F39682AF502C04A84DA36E60C82D68 ПІДХОДЯЩУ
458,260,484 *2E8B5084A1DD817D6E461CC742EAB66698447ECF CONDIGLIARMI
458,260,485 *2E8BD77C0D5F499BACD2D78E0EBCA535C13D9F92 anmg-
458,260,486 *2E80C2FD603E4234792C288B55FD9D9F836487DE CONNIE.SCACCIA
458,260,487 *2E8CC8DC78339F1778D8D3E8779168C30B8DE0AB anthony.braund
458,260,488 *2E8DA51396D5D148D9140C4B55E81F936AA8531A эўбэя
458,260,489 *2E8A5EE37BE224F19606A68BC30C0D3EABD83D3B ԲԱՐՁՐԱՑՐՈ
458,260,490 *2E8857A5D511B666C7A76B903EE58DA9FA812B9D  ігнатьєв
458,260,491 *2E829F48607FB4E780246D5AE137F898F3C9488B CP;
458,260,492 *2E8943444DADDD0F08C944AD11C203F7A3D992DF [email protected]
458,260,493 *2E8E7B7AC2C432E41F4BB25AA0B566B75C0155A5 crni8
458,260,494 *2E83A3E47A4FD0786D836778D12D3BB473CD760F 0sylvia7
458,260,495 *2E8B712A8DDBDFC3921878B8D5FEFD80AEDEA6DC CSGA3
458,260,496 *2E823B2F5C8018DCD7204A2413199D0D92C4F104 08281568
458,260,497 *2E8F0FEC27D1BAFEB31B08C12D1D487AD427095A [email protected]
458,260,498 *2E85BE166CF37CA0775170890057D7EA96CD398D 1521302 tavallisimpia.sekavuustilan.laukaisevia.tekij
458,260,499 *2E84B53D00AFDCF715FBA79B0E0D5AEAB3905B4B 1524990 auchdieballettabteilungdestsgriesheimtratauf.
458,260,500 *2E87C47D984B5CD8D796C8F8AF31D068070539F8 10SORGLOSER
458,260,501 *2E8DC4456BDF4A55989D03C3BC736958651E69B9 Atsegin-ditut
458,260,502 *2E87EB378AB1CBFCE52A06BF3C57E25280BB56E9 ATVEEN
458,260,503 *2E8F981F137CD252104DDD4E50A1012FBAAFCBD4 1185539 IMKNASTMUSSMANSTARKSEIN",SAGTER
458,260,504 *2E8D94DFD911F9A14E9ECC2D32853B0678DAC7D8 1198082 bills-come-due-,-bluffs-get-called-,-luck-runs-out-.
458,260,505 *2E8B46DB3976B8E4F5D37E5DE32C658D446C00DD audio-sources
458,260,506 *2E8CB703AD01460F581655C30745059877DA7926 1,2,3,4ideclareathumbwar
458,260,507 *2E87D8F997503F301224838A8AC261C5B60268B6 augustinegrusenmeyer
458,260,508 *2E81F5CE6BD0A04AA31CABB3B9C95D77CD43C01E 1444816e
458,260,509 *2E860F416E98313B0D77E7B30B85016AE140E724 1948018 THERE IS NO POINT : THEN WE HAVE MISSED THE POINT
458,260,510 *2E85C34145161B433B7FE0386D8CA6977B18B2BF 1619407 kirjassa on lis
458,260,511 *2E84BC6369166FF63D27743781BDBEB2299C27B3 AUßENDRUCHMESSER
458,260,512 *2E8CD98B89C3834ADF4D4BF5140109E248831E13 1726253 HAKUAIKOJAONKAKSIVUODESSA
458,260,513 *2E85EF6304F48B71D061AA413445FC12C961FA26 av=)
458,260,514 *2E840EEA02D51A1DB408220C30C181E8375DBBD5 1827543 siirron tekee tietoj
458,260,515 *2E83A79EC10355903F7E43B5781E4B223344EA42 1925年,與保羅尼瓦(PAUL
458,260,516 *2E884EC9551B0EC19C52DC3DA68C40CE0B81B31F d15bo5om
458,260,517 *2E858E828804DD2EB852471F66A66BEF70DC4A0A 1APWTERO
458,260,518 *2E8251DBD540B343A79C47D9161A2CBF37D5A99C 1.consturction
458,260,519 *2E82F2B9FD8D104D08C2CFB783F878CC24D1528F 1 cowinwhose
458,260,520 *2E8910EF62ED6B475E028F30864E6DC8E63DB821 1BANKBARN
458,260,521 *2E8FD800DC6DBD340DD67A8DC2DDDB5F031699AD 1-beliebt-spektakulaeren
458,260,522 *2E84705D92BD6C83573519013CA82221BB39DB55 1.DONEBILMELERINI
458,260,523 *2E8E17C9606EEE99FC823DC48C8BA0E652B5AB52 ay-carumba
458,260,524 *2E89AE77FE7172C7CDD946F0D32305917FF2DA6A 1ilovesnow6
458,260,525 *2E8F901A994637AF62ED64E466D4C0CFA0101426 b0qlo
458,260,526 *2E861560ADA2DBF082563801C1E459FEA55C9630 [email protected]
458,260,527 *2E8B626F8F396E1E36751B47FE2A75BC742B120A [email protected]
458,260,528 *2E87A223E7AB9F24BBD331C14928621A8251C9BE 1-industrial-osastoissa
458,260,529 *2E83358BC1572ADC5AB9129219A86D866AAD37DF dana-coover
458,260,530 *2E8FED7AFF6101DDC9E6BC63FE79493FC7E1BF3D 1kuparikaapeloidut
458,260,531 *2E8FDC17301C69F2656DBA3CB94C7E89B32127E0 DANNYSQUIRT
458,260,532 *2E8159BE8D1078D37E596603B68C912A0DE6C4F8 darjah-e-a'adadiyah
458,260,533 *2E8BC12B0D0E361E434921DBE4B28054CFD09BA1 1.PALONKESTOSSAKIN
458,260,534 *2E80BC730B50607A8AB3CE57D1ACA6E58C3B6CB2 1.palveluksestani
458,260,535 *2E8597192B040A1F8DC47CA65740239ECFBCB306 1-POST-KILLING
458,260,536 *2E8501B1134740896C60E7C9F8124A4336070C10 DARRELSCHRIER
458,260,537 *2E8B1E9405DC7CF3D0FA559FDE53B89854B8A419 1RDDAFWL
458,260,538 *2E86FEF68661E583BD266D973453B3715A98DCD0 DARRINLASTIRI
458,260,539 *2E8D26E0E0876D38ECA665CB62BF464BDE0F1510 1 RULING-AS
458,260,540 *2E8ABC852A701ADC97CF09E1CE5B17607B49D942 1.SAKALASIP
458,260,541 *2E8B4E1630D9EFD43FDD0871DF34D699009E9BDF 1 liimatainen-yl
458,260,542 *2E83B4F85113EFABC272C227277C370D48E688B5 1 LOOSEFLOWING
458,260,543 *2E896BA09267B6AC8512C20350639298A2722840 B75401
458,260,544 *2E8EC648755A684B3EC70396F6EF65D12E71D2EA 1.MAJURIIN
458,260,545 *2E866D2475D1A557CB2B802F072C4747174DF7C2 1 mananteils
458,260,546 *2E8AEE33A48839BB94F9B59EA5E675F1CEF5E389 DATENBANKEN3
458,260,547 *2E85BB91CA71E0B9D6CF765646D04D47118EA437 1national-heroine
458,260,548 *2E860FC1294057A54AB288A25152108A2CDB8655 1THEABBY8
458,260,549 *2E8FE41C6669E4894FD8F9DFC6B71414A8ABBFBC dbkul
458,260,550 *2E84601B2F9BDD415A0EA448DD50DAADFB4DC111 1PHYSICIANTURNEDLAWYER
458,260,551 *2E83BEE4EB0371161541D7C6730494A0F2BD8C06 DBTE1
458,260,552 *2E8B76602B330340B5BA398E87D90C95DF7873FA 1Q2W3E0736
458,260,553 *2E8EF6FC8DCAED08335EF02F8EB998B76CF11A47 1 withbecause
458,260,554 *2E8B1E3A6653E05B18DF48B3B3B894B0157D6920 dd5jd
458,260,555 *2E8377EF38CBD6817FE9673A8DED2C422C02D671 2336951 PERUSTURVALAUTAKUNTAP
458,260,556 *2E827D005F7186673EA4E5BDA8906A9C5539BB93 deborah-a-grayson
458,260,557 *2E8ADAF2711F0B456CCFF6CF7FD602E86BCCD1B7 BAILANDO AMORE
458,260,558 *2E8E5F26AA702B7ACD12056C208C5C66727DD2D1 1 SENSORENTECHNOLOGIE
458,260,559 *2E837CD04395C062ED1F91DDDBDF044A12034CE9 deduisir5
458,260,560 *2E804E21DAA31B9B4C05E12F784892A5BE66D819 DEELYNN9
458,260,561 *2E8DB5AADF6E8100A49305A8BD5018B6A21617BC 1 TABLAKLAENGE
458,260,562 *2E8588B80292EF8EDE361A3CADB614743E283B80 255-218-185---------peachpuff
458,260,563 *2E895339C6AB32EF1206D5CF328923DFF5AF4111 BANOVINAED
458,260,564 *2E844A8BE71E0E229D297E873CACE7FF81AD4373 298KAI
458,260,565 *2E8BFAE943AECD52706EDC6222E26CD27D780C5C 2BFISHERMEN
458,260,566 *2E84FD4B9BEDA33B13249F2AF5E97F86F1B3FBF0 DENISLANGHOLZ
458,260,567 *2E870EB57DCE8E504A2FD464EE0F0A06450D42D3 de-nom
458,260,568 *2E844F0599C8B8762E1C1D805726F223ED8E93B3 1.yhteistoimintaelimi
458,260,569 *2E851BC26970806D5174809DBE48D2DA53E11C08 1.zdf-vorschlag
458,260,570 *2E8257848563BDCDE15A6BBB16295127D3F89145 2.euriskilistalle
458,260,571 *2E8857B31A7F0D106A77D392D38E794AFC7D15AF 20.04.1056
458,260,572 *2E8025D245633DFEF36079958F3822A6E4EDAB1A det$5
458,260,573 *2E8E06ECEC7AD2C1F455ED1A41D380DF5297E66A b&b.g
458,260,574 *2E88202274D4335357929BBE83E4F6EF27F2711B 30091104JEA
458,260,575 *2E8F87D91AA1C59488B30EC9C858CB47D1E089B6 bd#sf
458,260,576 *2E8865FD0DD9AFEB96E15074EED9C3582DD917EF 376BRENT
458,260,577 *2E8175A16B6FD8737CC9FAD1A8CED6B14EDC0035 BEAUKOSCHO
458,260,578 *2E84D673710365658552CCB2FD864FAEAB281A87 3ATOMBOMBENOPFERN
458,260,579 *2E8D5DC74743EAA3614D5092A57F4FA7C5A41EE7 27triphyophyllum
458,260,580 *2E878E7152EEFE48A0BB10128B008818E230DFB7 BENEME7
458,260,581 *2E86F82DA48DD9565E7B4507F1AD15F7CFF22C23 D-i
458,260,582 *2E862C7EDAC34B177E99B8FEFE6C94B416E63360 3FELDSHER
458,260,583 *2E8FCC6AD9EB215D23ED38F53D84329C240388AE BENNYHUSNI
458,260,584 *2E8FB6CFD5C932C9DB68C84240968460441D046D 3IHSOYOAN
458,260,585 *2E889BE4A8EEC6A160E9F46F6E4A7A40AC1BE219 2-HALAI
458,260,586 *2E81583F37BA0AC9FFBECA92CD45550C6915E45B 2.ige-antikoerpern
458,260,587 *2E8E60C8D84C35A558E185372A33149DBD63358C 3 LATHROP
458,260,588 *2E815F969B842D982F233847B0FE418E25DF2F89 [email protected]~O~OO><
458,260,589 *2E80740594D98372182292DACAD247ACECD80FED 2papakostopoulos
458,260,590 *2E89D9D3A2C5772A93E36812A321D53FEFE4B248 3 RSPB
458,260,591 *2E84DEF20CA8E7297AD946DF44E6AE4AF3FC050A [email protected]
458,260,592 *2E8C45C20A72102968F0A66022F7E1AA4690F032 3THATPRINCESA
458,260,593 *2E865460C4AC81A9C5BA7B461AE881BD286E73E9 bf"m?
458,260,594 *2E843DA60F5F3FB3CC2448C90E14A2C9C47F7985 dkrt
458,260,595 *2E8C244792B69BED3988B33D9D0C68CB1CB2880A 3ALEMBICATED
458,260,596 *2E8EB9F1740C3302BEB455B3FA105803EEE66F47 4FKB
458,260,597 *2E8C17FB9349FA180015AF5F13EB949DA2CC7C5E 4GNILEDLIT
458,260,598 *2E8A0B2FCE90536C1A14352809781D181E5C4904 dmgd2
458,260,599 *2E8F0CE11CF53BB881375F7DA6B969FEDBD0DD61 b&ibc
458,260,600 *2E8A9B371517FD94DC1ED4721D65D7184AE1F914 BILLIECRUEY
458,260,601 *2E8B276316F9F9146D2772404FD7F243CA09791F DOMANDIATING
458,260,602 *2E8A948C33791D59EEB3DD9B630A57FC935E9077 BILLY-JOEL-UPTOWN-GIRL
458,260,603 *2E8EF1A1BB77AFB39B5FD52160B68FB644AC5079 BiOO
458,260,604 *2E8074C4BA349812406B555C13A6FADDB0679649 DOMINIQUENOTWICK
458,260,605 *2E817480F2461CBB5C1C08EC24C5DBFEF8356E52 bit#
458,260,606 *2E8C975FE81B45AA9A083C1F5926ED3D252B3346 3.PFERDEGEZOGENE
458,260,607 *2E80FCCC65D68752F5D952F6F93B11E1E3A78272 4RBDEIFISSALC
458,260,608 *2E8575392F4DF2D04CCF91E443687A7BE70E38F2 3=====P * *(X)
458,260,609 *2E8D41C9B1F71DCE413B080691D3A5802508C54F B$KFO
458,260,610 *2E8FB19E01860A35C73BDDE9752CC24EAB3DE3DC 3.soccerliga
458,260,611 *2E8A8034103C78D0B440A332D10513103297F601 blastoporphyritic
458,260,612 *2E85016558BE0745396CE2508C3AF3BF8C736B9B dov=5
458,260,613 *2E89F405180A4331D8C6E5E10E499DAFF5ACE6FC DQ7#L
458,260,614 *2E8EF7EA50EAFDFBDDC50EEDB84B669E8212E259 DQKB(
458,260,615 *2E8ED005CDA81068E9DF94648DC276B3AE463E86 DQT9L
458,260,616 *2E801F29B98BF4164B0D033A3F4CAA299AB852A1 BNXW
458,260,617 *2E8056B207D237708635F3BFF32D68917B5C3507 boats-n-hoes
458,260,618 *2E864A5071D6A8D88A22D0B3222262F8E9DFE4BC 5DECAFRUSER
458,260,619 *2E85B8DC1E89B4F0381525BD5580A5880392756B 5decaisserais
458,260,620 *2E84EFAEEA335B39C6C227C8784A165DC8927BCC 4JORDANLAURA
458,260,621 *2E8EB912D4DF831D69EC1D948168AF836024B346 B&OJE
458,260,622 *2E8823B26082FDF5032546F895BB28857031AF8F 5GORDONSHEENA
458,260,623 *2E86C35AD1D80B9F13588C9D516212AD0AACE1B0 DTMN9
458,260,624 *2E816E53DD54A51B2D1E05045D15664AA92FAFF4 5LAUBSTED
458,260,625 *2E815C16DD9E2ACA8FFB4C4E05227A51DB0D23F7 DUAALBAHA
458,260,626 *2E84BE41CC8A5053EAA106DA88735659B0297C2D DUANE.HIRAO
458,260,627 *2E8A99BE7D58A484A73B86E4F90C1C2AE4DEA4B4 BPVID
458,260,628 *2E8CF649C15459E16965F675676CDEE49BC2D917 4TEDDYHELP
458,260,629 *2E8F914B9699ED0CB0B90C9009A124F202E50013 B(QD
458,260,630 *2E800C154A983D1662E5162649856E81DA9EA7DD 5NOVEMBER1968
458,260,631 *2E8936A983502A1F845BBFDF314D5CC715083042 [email protected]
458,260,632 *2E87164776C0DD96F24812F156BA9CD61B0A9A8D 5PORSCHEOATMEAL
458,260,633 *2E83B6D6F8056734086AB3C2F6DE85DF49371A19 dustin-fordham
458,260,634 *2E8A7DADA4AEC91A2A1CE0C9913B09CA1D41C33E 4ZACHANDZ
458,260,635 *2E8B52EC856500DA1696669FE585A819CDB05CDD d/vsu
458,260,636 *2E89C0E09D34D994A810D8925967A06E439C0C24 547EFD8E-6521-4D57-AD94-9DE24E69327B
458,260,637 *2E8C08B96EAEB6704CBA480DA9A11C7D6127C9CA 5TSGITHCATOPS
458,260,638 *2E8BF39F8DA7FF9C8937A72E9B4F4DBA186E628D 5UNLITPITCHIN
458,260,639 *2E80C25B4DD758844BB989F9834DEF9F5372E599 55YAIR84
458,260,640 *2E8863B1E2CA0A0A8FC0D776283280CDA787F624 DWAINROZZELL
458,260,641 *2E879547EB8F6ADA1D5C5FC0BA276CA1A4D0EB92 D%W!I
458,260,642 *2E84D1BCFDFA642BEA80EF320C56A4E93DA207A4 5WONTENGE
458,260,643 *2E8AFEBE951DBEB14DF483FF738F14B7D5775145 dxsau
458,260,644 *2E8DECF025BCBF4C5DBFC19C7BC45304DE4171D6 5a949db718684d72a66587254c16d3af
458,260,645 *2E86AB029AEEADCA38C818C6674E043CD3E3951E 5ARUABIHS
458,260,646 *2E86441F8015C4F703BB9D3D0CC4869DEFF08BEF 5BLEMMER
458,260,647 *2E8242BCAA4DE5F3E9D269EA1D0E55601346BBB4 dz0bo
458,260,648 *2E8580B10ADC6C44A7E5FFCB889F285AB4D03B96 5BSWHIPERSUELOBSW
458,260,649 *2E821183424BA4CF9C88C3A2985F126E39B0215D [email protected]
458,260,650 *2E85864198F78F6E5D4BC6A22DB0F829854A18CD [email protected]
458,260,651 *2E8985253C42FF1FE1D01A4B9C206514C83123D3 5DEUMS
458,260,652 *2E8F231C8A37BC35FFFD164EC10A4DDE4CD2B892 E]\8
458,260,653 *2E8C34E9ECCC798CF5AB4E4DD86CDF09E48D163C 5-energia-aineenvaihduntaan
458,260,654 *2E8382AB1A79FB056C12E59A7ECE4C7154D7322B ebaqw
458,260,655 *2E8AAC486CFD277ED5B93763E49D6F1977652A1C bridget.wigg
458,260,656 *2E8C0CA807324E119152598EC7A1F85559F944D6 5FRIKSJONSKREFTER
458,260,657 *2E88AB8B2A5AC077CA9C71114027D813EB13C8AA 5FWAYS
458,260,658 *2E8730C1881278A94FC44C9156EFFE31D9E1889E 6BSWKREFELDERBSW
458,260,659 *2E8EEA970D9EE5A4095DC5D230C439930FF7DD5D 6CFHTCFHT
458,260,660 *2E833246AA896FE66847D20578150960B65D39AC broderickreys
458,260,661 *2E83AF570A3072A45BDB08AC40DF7C2D27EA9655 BROZENGO
458,260,662 *2E8DEBD8ACBD00564121A811EBBF274663900472 6°e16’30″
458,260,663 *2E82CE49F81E34B98FC8588DB19E0E94E1DA7593 6FASOLDT
458,260,664 *2E85AB31EA1BBC563D27ABB214A58D62B5E3011F 5LOUISPICARD
458,260,665 *2E8308C04D16D3F65B11A1E3D078B6DC28339ECE BRYONDANFIELD
458,260,666 *2E83B7866A21D1ABB3F44BACA4EBA9F9CF819B60 6HIERARCHICALMANNER
458,260,667 *2E8D19646479C7AD80A717EC0D4B5D6705324979 edte
458,260,668 *2E8F06795994C57D59BA5FFEB14BB41DA5A5BE3E 6LIVERSALTS
458,260,669 *2E8D2A558315ACE73F3C51EFB163D385A61E7454 edwingaeddert
458,260,670 *2E84E3EE4F2D8EE1FF0A7C1441298A5427301ACC bswpsychout
458,260,671 *2E89C1A3E86BF893810C224B8928AF3CFFA517FC [email protected]
458,260,672 *2E88EB1446AB1E5213A0EB9BE7C7B665D4191EFC [email protected]
458,260,673 *2E8987185654CBB06C84DECB25DB7F273CAC71D2 either way
458,260,674 *2E8C928BB833AFAB05027332971B8383FDF8B752 BURUMON
458,260,675 *2E8A3DFF999E0FE5B07B35CC1D591E49C493C834 BUSTER.MCMILLON
458,260,676 *2E8F22AB1980BC0C834EA2B01588EA8F51DBB24B 690939 DMF IC VE DIS TIC
458,260,677 *2E846AD847352B59FDC0B4876DC3CA099341C09A B-%VU
458,260,678 *2E844B43FFF3459BB1DC389024CD1C10CCB46C2F ELLENROLLS
458,260,679 *2E833B64285E093F477C6E611AC26C75967BA537 7aafecbe831944038ba5bb676bdb242f
458,260,680 *2E8DCFB0ACC1C2E00999CE84436D9DAFBBB203CF 6ABSOLUTHENDRIX
458,260,681 *2E8BD3AE1B762B622B3F775D3A3C2E6D113389DA elnshund4
458,260,682 *2E8AA461D48076D255A93165E5D1AF80648099CF [email protected]
458,260,683 *2E8BC6698F5C26C1E8ABE09F006A861B36A1F695 bwe)u
458,260,684 *2E83628276E28357BBAD39D619182811DA487BF8 BXdd
458,260,685 *2E8632D480CF142D5C7F63823950E0EA8285D789 BYBERRY3
458,260,686 *2E8AAB420390D46CC9249752DEFE783A35F9E3E4 emdy+
458,260,687 *2E81BAF158D8C7E8551C39C119F7BFE02735EA56 C)0A(
458,260,688 *2E8AD2E0D1B2D4FAD2E66F833562BEE6919E966A C1%A/
458,260,689 *2E8631EF99157C8F4CD8D8B2A8819D770B35D263 c)3m
458,260,690 *2E8B2874C8B7D731F31E0DD7DB237F800B76B752 7KONFISKOVAN
458,260,691 *2E8EF9FD2BE8A54CE639FDFEE90519199BA0F368 C4"0K
458,260,692 *2E8A3104D5F9374124B9EB59C97DB5A2027DF951 c4py84r45
458,260,693 *2E8047396A0F9DFA8C9200B94D560ABCBCD62EDE 7NAVFEATUREDSTOREBLURB
458,260,694 *2E88C2F6E2C670736815374119473A823A5F0F35 6SCULDRU
458,260,695 *2E807F9350929E180EC599738C05F14E60A7350A ENIBMULO1234
458,260,696 *2E89030D45E2E230A1D8F78C7C139930C22823B1 eniogaer6
458,260,697 *2E841CC7CB68845EBF3253C1D07FFAFF6FF50E75 7ninevitical
458,260,698 *2E8773BEB1FD397F87A810A9F69D7DF811151854 c7pwp
458,260,699 *2E8214C9E497518B9A426754EA099BAAE27117FD 7REMINUTED
458,260,700 *2E8B6EA8A7B19C78FC9EC30887395F77032953BA 7RNCMACUK
458,260,701 *2E8AE9A4932E097395E5D3E299A4206FEC7F7BC1 c9xme
458,260,702 *2E83DAB627AA662686948D93CEF8D579389583CE CA1VN
458,260,703 *2E85A3169BE874FA576593A93517971FEB346508 cab"
458,260,704 *2E83B5775209528538074CD7ABA5C6DA860B56B8 ENZO874
458,260,705 *2E8ACF5A4A932E8CAE7338235515DAB8CA828D32 C%ACC
458,260,706 *2E863021626A8EBA8C78D6A517E7B7F3FAE0C28B 6THATNESTLE6
458,260,707 *2E80F700BB194C7D3DDD2E18004AECF3F2FA7783 6TSEIBBAUQS
458,260,708 *2E841968B8D037585EED85796BEE0704912403B8 7-YHTEISHALLITUS
458,260,709 *2E84A0A66E90D3B962F8489EC93FB5F7F9111381 caiel
458,260,710 *2E8F8A75DD3AB95717501EF796F45B0294B9D565 8221031I
458,260,711 *2E8E40EF2966CCB5F9C2BC0E1E439FCB2B55785C 71652 sindirimi-kolaydir-.
458,260,712 *2E8CC336D25B670B2FBBAB4EF6C6A1AC2BAF3D30 86perilous
458,260,713 *2E8EE44D7C9DF5356AA61EE7C252CC8D8F1892A4 CALVIN.GREENHILL
458,260,714 *2E87CCA9285FB3A5128B4C57335AA8A44D4EB5FB 8ALTERNIZ
458,260,715 *2E842A44AAEE225CA1B7D5E54BE87AD16B8B0460 erhobene
458,260,716 *2E8AFFF60D01313F1AD349D9FA027A7E944A9C86 7ANGLETOU
458,260,717 *2E8252BEA59044CE718B0DC8D7C7EC5429CD9D7A 7BEAMFILLING
458,260,718 *2E861B72164C973228A2F4ECAC1917B0046418B4 8BAIJERISSA
458,260,719 *2E81BDD3675FE00AF73F090351E9D6629014E0BB ERNESTOLANTIER
458,260,720 *2E8CB289F33CB9FEB20755130B5384CC9B220023 7BSWSYMTABLESIZE
458,260,721 *2E8E5E961512B99E24A32F767D2C64D1DE12F95C 7CHRISTINQUALITY
458,260,722 *2E8D005F0DE5D509E198C7652D9F358FF79E4C4E CARL.BERNHEIM
458,260,723 *2E85923C7438C34ED751820E2DA5F94523B49220 carloscobler
458,260,724 *2E88F20720DAAAC9E3EFDBF078589802F504949C ethylxanthate
458,260,725 *2E8DAC91A54E90C619061BE1E49C3AF96340FEDC 7HARDMASS
458,260,726 *2E8463BB0DDB3F12A0C2D1DBC81DB03B832C5F9C etpu
458,260,727 *2E838ABE86D7BC28C8ECEB30931E081A52526FE3 $8l4t3
458,260,728 *2E8F149B676BB879942629EA68022A8FEED0CA35 eupp;
458,260,729 *2E8F265F984CEF5D129A3B91D0189EAC3A07F475 eusebiostanzione
458,260,730 *2E8451F4A53C535EFE6B846545A5EFD3E84A7EA2 casteleao
458,260,731 *2E89F1BC16A4683F1411BB1C00E24C13C08C3F8C EVAN'S.RADIO
458,260,732 *2E8BF2DAB49831D0732DE80AD3EA538AF31A3C00 )8([email protected]
458,260,733 *2E8A7060AF35564294F0F96D226E6CAC9C480451 8->-~O-~O-3B<-
458,260,734 *2E82291D861F236C76019B8A7EC2EC74D7586B50 8--P ~0 ~O )0(
458,260,735 *2E89B838F7ED9FEC07DD97BBF26E168FF83E1DD1 7OPUTNIEH
458,260,736 *2E897E836C743B36F4430CFE8878C14D58201F5D 8SOBREVIVISTEIS
458,260,737 *2E8403F798489A08B1DCDF346CF6B718F3080899 7SNAPPERED
458,260,738 *2E8838778FF2EB061A6A232CFF29A41DA83A70BC 7SOFTREVUBSW
458,260,739 *2E87B216BF09F124A15EBE831BB2FE43C9DED2B4 cc%go
458,260,740 *2E8C641A4416B74E6FD9F1EF218083627F5ACB5B CCV2$
458,260,741 *2E83667EBBEBF3A631A1B91FA31BD6E38464BC42 8WESTERNCHICKEN
458,260,742 *2E86921A4326BA507B56C9CEA6D52BCF4F2D34FA faceface9
458,260,743 *2E85985A265AD37975A9954393F5C1FCE86968D9 934allisson
458,260,744 *2E8FA07962844E3AAA660BA6A86AD929CCB3A9E6 FAL
458,260,745 *2E8DBB4C3D0748C1953D4291E56E1FDA7A315019 CDU04
458,260,746 *2E846555A2E4BB63E2272A7D7FC4876E75B0CE3D CE0J_
458,260,747 *2E81B1F99884A46DEBC0E1461A33D099D7CE95D3 8BILLIGANGEBOT
458,260,748 *2E8196495B4486F40A1059E4F810ABA04CB16EC8 8BSWFERNANDINABSW
458,260,749 *2E80D5497643E5AACA70F2213BA887FD931C1768 ceratopsian1
458,260,750 *2E8FC1E4346AB8541214E176F8DD33329388DB70 CESSEUR4
458,260,751 *2E8AE5B452175DD0E7FF8C7D044858CDF860F9B4 C?FHE
458,260,752 *2E8BBB06C369E7B21767096B7CC59E0137505E64 FERDINAND.GRATER
458,260,753 *2E8491BA3ACA6828A9481284B123FD7D73FBA3B6 FEUERSEEIGEL
458,260,754 *2E876FB1FA935CB9ADF516F3AF78128DDBCF14E4 FICHTELGEBIRGE
458,260,755 *2E869AF0724A281D6E18F751561568AAC5C63956 9THEBUSTER4
458,260,756 *2E8E3B918A56BB2C44F93B9D4A7EB26B641A7378 [email protected]
458,260,757 *2E8C7A3ECEA708D225792D0566E099BB878AD82B fkzx
458,260,758 *2E868EA800D795CE285AFCD0E3225BB28CA95DAF 8NENATOCILY
458,260,759 *2E80B5BE22172ADAE696BB1B6E2EAF71364E0E1F [email protected]
458,260,760 *2E8BBE006F5E4A8A7EA7304A63F977374A7E389D 8OMEGA1
458,260,761 *2E817F2780C2BD2D5FA58BF17BBA4BCDB450A65D a:6)d
458,260,762 *2E8FCD28E143AD65B4E17F2B32F47C1C3399C69F 8-----P-~O-~O-(~_^)
458,260,763 *2E8AEBCA9004FEA452C5F71B6BC3B09038454AA3 8roodgieter
458,260,764 *2E8FF7A8321483B597F4E3E5A4A17068B7726EF7 forwore1
458,260,765 *2E8186C8CC3F24C3F1D3349548B353FFFA46A545 A-9P3
458,260,766 *2E846588EAF510BC5E7DD45BC3A3F4C9CF222233 8ZSYLVIE
458,260,767 *2E8A9E0BD6132B068DF4E59C45AE1F9954BFED7A AABD/V
458,260,768 *2E8B106708B86395C9C49955017B85DD69A69B53 AACS62
458,260,769 *2E8DFCCCF128117E63ED4D065DF0D21F3C9F30B2 fredricksanes
458,260,770 *2E89726AD8A139203B8CEBE8806CD7A696A58BBC AAD"0}
458,260,771 *2E8D828CEA512C48F6F7CCF33AC0D9160FF94F66 970812 DER-FLUGHAFEN-DORT-STOESST-AN-SEINE-KAPAZITAETSGRENZEN-.
458,260,772 *2E8FDA8699100B6A38E7FD06DDB73BA687E4CA5C AAE'P"
458,260,773 *2E8650184074C43D1CDDE89D8494835306FF5CDC 9BRIDGESASDFGH
458,260,774 *2E81C4B544504C9FC3AC89B88D39D6785DF83672 frthgng6
458,260,775 *2E81A56E122228B0642EE4BB92BE7DAD5413BFE0 9DORICALL
458,260,776 *2E8F5807807738D1AF9D87902159DF810B98E690 AARONSIFFERT
458,260,777 *2E8DE97EE3552415F8ECAC300BB2ECC99521A779 funkydna(disc1)
458,260,778 *2E876DA49559DC69DA255E084865944B832A77AD chs/z
458,260,779 *2E8255C6A63D4328DD61418113A0F34ADFE50C31 [email protected]
458,260,780 *2E8B5E430BC948E30D01E8B7A8A28AF085A3721B ABRAHAM.HORTH
458,260,781 *2E84515C2B65F94FBBB0AF1D91C043D66C1A19B2 abramklinko
458,260,782 *2E8342784986E5586D798A110508B41271B96EDD abrivados
458,260,783 *2E818D1917289FBE04907203959418B3610BB7C4 9STARTREKJACOB
458,260,784 *2E81F6EFB0573945EF48B2B9169872299030542B 9STOLPERTEBSW
458,260,785 *2E8960F115817904E839AB2B02E9D1049F793B00 civilian-held
458,260,786 *2E8CECFC7ABC9B7FB388EA04BFA406D1C0CEAC94 [email protected]
458,260,787 *2E8B573172E8A823B7C6A9B0AE092DCF6E4B2F85 ADAMSFAUSTINA
458,260,788 *2E83F9A600855F6D41E409A24EEA9777F23ABABE gcwxhlqvnhic
458,260,789 *2E8CA1DB4A27A1EA9476C913334BDE7A45171C7D [email protected]
458,260,790 *2E865CBC6F9497DCDF9F97B982D05EC3688EED44 CLEMENTHOLLINGHURST
458,260,791 *2E84ECB4332BFB06E8E4CF547267AACDF66F4DF8 CLINCHER
458,260,792 *2E8D7D98CC12F56044268AC408A5CD8239F3B9EB c!lsk
458,260,793 *2E81DC2E0156026D3FFA42CDC7771EAE829D0A8D GERMANFUNSTON
458,260,794 *2E8B37945F6F6A0BB791D1671B38E597C67724BC AEKST
458,260,795 *2E820566237922C8834D5B7020097BEBCD7EE466 GEZEBAH
458,260,796 *2E8E24E5BFC4D6D4D9A782DA6154FA61F8619CD6 CmjW
458,260,797 *2E85FD750DD3C13AA8AC3E3EB04A7244669028E9 aab),-
458,260,798 *2E8A8598041A2C285F3E46695B063D5BF12E2822 AFGUDERS0
458,260,799 *2E8D2E58735AD0142A377AD54379CAD4F81C2F6F COdL
458,260,800 *2E8CFB0E6075BBE87BE8DC9E2AC19C7A81AB200F colindante
458,260,801 *2E86B369A6F3741E9F53641C7C651CC150F6CAB9 AGCOMBSW2
458,260,802 *2E8FDAB0E55F254156D84BFEE08F44CF91C6AAF9 ah2r:
458,260,803 *2E86C4487D5B544E023D049D11EC21C1530FC5BC conditional.expression
458,260,804 *2E82E67AD09B6479D813E1C56A0F23B30CA4AF1C CONSEILLERES
458,260,805 *2E8AED9987D3B86B85C33035DF49214BB8E722B0 CORBIDE1
458,260,806 *2E8C9FBEE4A0A826C1E897E7F6B2E2B7E78EF276 a_iu
458,260,807 *2E843D974E90C28CF1F672B23F044D1305456810 CP;
458,260,808 *2E8353EC3D50714A64E492DD132A484A36FC8068 [email protected]
458,260,809 *2E875BBE48D0D5D300EFE27D4B7B9FD65A66AF23 [email protected]
458,260,810 *2E8010B60DC48EFAAF49A68A093AD1623D9DD053 al8k&
458,260,811 *2E896A82DCC349DE033C5373D8B116D12BCE0593 GUILLERMO.MILLY
458,260,812 *2E84646F317CBE9DABA9AAC24FC46064C82BD276 gusnoyd
458,260,813 *2E82F0A9AD8F14FE683352DB3047CF5B2CE28404 a/ld:
458,260,814 *2E8B6257FD90192A8296B213CE9D5CBF50B4C259 GZBC
458,260,815 *2E89CBA84B06280A0886C5840B1A48B2E701DF5E ALFONSO ROJO DE LA VEGA
458,260,816 *2E8FB5A81842039CD8E1F1D4FBBF10B52F3EFAE5 cprd
458,260,817 *2E8F9DDEA2E24EBE530135DC207FD7D8470D0954 abm-r
458,260,818 *2E8EF0693DAAD055AB007A2E18682E6B70D69BF3 ABT"N
458,260,819 *2E8AB33777C6BCE0431382AA8F5DFD0F08C81B09 ac1cy
458,260,820 *2E8A1200B2B8C7ADE1D9BF54ADEABC61572E4B59 ALMANAR83
458,260,821 *2E8ABF9902FEF3AF5029E79221B8D511A3E4A42B HANKKINU8
458,260,822 *2E84B9966B078A96F1D3F0058896A64E97CF82C6 HANURINSA8
458,260,823 *2E86D2BF73621E45F9C868086C890498202A1FB4 HARLANANTAL
458,260,824 *2E8EF4704F7CB4B7A80D9137BE7B8D78776DEDDB alvincarder
458,260,825 *2E8776F4D71BFB231C776F5AF9B33D3998E8335E alvinhouchin
458,260,826 *2E8630BE3544257FFB6D6BA1CD6CC0613404D72E A%CLB
458,260,827 *2E8C1DE87B93B2291AF17B023D6E163F4C054B4C ACOKLOW
458,260,828 *2E82C498E0FE746515968296A1BB9CFD839B56C5 a colloquial dream (alternate take)
458,260,829 *2E86D008085A205BEB7CE863FE6FDA2F30D45B60 [email protected]
458,260,830 *2E8A4C23FEC178ABC8D638F1FB4D056A3282B93B [email protected]
458,260,831 *2E859354EAE8951B4C002A9A7EE7F58AF1CB061E Ac=s
458,260,832 *2E858AF3CBC5AF6CA6D4166E8CF21D85271E4270 CRICKETERTURNEDPUN
458,260,833 *2E8F8690604535823043A547B5D5E529E0EBA096 ADOLPH.FORTHMAN
458,260,834 *2E8E367750E371CE6A6E1B685BAC1D40F9663173 ANDERSON.HORNACK
458,260,835 *2E88834FD5EA08766B160C425A858BB42AFA2DC4 CRITICALOUTCOME.COMWWW
458,260,836 *2E87287124DF82AFE6B4C4F00113E7DA519F25A4 ANINIDUE
458,260,837 *2E8E79DFF30D69F409E8BD1CB73A69E1590E3766 hilton-international-luxor-|-egypt
458,260,838 *2E8A0BCE91B5BA1443C475C30750CEF890039260 AFSLOOFD5
458,260,839 *2E82B0ADA999055C21759C7665BF07AC64437753 C!V8C
458,260,840 *2E87B490BF6B310172A9AC2D362FB90D5AE9CF2D [email protected]
458,260,841 *2E809AA36C0FAD0E5D4C3EC602CE4307B451BBF2 AHMADBLOOMSBURG
458,260,842 *2E8E49441198EE9FFA4C2013EC658F9886760533 AHMEDBURGY
458,260,843 *2E85ACBFA225BADD55AE8E1790B0310057A89E53 CYNTHIAIRIZARRY
458,260,844 *2E85674224FDB40B98F6BDDC106C465C5FFEF529 cyte_
458,260,845 *2E88FA8388FAECC51AAB97BAB6BF59320D696D31 c%zhu
458,260,846 *2E819D4426BD3C24A221F27BB6D84C57CA51C1CC CZ,SZ
458,260,847 *2E83714494A962CADCA1176F1663E88304496F8C HOTWRATH6
458,260,848 *2E8791F7C82F7B3BA26F46453F7EC3B0732948A9 [email protected]
458,260,849 *2E8E21F856E99D038664FECC379F85DEB68965D7 a/j(
458,260,850 *2E820EEDFB7943F2B4601BD8215DF8C9B6DA52B7 AR2008030501303
458,260,851 *2E81600DB0FB4F4B20D4AA015EC27F4843B401A0 ARGOPE8AINEI
458,260,852 *2E8CEE02B5ECB3B4CBEA21BDFF9EBB415EF48868 D)7VO
458,260,853 *2E8857861F41016A606075274510A18A7DCE3734 d872o
458,260,854 *2E8BB438277F1BFDF19A53AD1E590A50020DEA62 ALEXISFOX4
458,260,855 *2E8D94A06954ED227C32AF67DB7338ACACF5B34F ARTENERE3
458,260,856 *2E86E0464FF2438C22EC9803E3D23FE3AC892846 ARTICLE98451
458,260,857 *2E8DC500B91F1ADA0072427B320CFC160354B74A ary+w
458,260,858 *2E8C8F9B67E13654802459C588BFB400BD9206B4 AS/A
458,260,859 *2E83751EA7CD7FA02109CB093B69C41889DF1418 hzstats
458,260,860 *2E83CB0440376C3B055BF7A07C74A0057B4CFD71 danék
458,260,861 *2E8499B2714E280C6241AAEBA140F557F704452C ALPHONSE.SHERBO
458,260,862 *2E887CC5A9F22EE8AC5CDE83D668CF9EDA95EC2E IASACNIR0
458,260,863 *2E8D4CDDA1302460CEA9754CD969978A3050999D idejárnak
458,260,864 *2E8A6A0931EE8B93BA07B7B06EAAAC25E57D18BE at#es
458,260,865 *2E8B0F1A9D8EBCBCE1891673E2A12D15AB127440 ih,k
458,260,866 *2E84D3CF1834D50650C16148E2F54732B4F76BFF DARYLHAUPERT
458,260,867 *2E838853C6457DA4899E37B733FB5811E880F334 IknowthatlanguageTwozorkmids!
458,260,868 *2E8DC3D5FCB8B2C048A811BF679EC058550D1851 dave.forehand
458,260,869 *2E833E89A9C89A199240C40D9D485A31B740B891 DBGPROP.H
458,260,870 *2E801C1A590DEAB82565656B1709E4610A92273F ILOVEARLENE11
458,260,871 *2E8CD6EF7B9393026BD4A3CB5548A51BA6BF77B8 andreahummert
458,260,872 *2E8FBFFD6A36FDC1A0121E9F4D638D499B9324BA ANDREASAMOWITZ
458,260,873 *2E8775351D231B23D3528EFE4B43E2C42357A403 avb$z
458,260,874 *2E8270A0D5DD07B840D49C5EAA0084D56A8ED014 ILUVCRA-ZBOIZ
458,260,875 *2E8240645378CF9BAF6860FBCD8343C39CF76AE4 av(.m
458,260,876 *2E807BF4BDC919B55EE0FB79EECDCDFF4C932869 Awaken....Larkrise
458,260,877 *2E813FBB95190E69AFDDB32F0BBEBFEE7120C306 awc4b
458,260,878 *2E8F4F1C6EC5409499A786017D89B7E074C0E778 ANE:R
458,260,879 *2E821A387A957B6541BEF470714185E0D25090B4 I'M-A-KID-AGAIN
458,260,880 *2E854CA96ADE1C28F9E89061E3F90DC86E2CEB25 ina-b
458,260,881 *2E8BE910C62B5978BC3FC37A1687946DEBA7203F AYAAN181
458,260,882 *2E8E0BEBC97D14C0A12263CAB5A945C79F9EC955 DELBERT.DAULERIO
458,260,883 *2E8A08AF97D4129096A68B326035B5EB992D4297 azdmq
458,260,884 *2E866C2F0D821F00177F8CB233B2F68396883136 infogra
458,260,885 *2E85F467CF334231A610FC2DFB5D3A07FF4F4D33 ANV ADRIF
458,260,886 *2E81F1A24731998CB483AADFBF6AF3A2BF4230C5 dennishullings
458,260,887 *2E811F7E75758F401F962486D20EFDB319DA4574 b1v:)
458,260,888 *2E85EFCECC4551B9EFE1996D17EC5B531AFBF00B irvinskalak
458,260,889 *2E85899D3DA36C2B4256A4BF585B02E1BCF99144 b3-!#
458,260,890 *2E81804B12864145E71487CF1E86DBB835FE2D07 derağzi
458,260,891 *2E822E7475F1F281D1949FDBBF81DD1ABDE2ABD6 b,,4%
458,260,892 *2E8192FBF32AF52F8C2C87A87A759FFF3435BFBA b$4-
458,260,893 *2E877223A4037899A950AA1B7D16D56394412F95 ISRAEL-HOUGHTON-ARTISTA
458,260,894 *2E80A585DF3F5B3614616CB11C72544FD7BD580B b?5/l
458,260,895 *2E845FC7CF3579B6939D2ACEAF2C16E054766FBA b60)7
458,260,896 *2E8268C84013BB6B776C2346EA16B71ABA99E887 IT'S-A-SIMPLE-LITTLE-SYSTEM-(FEAT.-EDDIE-FOY,-JR.)
458,260,897 *2E8DC8DD88FBEC8240F472CBBAA7FA8E43871B2C B6R
458,260,898 *2E868517AB5042762E66EB900C3DD6F529F48B95 AO,(%
458,260,899 *2E81A59913D3AD5F1A93C59D12A7BA2B7767E9AE a:oa%
458,260,900 *2E8F6A7578AAABE91B63439C44AE7CF80EF95C8E APERIES
458,260,901 *2E82E5E7B102DDABC464161E13248A6155F0F16E Dg=(
458,260,902 *2E88F3BE8C610EF5BCFE2B42965B994A3D3C1F83 archiejohn316
458,260,903 *2E882D3C458EB34214325CCC6E80D9F12AC3A62E [email protected]
458,260,904 *2E84EFDB6CAFAE629E7641CE2D159FF140A9D947 ARLIEZEMBOWER
458,260,905 *2E8CF6A00485DC32672E15D02A0BA8C841ED042E ARMANDODELASH
458,260,906 *2E80A89AC08B6E11887EB004F5C3D48B15C294D4 JAVIER.ARGUETA
458,260,907 *2E88429A59AF08D7EE73DA96497CB5922DEC9FDD BB.~0.;)
458,260,908 *2E8FB61D8F612C07D5470E6A57795D516D61FD85 bciv
458,260,909 *2E83E9ADF8CD6B863562B397064F929D60D017EF jennifer-keem
458,260,910 *2E832B20DDEE2496C079A006937658C9D6F95564 jeredejoode
458,260,911 *2E8F2790E10C7ED5BF00B79335DE38D6AF91B71C BD?RX
458,260,912 *2E859D31690AF025CF8BF9BC19D08A6E693B9DEF jerrodgunstream
458,260,913 *2E8C5B318FFAD7CA40E4906D0BF7FC3A5B091841 ARVOKALAAS
458,260,914 *2E800FBA39875D57D4704AE8A0547560D238FF5B JESSIEPACKEN
458,260,915 *2E8C9F0F45F0C37457041B8CD1E1651520CDAEA8 DIEGO.BLANCETT
458,260,916 *2E867463F7AEB5B61525BD33661A6407D615A1CB BEKWL
458,260,917 *2E89486F1793599404F74D3ABED375A7E91BA368 BENECKEING
458,260,918 *2E89470E20C645B2FD61860101AB217A85CD96B8 benedictdolbow
458,260,919 *2E8D78DA21637F0B9D0CCBD4762BDDBEBE0B2E33 [email protected]
458,260,920 *2E8CDB2DC96D618D86E9FA09064988A6DA3FC32F ashubham
458,260,921 *2E8AC016C79F8AB834DA79C8B56699CE753E481B benny-escontrias
458,260,922 *2E86E1DA52C4A62C7A856A5D3C723CCB40D498AF ASSCHEDULED
458,260,923 *2E8FD7C3DE619669EC2596720E185A0985B40408 BENTONREDD
458,260,924 *2E833317D0FFFA8B17796D1D5A3467B4021B6740 JOANNCLEMENT
458,260,925 *2E8B5649DF55B666EF15CC1AE16B1E2AC315A7E0 JOAQUIN.GARAY
458,260,926 *2E8F4DB83BA381FB2C537D426D73A1AF7F3E54A3 a"t-_
458,260,927 *2E86C5E816B79F16798F190EAD9AEA42F83384DC BERRY.LIVERS
458,260,928 *2E89A5E392756C06F995C491612990AA62620513 BERRYSCHAUMBERG
458,260,929 *2E89B372E8EA27AF91EEE3C0DEBC439215A15935 dismiss the mystery
458,260,930 *2E8B2FE7389AA0BC5A08992FB973517CA26C2871 JOHNSON.HOOK
458,260,931 *2E85FE7EC21F03E5A85861D25A553D31C8B104C9 johnxfiles
458,260,932 *2E87FCDE833888BCCF53CEAEC3474F4F25D2D26B B&F6F
458,260,933 *2E8E167CDA96082168C2CBD1DD16B411B25E7E73 ATSODIP1
458,260,934 *2E85750ABA5F4C299EFE8F40620EEB9AD3B2F547 DKKCU
458,260,935 *2E807B7BCF323B85414E219FC4E1B385547DE0F3 JOSEFSMID
458,260,936 *2E8C3C41D9CF80CBF1E5D6AE8B7F608E9585A9D3 DKP:R
458,260,937 *2E8F424A3E67CFC3700DF9DAE76EC7AD88B521E7 bgp7w
458,260,938 *2E8519DCC9446EAA6A8A43B642116791862CA420 BIGGISH
458,260,939 *2E8337A8DE074D5A08F164E5DA8730110F6C16A6 AW0KT
458,260,940 *2E8214F337B69AA96981B57AD5CFD8136D0C51B1 DOGGIESMILEY
458,260,941 *2E8EB737E7DC9839D7E334C0350C52950309BD0E BIP-M
458,260,942 *2E84A463938A0098192083437526D1B3A6861BBC DOŁOWAĆ
458,260,943 *2E8301120C11C1F2B97C39E2610F109265375D56 A"YDX
458,260,944 *2E8AB757DD98D839BE6907DE39568243CCCA36EA [email protected]
458,260,945 *2E87CFDD73E0C12F601B47D5685915F54E22B3D5 B012975
458,260,946 *2E80A913B7AF675BBC5C2A32F3CDD2EAC063324D b0?g/
458,260,947 *2E8A856F26FBD76A5A10829B6629E79D188EA8E9 B1ACK7HORN5
458,260,948 *2E8CC57DF9F672CB1F6681B26AC5F0D132BD5840 blrt3
458,260,949 *2E8650EDC063F2E90D5AC7F62E550B191276D0A8 KARLA STOCKLIN
458,260,950 *2E853F097B208887FE7CB4273C9530780FBEE05D BMBK
458,260,951 *2E857A710DC99917953DA43555593F6698661C6D KAZUAKI-KIRIYA
458,260,952 *2E85E11B15B4941F1BBF58905424E5994A99CAA1 [email protected]
458,260,953 *2E888C0962BCB93FDB0FB5312D312D7CD2B3CF84 KBDAREK85
458,260,954 *2E8EB7EADF601C8DE33A27CD870185327C261AB7 bo9qg
458,260,955 *2E8BE473FDF2ACDFC44CE1C3E76E265F9D4F31B3 dp97q
458,260,956 *2E8A6AFCAE0EAC2C57478A6600A5B2F9C33340F7 KEN.DAINELS
458,260,957 *2E816845DFB8C6B7A3F342932D0578FCC5816331 bombazo.mix.3.(disc.1)
458,260,958 *2E8D105E5E2E652309653398132958974F0C3BEF B9"=
458,260,959 *2E8869DF4F7C8078B3EABA7575A15AD1DC45B671 bosjv
458,260,960 *2E8B909EFB40145485DD330694E7BD257B9D8AA7 [email protected]
458,260,961 *2E8779AED60A185F51EE56DF75BD4BF89A447356 b=&p$
458,260,962 *2E81292E9DC7C9C82EC049680A5603E361883DF0 [email protected]
458,260,963 *2E8317841EA859D4152E75A9B97B721BB764ACDB D?r-
458,260,964 *2E845F246E231B2EE946CF7D7B70899E4D674D73 B##P~O~o(>-<)
458,260,965 *2E8D531FA4186E0173A932A563F0E2D60DB191BA DrLZ
458,260,966 *2E845C82B530171B1D6F0747E0B466559965AC38 [email protected]
458,260,967 *2E86F5973BCFD8B948900A0C4458943914603C38 bananarambo1
458,260,968 *2E83185EA5EFCBF66B6173E0E77302AD079AAF52 brendonmonteleone
458,260,969 *2E87BA39B86405B19EA56046DC4B876BD3F4E9DE kriói
458,260,970 *2E8411B37E24712CDB222CD8613E94901005573F [email protected]
458,260,971 *2E864D1284458FF755B9F9295C64DAC03DF60571 KRISTIAN MANN
458,260,972 *2E8F1BF6D03D7AD6D6F5690D0FB1A8D30E89E65B DTQJZ
458,260,973 *2E8317BA60874834E41A83DB72DA7AE176C3AFD4 [email protected]
458,260,974 *2E832C32C1B1EDFAFEA3AEB70AE2E08A9CFB544B KSTING2
458,260,975 *2E84CE7180EE94165FEF8615793DDDA5C1106CB6 b-"b
458,260,976 *2E82AA0230016CC4B8E410B8657E10911F5236B2 BRYAN.ASCHER
458,260,977 *2E8CB8526F52CA1D5ECB61A34E99F510C6D82AA4 DUNCISHN5
458,260,978 *2E85E3D2F63606CE18DB213254256E2CFD136280 BBX_J
458,260,979 *2E8C0F2712BDA347710E1B526787CAFA82BE6E7E D/VNV
458,260,980 *2E80FD615F9043F4BE44C2FDDDBC4D33262F11C0 bubba1kevin1
458,260,981 *2E8AC64E911792D5BA138C772FCE098F52E0443C b&/#d
458,260,982 *2E8D2A2954B74163D0AD01367C245E2A19469FC8 d/y1c
458,260,983 *2E861209AC25C83F9A713206B3D2CC92ED371760 dynamited4
458,260,984 *2E86AFA2B4EAB70A73B33896239B6AC8C786E30E BURL.FAIX
458,260,985 *2E87E028CDABF94131BE96AD7B9FB38FD6520D26 B#D*SPLAT!!
458,260,986 *2E8ED083A74C77DE731B41BC344BDD8122CE3FFA EA?PR
458,260,987 *2E81577E34FE58BF4531CD9B52C0CFA6428D3695 LAVARENED
458,260,988 *2E879161361BBBFE864AA71E45FF9920F9595176 bwuqe
458,260,989 *2E83E932ABD114EBE0E3BA4E600CDFB27B15E7A1 b-x7"
458,260,990 *2E8B8D3851BD259E5E0663E0A2DE9984E5E83B5E ed1lu
458,260,991 *2E83DDEB4A5C7B155043E1FB77E13E89546D1A26 LEINUSHOU
458,260,992 *2E80906C74E70A316F77E7986245375BA1265CA8 c0mpa7r!07$
458,260,993 *2E830C83388941C63994136BE51D63EBE3FA54E1 lennyschleuder
458,260,994 *2E84EE8727FF7E0CA167E1DD90E38E98CF1FA51B c1v;j
458,260,995 *2E8A8C6E641DCFD8295D2E261039180D3B4325CC c2gci
458,260,996 *2E89A889F170A33DC6F7C21F792A8CB3E8C6BF65 EDUQ
458,260,997 *2E84C8BAB3BCDE24F2CC5AE75C1378666ECF773B benfetterolf
458,260,998 *2E86DBC008EEAFB4CA1EF820117C46FE0F25472D leubrie
458,260,999 *2E881322DA85863C60559C3B5E74F4AD3060AF2C C8NPH
458,261,000 *2E8D01782F9C896CE5C21D20FB876DC23FF7B5BB c9v(r
458,261,001 *2E8B9D5B00DEF42F8B5C8148DFBDF7C8E0EA847E [email protected]
458,261,002 *2E846AB6184961BFDDF30480012DE82920C711D6 [email protected]
458,261,003 *2E85E53EABBF162147662B4B9E930BCB3193366E einflobende
458,261,004 *2E8BBC8B3FD781FA934BB6A6FAEB81FF1FD55714 EJTNAKRE0
458,261,005 *2E8A6085302445DDD7A2FB2FBF93115C481674F6 CALYCULAR
458,261,006 *2E86A2776A80564A8A395BAE7FE9E3CBA7449819 BENNIERYON
458,261,007 *2E8C0AB0AD3F002E2102BEBDD6394E4096E8B33B LINDSAYLATHEM
458,261,008 *2E89AFCFF11D6AB42ED0AA398A1CDB813815552C linokloer
458,261,009 *2E8D905A86CD956103B22AE7027F13DBEFFF70BD [email protected]
458,261,010 *2E8E0C0A80AE6AEADB99FC493C4FDE7DA3A7F62D BERNARDDESCHAMPS
458,261,011 *2E86454029042A9BD674302DF7D426266C764E99 lisa-mally
458,261,012 *2E8AFA60A4B503D41C5A59B5E353B3BFC9FE4A76 ELECCIONES-EN-LA-REP
458,261,013 *2E83947C93CE16CF84CFFC70A4D6F8458821F785 [email protected]
458,261,014 *2E843CBC384BF0505AFFDC95FBC6055051DA692A elisifa8
458,261,015 *2E8350C1EAF353E401C11FCD9A25FE85FA3E67A1 BETHELCHURCHHAVINGAPOSITIVEIMPACTONTHE
458,261,016 *2E805B54B52BE8FBC07B679D3A53FF46ADC4268C [email protected]
458,261,017 *2E8C5C2FBEAC67D61C5DD7A8D0D3B0EA69470844 ccpspch
458,261,018 *2E80C1452DB166B2B56D5759B09C7D307CC7B401 BI1AGSINT
458,261,019 *2E8CFEA6D0ADAE8D58C170AFF24DCE721657A032 CELLOPENG.BBS
458,261,020 *2E8C2FF85B61291C07E2193F98807EA2FF68463B bisc;
458,261,021 *2E840832BDCB8ECAED323BD635611339333C5AC0 cfwn?
458,261,022 *2E8979272307875370F9CC442ED51A9D7520C0BC machiavellistischer
458,261,023 *2E816B4BB5C3890BB8D47F8FF841DF8D02B659AC bloeiperiode2
458,261,024 *2E8E06B593BC905E929BA12DD1BEEA1F5C7E5C26 chapter-05-06
458,261,025 *2E8FB964E91A575507F6C46D417D7DCA7CB24C5E CHARLEY.PRESKAR
458,261,026 *2E801A9E69C9EBA8156AB45B00BE51C4576AC6F2 charlie.chaplin's.chase.(15.second.version)
458,261,027 *2E898EE0D668E258F85FC80D35F1B1513C68189F bmwhawaii
458,261,028 *2E8FD3AC427627C48E677079A576CC42506BBA7D bndcw
458,261,029 *2E8F3C880609E50DC495592A1FBF9A0D7B3BD67A ESTERIDGE9
458,261,030 *2E8B265797DB89AE8587829996F9944E2198DF30 MALLACEEN
458,261,031 *2E809024BA8A3E2DD109B220523578D345392508 maltonibsw
458,261,032 *2E858334189216AD2B59C2CDE228506916A01B34 [email protected]
458,261,033 *2E8E8FEAF5F73EEC8C0BD10B460FE2C42A9D2F97 [email protected]
458,261,034 *2E80FAAAD16E7737FB7C8AE1751A48EF012C3848 ETIMOLOGICO2
458,261,035 *2E8043F14E1809282A7B3F5804D2B846259BF75F eugenewaidelich
458,261,036 *2E8967FFD431C32249A9DFDF5E6F02059AFAF3B1 BOLDFACECARDS.COMWWW
458,261,037 *2E87E5BAC5B7798F1E1C42465ABDAB08EB7CF096 [email protected]
458,261,038 *2E8BF0370731D0ADBBB1CD1D0E59215E070BD314 BO.MCKINES
458,261,039 *2E876FC9C3212038E8C2DA1A19754A18C057C89D bondtimber
458,261,040 *2E830C34230E5953262B54BE90081CF14BDD1E29 MARK-DAGUE
458,261,041 *2E803D791710CA92CF7D9A298CCDCC67BD6582E4 BORAWSKIEGO
458,261,042 *2E869330D033172AB80536C5A5F96FA2A9C8AD4E CHRISTOPER.SANTALOCI
458,261,043 *2E8D6E2D9B72F2DC24D8A33992561FA031E36AAD EXIT23(AMBIENTMIX)
458,261,044 *2E822DE2C104F450739B5C86659FB366DAE7B1B4 boycehackshaw
458,261,045 *2E80501E46905FEFF9EAA0E1EBE78C262F2036A4 b!#p!
458,261,046 *2E8600CA45ECE3F048A976F67D68256AA767F9F9 B?QAC
458,261,047 *2E8DCDF2974350F49A9E9E1066745AF66E9A33D9 BR9T%
458,261,048 *2E8FA35036714FFB2FB0580C4F1E0557423BF915 [email protected]
458,261,049 *2E8907911E7BE65CC25F69DC0EFDE16DEB7573F8 BR_b
458,261,050 *2E8E53BD341C11131EF408B63D7FFA87590EAB3D CLAYTONPANZICA
458,261,051 *2E8D15BF9CEBCBD4C90CA9C99D2CEEED635C8C46 claytonzegarra
458,261,052 *2E8A9CA6A1D3E7F60C1B91B1AD5125BC458A7EAA MELODY.ADAIR
458,261,053 *2E81280D64DFC9E52D052DE7A6BDD189095C8DF9 [email protected]
458,261,054 *2E823C74BB5344E9E4AD796A5357E4BD4BAC10C3 FEARLESSFUN(EFDEMIN'SCONFUSEDLIVEJAM)(2008)
458,261,055 *2E870D23AD37F13B56060CF3EDBCC9EBE7B1B2A7 CLINTOHARRA
458,261,056 *2E8AD4FC186AE2CA30A484E0DAA24AF04537F324 clocloreefer
458,261,057 *2E88FFA7FDE72E43129559E85BC5A6C15474E245 CLUC;
458,261,058 *2E817FC2AA26C7C56C715743F9E4A59526538952 FERMINKYUNG
458,261,059 *2E83B18A65EC9FDD044B016C55CEFBF251E11F49 FERN.MOSS
458,261,060 *2E8650213511074F6264464C35568D2085616730 MIEDERBEHÄNGE
458,261,061 *2E8018767CF3326A53F2397029937FF9B9B9251A FIDEL.SCHULIST
458,261,062 *2E80D211A7607369D12BF03191C8519550AFEBAB BRYAN.HARTER
458,261,063 *2E8F9C021C89D118E988E97574688E91191A2B7D FILIBERTORONK
458,261,064 *2E8E7BAECA539E45EF8103321DD79530AB17B75F FILMINTERIAPL
458,261,065 *2E8A905B7C557934461EFE40CDFE8B67EE21B432 MILES.MASINGALE
458,261,066 *2E85285D6B4B893DBCE4D2B0D8E10DACC3C3E323 CODV-
458,261,067 *2E814FBE0ADD9AB350CFF756D5C4FA87D106E2E2 COLDNESS
458,261,068 *2E8C3666281C373494C8F8566493C71386603CB0 [email protected]
458,261,069 *2E80963CB887595522ACE866FE32C253872ED9A5 MMNTPNMN9
458,261,070 *2E826B86112787334400F3B92485103F1E2D41D2 mohammad.golam.mostofa
458,261,071 *2E80F4B16FADAD44D403646388C3B629BDBC6D42 mohammed.al-khamali
458,261,072 *2E83810E491293FA94CA9E08E5901C000BC9F733 MOHAMMED.RIVERIA
458,261,073 *2E85AF2B948F0785006F200E2C2A4C97EF44F823 bta
458,261,074 *2E832CECA764BC56A2CA766D1B33F9A72496B4CD bt;li
458,261,075 *2E89A9943C1618C7315671C0253D2C1F8C91A594 MONKEYCAITLIN
458,261,076 *2E8BFC7A1B8E553A92E2EFBADDED860A4E057DA7 BUDDYPOSCH
458,261,077 *2E8961F6B8B4399FF021577951F9CA7C4066B8DD [email protected]
458,261,078 *2E8F779381701859AFA48C05FAFE6B3448B63E04 coraunte
458,261,079 *2E8A735D323FFE47977C59B3C4605CDE8261E278 coreyboxwell
458,261,080 *2E8729D4B63B8A0598867E8FEE56B28490C3AFA2 bum&f
458,261,081 *2E827D3B899DBCAA7D2A7D095BDC3DD365BE428C BURNINNOISEVSQUANTICFUSION
458,261,082 *2E8D18ADE2CDCF31286C504C8B2B892A8F1F9FA0 BURTON.RENDALL
458,261,083 *2E873584EA1FAD4A1ACE8AC507FA8E2E0B99E984 mtrlztns
458,261,084 *2E8804CCD3CEDB85A6FBD0FE2DF8E702291242CB FRANCESTATUM
458,261,085 *2E802D901C89AD8038B9A7322D9CF72BD03F9317 franciswhiten
458,261,086 *2E878DB656C4D89F93298DB02C139948531FE790 b/-xf
458,261,087 *2E8B1CC398F8A7E45859743A12B4C357F53BC877 mz_og_lowlow_13
458,261,088 *2E82DB62B85D160974FE25C66EAD39C3EE6DDA44 C=Q\
458,261,089 *2E8BC91D1393C1277BF1D355E3E41F68A2B093EA NATHANIEL.FURCH
458,261,090 *2E8FAB9D204145EFDD2873859089CB7D05D05377 CRAIGDUTTA
458,261,091 *2E8E1F0346F885C6820B5DAD473B5130A6C46683 c03#d
458,261,092 *2E8A15269DE2295538A439C5D92CA9B8091872BE FUIRSSDAY
458,261,093 *2E8FD466B6ADEBE526DF1FDFD770CBC39AFC0B4A [email protected]
458,261,094 *2E8FA5D58BD6C92FC7009356B1E1DBB27AF10772 [email protected]
458,261,095 *2E855C7E8066427FA44C8FBCC0D138E9BDA5949C neisseling
458,261,096 *2E8354E31BA913D447951A4D4221F8C4468B01B7 C1I{
458,261,097 *2E8C0176454F318ED930F86A2B1C74C758E723E7 C/SDK
458,261,098 *2E88BA3B549526F2983D14EBD0651ADF6224764D NFZEHNTE.LEKTION.NR..1:.SONATE.DDUR
458,261,099 *2E87C7F91BD4BBBACEF2DD86645B8F43337C5282 nguyenminhlinh
458,261,100 *2E8257B877462C4104FFBA366CD7DAB3946750D3 [email protected]
458,261,101 *2E826EE3EE9FCDCEA190A1EFD6DFD70D08AF5026 c99x"
458,261,102 *2E82FF39E4097389B77717CF231DCF653747B2D3 CUW[
458,261,103 *2E84045F1237FC5C2F7ADC0A1EA68BC9CFCAACDF cvmi)
458,261,104 *2E8F38DCD21D9D870712B34EFCED7CD99D52623E cwc$w
458,261,105 *2E8A87B02CF4C99D1B6062B77016797283A95C60 cwk3w
458,261,106 *2E8BFEEFEAC6BF2B4B38323809527CE41658E04D cxa-/
458,261,107 *2E81DB6E75402EA16129C2DBD2831C8FFA0E5085 CARLO.HELZER
458,261,108 *2E82C16DC3B9361603D9A5D20EA37754291C8B4D CARLOSCONNECT
458,261,109 *2E81521E0EEFB5150E31D6142899CA774EBC1E74 CARROLLFUERSTENBERG
458,261,110 *2E87B7A7B9E67EBCE75786153A36D00AC5752762 GEOFFREYSTEIDL
458,261,111 *2E8F40C91768900333ACA26BDB7B2B872EB180C1 d/&5,
458,261,112 *2E8474E2306006190C669D9417BD781DC93A674F d?5wg
458,261,113 *2E874ADEB78886D69D953C1142364E5BF2F639A1 D7K0W
458,261,114 *2E8CA53C5392EA27F05DED7FCBA86ACC9299E85D [email protected]
458,261,115 *2E86473140B6D4E8D0976BE3B4F815C72E40C761 DA#IH
458,261,116 *2E84E9A81F841DE7975A58CCC3D539C26C38A470 DALTON.NGOV
458,261,117 *2E82A624A2FC1E6A9929B08F1DF91CCC26849117 damiendeckers
458,261,118 *2E8B2BF4B3F4332C4A1E8DB85C2E84BE60A0C068 DAMIONMAJERCIN
458,261,119 *2E86AB1A232CC1E0B051B1C19136CD7CCA8D8C98 ODELL.MIGNOGNA
458,261,120 *2E8531906B2D413A5B4168688E19A11C57C04443 ODELL.MUCKEL
458,261,121 *2E8249AF7AB5B1DB0FF300B03DF4DCFD581C0B42 ODKRYLIMY
458,261,122 *2E8B9E1F19A8208278644AA40333F4C7056939CA CCLW
458,261,123 *2E8A15B678F7060D77425BCF039E26FF63DD3E73 [email protected]
458,261,124 *2E85D2CEA3902939B025A09D3A2F605F1044D645 cd:ie
458,261,125 *2E85C2D4C10EC7E97324D226632DD81ED424DD48 GINOOVESEN
458,261,126 *2E8A4BC5A3E8E7728D2B1F51AD46292097FDCB6C darrenswabb
458,261,127 *2E89E714F6328DE7A1A4DBA28DBF51E14DE6E96B OLLZH
458,261,128 *2E897ECC8581CAF093503A8787D5D5F3E1EE6FC4 oloklhra
458,261,129 *2E89EEEDB964E2DFF3528E82A0EC14F600422925 omavabured
458,261,130 *2E8BCAD4D20525BCDB0F2F15388BDB7AB7823455 DASHAXXXXES
458,261,131 *2E8FA6430788F3A025A768610B33AC5457E16745 omkostninger7
458,261,132 *2E84986471EBB1BF21B55851E8D93D6501E0890D C;F2Q
458,261,133 *2E8A4B17D6619568FEC6E515E7A907198C3D4CEA ORENLIZARDO
458,261,134 *2E8453D5B0434219F3AB470ABE374D8B9C607793 CgO.
458,261,135 *2E8DBECE35B04824E222EFD6F6939701BB69DFD5 DE61T
458,261,136 *2E8456148BC5992C5ED705C6E0A67007128EA232 othabrouhard
458,261,137 *2E8CC21CB220389ADAB40F67E8BE079D4699884A DEANGELOMAURIN
458,261,138 *2E89ECE279FB463A253E9E2A26726D71FE58AA28 [email protected]
458,261,139 *2E84D4893B1C0A1F9A5372170DFCF2BAE25CBA1D GRAHAM.LINKOUS
458,261,140 *2E89A0A0A3045B99950857947217D44CF0A0A862 DÉBRIDAIS
458,261,141 *2E8AFA9797BD438711A80A2514CBA4E2B7658865 DECOTERIONS
458,261,142 *2E8B58D403D094A3C8DB21C89D80506E6337E734 CHARTERFOLG
458,261,143 *2E87F92412EFEBED8620A463686AB79F93F23D3A CHAUNCEYBUSHMAKER
458,261,144 *2E8356A392F166A9134CEA53CEE42FA3B358CB29 DEGIVREE
458,261,145 *2E891B79D279FB6D0DAC6E3AF45C683E5C813A7E ouse1s
458,261,146 *2E817DD9D30E70F812DB346B70064B48A15145FD DELMER.NIEVA
458,261,147 *2E8CAAD1AC711D900EAEA967A9C20E5A8B2EA718 grilleraises
458,261,148 *2E8F4C1023A7191142C48B0E42F88A62D4D3F832 DELWAHS4
458,261,149 *2E8A8FF882F05E243F5263F94908668595C69FBA P3PT0G3NY
458,261,150 *2E87328F57C470D1DA40E33A07097917DFE75F4F PANDALIILE
458,261,151 *2E8A0DC085937A06467D74B411E8321BC64F7F58 depastro
458,261,152 *2E82D5AB307A8DB325CA0366ED2A414F5A9C0508 GULZIGHE5
458,261,153 *2E83B620C561B39D72D3303C3139A4BC83F4C36F CHRYSTIANNEB.(FEAT.KARINE)
458,261,154 *2E8AA7C818EF2D47A850FD29B6DDA9A9C31AC95E patbonniwell
458,261,155 *2E8C27EDAB0353D303E52192B2B046F3AA1A58DF H0M30M0RPH0US
458,261,156 *2E82BDDC6F9642B2323A1B3D606681E9F49303F2 DEXTERKEPP
458,261,157 *2E8F061CFFAC5811E55BFBB8915AE2236DBF6733 payo
458,261,158 *2E8EA98FB9E4C36227CC1A81C9F5981A1F847DDE df;hv
458,261,159 *2E8E75FC4922A224B36F94391FDD8149854D0444 CJ.YW
458,261,160 *2E8B339221AEEDB3E4D56FEE087C7A71A8D942B0 PETERKOUÉ
458,261,161 *2E8DDA0C1FE206CFA973DCF62903676C1E678FAA CLINT.NINA
458,261,162 *2E8FFDDF6C18EB75C7A7F8857640E2D68354E702 pianotester
458,261,163 *2E8B04FF81CB536C7461886F414CF9D179DBD0F9 PILISSZENTLÁSZLÓI
458,261,164 *2E83136C9262072DF2B97B2FD41C2C5A97D6F98A C,Mm
458,261,165 *2E8C5DB43D62D177900AC5AF926D36E0BB94C785 CMOLF
458,261,166 *2E8E74D5DE225177C45E6C567F445FD08462CB71 poor-visual-quality
458,261,167 *2E8EFED323D283EA6975B8D9616CF9822F0167EF dominusdixit
458,261,168 *2E8BEB2FF24D479A3DD1BAB9A4F0D3480C2316F2 COLESKA
458,261,169 *2E8CE6339C856FF0FC27EB26AE96FDAD529992F0 hj)b
458,261,170 *2E89C83B90DB8CBFE8EC9C1D85D4259FFC9863C0 presidentobamaannouncesstepsreducedropoutrateandpreparestudentscollegean
458,261,171 *2E8DFCB152822D2BAFB984B3BF67133788677E1D presserions7
458,261,172 *2E8044FBDCA69698A2DE5231AD0083C2928E5275 PREVAZITE
458,261,173 *2E8B1D6DE8876B658482CB60C4084BCAFE6B888E princess*23
458,261,174 *2E84698775A3A929264ED2EB7B2D42762AC73BC1 prirkla4
458,261,175 *2E82FE5EDAA30D4A391979C1C60B4423EAF93E1F HONGPAIHE
458,261,176 *2E8F5B3727D3E57F62351DFE66FBF28CD883B26D HORDZÓ
458,261,177 *2E8D910F6D9DB1F5EBA14993AEDD8EE32195D81B [email protected]@[email protected]
458,261,178 *2E819B012C39325D8F3B30D069AB46C7A9CB365C PRTXTT
458,261,179 *2E837287D80DC204DF2F39F00067D6C98ECE1D95 hospitlisations
458,261,180 *2E8D907959D7A51800BBF15CFC1E0A19B0F9675C d.re:
458,261,181 *2E852CAD45FCBEEC3DBFFF3F40D83170BA35BCA5 p) `(x)
458,261,182 *2E89EB2CC5A60599D74A9DD0BD4D2BB3E25198BD CP6IJ
458,261,183 *2E8F887594AB989F11AAEEE81974EB3D21D36EE2 [email protected]
458,261,184 *2E8C858C5BF98862854273DB77E1D96645191B0E DTHELIZARD
458,261,185 *2E87201BA11C3FF43030DFC15AF4CB7DEA50E9E2 HUNDEFREUNDES
458,261,186 *2E84A27095916DEB9E8E151BA15F21D97AFBFE35 QU4DRIINV4RI4NT
458,261,187 *2E8001DA70620556624201D14268BA9D2B4C819A cqx2m
458,261,188 *2E85FF1284D0D7E8703CB3DAA8A1C51B4EAC84B7 DUSTINAYARZA
458,261,189 *2E8CBA8C830931E9338591CDE0D1846C46BFCE8E dustyzavalza
458,261,190 *2E859D6E6A6E0233BEEA48B2AC83A78C3FFFA67C QUINTON.KNACK
458,261,191 *2E8BE5316D95B5519FD8867A129C7F8B062D6A22 q&vk
458,261,192 *2E8C93C545B2BCDD8AE4596B04740DBD6C168DA3 cromolito7
458,261,193 *2E88093590CAC3501BFBFA749CBB1B5F7730B0B4 dx7r$
458,261,194 *2E8B04BA1781F73B42F25E47ADB54B93F78AA83A iamvoyager54
458,261,195 *2E89DAE413A49C496C56009D4E447EA11D88B9FF d:zq7
458,261,196 *2E8AB0E7A8CBD88AAFF3444D60E0D5D1294222ED IDX|
458,261,197 *2E8439F4439081D7B358E2D5C798742DC4357478 RASE
458,261,198 *2E8151E5833256470E97C621CCADD5FBDEE956C7 ecn3$
458,261,199 *2E85F590BC90107CFA33992617DCD64DD6CD9ABA ilicitudes
458,261,200 *2E87EB1487C680B7288A6C2C0DD14AE8EA481617 REBECCAROFFEY
458,261,201 *2E8AAE2C9061240864B42A4E84087F6609916BCF reedmcclearen
458,261,202 *2E87FC3EA78F5C7F690D9EDCB7D332958AF2A001 REFEINTASSENT
458,261,203 *2E81F5BC010145786BFE9FB3ED0FE783921403A6 cyclotome8
458,261,204 *2E808C0069866387AC7127F2DB157E0AD7A1F0E7 INAPROPRIATLEY
458,261,205 *2E87CA2B7F8073E8B12E00587E34E31B6AF8CC77 RELAVKSULATNATER
458,261,206 *2E8F911862EF78AE5F53DF17741DDEC7293E1436 INFORMATIONWILLYNILLY."</P>
458,261,207 *2E867010D9EFCFA7591E6AEB8983713D6031F06C effacing
458,261,208 *2E8A5E8BBED30BB96D768125EE1B9C8ACB8C18E7 interjectors6
458,261,209 *2E83F613B8DAB8D719FD6DE218306977422EDD16 EGATL
458,261,210 *2E8678DBEFB058DF1E91349669AD482EB094150F D3FCL
458,261,211 *2E817670CEB9E97D53B01160D5C708FAB74BD00D RESPIRATE7
458,261,212 *2E8944603BE6D0AA8A9728919BE5E11147DBE18C [email protected]
458,261,213 *2E8B54BA5503AADB8D1B3F511789FF711E560FDD ekpmm
458,261,214 *2E8EE69826890D78A23B13EF8E2736B792B68560 elifsnoding
458,261,215 *2E8729BE81DF91FB90C050AA0D3E3FF008351DB1 ioneldanutz
458,261,216 *2E8645A35B01EEAFEA0EE59930273AAD049102F2 RICK-PATCH
458,261,217 *2E8F0F6A929ACAE5908A8A5CEEE785308835ED55 RICKY.KRUER
458,261,218 *2E8E69487C41E57BE4205C6EFB50E5A3B3600170 d8oc#
458,261,219 *2E84DF7AE869B8D8CF52594B5E05C8E7E7DA98EB RIVAGINZBURG
458,261,220 *2E8B19C6867E0E5BC5002D56FC15E9BDADFA9253 emilionovelli
458,261,221 *2E89E34A17A0A244E2764044A9AF55170B1E4C64 DAN.STICKLIN
458,261,222 *2E853C3E5AB026F8008824E34F89F547015CBD90 ROBERTBENSINGER
458,261,223 *2E8CF396457108528F232E17D1AFADE224F87837 ROBERTWHITE&CHARLESSPICER
458,261,224 *2E8E8A65BDF7A5FCF7D1E88090C698298CCC1B0A JACOBHAGINS
458,261,225 *2E8B8057FCA30340BCC4CF91DC89898E5DE87C0E DASFEUER
458,261,226 *2E82C33BA34D5AF3C35F13EF0FB1D8C53ABFE06C james05
458,261,227 *2E8D64A14AF4A10FC262BA96B29846ACEBB8BE43 d_"b
458,261,228 *2E811E8A3B02AD238E7BE03D5EE4E61DFEBC8DEF JAMEYZOLEZZI
458,261,229 *2E82F7E56BC280B6ED2BB9EE8057BAED4223BE15 eq?s1
458,261,230 *2E8896A15028B732D57198A7BF42FA840092B97B DDI#?
458,261,231 *2E8C3928549C4A79437000AEA93270900B8B9EF9 JASON.WENHOLD
458,261,232 *2E84D014A99CDE8DE39B8A7D40750159E1419CE1 ROVSHAN.MAMMADOV
458,261,233 *2E854C62B64D05A124F8CAF8F683FEAAB110ACF7 royjae
458,261,234 *2E8C7F6CD34CD6E22D075E3BEF77F652239B165A JDG`
458,261,235 *2E8DBA677029CD3443DD8A1AABAD29B285071539 RTEBRAUX5
458,261,236 *2E8A3AA94A654609A75EDF9F85A7C6A676C35499 JEFFCARL2
458,261,237 *2E84DC195D6F478B15D8E13D3524E5B39AE02BF3 ETODOSIJEVIC
458,261,238 *2E851C8A3A5C6C82CECD1CDB390D944F0DDA725C JENNIFERGILBERTSON
458,261,239 *2E8685D180B2C60FB50EB87F73D20AA6EB1FFA54 [email protected]
458,261,240 *2E837AD2367800E02F7A74D35D8D5F0EFC369CE4 RUSTYDAYAN
458,261,241 *2E850CD150EB9B59D67A684EF66EEE0645FC5107 [email protected]
458,261,242 *2E84A951E1D76C87CA414A035B7FE6930A9DAEC2 JEROMYLUSANE
458,261,243 *2E8B480DF6B07CD7633B168388431FF7626218AE JERRY.RONERO
458,261,244 *2E8E41522F875BFE43FBDA1AFF8206529C14B7A9 jessie-tian
458,261,245 *2E836444E86E64AA9A25DFC58FB74214E2640635 にはJG
458,261,246 *2E8D9449D117314BD05BC1315727381C9BFA658E SALATUIS5
458,261,247 *2E8EB3C5D1B48ECD79BDC11F62C3D2AF4A4934A9 detiver6
458,261,248 *2E8ED3330BB8576E71C5D51A1CD7B80641DA7EF9 FABIAN.BERRONES
458,261,249 *2E84E7729A73617DCAD86689077192FDA7C73CE2 FAEFFIE5
458,261,250 *2E8042EBF3EF843CDD30215FA61908E53E98DC96 DFFIJ
458,261,251 *2E8B7D4A03D305C78A179C4774A14F856ECDD16C [email protected]
458,261,252 *2E8528F8780019EA19A16871A8EEB1555688583C FAULTLESSNESS.5
458,261,253 *2E85FEEF4687F19479762505D2043E130577F3EE fdq#
458,261,254 *2E822929EB155D14A5320CFB544404F1657D53EA FENCES AND BRIDGES
458,261,255 *2E8E7205EB7EA46D93177D643736B4F506CC5854 dgvnf
458,261,256 *2E8E33154EABE9202C5A80B870EA3FDE6E789443 FFOSSOKING
458,261,257 *2E858FA31D203508965B944EF127735107BF4F42 FIFEU
458,261,258 *2E833E1B1011A3F6AE60E0B27F9F0179C913CCF9 SCAR232315
458,261,259 *2E81B878445CCBBE82806C1F75CD2C712C1416BB JOSE.NIKOLAI
458,261,260 *2E8E2DB83AC32FA2B2672AE6CAFC7FADC618266E DIMKER
458,261,261 *2E8304AC1856838B708BADD6B54C6464C1299BB1 FLYERSS
458,261,262 *2E8DDEE1098159873023C55F8EE470BCAB45EFC1 JUGENDPR7
458,261,263 *2E85FE47E8D43BE07D75BEACC98C2C650EBCC0F0 [email protected]
458,261,264 *2E805E96934B7361EC2CA64EE3F1862447EDC7E9 FORTUNG3R
458,261,265 *2E8BD79ED0F70FBE3C829E4DF3C8681BC256D5D1 FOSFAATTINA
458,261,266 *2E84D481E3AB76DFDB0AFD60901D5F61B5CE8CE9 JUSTINTIEMEYER
458,261,267 *2E86D9D42923F2C44F3871A09A91B7F3BCE45918 DJD$L
458,261,268 *2E87B0B4DC430767DF6B0210104E065B2C2812A3 SEMAGĦX
458,261,269 *2E8921848205EDD7144D23A6A2AE79C3002E7884 FRANKLYN.FRIOT
458,261,270 *2E8E68D96F6C981681FA338A1110CD65F5E43F50 franz.josef.ivanovich.ruprecht
458,261,271 *2E804CF13D1C625E251BF9C3B7750F7AE2438D84 kantarinom
458,261,272 *2E8910EAE259AF0D8F76DD8EDE9129088B7C6D6D DKP%
458,261,273 *2E89B9D52767E7F9DF2EE7584114CA8C69F19D8B FREEMANELIASON
458,261,274 *2E8A4FA0AC3C6DABD457FB08CC9E7423BF76A734 [email protected]
458,261,275 *2E8B09E9B123C90CC6D4D4F7EB32592ED456F1F3 [email protected]
458,261,276 *2E8CAB054217F6B5BA335E95908E9DDD8DA99747 DLKSK
458,261,277 *2E8AA2453B059E7431FF9E3FE70C96ED9318F56B G?AC
458,261,278 *2E8AA60C8EAEDE6F95BF7C09E479BF3BEA1F939A galileovanilla
458,261,279 *2E829AA7081B19B618BE57FB17DFDB722DC82F97 d",n4
458,261,280 *2E8DAECDD4BE06FC16C6578B4BBA4F08FB0D4671 SHDJMBSW
458,261,281 *2E85E4802B0AA57217468BDDF2F8070BC23999C3 [email protected]
458,261,282 *2E824BF26C4C053A3544B6102A48B8599820DB5B D&OAL
458,261,283 *2E8178A1955D817010981DCF4A4773A35C65D6C7 kerfraval
458,261,284 *2E87737CC377C914C998E22AA308E82A63B62D3B GARTHMCCRATE
458,261,285 *2E8FEFA5C8AE83B82817A941EA4AC1C0DD628D9C gasdrinking
458,261,286 *2E8C8CCB710916F8272897DBDC0D3D2D2B65E41C gaynbyer0
458,261,287 *2E8F5D83784EE47A5D94A349F46F8B69CF23F9E1 K>_F
458,261,288 *2E87D42836FFA9331D97213A366FEEE0B99CCC13 kiekentje5
458,261,289 *2E85098C807C84E4D71D28D78A6D22934D838D39 donnaespinosa
458,261,290 *2E8DBC3B003AF36FB843C27D7A89EB9C88DBBE4E KINGKRUSZEWSKI
458,261,291 *2E8D61639E0F06E547271694800038C5B184F4D6 show''world
458,261,292 *2E875511BFE80C533E22FBBDC4951CC1195E267E KIRK.JOHNKE
458,261,293 *2E8B846A63D3C70FB8716C08BDB72314D08176F9 georgesmiddy
458,261,294 *2E8B3911087CABC4C2DE4D913A0E4810A694C6B2 KLARIZZA-PILLE
458,261,295 *2E86DA49E67BE8C3B07974D0EB602EF49E871D13 do.you.smoke
458,261,296 *2E8EA6A5C504FF9EA4D7036235D704F5746D6511 girlcallin'
458,261,297 *2E882751CA00890BFE2749665B21FE7413BC2404 d($&r
458,261,298 *2E8B2144012BF3DCF67C39AF6B7D72707D73A044 D:R7
458,261,299 *2E87A7FF8566FB02960DD9AC951529685656C8A1 KRERSTIN8
458,261,300 *2E8A43FB3E5E5DD6A14A699175F0079FB5872427 KRIS.BEAUDET
458,261,301 *2E840E2DE9DAB3FDC46363536A00DFB5DB9280E8 [email protected]
458,261,302 *2E8F5BD922A84C68E55FF45E34A5A98FE9E7583C SOFARGOMO
458,261,303 *2E80F2D4A9761597F8FAC3D6A035F0F7F0D74C4F GPF.SUCKT!
458,261,304 *2E88294992B0CA03FD4E748F26FCB86607F7618A [email protected]$
458,261,305 *2E88C888DFEC7D3C6B1E690D19A81DF170D133C1 GREGSHETLER
458,261,306 *2E88DF284EABE24B7DE639BBF64D42F122396E4A DUDOFTHEMONTH
458,261,307 *2E82B5B43A195DCE9FF8B4AF00B578007DAC3FC3 SORROWRIPENI1
458,261,308 *2E8B3584A9AE49F0FAB2EBE85C53A0490C98ED31 soudnim4
458,261,309 *2E8CB98E97C925169D61B253911EFFCB4BD6E15A DUUIR
458,261,310 *2E88680FA41B1C5269D7D2811387C43257EED734 DVKZD
458,261,311 *2E85C1F2E5CC64DF92E22CD655ECCDF770C2D258 [email protected]
458,261,312 *2E8CD83431718F0118192B54DDFCC35FBC3DD600 H4P7OPHORIC
458,261,313 *2E8BF4C3196A34936BE2A7C4E366986941595BF5 [email protected]!ng
458,261,314 *2E8B5DD2AA0DF8DF38A7C01BCF144DCC14976F25 DWAINCARLON
458,261,315 *2E855ABA4DC53B2D9B36CB3277F1AA78658B0340 hagarstown5
458,261,316 *2E8A6D6E249F5A80F5637B8252208C44D0BD0715 laurenceellstrom
458,261,317 *2E8BEB2C721D96BF3454C534C218275D73518FB2 dy)uc
458,261,318 *2E831E1F019C45F8C60F1FBFEADC9927D67CB88B lazyass1
458,261,319 *2E858634E05E206F20D15178651780B0C363FB70 STANLEYFRAGOSA
458,261,320 *2E868C61390B492245926821A2406FAB4D7EC9D5 DZmN
458,261,321 *2E844BB9A85F568EE9E4B75577CC7C961CDB0914 E5ESOM10K
458,261,322 *2E8653187804C22D043537CD6082015C9418DED5 EA.$K
458,261,323 *2E82B2F7BE8C64BD9C2D6F5CD07CA815D1557FFB eb/cb
458,261,324 *2E8EB7E58D05CC52D9AE3A2DE91128EB996DF920 steigerhubelstrassebsw
458,261,325 *2E85E0ABD37661F5A58676436EAB526E9B69240C lenrusk
458,261,326 *2E8306AFE5CCC51E09C1DF24B317F0561D9D91D0 EDYb
458,261,327 *2E8DFC7FF38A94940F926B3D4DE74DF13D4C2CED leptotyphlopidae4
458,261,328 *2E86023AF60DA5EBCC91E390F0E6B3FE2866894C LETMEGORELEASEME
458,261,329 *2E8BFF9AD7929F26FCFA90B8E46F89AB63DBA202 LF??
458,261,330 *2E89B929DB5E041523BC08C1CDA97B8821D0B6B0 [email protected]
458,261,331 *2E89EC519DA490728910CE2650117AC107147BD3 HINEINZUSTEIGERN
458,261,332 *2E81BE4819E0034E19E67AE137E9A52D25A9D0FE SUPERPETS06
458,261,333 *2E8464DA49F61DC74E8DEF1F739791C6EC4227A8 ehpzt
458,261,334 *2E85D4FBA12A2AB73C1A71B3D08FA2135A6C7A9F [email protected]
458,261,335 *2E8893FE72F90740545DFCEEE8D01C04B635A9C4 ekoorb_tnesein
458,261,336 *2E8356D58D5710464DAA926E2089C4ADC8BB56E6 elbertmolony
458,261,337 *2E856837FFF258180A14E2016166719BD027958D lindsaycicione
458,261,338 *2E8B0AD4B3A69E69BD8FCBD0729188330E8A7755 HOP.E2LOVE
458,261,339 *2E8B1E3625BD60C0206AE7B14325E2168E5A13A4 symbolcalvin
458,261,340 *2E8F29A81D0721F686B990FA8CF33AFAC4E4BEC0 SZALECCY
458,261,341 *2E878EF06BE3C35BAAB9DCCDE05CA911C039B362 h;/t
458,261,342 *2E82D440776269AA02812E1FBE00D502D227B605 httpwww.ambientdesk
458,261,343 *2E8A91D88FDD1D3434CBBDA0A9A6645D4E3A2FFC ELI.VIELLE
458,261,344 *2E85D2DD07A4C32B210CF7E5581EFF3615E09EF5 LIZA RIGBY
458,261,345 *2E80B5918F2E2876F32D599EAB036108199D809B Huastec
458,261,346 *2E87DBE778483E7CEBF63A7DF1828A9FCDD648CB HUGH.LEHRKE
458,261,347 *2E8EAB2ACBEE7EAD41A17F07C0470E398AE6F103 ELMER.KAWAA
458,261,348 *2E87EE7E69A30184B6739BAA3411A59970CE40A5 elogy
458,261,349 *2E8E095C796D271C8C8647EB2F7C70B2BD3FDC5E LOKANIN2
458,261,350 *2E85AC06C4B9AF60AD78BADFA5F5A75364B35F4D EL&w
458,261,351 *2E81473D16F05A1071AD00E0D23193B981F4BD90 LONNY.CAMIRE
458,261,352 *2E8EF5D117D68D50C48B79BC59032D86FDCCBEB6 LORENCRONHOLM
458,261,353 *2E83CB334071651D79B43288903C8832B7BB0E42 IDIAITERA9
458,261,354 *2E83D5CF7A094D9B0797FD181E862520292C9045 TARNASHAT
458,261,355 *2E8C9A392CC9261F2AA930575DA29126B3BDFAF8 [email protected]
458,261,356 *2E83D0A104DC6ABAD3B5EF8D11111D0E4D038774 IDUSTRE5B71VC20091208
458,261,357 *2E80E5943C9230E57EC33A81D0BEC6A9574F727C „iepurele
458,261,358 *2E888F43422DE0902F77F781CAF41AB4A52986D8 luciensoricelli
458,261,359 *2E88CF03F5E73336A781E716C47449A2CC1E8B45 [email protected]
458,261,360 *2E8693D7C472E8C1E2F6EEDCA488D4BEA10CC56D LUCRETIA-LAKE
458,261,361 *2E872DC27259BC449E30CDDA2C5F6E7A4EC7A7F0 TEFFAKS3
458,261,362 *2E8CE470920F1374626680823D076F42FDCE8AFE EOALP
458,261,363 *2E8B9788BEB0529592971BDDEDA4C223212D8AE9 TELEIMPRESSORES
458,261,364 *2E8BC239DB8001459DD3DBBF80E626966BDB52ED EPOPEIA7
458,261,365 *2E8DE3546D5C60CB7D6D9F3BC2C99F761084FE9F imbedded5
458,261,366 *2E8255B205649E7157F7C2BBBFEEE38CFAD60CB5 es4a_
458,261,367 *2E82247D82917FB066E0539861827BCDA4E715F9 INESE-STA
458,261,368 *2E83479C2DBAECC3CC539E3CE56CEE294FD49111 INTERCHANGING!
458,261,369 *2E84725ED9029F358E2C97A62934379602F98A12 EVERYTHING-BEFORE-PA
458,261,370 *2E837A7A138505B5D4F1FA948D7FED4A3B7C2B28 thesilencetime
458,261,371 *2E889EFC326E53C841E0F6F7CDA3923EDA79C55B IRA.CASSAR
458,261,372 *2E85DC707433465CE9DE315E72692E346514CFE3 ir.nieko.daugiau.(duetas.su
458,261,373 *2E8899C30EF31113452BD899ADD8F54C2F8222E9 marcuola
458,261,374 *2E86EFCF87F54570B3B35E2E82BB1743DC3AE8A4 F3L4NT
458,261,375 *2E8C8119853521A776703939E23C6E4511529F6F FABIAN.ENDLER
458,261,376 *2E804D54783FC8F3983A0C320CE41C868A650A13 FAL
458,261,377 *2E8A4D33496EAB23B7FC7B1C51EA687275012070 I-Stole-Fire
458,261,378 *2E82EDB731CFAA231A7F25187662C16BD06DF0A6 TIME.DEJVID
458,261,379 *2E8E2123A753EE0387385443B05C96E8E296355F [email protected]
458,261,380 *2E8DC73062C94C5057783F4879F8437B7A6E024A IZZ-KHALID
458,261,381 *2E8647203614B8CE43A30D9357E5F5316E45E671 TINAGRAY3
458,261,382 *2E86CF8FC19F600ACAB0CC187DA54A262FEE81AC t,$k
458,261,383 *2E8E3995EF8D31072072242D0F2A4B1BB7EBF716 TMACHLAN
458,261,384 *2E84BFEFCDE33DE4D4E4B830B820D221D82F18BC festzins8
458,261,385 *2E8DA06CF0772CAB06BE80253FCBDF0FC71E76E1 toddwacaster
458,261,386 *2E8D00E901042225A5D4209D9A5A9A9D3F6F73C9 JARROD.SALEE
458,261,387 *2E8C6C850AA748B3352572CAD832091E9805F6B2 master'smonkeys
458,261,388 *2E84994CDEB75F0685991386C26F1D61C02EEFA2 matt.bray
458,261,389 *2E8E33E4C3C57D9ADB802D0E28966BFFFABA528C FLORENCIO.SCOH
458,261,390 *2E8F56116770B17A333340086102470188CDA329 FLORENTINOCABLE
458,261,391 *2E8E42AA0142F9A247563472D74E812229975A6D jeffreywillegal
458,261,392 *2E865E93272258FF7CEB101B93922A18EC0042EA FLXKBB
458,261,393 *2E8F3E810DB76C3C458CE58BF2C067914A9B0B87 JEN-SP
458,261,394 *2E8E651E39C9153DDAB667D8BFA3F9C0DB3B000F foetalism
458,261,395 *2E87DC42448C22B58EF5A0A6F3B2902273D97AC5 TRACY.GLADFELTER
458,261,396 *2E888F2CB7A0182A66E9DD14D0336F38B5F36791 TRANCHEFER8
458,261,397 *2E8C2E74ED9E1B382BA36FF1ACAE5CE5F89D0E63 transparencia-fotografia
458,261,398 *2E84B90B3869C9743FC185F514F71C2414BAC5D6 ME-HAN-CONTADO
458,261,399 *2E8F463CA44D91C7BA2303529BE0E986B117A854 JESSICATRASTER
458,261,400 *2E894CC8DA077091B2CF16DC56A8CEE2E06C0BE4 JEWLRJIM
458,261,401 *2E8D460AE77B9F9E9E4D44C0518F8E9899E95B93 TRELKET1
458,261,402 *2E8C37959E37DACF8C45DD1E1CCC3555B0421D74 MERRILL.PEIFFER
458,261,403 *2E8596661B4E4E4555083855E0D20D03DF927EAE FRANCISCO.VENGHAUS
458,261,404 *2E8BF7D8E3FEF5B428CA94BFE37FB85AAE1AD7F3 jimmypoulisse
458,261,405 *2E83EA6C8F12CB9829208292F10119FB2F7CAE45 jimmytnguyen
458,261,406 *2E8ED074A87AC58B1BB4AFFCAF9C0C5FEB7CDDF1 jim.sandefur
458,261,407 *2E886C859713B0049AA4C4A0EB4950C2E82EEE22 METS2009
458,261,408 *2E8C105B6BB3E294A727AD924178C620665CC0A1 MICAH.KONDRACKI
458,261,409 *2E8F58608E76DD29F641B9B8392D1A57BB5BC57B JNWOOD
458,261,410 *2E8E47E5C55B5A6675078256998BB9AC1BA2D1FB [email protected]
458,261,411 *2E882619E8E3D449E57945653005FAF717BF08E4 FREEDEM08
458,261,412 *2E81DF634C7DF3CFDA3C45199D253844AACF6968 joee
458,261,413 *2E8D44E3199DD4146C093E8D30BBB08060B7D158 JOESPH.CATOE
458,261,414 *2E8669A742AB6EB9115D3451309808410C29E12B JOESPHSWANTON
458,261,415 *2E8911F70FD758978A250459DDB475F0061E7067 FREMDBESTIMMT
458,261,416 *2E8818520C49E841FC50DE69BB916952F4472367 JONATHAN.LANDEROS
458,261,417 *2E8E38C1CF74E2E90E9673E091B13EF27C0E5021 JON.ZUBROWSKI
458,261,418 *2E843C0DC5DB606648151F712B0B7C2BEECD2DC5 fugueno13inf-sharpmajor,bwv858
458,261,419 *2E8C675CF9F4EDBF9406A8F9DD07AF61F411CC66 TSAKOSHELLAS
458,261,420 *2E88431F3C9A355CB0C6D2B1820538E343BDAD10 MILTON.PYEATT
458,261,421 *2E86E35D237519CCFD40C144356F1DCAC3B64C4C MIQUEL.DESLAURIERS
458,261,422 *2E88AA6F67FAA4948F44B6EC0BFFC85A8F815061 tuandaffin
458,261,423 *2E80C33BD1D9929790A59D85E5024152DEBF9558 juditina4
458,261,424 *2E832321C2E2A37F7B26386909B267F3DB342D15 JULIA971
458,261,425 *2E8AB7E34D63F5E3C5ED64A3EA98E9493386BFF6 julianringwald
458,261,426 *2E8A38890DEC775A53A7AC2217AA819229133403 juliorehbock
458,261,427 *2E840A0F76ED62F6E65681A21591373D51BC1F22 GABRIELGIORIANO
458,261,428 *2E8B4E3A32FCA3D9A259EABA4617FEDD8219598A JUSTINCALVIN
458,261,429 *2E8319A510850AAAF5F0289301AB384877566E03 gailsablea
458,261,430 *2E8FB55CA5BBE46E2A372C57C1672F45208B8135 Twoalarmfire
458,261,431 *2E8F46A22CCF906AC3A499C1FE57711B0AB2C29C galenlaperouse
458,261,432 *2E861D95CF3052E94F680ADAD8DDE55D6FA64FF8 tykese.fineaswineizluvnmylife.granger
458,261,433 *2E886E30BD6CC88913B237A4152A29081CA715D6 MNTNWRDS
458,261,434 *2E8F205C9C9F15205EF1BB93959F7A94025EB389 moisesdigeorgio
458,261,435 *2E8013D4715CFD0CF9E543C48867F3686F0A1182 KANARIGULT
458,261,436 *2E8D5D8438C1D2EE897A5A789BA3411FEAD22D74 [email protected]
458,261,437 *2E8619207EB9B8CC8CB6CCD15DC580A3F1A6E54F [email protected]
458,261,438 *2E83E395CEB77B8EF467E8A9F46F5052A456A50D KARADZICII28
458,261,439 *2E88429862E80DC70F98C648BFF4D632F1A78498 KAREEM.ZWOLINSKI
458,261,440 *2E83CC2C73A773930ECDF944DB866EDC78760E8A karen.connaughton
458,261,441 *2E835A919DBC5E3D4F89C05535845AB0EB95A604 karenmolinario
458,261,442 *2E89B26A3C278B6262975437414E6069EDDF472B uagtsomheders
458,261,443 *2E8B29EE1EE89306BDF433C0BCB403D90812A656 Mother's.Tale
458,261,444 *2E8DA0F28457D304EF800B826B770C8CF7DA4D9C germanloehrs
458,261,445 *2E8941F4D7E23D0D1EFD39E1BCCD3E93AC684B99 ULTRAPHONIC.JAZZ.ORCHESTRA
458,261,446 *2E8CB21AB4C27EFCB30F925B7A460F85FD53E2F2 kellyadidas
458,261,447 *2E89EAC2AC518AAC5834DF5FA6DCEF3A8EF57807 [email protected]
458,261,448 *2E812EA9BC05935C0D297C9444D54DA805EE3681 GIL BALLESTEROS
458,261,449 *2E840E436B65D700A6B26159AD8597270ACB228B gilbertiseley
458,261,450 *2E84E97194CCEC7ED69F3F3F755CDC83EF221400 UNDERSUI0
458,261,451 *2E879FB92A57CC4A97CE7CD8D6B9996CE004C145 KERMITBOULTINGHOUSE
458,261,452 *2E8FA353E9351887265FC620CE6E922CCDE065FA MXNUOJZQEMYEZA
458,261,453 *2E8E2969766D576B6402193C1A10D9450E2A8E61 MYJUMP29
458,261,454 *2E8789556BB29C2D8E1AADE87C85C4CF159F84EA [email protected]
458,261,455 *2E860FD6CAE23ACB4EF3E87234F29744EB396911 MYOBIWAN42
458,261,456 *2E81B3FCF94A36BEB2A26EC60C579A104A6754A5 GLARINESS
458,261,457 *2E88D596EB046F44344A1BB7C01A951F777E9FBF KIDSBANK7
458,261,458 *2E8F281E2101C9ED5F69674AC97BAEDD03898E3F UNTRUTH /@/N'TR/U//T/
458,261,459 *2E8A7AC85CCFFFB2ECC4585F2C2741055AFBD0F0 kilpasoutaja
458,261,460 *2E86DE9F10FA58044226FE5DD5F884CF9F192ED6 kingfishpatricia
458,261,461 *2E8DD58AD66E6744996E2BE3BE0D0A75058B251A KIRBY.HICKERSON
458,261,462 *2E86F7098E2031C05C44417354E8805B91548011 USAENGDIST5
458,261,463 *2E8FDDFB36C76776929DDFD57E7E2BAC4A06D735 KISANEJAD
458,261,464 *2E81C44F5C7734AD39F9C146CE0EFE2F0FAC9285 n'''ada
458,261,465 *2E830055969D4173D4E019688ED22AA324E61401 U=V&
458,261,466 *2E8158098C0FE3CA031CC3BBF1A9FDA5A55E4EDC U)X
458,261,467 *2E87464B30AB25F71B17591ABD26FC9AC8C5E84F gqsa
458,261,468 *2E8CFC4B4B16C6796A5DCCEC97EF2ED9BFB595A8 NBLOSCKI
458,261,469 *2E8C992BE029428A1094CF1C5BDD21866F0FAD2D GRANT.MATTSON
458,261,470 *2E8BAFDEFEFB7A9B81847C360703E359D35B894E varga-florin
458,261,471 *2E84C28A5EBCDED1BE8695CA3B5949E7202F78F5 GUITIGHE2
458,261,472 *2E8A1F9D3F516D6E1118DFDE92501838D00A70EB night.--i-gotta-stop-and
458,261,473 *2E87F1B4BE76EAA2C3989F8E60C666F8F9DFFB1E KUPFERLEITER
458,261,474 *2E8E7F54CC779EA899B63A3FEDBE303CA4145AAC GVKL
458,261,475 *2E816DC2360CF21F078C932621AEB8688C6A2D5C KURTKUZMINSKI
458,261,476 *2E8028ECA9CEC22112782E3E79F4F3C98DF56CF2 NNITROSOMORPHOLINETREATED
458,261,477 *2E81A79FD33E6C1DCAB0C7D5D2D934A7556B1412 HAAKKRUISEN9
458,261,478 *2E8D177F1878DD3E6C01AC4ACAD4C43B3B6A95CD la.invasi
458,261,479 *2E82A37786BD9CD87C2F8E5C6C471921BD0EA909 handisecurity
458,261,480 *2E84C06DB6A9400C49D0271DDA20AA9C4C959F93 lavernda7
458,261,481 *2E80926DBC16CA7AED4B15187260A6AD1BE29C2B >-<O~0~<--P
458,261,482 *2E822B51BFF720FCC2A1D107FF8E1CC6D277B73D HÂRTIILE
458,261,483 *2E83FEC98B7B323FAAD68DD32D149DBE52307698 HAUTBEWEGUNGEN
458,261,484 *2E8356C39CC82E96BB98EDCEF04C5308C844D940 „LECHAUF
458,261,485 *2E87D18A2064FD6E1B56B0CD579BFBF5B4ED3BE6 LEEANN-AXCELL
458,261,486 *2E8EBBD6ADC709614E26DD5877DDE8AE2689BFEA leebettis
458,261,487 *2E8CADEFAC2DDAD645A131CDE93AED344DA136FD LENREVEBS
458,261,488 *2E8628E40926C624AF39F21F9D992856E90E4DA8 ODELL.APPL
458,261,489 *2E8B4F257E226A4CA7FD312296F0EA8BCC5437A8 HEAVY-LIFT-WORLD-RECORD-HOLDER-WINS-OTC-SPOTLIGHT-AWARD
458,261,490 *2E80E31C860C9D594C8D24D780570B99C7E49840 [email protected]
458,261,491 *2E86C06AC690B6B4036FA7B2900D8C9F731727CC OND PER
458,261,492 *2E851072C67022F354F76DFBB71FE050131FC805 LIBIJCZYKOM
458,261,493 *2E8497B88BB47A8A481B6DA633DAC4766C9FB3E8 VSVSYVJKSKYE1
458,261,494 *2E868D1FB619E84096255F457A6A65921E089784 (~_^)[email protected]=3
458,261,495 *2E8A6EF1F73AD1427F6F15AC0CCA8CDBE352E703 limacines3
458,261,496 *2E874F51CDAA58F04E644771AB1B01D75D548B98 vzrosloy
458,261,497 *2E8D6DB107671685AA000B8AA5BD0A6354FDC345 WAFAA ELAMIN
458,261,498 *2E8652909019567FAFFA2A83E0BAED7540B7E549 [email protected]
458,261,499 *2E88FF223B778CC55B5FF6FD19E4289EFF78C218 walid.abdel.hadi
458,261,500 *2E858BF931A1F7B0F798C7A466647185F09E51EE [email protected]
458,261,501 *2E8A57478844934BDF1018DBA3AE56BDE7C05CB6 oS|
458,261,502 *2E81060AE229FDF956C0B5388C18C914544E0523 ottokiltie
458,261,503 *2E8F26057C93A6F879AC8DBA21119DBFCBF3BAA5 OUDER
458,261,504 *2E85B3BD183FA798D18B98B9F294BE88BC3B98CF HLFONTANA
458,261,505 *2E80454FC2E56B5AE24E4E16113E43A47917AF9B owwemblem
458,261,506 *2E878471AA94EB535432FA67241F324DCC660712 “LOZENGY
458,261,507 *2E829E31752E67A4C1CE6B5C23B6DB55B7CBAFF1 lpatrick0
458,261,508 *2E83FD13806EA7CA7B734720DD5C943B247AE0E3 WAYLON.SCHLEIBAUM
458,261,509 *2E8C1576D3B5E056B036281C01972C59AE61D61C LTWWW.CELTICCLUB.COM
458,261,510 *2E81EE4F169200C7DEB5CE8A048D7FCFCDB8293D luciusgrossberg
458,261,511 *2E8AA93C3702F9080EB7B3C1246F703A56CD1A89 [email protected]
458,261,512 *2E8CC9C4DADE1F52263622BAC2D704F95B09D3CC ludoed
458,261,513 *2E8CE5DF173A4C0E0982ECA46F65FDBF4ED91FFD luismoreira94
458,261,514 *2E8B25EC4A975E3256559EA94FE423F88F8CDDBD wei.liem.chua
458,261,515 *2E860A7F81D06219E86393A7AA16835CD185241E LUKEAFB9
458,261,516 *2E83610F4D5E33BE8A00118B43A63DAF856284EE housedelicatessen(disc1)
458,261,517 *2E837520F8A60EEB5C10B246959750ED93D80B80 HTTPWWWVOLNYCZCZFI
458,261,518 *2E8F8607AFA97C11923F5B2A7865CF6CA436E137 patricia-kristine
458,261,519 *2E8DD0F2805E90455C8E7185389E8EA656DD9DD3 HUEY.RIGHETTI
458,261,520 *2E8314D42CC469762FE99F6956BDCBD4F32AA0E1 WGGBLZNN8
458,261,521 *2E85599BDDAD67995BB44A6FD901634DFD46D77B w{h4
458,261,522 *2E85A132E1CFE84A7001431CB9180FDBA476812C [email protected]
458,261,523 *2E8E42DB96AB2D3A43BF07BB9300B392E6154D7B MAARIANAC
458,261,524 *2E8D9528839AF03EF03449B156164BE28C960A68 MAASTRICHTSSALONORKESTMETNACHTEGAAL
458,261,525 *2E8B5C68CC2720451AD0EE606B31C9ED42F76D5F p#D~-}X{
458,261,526 *2E80396D9041D729ED09445D13F23BCA68CA74F3 PENFEUNTENIOU
458,261,527 *2E8E7E65EC8597DC2F5BAD052DC645B54F9A42E7 hypn-13-0
458,261,528 *2E896E8D140A96E822540C1F31327B9BFB8BED8D pentagrid8
458,261,529 *2E8D8600B3C1C89C1A20F58B622D610ED6C5977F PETER.SABB
458,261,530 *2E82CB6BB43023584CB7BF6CCA5C6E76950CC6D9 wilma.pittman.stark
458,261,531 *2E83348118759AFA683E8B86AF8F06704576E959 WILTON.ENGEN
458,261,532 *2E8A264DC71619C78DB9F7252996C7FD20592B22 IDEGNOPSES
458,261,533 *2E8F84A374F73D1DE54D483393A676B878E8B802 MANYQUARTERS
458,261,534 *2E87443ED9893613B1CB1DE716F8E5CF985B0CF3 [email protected]
458,261,535 *2E809B8C662E498A065727C6D90174625F8A98CE wingfil.paul
458,261,536 *2E8FC246746CC05F6BD74E460FCB7DED0242103A IERPHCUBBING
458,261,537 *2E8A7E63698F7F63A831FB0E9E31C3728E63B385 planes-ride-waves
458,261,538 *2E87FD8AB82A7C1408F9E46763B6EEB2CEA12FA9 IJY
458,261,539 *2E8693392A98F6FC5D12E996DF325AF5C9979AAA :p.O~.d======B
458,261,540 *2E88F30622DB36E7C13EC30BF0F7BEA0FE4D8861 :po~o~ (==b
458,261,541 *2E8D6B14E76570CC779204991403A9ADFB3FAFD2 markusswarthout
458,261,542 *2E85CD185475B3609CAC21F59118CBEEF41B0A30 WWW.SOUTHERNGIRLDESSERTS.COM
458,261,543 *2E8B1E1A109EB7946925D52D4248BCB85445F44F WWX3529MGF0
458,261,544 *2E88D5301D1E47B0AD031B7D874B466F032AC61E P====P-~0-(0_<)
458,261,545 *2E816171DDFC0391C8CB32E2E66AA3442EE59EEF [email protected]
458,261,546 *2E89737F4BB9886C2C6F449968E14E74A2F86D33 MAUERDURCHGÄNGE
458,261,547 *2E8571C5657069FE81597AB6BD0B77274A4FCFFF MAURODELPAPA
458,261,548 *2E8DA773EE27134C34AF7083779866267CF58F59 XIRETSAREFINEJ
458,261,549 *2E8A4F43B30868E44F6820D6C9A7B713A83EF7F2 (X)O~Q------B
458,261,550 *2E88E83C0726C168F29DEBCD6DE44FD98EA41982 mcleggon6
458,261,551 *2E83C39CA3FC40FA2B6A62A102234612446E703E mdlu
458,261,552 *2E8DD55E4906550F1559FE3904724A8B4A6E3C57 [email protected]
458,261,553 *2E8C73801D82B5E812B4D7D0D32FF5388EB9A631 prestonraciti
458,261,554 *2E82E303AE11A5C1AFCEE6063F8051BDA1FCD2A5 Pribalti
458,261,555 *2E864A79BB3570E7ED9CBB702F5C12ADF1168B38 princesundt
458,261,556 *2E893B7AF6836A6B79DD8BB5ADFB50A10BE99CC6 YAVORYORDANOV
458,261,557 *2E8F116DDBCE5CE0DD2A6FAF6286BE6D05A9D9CC YAVUZMETEHAN
458,261,558 *2E804D04C0C7451E8C7524ECB62D727429DC31BA YBGURSUFUR
458,261,559 *2E866151D4A82F72A57005FC6B7B10D1E056444C pro$31yt1z1n9
458,261,560 *2E8DBF7B4552D1616CB23975B340F1FEA481E1D4 [email protected]
458,261,561 *2E8292CD88697E4EE38E75BBDBEB7BC49D3B1A48 YEHOWIHYODSHEWAHE
458,261,562 *2E8B0E1B34856E2FFA5CC7FD7B193ECC1AF0FDD7 PROMOTES567
458,261,563 *2E80FE3AD477FFB5A384BC599559ACDEACBAB003 y[,h
458,261,564 *2E8224DA29C09B3E9284B32201D235705C85C9CC michalsuite
458,261,565 *2E8F4CA36FAC28B27926DC8C04F142BDA0123F00 PRZESMYCZKA
458,261,566 *2E8D230818E24F0CE6881244C795258D0DFD8197 MIDRESHETMORIAH
458,261,567 *2E8B131A1F1C7A857E6D809723BD8D4A36469187 yongdallmann
458,261,568 *2E82281289E6217ED7D2F62EED331C54BA6ACDF5 MILFORDRAE
458,261,569 *2E82AD669025B4FBA68F805AAB6B81E8EC653A91 YOUNGWINCHEL
458,261,570 *2E881E8335B724AA9F0DBDB4034C959426222626 ytu
458,261,571 *2E87635744220BC51583BD8B9C20152024ECED6F qB~0)o(
458,261,572 *2E813CFF7D0CD87271865EC6D7369230FE65A06B [email protected]
458,261,573 *2E848A66A0ECBB54D31594ABB65E7263DE1AC135 missylou17
458,261,574 *2E85F2E603628CE39C042DF3286D78283759E083 molander1
458,261,575 *2E86A6C5912BE6CD1F0BCC0C7E0B8A46A0C6EBD2 zat#
458,261,576 *2E892A98928CD8D91FA28683F4B980CCDA70CEBA iotterol2
458,261,577 *2E8FBC7852E17D6DB83C37C49076653CA3065976 IRISHDUKE3
458,261,578 *2E84C18334174DFA9D32A86A850998547B14052A IRVIN.RONDON
458,261,579 *2E8A2F5605457DDDF32748108B4A2C7A397AAAE3 İŞLEMCILERINDEKI
458,261,580 *2E8BA72075F5D13FB8F86DA3EA0907C35C08FE83 isthmian.
458,261,581 *2E85BD5FC8B64A5EF870984D8E8EFADE7F457B17 IWONT4GET
458,261,582 *2E80D4318A72AF65C332C1F97903C1D79CBF86EB myconceptqwer
458,261,583 *2E81B1B29471146E82ADF052B9BBEAD723684DAA MYLES.LAUER
458,261,584 *2E8BB5A4537B46CC5305BFA06291D7680743C0F4 reed-back-r/i/d_b/&/k
458,261,585 *2E8615E80C0493E5373A5769FB3308ACCD41409B [email protected]
458,261,586 *2E80BAEC44B62F8F2C3BE1AE70D6AC57E165132C JAMISONFLENNIKEN
458,261,587 *2E8F6E6C963D6851EFB2DD5CF157BC499F714DE7 REKCARCE4
458,261,588 *2E8AE9F79171E2D0F8832BC22EB3ED7C76B4D45A NAMOCILO
458,261,589 *2E893F0DCD0C26D2BB9A932845D4C5AB85FC91F7 naomi.sample.and.the.go.go.ghosts
458,261,590 *2E846BA9C010FB38F8E5632F324A636F867735A9 NATHANAELWESKE
458,261,591 *2E809E0B1DF1E8693353F075801C46DB45A01103 NATHAN.CHAUNCEY
458,261,592 *2E880D65A55A73C33BFA478A9C4684C291FC04C0 nathanhillburg
458,261,593 *2E8618E05B684F9C87280F834885E877B28C33CA nattigheid-in-limburg
458,261,594 *2E862997DDE52A04FDDBEEC252A5B7594539F72E ncomptroller
458,261,595 *2E85BB34B7F983467E378F5D8F7A55D2C6F31C89 N.DEL.ODIO.(INSTRUMENTAL)
458,261,596 *2E82C90ED6F83A7BFB404E134548A72472E74E34 JEFFERYDIETERICH
458,261,597 *2E84FC2741AD4FA9675351FDAC72C4B3A4FFD452 NELSON.COBINE
458,261,598 *2E84DF3157AA4A2BC2A286B6EC93157A2BBDF291 RETICULATORAMOSES3
458,261,599 *2E872B88775DF9926E8DD47C91177A75AC30BB69 REZIVOST6
458,261,600 *2E8202A244B1C16572C673AD73D9A8D61584957F rhettschollmeyer
458,261,601 *2E838DBA75E160E1BB9FA0E7B2A770E25F74D774 ЖУСТІНЬЯК
458,261,602 *2E88E1FE3C46A700E2891B48E806C2B552A4A36B rigobertogierhart
458,261,603 *2E859E0EEE5FDDEA45EE05A2058EDA54418371D1 nilsaramos
458,261,604 *2E899295FDE1B6EAE94097DA08955825BBEB675A линколы
458,261,605 *2E81059ACDFE80011B76034105F3391D58226AB3 МЕЛВОАН
458,261,606 *2E855F915046E71D44191BBE3C5EA7B278CDE774 NONDEVADASI
458,261,607 *2E885F3CF6F6E2ED9FE597923BD8BF52955BAF1D [email protected]
458,261,608 *2E85CD4AA0C410A668FD36FDEA53B1D8A2707723 rockier3
458,261,609 *2E85471B6D4015DE8F8623E5C4490716A3727CDF rodrigowatzka
458,261,610 *2E825F08B417290B69A503AA4F9136812B715C42 notorietydrivesmassshooters
458,261,611 *2E8D54B1E885831C4045550313032F927F7939B9 NOVASCOTIADUCKTOLLINGRETRIEVER28
458,261,612 *2E85B9B35B7CC1F5F19B4EE49760FA60AF16673D JOHN316WIZARD
458,261,613 *2E8591804588082BBDF5D41F7720E669DC130CB3 nwfp
458,261,614 *2E8ABEDBEC495ABBEA90CA7816E2A2D4A162E4AE >-<O~0~<--P
458,261,615 *2E817A20F31D855378431221BDF372E98D862208 ROY77
458,261,616 *2E87F44DBB1756CCE55DF3ADEFAD274B8DDC908D JSCANZON
458,261,617 *2E8649E547DCE92A6366262C54ADFA21CC212C3F [email protected]
458,261,618 *2E89DDCFBE232375EBEBFC74BA1F951CB423E1F3 offbreak
458,261,619 *2E8161634F8A2A805A253F35FE886F60C5EA71A4 JUNAID-SUFI
458,261,620 *2E88192124A1C97911B8108036236949B7777497 JUNIOR ARAUJO
458,261,621 *2E80030B564730EDB9D371CDA426E33F6E42F358 が売却予定であったBARNEYS
458,261,622 *2E8EDD52F7D1999B4951832D775CBE1EE644106B ONLINEBANKINGREPORT.
458,261,623 *2E8B932F4A9A89DF6EBEB88A25D9D3BB98ADCE54 S143305009
458,261,624 *2E8CEF511167382F39BD93DCAE94A2CB30968832 sahcelsed
458,261,625 *2E89D03E24DFD51A6F84296535E0856AD9BF98D3 OR1HYPERBOL4
458,261,626 *2E8A06C53A944F780540AFC7687A8FF54265C70A SALTEREMMO6
458,261,627 *2E8AFA1E031A4EFBB3213B8E4C30C7BF79252DF3 orlandotopliffe
458,261,628 *2E8F2B7DFB647F2B5B025235668590C9E63F50C2 KASIAHC
458,261,629 *2E88499B61E4C01BA21F5AA3C1D59E536594EFF3 Orquestra-de-Cambra-Teatre-Lliure
458,261,630 *2E83F921FA0CADB21B341A0C20924F35C24DA9AD [email protected]
458,261,631 *2E8FA90995F4425D6D6DC7889C6F75102289FF36 KAYYALAS
458,261,632 *2E8D098049DE4813E19327DAF5A993ACF1A3EA2C OTACCOLB6
458,261,633 *2E8136ED8CAE538663EB0DBD3B5F993E560588FF KEITHMALIZIA
458,261,634 *2E8EB965280FEDC168BF56BDBE698E3A2D33C641 KELLY.DUMPE
458,261,635 *2E8648F2C88479060E6EB328948CB95D621017B6 [email protected]
458,261,636 *2E84CBC0F9AB8221925338D94E9863C4F5FE03D0 OVERTLY-PRAISING
458,261,637 *2E88E7B074D868C22FF2DABA03955782362C781F oyalandırma
458,261,638 *2E8FCFFA98337248816B057F5C6C7C67CEB3C9D6 P4UC!7!E$
458,261,639 *2E89AF12BB1F357CA8C316019C69206C91B1BC60 SCHARFEIS
458,261,640 *2E870CEE099CD0B43D41B87E7AC7BD0231D0BEEB parmacagliaribolognaudinesewantsampdoriasdaniele
458,261,641 *2E8E93F53A0FD92F0994FFFD34C0869819291D3A KN"G
458,261,642 *2E8A97460D0A34CACA164A69F5B60B027327CB05 paulluebbers
458,261,643 *2E84478FCA5900862865B554D2E687F48046E949 042290A
458,261,644 *2E8D9D068C1F33D13EA38446FC60CC791DD5CCE0 [email protected]
458,261,645 *2E84F04F789F1CF6FD92F622BEB6995A0EAE83DA perthshire2009
458,261,646 *2E8A32840BE06C9F171E83195EFE87D0892CE6A6 [email protected]
458,261,647 *2E86B3FB27255B0648E4B13E8E1081A6213F84D3 KRISTIANSTADS1234
458,261,648 *2E85BBB82CAFE0780E532A6AC39D2BFD4865CD1F seymourchrisman
458,261,649 *2E8F66C1ACD56C67274C8B2E07CF372AA2B89591 PHILLIPFLESCHNER
458,261,650 *2E8D9AFEC3EB7349784D5EC097DCA08A567BD23F SGOMMA
458,261,651 *2E8590AD58EF65564412351DBACD75C6A5BA9E63 113ashlyn
458,261,652 *2E8F42692954B44D1814054CCD37F027495A03A7 shawn.donovan.jones
458,261,653 *2E84E275152132F55004C9FCE9A95DB8DCA9474D 11flugzeugfirma
458,261,654 *2E8582D09A94DF29C2BE190E1EACC0F532A9BDED 1214377 PUHELIMEN-OLI-ILMOITTANUT-74-%-.
458,261,655 *2E88FAD99B735DC335B42D54CAA298712F82BEBE [email protected]
458,261,656 *2E8D9BF2FC2A67587EB89535E660A07266750129 1451758 el
458,261,657 *2E87AA617546FA3C8758C2DBEC83EE87A1F91578 lago-de-la-ba
458,261,658 *2E8C2E17F054FEF6C188BE8266E71DBE1A0589BA LAJMINAJ
458,261,659 *2E87160F7C6B9C22CE28712DAE307BC9DB5951F6 LALITHA RAJAGOPAL
458,261,660 *2E8E05C58E47D9403C65F250A3A4419BB984B6C6 [email protected]
458,261,661 *2E8206383073EBBCE4A92FC5E163E77F9D75BC10 1885A6A5BDDD196C222201F278F0A863
458,261,662 *2E89E14339C429A270F01112E13F1732EF8D6921 SIKLAMEN9
458,261,663 *2E8C6937919D7B13C7C2D64CFB9B45D65FC64574 SIMONAL‎
458,261,664 *2E80A39386B6E244A1845A0A1C51DD2813AB44CF PORISMOY7
458,261,665 *2E80778BD83E0CDE3599163EE605E03781A7151A p=====>~o-sploit
458,261,666 *2E8C30EBDD28C097EDF81F158AE734F12AE73CA0 [email protected]
458,261,667 *2E8B47EBD1DF081C17C0EADC4AE04FD825B5041A skynjum
458,261,668 *2E80BFBF5F2CD7C7BB94963E58DDBC7F2BDF52F0 [email protected]
458,261,669 *2E86701897FF0BF334774C7559EFC206257775F1 pridgett5
458,261,670 *2E89278065E09258E5D135221C8DF67085F25802 PRIVATE..A
458,261,671 *2E8E6DF17B19F3C72453841A44CBDC461632913B PROGRAMA.NUCLEAR.DE.IR
458,261,672 *2E8744B1F411D75DFF3058F9A20C3EBFF8E58C0C LE-MEE-SUR-SEINE.FR
458,261,673 *2E82D88EC23A0ABC6B952083CBB0DBE1F9125850 SMPLRSR1
458,261,674 *2E8359BC86C4150BC67F78B46D8907AA76138FEB 1bienenversuche
458,261,675 *2E8C9333358EAB47E75DC1A1FCFD326FE2112DDA PROSPAN SA | COLOMBIA
458,261,676 *2E8BD90FB588013F24FBA973A288FC02DE9ED6F9 1BUCHSTABENGLAEUBIGKEIT
458,261,677 *2E89DD1DDA7694C99B8F8D7C5B2C09C279CE4C6D PROVINCIADEJA
458,261,678 *2E8E111B3806A804003F289407AD133460851446 provincial-disco-(original-edit)
458,261,679 *2E8C10C1CE8469579DD5E001B8B23C483193CFC9 [email protected]@psycho1og1s+s
458,261,680 *2E8EAEA68D0B338A27CD2042A1BBF1C29E523099 LEONARDOARY
458,261,681 *2E899B91B5F68A8FE11BB029FC204716E44961A9 1-clazie
458,261,682 *2E8DDDF2D883BB493A413CC0C0D53963E03B2075 1 COLLOQUIEN
458,261,683 *2E8BFC8A5B6C4E9F4BDB0069F2D2314AFC2A492E 1CONECTIVA
458,261,684 *2E8120F12AC115CFC843A00F65598410A74754BC 1-dinosaurierschlaf
458,261,685 *2E828AD24BDA1CD9330E0B2EF25CDA523B458B00 1disagreing
458,261,686 *2E81150210E068383D84EA7AC793D27B36BD52F9 SOMERINAVS
458,261,687 *2E8D2F8C5EF4D2DB64D145C7759096F516DFA330 1HEIDARI
458,261,688 *2E8455159BE0F41D802FB909BD61FFAE42956DAA 1 LARVATIE
458,261,689 *2E82FDC425AE0B6208C1C1C06547DB034A22BF20 SOVTEKBSW3
458,261,690 *2E88C22BBA761777B92C5648CAF51F9D384D91D6 1MAKSUPALVELUA
458,261,691 *2E81F6F0BCE406965DBBC647C6EF0108F6643157 LILLEE-THOMSON
458,261,692 *2E8A5900CB87F40236F7E7A1BA1193C2E8628814 1MYTHOLOGY
458,261,693 *2E8A84492C95E9F30348B79519D6502BB91C6F81 [email protected]
458,261,694 *2E8D4BF54B703A28FA68B901A76A95A340886A04 LINWOOD.GIROLAMI
458,261,695 *2E8E5E784DB546EBB4B829496BD0112E9B60721C LINWOODKANTAH
458,261,696 *2E820633F32548A4A2A4A2A8691263DB520C1536 R3SMUNGLO3I
458,261,697 *2E8E1EA1DAC4DCB08E94720C731530578EC9B939 [email protected]+0r$
458,261,698 *2E8BDD28FDFF378CBF6D21A95CC15E4F38874026 1psoroid
458,261,699 *2E887196DF8596CA99244FBA09CE8DBACE677140 SPLAT!!~.Q==P
458,261,700 *2E8A8C114FCB6EA45DAD94EB9E00D0BCF3D7D11F 1.sicherheitsbuergern
458,261,701 *2E823BA1606EC43852915A10DC1535D0FDA01515 1SMART-CARD-LOESUNGEN
458,261,702 *2E8AAB5D02BA8F51938C504DD988AA503AB7B79E 1-spiegelreferat
458,261,703 *2E83BB9D3896DE162808CABC99ACD3E58DE24072 rampish0
458,261,704 *2E8037573D3CAA0DDF2F7A84F9F10787EB86FF5B llewyenos
458,261,705 *2E85B289AC44D1C9273C80667E8037F56910BB91 1.vauhditusrahap
458,261,706 *2E8CC532AD67B0A7CD01C0779DB91BA2B30B3AAF SQUAMOSOPARIETALS.
458,261,707 *2E8326EACAAB0AEAFA2814F151CEB0255B4A9C02 1VNINGSD
458,261,708 *2E87DAAC53737193BC20B5A232105CC823F1C388 RASE
458,261,709 *2E854870AEC141789F28FD7B6BA432860B3C994D SREIREFSGADEDEB
458,261,710 *2E8C9EA91C5D0986B3ACEF4317FC6D19F8DC4BAB 1.zdfvideotext
458,261,711 *2E8465E4EA532ADCC71F6E4CA79E18F29CD80057 RAYFORD.BREHMER
458,261,712 *2E86CF81F5C15D1D6B380AA608A94F7E32C81965 raylonganecker
458,261,713 *2E85A814E8518518328DA16DD144F0CF18A3061E [email protected]
458,261,714 *2E87337969DD662A3D60EEBADDEEFA1FEC3489C1 LONG.VARBLE
458,261,715 *2E8D469D080CC7E5BA0DF732FD9AA7C5D4A3908B 2010年1月10日に放送された『CHAN
458,261,716 *2E8E47D8973DF4A7170D270DC53E0A06B8005EF0 LOU.RINGGOLD
458,261,717 *2E86EC3083B0EDB9D154745073A5D8EEC47C1949 LOUVELIAS
458,261,718 *2E8B2395CFFC826EE46C91A5DCA262142BA2A9B2 stavroorvats
458,261,719 *2E800170EAF9C1AE6EEDE09F2B19D329CDC8777A [email protected]
458,261,720 *2E8B7ED0E0B24927892B01354F9690AE8EB14668 STELLACANNONDA?
458,261,721 *2E8A11567CC2149F12F142B377F056B3DFE61F94 stephengetzlaff
458,261,722 *2E8A78BD9CD0A1AE36801A196011FC27B2FBF031 luciusschelle
458,261,723 *2E8542C403F73C8DC849242E8CF4F2094A2DD703 STEVEBARBIERI
458,261,724 *2E8EFF759A427001BF9F7A71557EF0EE693D15A3 REGEXP40S0934
458,261,725 *2E87A8F96972C502B2ABF4C8A018478C67C46911 regiteibood
458,261,726 *2E8507BD4D1DD34AED30A3E48FFA459872F16542 REIDMORY
458,261,727 *2E86AC0FC8051292D5A450F9055B0CE2A42546FE ReinaldoMarcus
458,261,728 *2E8921C09CC8C99EA60E0A2D92BC4EB0103B8BB9 lwbrhd1172
458,261,729 *2E8579CD8020F57FEC46C47F6EA33A7F745D523E stonega4
458,261,730 *2E89738C7DE76D638C4FEEA20E734655582F9569 S{TUHOJA
458,261,731 *2E88E02A490AA4FB83EEFEC55B26DBAF60773DF8 REVEILOF
458,261,732 *2E84E158BA0E94D34484AD6117E1B8D02B8DF7BD su7n9
458,261,733 *2E8E539A8EA0C8E83935C85B97F48EB7F5ADB7F0 submass
458,261,734 *2E84FCB77F408A6F55A0BB17E7C8F57A4B1EC95C mahdollisesti
458,261,735 *2E8095643C1440CA04C74837A84929DA6579644A RICARDOTWOHATCHET
458,261,736 *2E86C00526CC09FC4689FDF541EAEE5BE810340F RICARDOZALESKI
458,261,737 *2E8A8BD9A0FD384A7F632EE237F35F5A70CF84D1 [email protected]
458,261,738 *2E814C461142FCA71DFE501D99E17FE2848B42F8 manteler
458,261,739 *2E817A72E6536FF9FF2EC5BDEF8FEEF8633073C1 SURREPTITIOUSNESS7
458,261,740 *2E81469A6C4C6EDE91960CA4F660DC6BB1EEF67F RIJKBORDS
458,261,741 *2E82FB00197E03352E72E20E5B8BDF8CDEE6CA59 SUSAN-STERNER
458,261,742 *2E823DFF2452577A1AA05B1F7AD3569BC29F3DCC rio-do-Morro
458,261,743 *2E8757E101953C8A47CA333FC8A95DA2B4F0DE2F MARC.RICO
458,261,744 *2E8E2A30F4B46308880B5B36E06B7720B89F46D2 SWISSHOUND5
458,261,745 *2E88897FA1D961F6F915E2BF55EDE9705BF298D1 SWOOSIE3
458,261,746 *2E8CB2F6964CB25BB2487DD1A97CE8C0D92E94F0 SYDNEYMCCELLAND
458,261,747 *2E8D94872EB5EC998C70D99A7057F6E925A0EEBF SYLLABUB.BLOGSPOT.CO
458,261,748 *2E837886A59FFD1E0A4BFEBB6A5922A961A5E7F9 SYMPH NO86 IN D MAJOR - II CAPRICCIO (LARGO)
458,261,749 *2E896CA54C98BD186BC226225ADCB4802B6D4D1E ROB.CODDINGTON
458,261,750 *2E86D0051832A3D983E1160AD1304539BD3DE1A9 robertdaft
458,261,751 *2E8498681CFA5B5C51231C88932AD83CC30243E1 ROBERT.HYLAND
458,261,752 *2E8CB3598BCB1E1D91F95D34E3D465663B0EA788 2.schoenewochenendticket
458,261,753 *2E8AD2C1B1699A5EB6A622F3966579EC5C0A25BD SZERMER7
458,261,754 *2E87219B3F6E820D96F072FC908DBA7130022D1C 2twerp-all
458,261,755 *2E88B87F8E6F1B78D93FB81017CF17D2B8067533 marvinwenke
458,261,756 *2E84F7308C1B4C7F0D5B288388EAE339FE25D578 MARYANRUJAN123
458,261,757 *2E8365222B71F2B067F74C4B7344AC7A09EDFF44 ROBTSENESENES
458,261,758 *2E8434DF12C10AC7BDA521E30D521A759EDB69BF MARY TOVEY
458,261,759 *2E87A08F56701CB9A725B9D473A09752A82F870A matasanos
458,261,760 *2E8501A617260562B8B35E8876DF81FDA26AA37F 34-MURHAYRITYKSEST
458,261,761 *2E8F3D9AA7E4C016CA78C8FFB816F966FD0C47B9 rodneymontes
458,261,762 *2E8EBCBFE97C4C34CC3B8616DDE4DC6E6F3EF68E 35-hazirlamasi
458,261,763 *2E83C1B5B25F7778A73AF40D8A71CA6C91ABD38B 378sherlyn
458,261,764 *2E864AD3F7CDC4A546E184420FECCE9BD7CA302B takeabreak1
458,261,765 *2E824AAC42D9D7F56C4F69248531A506D2AEA452 TAKHTEROSTAM
458,261,766 *2E877A819B9507554309DF3CF9DE2EB47D993F6A 3---d~o-~o)0(
458,261,767 *2E8124925B14E830C137EF6E33BCEBB349B2F5CC 3E1CD38AF8F038A0BF99604858355CB0
458,261,768 *2E8F5979E427795AB154483FB313F36A4747ADB5 [email protected]
458,261,769 *2E8F5351CAD23C48C445E8D404B38D975E414684 MEJORARTISTAALTERNATIVO
458,261,770 *2E89465C58E80F8956E7FA713C4EDBE36E1F7205 meldeen2
458,261,771 *2E828D9A6310B20CDA9BF9A34FF7F7B4CF18731B mellansnack:-skivsl
458,261,772 *2E8676BEE16A7CAD751A04A0C5FDAFCEC9E89EF4 ronschurer
458,261,773 *2E85D40F48C444CF94CD799984154125F8D2B293 3NV3R3D4RLH05
458,261,774 *2E8207584781FED7CC8176EEB60219C5682E0B9B 3==>`(O_)
458,261,775 *2E81B2FB479F801608314F8A431B78BE14A0A17E ROTECTIONO
458,261,776 *2E8A419287EA414CDEB9C9CEE35E4C02C7588983 [email protected]
458,261,777 *2E884933614DCBADE43BB7EE42F447D8D698931F METHUSELARITY
458,261,778 *2E81C1B4795AEC7FAB6EFA9C614D8035C368015E 3YST
458,261,779 *2E8941611CBA0B3E8198D7ABA85F880A85BADE6B rufusgallik
458,261,780 *2E81335D5C68664662CD6FBF242D00D535207989 teddysagehorn
458,261,781 *2E8219A18D5292AD99B7EC1AFC17BE201E9FEA03 TEMPIFICHERA
458,261,782 *2E87D6349832DFB8C2E40F5115CC2A496D9DFA83 tendages5
458,261,783 *2E824F6E19E779DE7CCD499F88C7F20BAEFB9112 4KAMISEDDY
458,261,784 *2E8F27A67794F677394C0BF5B3A53FE15F6027CE RUSSIANFOLKSONG-"OH,NASTASIA"
458,261,785 *2E84869313E8264FAF5D11C2033E6C7107B4DA83 mindfulness-N:-~mindfulnesses
458,261,786 *2E8B2D362468D93CB8F954ED1A4A1A83FA0B4DFC 4LLEACEAE
458,261,787 *2E8C074A829CC258BCE9CC2AAB4B67E590A01AB4 MINNIEEMAIL
458,261,788 *2E88DFA1DDAD44ABD3AEBFFF81BCBB98BA22FA47 misrhymer7
458,261,789 *2E8ED13C193C3D93E250577AEF9D38E6D416C91B mistyscarlet
458,261,790 *2E86817E6A2F9E33F8D7204F11A80A162832FAD9 TESADE2002
458,261,791 *2E851B03E302DA12106C6C64666FCD6794ADA0B4 MODESTO.SCHLEUDER
458,261,792 *2E8B5369863705ACF4B7D1036971BEF51A7F7B73 mod-lang-(live)
458,261,793 *2E830B2F3756072B694CCECBA4A5C382683BFEAA [email protected]
458,261,794 *2E8D37AC4178B63B1497BD3330379BA88AF60C1A 4thatunique4
458,261,795 *2E833204B16322AFCE4B08C3F0262CC090896E09 MOMENT160O
458,261,796 *2E8F3B921B47112EB12FA5BFDEBE4991C2B3A2F7 MORGANFULKS
458,261,797 *2E8B3044E38AA0F0AAD81417DF553E4812C7C59E SAMDRÁTTARLEYSI
458,261,798 *2E89E13008DD9B5DE3F0F4ACF3F2BF632A4CBF70 mosezanetti
458,261,799 *2E8581B0C396C7899C8D25703438F56E14654C53 511926 PERHEESEEN-KUULUU-MY
458,261,800 *2E86DDD303A56D02654B92E77A1A948992AAD53F thedeathoftheballturretgunner
458,261,801 *2E8F37BA94F777CA409A086DD1AC9ACBB484D14A SAṂRAKṢITAVYA
458,261,802 *2E8960E40374AB53860435668E37A5B14A03C467 THEFREAK:ALLMINE
458,261,803 *2E85B7D6EEA58AF40466DA6D7FFCAEA7B92FA1EB SANGEETAKESWANI
458,261,804 *2E8A2C46C41660B23940B9B2355D8CFF2F210772 [email protected]@ud1ng
458,261,805 *2E87A23888B51D9AC8BDDB0CE2C51C92C018353D santomerksamer
458,261,806 *2E87F6A999821409FCD1556A347BE4EA78F666B7 THENRAJAED
458,261,807 *2E8016EF68126EFB1242902596A5FFEE7A7B0715 5CLOUDINESSS
458,261,808 *2E80691B455E45B41BEC7525AA3163A77F3A4D7E 5COLLUMEL
458,261,809 *2E832AF62E52D4DFE98305C96B1A3E3D253B7D31 THE-RED-HAIRED-LASS-/-PADDY-O'BRIEN'-/-THE-SCHOLAR
458,261,810 *2E890FA8630680D42D4CD693B129A086EDD578AC thesnowflake64
458,261,811 *2E877FFF58107C4A3C486C883562A6B5680789B3 mytacobell1991
458,261,812 *2E868893D7ECA9F2E6429D4E81E9CC37FBE1E77B 5.mandatsgebiet
458,261,813 *2E8118CEE663C7C8B7E5DA7A047A0E0B2C588C69 schleptet in e flat major menuetto con brio ma senza trio
458,261,814 *2E81021CC446FBC84D1F7C4A14972219EDEDD5FD N310=TOPIC-(
458,261,815 *2E8194F4BF1F338EB9D5F60D127FA80A2DC0DBC9 5NNCNDSCNT
458,261,816 *2E8B8BF42CC0345100ACEF203B241C9A2D0DC0E9 SCHWITTERSJOHN
458,261,817 *2E89D36ADF2DDF9674344C207AE37D477370859B 5PAPAGAYO
458,261,818 *2E88B90D06D12959E472434E85D735347CE990C5 timothy-doiron
458,261,819 *2E85888D2FB7EEBB84BE02AA28783ED746D8B4DE NAIMA940
458,261,820 *2E8C2EA852A140F93E14BE19DABF19D38F6CDE3F 5STROPOM
458,261,821 *2E8AE7DB17609F06D7DC27B1F4067398385790B8 NANCYDEARTH
458,261,822 *2E8191E45FEA348601BB16CCD86C19783B572319 SEANCES
458,261,823 *2E81F9E2F2799B56A6AAC571EDFD67153B7BF5D1 SEANPATRICKMCDEVITT
458,261,824 *2E8B869B451327A0E05B750E367946C1DBFB04DA TITIHOYE5
458,261,825 *2E83FB0E47C8566944FBAA34A2BA1B8BCE09C00A SECURITY-TEST-AND-EVALUATION-ANNEX-TO-THE-TEMP<P>
458,261,826 *2E8DA411623557C2ECCFC0220006ACE25496AA8E NASTEEH
458,261,827 *2E8C72DBA81EBC774EF90189340E3644976F59B0 TMPSTAT9
458,261,828 *2E8A08F1D7FC6BF515A31334165F24F12B048644 nathanielburgos
458,261,829 *2E8D16813C6938B559690F5C05ACC17C0A0458C9 SELF.TMPYCLIENTYOFF
458,261,830 *2E8CA6EF2DC1CFF7948B73BC5CDF6706919063F8 tobiasdesantigo
458,261,831 *2E87E02CCD3F5C73188582C995B36D5B8F96C33F NEAL-HOCHSTETLER
458,261,832 *2E8604DA109B931AB7967EFF005A283D3011315F 6andmar6
458,261,833 *2E856DB31468F56715504E4DF3F07DDF46ABCF8A neha.kesharwani
458,261,834 *2E89D691B66F13EF32C40ABE5B5D76B955D04C3F tommymacon
458,261,835 *2E83F06D2870F33C1D5AF5EC6E7EB46EAE14EC64 TONIANNF
458,261,836 *2E81BED19202A53080D46074D545BC5B63F83C3D 6BSWELOIGNEBSW
458,261,837 *2E89198E0260580FADB1586FEE909B1712A61CC1 NESMYSLN0
458,261,838 *2E8CABF5A0874A5849DB6924557123AE2A596FFB [email protected]
458,261,839 *2E8E7383D99C87F62FC0CC19E69D9B7F00F44E1F shewoman6
458,261,840 *2E888F24577EAECA5D3DB401F911461B011ABBAC NICKOLASDRAFT
458,261,841 *2E88047EA59CC1FA7176249C38C5376B6A2AC78D NICKOLAS.FREYMAN
458,261,842 *2E8347876B03C12199C19C88C1EAA252684A5BC9 nickynovello
458,261,843 *2E88D6DF3C75FED94DCEC2E41195804C2B0E1CD7 night.--i-gotta-stop-and
458,261,844 *2E83361D2419F78211F34E63C3D4DD6BB04627B4 [email protected]
458,261,845 *2E815A5345751C17D41CEF3531660A249B3853DC NMUMRAU
458,261,846 *2E862979538983C1FC96EFA27754FFBA4A1800D8 6STINNPQGBSW
458,261,847 *2E807FB4AC08A3D297D036DF231A0B49589CA474 SHIZHONGBIN
458,261,848 *2E880E032D49E94E7F2A86038422FF7231872E2B SHKEMBK
458,261,849 *2E874549334F44AD25CF3A5C702FA7FDF7D995F3 TROLLOPINGS4
458,261,850 *2E8C6C41CDB97A993F9B5878E70062790CD89733 sietoa
458,261,851 *2E8D8D0CAAD93742E3AC5D43CE7263BD4B85897E silasarts
458,261,852 *2E8C0E5176BAD9EBC805A97912C46B56461DAEEF SIMBIONTI6
458,261,853 *2E8B1BDDCEB7C1E24480E16BEFBA55B88A5D0E81 «SIMONIZING
458,261,854 *2E8DE049DA6A30594A12DFF5C588B4684F60FC1F notmykindofguy
458,261,855 *2E8D88D574FFF05498F894613192C5A2FA001171 7BSWFAGELSON
458,261,856 *2E81DDA462AD5EA24EAA980364C1605BCF140A68 NPUINN
458,261,857 *2E83FC77C4978082505E801F8CA76BB900A74185 SISARHANKE
458,261,858 *2E8A9F1B2E4F9AE767E75C9EECFD1D4B063B059A [email protected]
458,261,859 *2E846F3C3498C5BA6761FE44C0EC8D3AC43E094E TWO-SUPPORTERS
458,261,860 *2E85014ED835E0AC73CFD69494415C5862B09D40 NZNREVAK
458,261,861 *2E8879D1BC27FB21DA05763AA7CA3062B2BB42C1 7LIFESCIENCES
458,261,862 *2E8DBD9AB80F6D4BCB8F8B238A4772279247D33D SLETTEPROGRAM!
458,261,863 *2E8D94D6CA3AAC6D8317032291E3047FFADC729C udaraah
458,261,864 *2E8B8F9BF09F0ACF4A851356E2B7923D13381BFA ukrajiniec
458,261,865 *2E84B1F097DD5A6826052E4DE47AB6121E0D2968 (O_-) ~ ~D==3
458,261,866 *2E8CB518E4CDC927C2C23F1D4249DE9586667C60 snopvi
458,261,867 *2E88A4AB077538D32284E0927D0FCBDE8C2DCB5F SNRQ
458,261,868 *2E835D7A4FD6F82F2DE273113D536701C66045D4 ODELL.SIGNORINO
458,261,869 *2E8056EC981B43A668CD7234D3B4C53617BC1CE1 OD.(FEAT..ADLIB..THE.ANCIENT.ART.OF.ADLIBBING)
458,261,870 *2E836BF1D23E9DFE69ADF6BB98A13796D06307AA ODIS.GENNARO
458,261,871 *2E888ECF8DEA07752A28AC1E212C1DFBAD6867C8 sodoyou8
458,261,872 *2E882C512566C1185F66FC47C8778A7756D63132 UN.AMOR.VERTADER
458,261,873 *2E818FB6F5CDEDC66F0D59231312D831DF415D17 [email protected]`~>-<
458,261,874 *2E897EA09D935B8209DF59A9B4C8EB5FA91C8B74 8######)-~-~-~-(^_~)
458,261,875 *2E887585C528D500DAB3E1D698C3739C6BF11B83 SOMMERLOKALE
458,261,876 *2E867E18FCBFBA2B155DD16F946F1183E8A82174 809156 ogunlerde-bu-tur-yiyeceklerden-kacinmaya-calisin-.
458,261,877 *2E88A9697F4ADEC58CE376D179C729BB8CF0F7A7 ofknt
458,261,878 *2E86026F88B30BE7A802E929CAF9E32CF529ED5E 843ARI
458,261,879 *2E81918A02C935DF3E227C14DF24152FD222461A OLENSOELLNER
458,261,880 *2E8A76608D2AA5A93B242DD685D10ADB93492482 8ALSAHLAWI
458,261,881 *2E8378349BA762DDE24010AF8CBFB3772D5E414B SPAANDERTJES8
458,261,882 *2E8167D394CEA15CEC9C56BE2D3F5F346BF0E623 UNIKKNAH9
458,261,883 *2E80008103B2B13A7FD4E9534BB0CC29E65E9643 SPACEWARRIOR.
458,261,884 *2E83A221E97A16830494F0E9BF73DC7B021CF574 ONLINEGUIDE0910
458,261,885 *2E8291F44DBC00D6473A6AFA3A4173B1AB1302C3 8BUBEN
458,261,886 *2E8B38D2B6CA80D3AFF7106B4CB75B82AD2A3456 ONTOEREK3
458,261,887 *2E813065AA722DFFDA34EC385171D29E59794465 O->-<O~0~-D-----8
458,261,888 *2E85A6ADF2EC367C007BC8AFE2C04EA694A31BB3 8###D-~0~o(0_<)
458,261,889 *2E8D9252C56EDFEB88C28FA9438A93F10ABC5A2A o>[o],ohs
458,261,890 *2E847E3F1663CE225395046AB56D04A12F1F8E98 8DEADHEADFLAMINGO
458,261,891 *2E8A9368766FFDB820A7C29954AEC60425ACB74F UPSTIRSTUDY2
458,261,892 *2E8B9941F0F6285190E60D7D9BB3D840776B9541 OPATOR
458,261,893 *2E85BBA17140D7638E364E2CCD5560C439F4E272 operamading
458,261,894 *2E8FFA347AA7C26EB961B9A904F6C2802FE14353 opstreek
458,261,895 *2E81F52BBE2F2678A54078A829F4CD71B75890EB USERHAJ
458,261,896 *2E879CB119AE6E2A763EF8F6D9871C4E885D8379 splat!***<#####p
458,261,897 *2E89339F1B67AB71F1826DC8DCFB4FFEB29AA10A [email protected]
458,261,898 *2E8A6F0A3BAB7CC9374E2CC2110189DA83EE7B6B orlando.voorn./.still
458,261,899 *2E8C95F64558C9FEA1C999DB0EDD3F30DFCAF2AB UTRUWPXYOI1
458,261,900 *2E8ACCCB35E734DBCB42F29CCE7DDF7D65702FFE ostomate
458,261,901 *2E88B796411AD3CEFD28CA67112E8B61008C0FE8 SRESLEUKSEBELVAN
458,261,902 *2E8B00620677E5E3B0FA38D2D4A0EDFE1D4C4032 V280483
458,261,903 *2E8498541F9BD15292CDFBFD42452402357C16AD OTHEROBJ1234
458,261,904 *2E8D302A28BF97FDD553C9E6CD4668924B5A8D6D 8#).~o.)o(
458,261,905 *2E8AD9B836EE826FBB34D6D8D2BFCE282269631A )8(.o~O~d====B
458,261,906 *2E86EE06A4137D86FC60E9DC9098FE8FCCA80566 8PAMPPUJAAN
458,261,907 *2E87C835EE249BEBFBDB468E8E1C4CAACF1E1C6B overadorned4
458,261,908 *2E8E17B8FF32DC79EC78564F822E10525A8A5772 STAANDEVOETSES
458,261,909 *2E88C5F7090A919104DCB2DCB91FEC255DA5C9B5 STACEY.SEXSON
458,261,910 *2E8C2C1B098B9651EE66D4CB9391EAFDAF025014 STACEYSTRICKLAND
458,261,911 *2E81626D8AB461D106837BAA0635AB2786B90538 STANFORD.NEWBOLD
458,261,912 *2E87A574AEE0A9EFB72879CA95A04CFC55379E81 STANFORD.VINA
458,261,913 *2E809DEB91D9042A1FDAB8BEED0B85AF2C898FDA P0L7ER9E!$7
458,261,914 *2E859946D57AF4596D88F9782EA0F19776BE44AE STEFFEN.H
458,261,915 *2E8CE96A69EE3E6A308B70176456BA25295A17C9 VASHTI-LINGUM
458,261,916 *2E8DE948BF3CCA0EFFD961F8D5F5240D64DF368B 944abigail
458,261,917 *2E8C82CF980395181BE89BABF9477C6A23384277 977ROSELYN
458,261,918 *2E8709FD48E3EBB999AE19DDE0FA02BFE53271A8 vcwa
458,261,919 *2E88403D5DF7626AA97178E4F3319A2EB971474A PARADO.NO.TEMPO
458,261,920 *2E8E257ACE4987863EDAD3A0D1BCCFD504F35A2B VENTRUEPNED
458,261,921 *2E8B21B300B4FA52DA99D3EDA568387656A6B802 PATIOBONITO
458,261,922 *2E89CB46F2FFF40F74453882FA217B66344FD9B4 STRINGOP1234
458,261,923 *2E833749FCF299AFD099C3CCEBF137613754D95F PATTY.MALOTT
458,261,924 *2E8D16A345CCB9B4318D24BC3DB3A41D1611D62D PAULEDISONSWIFT
458,261,925 *2E89E3811F7A6D4223F574025A234080C7566507 veronicaannhonc
458,261,926 *2E878B3EFB578403ABF6F8A80FD48FC8085C3375 paul.manson
458,261,927 *2E8C12B311CE08D0BBB87257E3DADA65DC610CD8 9DAKOTAFLIP
458,261,928 *2E8EF5489FBA8245DCF937F0F36D4DBF2E909E09 pbuznmu1
458,261,929 *2E8F6442BF1860CA121B0B1A628C6B1DD92EE18A suavity1
458,261,930 *2E82E3B36402F53CD5BA1C50A144628F966B5CEB PEGUERAS8
458,261,931 *2E8BFC62FAA8E262D85FD1F349FFE0890BE301F0 VICTORYSINGLESVOLUMEII
458,261,932 *2E8D47166FA72895A8D7A73EA3039F98EDC72C72 [email protected]
458,261,933 *2E8AA38233137D169DBD77799D8938E2E13B13AF VINCECATTO
458,261,934 *2E8DB4F405E7094B8B71A194E3F0E7FCB0F98C88 SUN-AIPENG
458,261,935 *2E8933FF980B206344E12C9279CB8A5FEF419D9A 9THROWEDE
458,261,936 *2E8697726B38FD9F7D5E1025B6DEAAD4E501E785 9TIATINE
458,261,937 *2E8899A2D4D6B059C261014E96A43A7033DCE95D PERHEPIVKODIN
458,261,938 *2E8AC56A376D9860EB0A1075E8755F1549B86155 vinoloco
458,261,939 *2E881D71FD530CB9CDAD09FAED3440D7F5E0EF6E A…»
458,261,940 *2E80831FE79AE32C5B9D8674E52E9471BE75B5AC A1GVG
458,261,941 *2E88C01060CBA831360D83F8C88BC8358F85C8E6 A1SQ
458,261,942 *2E814CD99FAACC9CD5C1B501B8AB1FAC54A9368C Sunworshiper
458,261,943 *2E804B0AFF7AC53E7694916013ABE9B623348B1C <p><font-size="+2"-color="#0000dd"><b>h</b></font></p>
458,261,944 *2E863CF1B4179FF8796C7CDC0EE1D2594A474568 a2tva
458,261,945 *2E878D080FAC6585C1AD4342600BC4C4FFC9707B SUSANAMENDES
458,261,946 *2E80B72E355C3FB7D12F81EE88A68191BB7DA76C sven-hoek
458,261,947 *2E841FAC8997630997B485E0450F68567184495D [email protected]
458,261,948 *2E8BF657C82D83C341BAD1CC034FAD7F60C8E43A PHYLACTIC3
458,261,949 *2E80D37694E9DF8168EE760D0565B61EB81B5EE3 [email protected]
458,261,950 *2E878217C492A871F706A5218FD7AC07313BAA0C A5[L
458,261,951 *2E84D51BE7E5E078D908EF04366CF4829191E72B SYDNEY.BRACKENRIDGE
458,261,952 *2E80DFD27A3B729856C309BEA77B4553426F3C15 SYDNEYGOWER
458,261,953 *2E8FA41D9BC2D8FA3A46459EFBFEC3803F55879E VUM5ZUT5
458,261,954 *2E8B48F1E6109147A4BDD8496035ECEEA0839763 SYLVIEFOOTBALL4
458,261,955 *2E82ABA992160FD58C0F450313B8BD6318CB54A3 SYMPARISTATAI3
458,261,956 *2E81F6AD08511E79AB965943E6E6CBA2EAFA236A SYMPHONY.NO..5.IN.B-FLAT.MAJOR,.K..22:.III..ALLEGRO.MOLTO
458,261,957 *2E83D64DA1F2E28147C9FB483231E846D2D80CD9 SYRJAEYTYVAETS
458,261,958 *2E82DBBC81EF7B3B4B1343BC42316334563457AE A8U5
458,261,959 *2E8D7159BBD37B161CB44B2189C480D0AEE70E7A piperuş
458,261,960 *2E86A7CAD6E54EB7B8D3ABB58DA613BC2B083221 TAANNOISILLA0
458,261,961 *2E867B383A127F6FDF2E72F816D67D1C5ABA498E TAB-STOCK
458,261,962 *2E87B6B9005741077C3B1C61909468A8E1658AE4 aaa2i-
458,261,963 *2E8B545ECE5B6B875BF065E0E6AF52198DF78E5D talk19317208226
458,261,964 *2E8F31B4AA9499CB5FC53E9D1AEA2057A84AA11A WALTON.VACHULA
458,261,965 *2E844FBF5B785EF02C03C27B2C12974483C3122A [email protected]
458,261,966 *2E89849C22D699143CFB5E15DB5277CB289E1BEA pnyybsw8
458,261,967 *2E82F978D002911534C7E97634E13DC43A569A51 aab.yo
458,261,968 *2E8628CA49C3B8238E8531739D42B0903772D456 AADK{L
458,261,969 *2E8271EEFA02A03D74CAD4D14BC84739AFA46AE3 warran713ss
458,261,970 *2E8D12BCEE73725D94D957142EC2EBF76A069693 WARRENFROHLING
458,261,971 *2E88DCDB49C80A57BC35E82A471124A4A34E8634 aa-h*
458,261,972 *2E875E5801B2F976DAA5E6D5C80C1DDE9FF92E4B te\\'b5337
458,261,973 *2E8A1E10506F8855AD5DF0018201BA927105911E tech 9 move a private mortgage from a sr to a jr position
458,261,974 *2E85B3B6C7209418DE45CA2B4E77F6E0767D3867 ABDUL MAJEED SIDDIQUI
458,261,975 *2E8AB79BF6C2D09B6433E40688D8827371FEF5E2 ABF#}
458,261,976 *2E83860AB0A53FDC2A30710EAD05D3357A040FCB TERENCE.PITNEY
458,261,977 *2E8AA9E1C6CECBC0327FDF2CBAA02FB5C0EF302D ABIOTIČKOG
458,261,978 *2E8992FB829FCACCC7AECD72C951F58CFEE3433F postkasse44
458,261,979 *2E86D0D9D55EE04C4D624BC2A70782ECB8308447 abrahamfeezell
458,261,980 *2E80B4250836AC205B8E1D38044B77B39C0FFAB0 TEVÉSRE
458,261,981 *2E877F3F1AE44DA55824CCD16D2CCCD55DC34D53 [email protected]
458,261,982 *2E838FF88FDE770F158AC54F3A3D51C1D3B51870 The-Beginning-(U.K.-remix)
458,261,983 *2E8194DDBC221DB0191DA09687A6FBD613A05068 acsynge7
458,261,984 *2E8C16125F05264600700E2F537C4B12AA38C5AD princeraia
458,261,985 *2E8A42EB46C1B5E24D34D0AACBA24D2CD76C64D2 adanaeling
458,261,986 *2E87D9F7893A6808EA268636F4B1D970BC671146 PRISCILLA307
458,261,987 *2E8922F299678BD99E4A2F7B8924A324BA0DEB0F The.Man.of.Clay
458,261,988 *2E8B8FD736D47E476CC026C65AEF6EBD55579AA0 WHITNEY.FELGENHAUER
458,261,989 *2E8F5C0973D4C53937BB370F8CD716418B095561 the.piano.machine
458,261,990 *2E8BC6913EB04C6C17445BEDF00DDA5FFE46BC1F ADIMULAY
458,261,991 *2E8D04E59CA81B2D5EDD520821DDE5D32AB464E5 WIKIPEDIANSTIGRANTH
458,261,992 *2E80F26B41424F5309C5C623F9DE91462A44E98F [email protected]
458,261,993 *2E874F6358D36B82EA8BE17691A6E2803272BB9B THERONPETTERSEN
458,261,994 *2E805DBFED0DE59822F3BE1DF76C5D8585F18908 adolphins
458,261,995 *2E8D10B02CDE68BDD96449409444D373D744F3AD THE TEACUP SONG TAKE TWO
458,261,996 *2E8E5F698018726B727BBC1EC8A026819775FDB4 (#(ae.
458,261,997 *2E8F42C85033A51E51A94B0CCF361BF93D458C9F THYRCHNDRTMS
458,261,998 *2E8C81C6F58DC042F07E6E7A42460338768211F3 TICEMENT8
458,261,999 *2E8216F941ED9B5845F6BE6217E4245A8265DBD5 williscreegan
458,262,000 *2E8B0FBE78BBCBE598FC73D652D8BAB737453026 A=)G
458,262,001 *2E8974A8FD518DEF543A76C406121294761E07D8 AGENTKAMI7
458,262,002 *2E830083C43ADEC7B1D2AB41F31336F4E9D85150 TIM-MUMMERT
458,262,003 *2E8161BC3B373B46A8715A63BAD53B35B14DF1A0 timmyziglar
458,262,004 *2E860BD0C303DBF4D043515EFF161DA56861239D qayuewue
458,262,005 *2E83AE07658357C7352287888700FB5C4E154840 WINDA.YUWINATI
458,262,006 *2E82BD02274F758E2C3A1872101AF7D3B8CB6E8A AGSIO
458,262,007 *2E894002412F14CE4ECA06852AB8267FCEBDCC5F [email protected]
458,262,008 *2E8EF66C0AA9831A80615A246ADFF1654CB661CE [email protected]
458,262,009 *2E8BBC48622E856B7F8555D3FB64BA2CC1BC9651 [email protected]
458,262,010 *2E8D740C50B2B23F87B6D903DFB77178A41AAC09 TLAUFASA
458,262,011 *2E851A4F0DCA8269F3CCFA16B8FC482B728B899D TNEFFAIP7
458,262,012 *2E80E1732E481480465FFA24BD42BEA4A39007B8 ahmedhadi
458,262,013 *2E8398E86240F662F3E5CDDE8135BDEC3027EEDF [email protected]
458,262,014 *2E8AF4799582E454BFF8782E5F411BA696494D75 WM.CROTWELL
458,262,015 *2E857E32BF4213A2D58DAC5AE7C93978FEDF9828 AIRWAYSWIKIPEDIA
458,262,016 *2E860B966D11437577C635F4F8B1DE1A7E75B8B4 q===p-~O~o)x(
458,262,017 *2E84609ED9A02072D345E48B8F0FF5FA0F101904 qp*splat
458,262,018 *2E85B94218680995459D266A19C41DA167DBC081 [email protected]
458,262,019 *2E8F5A3968214B0A3AE05A68836B058AB2ADD115 TonightLessVocalVer
458,262,020 *2E87BC84265BFE0FCE8B5F24166C6094787FA5F6 [email protected]
458,262,021 *2E8579A95F5249B9DBBA2CBC4613623B8CFCAA04 ak2s:
458,262,022 *2E8DC9355D5DC3F25C0D9C55AD750BC08A5A5982 [email protected]
458,262,023 *2E8F4F4D9943B9EEF46D18D7E1EE36199D493E8D WU-HONGLIU
458,262,024 *2E8894215D4372182980DC0C742239B782B41FC1 [email protected]
458,262,025 *2E8068E7B5FDDC8F5A012D3817EEF00010ECC86A TRACEY.DIPALMA
458,262,026 *2E8A808467060274502388CB1A62719934F6D3E8 WWWBOLLYONECOM
458,262,027 *2E81DFD6ABAA80AB51AB0F3CDA992DDD354355F2 trainel5
458,262,028 *2E842198D6CD6BD774E4D669C12EDC2604020159 TRANSEJE
458,262,029 *2E89D33AE5A9E6C8C8F20CAA603A78DF5187B6E1 wwwlingerlongercom
458,262,030 *2E8F4A5363461C7D2085FCB446EA7C90B56B64C1 TRANSMITTANTQ
458,262,031 *2E865831740B0554ABEB150918D524316BC16DD1 TRANSPORTFEDERATIONEN
458,262,032 *2E8843AE8B1F95E44FAC330C56D20CB92BAFD624 WWW.SPINALCOLUMNONLINE.COM
458,262,033 *2E81CD1DACA79D4E3D2D5A2C46CFE75BFD15BAB5 TRAVIS-LEMER
458,262,034 *2E80AB159CBA6B051BD6B9AA3DC75034D174E6F8 TRAVIS.MANZANILLA
458,262,035 *2E87B38B3A0AD6D0B14BAE7487E8200A3758D286 traviswillcott
458,262,036 *2E8F7CC76CE8075ED10DB0F6845A73113BA40FD9 WYATT.BATLINER
458,262,037 *2E8F57BDFCB340000A9C460E126E75690D0D0744 ALEX-MOORADIAN
458,262,038 *2E872B5E81CF3392098DEE7D5D3066FDF481F7F3 ALEX-SINK
458,262,039 *2E82EF7F31E6C13A3EC4E6E7F2F92130FF980DE1 TREYING
458,262,040 *2E8366F7E5AB6B505420D05572E0D87715563CEF QUINCYBAYLESS
458,262,041 *2E880B20974B3AE58D6B558B256106AD9C44068C quincyedelson
458,262,042 *2E8736C67C9D8B4C8AC85444D49F0BC157BE3B9D [email protected]
458,262,043 *2E8186400A680B1354FE7FAA8E3CD6E643F1481E QUINCY.PUMPHERY
458,262,044 *2E8D1250B584B827A43EFD2A1C12EA6F031F7CD9 xidodedivinileno
458,262,045 *2E8039550694CAC4F44462DAFEF8C0D6F3EF1DEB TRINA MILLIGAN
458,262,046 *2E854847163D3FB4960B86E74BB488072F8B545C [email protected]
458,262,047 *2E8B4B35F5418837088F24EAC5419B877F47A205 [email protected]
458,262,048 *2E8476C947519613A83E80D96E5263930E39ACB7 QZZV
458,262,049 *2E88971CA8CEB138CCE898B89D72D66AF0BB732C ALLIEJUK0
458,262,050 *2E8AB76E694F717CAA8AB51896F19CA70FFCF99C A%LN
458,262,051 *2E8D376DD011ADE787928CDE65A6537095965FB0 TSEIMAEB3
458,262,052 *2E85F6FB2CF81E5CF3A41ED01B9ED53AD4FAB958 TTPRGPOIRPTT7
458,262,053 *2E8241D651F269D790EE9910EC60F7E86E97D49B TUAN.FABRIZIUS
458,262,054 *2E8B5FC8110E7F15626AE3DE784CE5A43DB92BB7 tudor.dorin
458,262,055 *2E8D96767A56DADB0AE136BFF81434AD19119497 YANGMIIYAP
458,262,056 *2E8A699DADEBEB7AD25765ABA77DA1FAE6565A57 tujjodas
458,262,057 *2E8B7FA8F12278EDCE954438DC63AC829DFE1C5B RAMIRO.BILLE
458,262,058 *2E87B18795B030CBEBF583F8A404555B1B521AC7 tupe-demolay
458,262,059 *2E844C502F4464533F7AAD615A08BC5B41623329 yasmin-syahira
458,262,060 *2E8D156DF92D0D19F85986A3DAECD53644E3FA07 TURKKILAISJOUKKUE
458,262,061 *2E89B6AD1077404738B58E9432965BC94BD76D69 A%M.F
458,262,062 *2E840C769C5305BBE31615FD84A1A06C204ADC80 [email protected]
458,262,063 *2E8B3AC76CEFC40D578D8B4C6C11E7EB6226B470 TUYO-NG-DAMDAMIN
458,262,064 *2E89701652BC0971CCCC44014C1C43016324A55D AMMUN
458,262,065 *2E8345704425E3B4AF67C1FC07ADE81D527D67F5 RANGEL
458,262,066 *2E887C7070ED32B4E5B5B0ADD8F70121F373892D AMRM%
458,262,067 *2E890E0367557C105221E5072D825526373B20DF ratio-moclobemide
458,262,068 *2E8D0F8335E7CFCCFF38A49BAE02D0D8D5933847 [email protected]
458,262,069 *2E84567C5A148BCC3FBDBA4755FEAAB5C180CDA5 [email protected]
458,262,070 *2E85F1FCC8915BB3FF55B6889242E3B29DF4FA1E RAYMOND.ERMITA
458,262,071 *2E89B7100D6D45F7B98B77BD5934D432211F51AE ylevitatiseh
458,262,072 *2E8A8AE89A4D05ACCB0DED6FCC78CEFA437A8D1A U115265
458,262,073 *2E8AB75DAAC7DEB8E5FA9B693ACE5BF5FD62BE49 [email protected]
458,262,074 *2E8246C37C64071673E836162A2F43F99C19789B ANDERSON.BECKHAM
458,262,075 *2E8EA3A1CD94459697ECD1FB1B88DBE952BAC7E0 ANDREASG8
458,262,076 *2E833AB88CF6335E1486F840345449D5752B0671 !reaaa
458,262,077 *2E87F646F84AF44CABDE74E264B5AE101D032B4B youri.van.veen
458,262,078 *2E8012995A142135916ED4880F4BB100388AEAC2 yourmindis...reckless(reckless)
458,262,079 *2E842F7D49BA046C67141A3417644E15DE913B47 ANG.KAH.KIAT
458,262,080 *2E8A4099A17AFE1CCB94201EDA3907E50B01D8C5 YTINRETXE1
458,262,081 *2E880110B538112FAEB14EAE3239AE88FFA03715 ANIBALGUSTAVE
458,262,082 *2E841B25AD04BC7B28AA35799FA9AA651EBEDB37 ugss
458,262,083 *2E8BC05C320581FA4D44AFF48DFA5D7FBFE88C7C ULYSSES.POSPISHIL
458,262,084 *2E87ACB808095078E47E857BD51589A6A55A2FDE UMGEKLEIDETE1
458,262,085 *2E8DEE3EFA6FF7B31ADCF3DA32D8D9770A8DB4A3 YUSNIIZYANI.AHMAD
458,262,086 *2E811D9E553D3D6C192C5D639CC132DB25364E01 REGGIE.BATRUM
458,262,087 *2E804C183C9CFFD2DFF486784FF91991E956741F ANTI-ANTI-ANTI
458,262,088 *2E8B04FB399883B68481D28E8D4EFFBD1B78AC7A ZACHARY DUDLEY
458,262,089 *2E8E6EF3E0635C0AA31D4E79FF109ECD801E4005 RENCOGNAIS1
458,262,090 *2E80173BA44AF29593B07991E3470EB773BA0F51 ZACK.ROMANO
458,262,091 *2E86BB26D364869D0D405AC2D7238E38711A8611 ZAHLULY
458,262,092 *2E8069B3A20724283590A1367623D2DB8C6171A5 ANY%3
458,262,093 *2E80167B8BDCAD9393E7400C43310C0EE8C86379 zamelia-perez
458,262,094 *2E843B8BB28F4516F0FDA78532EB090DCAC2D6BD zam.rye
458,262,095 *2E84120D234C29D176E681A470D24F85DD9995B6 ao8$=
458,262,096 *2E88071E1E425135EFDA113C6310F8025794A477 UNR3C09NZABL3
458,262,097 *2E86A1A6A0A162E471D42D92E846A0DE70DBB630 [email protected][email protected]+Y
458,262,098 *2E8A60DD1312649A2AD23952161977A39B295ACC uphills
458,262,099 *2E8DD0EBB6FC88034E93AC8E6D72515EDF01483C [email protected]
458,262,100 *2E8EC1E9EB089B7920057F4234789478C7F66D19 AQNTQ
458,262,101 *2E8E3B2B7B3DCD2CBA4B5C0B84C29B2CF0058B50 [email protected]
458,262,102 *2E8FC96BCEF8C7E0A4AF81E7AD67542137BAE34E ri9jw4rrnxv88
458,262,103 *2E8C80F0298C7FA008D92B1FCBE23021AE03C3B7 ARIELEE2
458,262,104 *2E86F8135E2D1945EB4F28B7AB8D4BD7616DD160 ar;ms
458,262,105 *2E887281B04D68262D72DF005CB345B9EE3D0A9E ZMIGNIEW9
458,262,106 *2E81B7477975BFAD0F82715CE533E86A8661417D [email protected]
458,262,107 *2E8C1B66D46793253D9C8295EEA6857D2AB840B9 arthurpeszynski
458,262,108 *2E8B37D708F225B6C7AE2A4CE2B14B822031B890 ARTHURSHUTT
458,262,109 *2E8F5038785FB88A61678E2112841E2BAB66EFA9 zuber-aja
458,262,110 *2E89D4403C8E5EB2A2638767FBB869C9916D40A1 [email protected]
458,262,111 *2E81FD4073D147A2ED3C0A21332F7F68D842A14B rimuloses
458,262,112 *2E819DABBA3111C4B30193A12DF0DE5AF430208C v!7a1!7y
458,262,113 *2E8172F9D050EE3045010D900481ED0B70C97FF1 ashley-yetter
458,262,114 *2E87E8ADF6A1DB6AE924D0BEB36E96A788A1B7D3 ΝΟΜΊΖΟΥΝ
458,262,115 *2E89A4945970D713C961BC7BA8A6B83A2B2A54B8 ROBIN.SEGUI
458,262,116 *2E82E0548B6322D73EAF32BD3D2BB687865D1D76 ASPLL
458,262,117 *2E8AE6D00EBEAC741B7444AD52484BF6B9F141C4 assiemuk
458,262,118 *2E8C41CF70270F7F56BF3E4BEDAF71C7CA8C9B8E ROCKYFRANEY
458,262,119 *2E8F3BF3E853568F6A413790D20B538482C3001D astuzia
458,262,120 *2E8B380841E8F9A257B7C9CE92AC478F25B0C694 V[C[
458,262,121 *2E8ECBA91B3A1F80BDE362CDCA2281F6FA79CCA6 ROGELIOSCHLUP
458,262,122 *2E8A1F59B74202B8908FE95EEC09AACE5CF87603 ДІАЛЕКТОЛОГІЧНИЙ
458,262,123 *2E8CC5A4B65053775B54303A02D2C754E805A82F ROHKTNSNCJ
458,262,124 *2E86198CD7083F089F1323F9EE98536707197F69 rohrfachwerkknoten
458,262,125 *2E8E9C1A3087E8F0770908A16775BE668C860F5A ROMANLINDSAY7
458,262,126 *2E8F031DAB4D426FC3E6543A9A8AF622924A65BE ats%r
458,262,127 *2E81CFBF650DB9A335EB40E7705B05BF76DAFBC3 a"tst
458,262,128 *2E80D28751501A9C2DE2C412300A01297933A0F6 VERONICA.SOUR
458,262,129 *2E864071B293EEB6CE9421DDCDE35A7A7F24E7AD AU#)I
458,262,130 *2E8EC09723B4BB38EEE2B7CD6014635C17BFAF27 viabasque
458,262,131 *2E8D3E281294F166ACD8A48AA808E38CD1357060 VICKI.HESTER.PARKER
458,262,132 *2E8F558AC7BCF1F1D09BB3D42158FE6973581AB6 avdp;
458,262,133 *2E8612372BAA3F5B2DE455CAEC68DEE82FD622A0 УДЗІМАСА
458,262,134 *2E8705E01C883B1485DBDE499CCDB63D92D4D7D0 ЦІАНОТИЧНО
458,262,135 *2E8203B939B012C30A3C5FC1FA02097E064207EC A)WMV
458,262,136 *2E8CCD73B2C664BE3EF4C38102A509FDD9556284 RUDOLFSUDBECK
458,262,137 *2E8F0C84F559F617036F943309101DF669B3BAF1 VINBERGEN
458,262,138 *2E8BE6F9F8BA5A97CCFB39974703F540209F17D1 VINCENT421
458,262,139 *2E8F78B9F08B15B80E62166C5A62EFA8722DCDD6 vincent.vigier
458,262,140 *2E8444FA92D4A1709815E211CCB7B1BE80562405 AYMANNAEEM
458,262,141 *2E872384B4A6AEA655C804A140D6EABF3C87CFE6 RUODABUO8
458,262,142 *2E8D58C51EB8A642DD9574C39DF600248FA6A8DF ay-ur
458,262,143 *2E87B127B59A6849A20DAA49FE2CEC55AF03E11B virginia-richards-smith
458,262,144 *2E803FBA1AE00E4AA628FAC7606A7658E75E927D >b0 * * * <b
458,262,145 *2E8707A4C4D89126C9FAB052B9908A7470EDDC91 b!1s,
458,262,146 *2E8222133826850EE869BD4E9B33972FC400A2BE b39yq
458,262,147 *2E88FB1263A48E2F9125D90FA3CFA6152B4DB0AB S3AKUEB5
458,262,148 *2E867DBE1EF9953AEF8B18B080A5F1810A19363B B3GD
458,262,149 *2E8BACA0CCD8E1B27B16E073842E21F54B53A270 B(_4L
458,262,150 *2E8C6C3982128BB364C33DBDD142FDAEAD48F146 [email protected]
458,262,151 *2E823D2C280F81DA3734CAC39AE910069CF801B2 b&(7"
458,262,152 *2E88C1EAB34B5CF4B2276BADB5B89FB6A855FC62 vqdmbmaoxx
458,262,153 *2E8D6AD02DA6D90D148FFD614346A7B8401B4B2F vveriate
458,262,154 *2E8F9FEAF96C74F9AD8F24751EAB8A086FA05C60 W123471
458,262,155 *2E849DC025F8A714562C0F9523CEC0249D860642 [email protected]
458,262,156 *2E8EC031464D05D2A1A1BFDFFF92386FFB24185A WAASSERSCHLAANG
458,262,157 *2E8E373DDE3AD22CE9F67B8014B8E5308DA3E487 [email protected]
458,262,158 *2E84A83EEF6691228CF0B210B4D82A97493BF7A1 ‚BAGDAD‘
458,262,159 *2E8A075EBFF78A0523099DCE3D179A251C82773E wadesinkfield
458,262,160 *2E8F70751CCA4F0E897556A52DBEC8F9CF545A0E [email protected]
458,262,161 *2E88D6442C2C1EAB6019BF1C2C2E7E4A16996D16 WALEEDAZEEM
458,262,162 *2E8821E5B418CB6A8B16898868DEE55001BB69AD sarah-mae-lopez
458,262,163 *2E8D2FD502CCD80EE7FF33E857B84F2A220D3872 WALTON.ETHRIDGE
458,262,164 *2E8772857E0897E84C04A13FE5D3E147C4A4A482 saulpeine
458,262,165 *2E88B131C33BF876B11FC3E9418487FF79C5B7FC [email protected]
458,262,166 *2E8BDE151F31551F45E79367F4BF37663A8B3CD7 savingly
458,262,167 *2E8A5E90BA530FEAF353E9819D4D7C2B8218E272 saxuirf4
458,262,168 *2E871C848472398FA3BB6A50ADF0FA1375083B4A SCALARAL
458,262,169 *2E8F090F72A63DD549BFF2C94FBF57C0075FD376 WARDMOSER
458,262,170 *2E85021A7221C1BD97A6E966F10036E767BF3D6C wardöe
458,262,171 *2E8E0F624E155A0F4C9F45DEBF4AC5CB8B88953F BASILBALLETTA
458,262,172 *2E8BFCD8937EC7BBF41771BCD86CD22970727826 warisa-somsuphangsri
458,262,173 *2E822386A98A2E5420280B50478429FA0F533E6E [email protected]
458,262,174 *2E8536368006CFEF4F493B4F44E0798F10BDE240 washiki6
458,262,175 *2E8E26CB73C50AAAF4C5E2C1641F59D0107685F4 schoppmeier
458,262,176 *2E8177C39D8A041A9F0F2C7CCD5A9A0C20E01F02 Scroll.chuck
458,262,177 *2E8AA044FC7AD4B3C684E885D6116C375FFA29F0 B!bu
458,262,178 *2E822D8863BFA967361754FAFA38AFA9A13B25F0 SEANCES
458,262,179 *2E80C8EEDB96069899BD848DB1A74255182C0020 bdgenerals
458,262,180 *2E83FF668AA8FF93D46D5DD522F64AAFC6D35FCB bdjd
458,262,181 *2E8F2AE0DA0F995A64B9F510B96C211F5182C072 [email protected]
458,262,182 *2E809F8CDA249F610A93638D6AB74916074704B3 (>_0).o~.0~.d==B
458,262,183 *2E8EB18945E712A81F40E6FF9522C1AF6E49D735 0RE WEIGH
458,262,184 *2E848122D7BA109D8D2F59456573B3123CAFA90E SERGIO.ENSLOW
458,262,185 *2E8626FCF8896B4FD8E42FF90C05C34C9CEAD911 0V0VIVIPARI+Y
458,262,186 *2E8056970E77BD710A2BE7923F3CCE2BDB601317 BEAUDRAPE
458,262,187 *2E808D0CCDC50FB7F3D854C5F413219C2B7373C2 BEC0M!NGLY
458,262,188 *2E894D3ABA8E0C1B481531FDAC1814FDF8372860 WHENYOURHEART
458,262,189 *2E8514F6C583180D27B8CBA1CA7536711FC015A8 bellerife8
458,262,190 *2E831291C5C5612566C690C56C33743E68D5054D beltsville.small.white
458,262,191 *2E8FC2AD437FFF44AF09ED71A04545FABBC4B678 11 HIRNTOTEN
458,262,192 *2E86227FF3FEFCED2AF63801BACE13F121E0BBD6 SFLEURANVIL
458,262,193 *2E84D5826AC3018D35CB34E4A6301EE6706E499E 12-19-1044
458,262,194 *2E813440A119970C8B3EB5DAFA1A468F415B4E38 WIHTGYLS
458,262,195 *2E816231FED35A9FA4A2B29F512484A2D8A4E29C WILBUR.HOTTEL
458,262,196 *2E84FF4E329B5EE0037F9B07A61462108D3B51C1 sharetta.williams
458,262,197 *2E8EC2938BA66F69D9C230EF620DA75EDA27CF9C SHAUNFAULKENBURG
458,262,198 *2E8C85462B0961D576F33B6672C5D7AAD29B0DCA 1390047 den-eindruck-hatte-ich-haeufiger-
458,262,199 *2E89337348AA156AAFDEE1B72BED5D9A7A3F4F37 WILLIAMALANDISHMAN
458,262,200 *2E85FD48C2D5F7780A2D434D7CFEAEC4E232CDD3 14-02-1844
458,262,201 *2E828A1D9B5351C0B08D173809466FC48763CA2D WILLIAMSGWARI
458,262,202 *2E80816680B5DE3BEE612A2F74EC8F2CE170D346 WILLIE.BROST
458,262,203 *2E806F43E6A1CA8FE81D0F8D1129D03A3552AA41 1542236 josn
458,262,204 *2E8BF43D3D254EB693EED921ADE55508E6674875 WILMERSENESE
458,262,205 *2E87D08578EB177C9CCFB440C582A6E2531F8EFD BEW
458,262,206 *2E8C6B0397E9F142B4C062E04780815D021A0E14 SHILA-BROWN
458,262,207 *2E8C41FEBC36003463B37E26296451A04BB8E5D6 shirtjeses
458,262,208 *2E87ABCF117CDDB2D7EF02A13E3D3EC8A8141BA0 15JUL1931
458,262,209 *2E842AF3463529C3BB608E509718C282F404F738 BG;VS
458,262,210 *2E8723F513D6E189A89E0AC38882D082D1F78B2F 16JUNTTA
458,262,211 *2E8BF3EECAB1C45D90F9537CAAB2A3C7068CE2D1 [email protected]
458,262,212 *2E88FA441490EF32C0331DE15E9D5DCA44AC1DA0 b_ha.
458,262,213 *2E8D7DFDC40D2457E2F8B4B371017EE6E7704CEC BICUSPID
458,262,214 *2E8958AED57EB25FA574D35C5639D84C74C0ACF5 silvrets
458,262,215 *2E8BBDD44F62EC450ED0D765BD35ABEA2D11ACD4 bi&ok
458,262,216 *2E819C0746A71FF8D1B53A16EABD53CDD431F57D SISTEMAINTEGRADODETRANSPORTEOPTIBUS
458,262,217 *2E8522A91C7165576E3A2BADB5EB0BAE29750C41 [email protected]
458,262,218 *2E8B51519EA46C3E540EB57738E1B3CB1A3C43ED sjilka
458,262,219 *2E8F1A30BFCD10F440ED8C182B1A1391BDC1E1B0 1aurada
458,262,220 *2E8842E5B83F17C067A87BDA0087DDABE73FE7EB 1-bueyuekodabasi
458,262,221 *2E8D3015575C2DC798BE1AA46684074B754049CB [email protected]
458,262,222 *2E82A91145B7092014494DE6904FD58660597F9B 1CHOSROE
458,262,223 *2E88222B0CE0F25ABF921DF3ECB8A6BA4BE5F5DE 1 COLLOQUIUMS
458,262,224 *2E86AAC8E41E18E8008905FE0A7AA3584424A937 blqho
458,262,225 *2E803E3233F8D85C017A0AF635F25CCE686AEFDF SMITHA.SUNNY
458,262,226 *2E8D4EC6803176A2A70784DA115DD2D1D3061296 B(LU
458,262,227 *2E8B97B2E0AE3C69B648142C9DBCA345C3F8B718 sniartivs
458,262,228 *2E871E675C0A56B0CEF43E1A82BE3EA1047A8E48 snowdead4
458,262,229 *2E8DFDD8666D23CA4DD146EE71DFB37F40A281EA 1DCMMNDNS
458,262,230 *2E8EDB1F71601DD8B14B588CD43DC5A0042942B8 1eckloff123
458,262,231 *2E8EBE9D8BDABEE44B582F3E8E720BEFCA127C15 SOLITUDEIII
458,262,232 *2E8855D10E686D587E53477B771F0D2B2971ADC0 B,NIV
458,262,233 *2E86C786A9A4D6952E1ECB4472E883440E42165E WXF<
458,262,234 *2E85115C99D4F30A9819FA8A5A9D66F71C25112C BOCYA
458,262,235 *2E8AB721803C8E1CD53E426052483A68A1569356 (X)*.*@------B
458,262,236 *2E85BBF2F8413EAA94656FEE5823ECBAFCC59328 bom.senso.(b
458,262,237 *2E835A2BDE95F3687E2D9A12E36863D99BF6E942 1-INTERVIEW-BUT
458,262,238 *2E859F875746BFFB0D7DA515A1FF2A5B3AB1E4A3 bonobo78
458,262,239 *2E85E8D3BF0005AC59B4965D0E6A45696348AE46 SPANIOL3
458,262,240 *2E8E0503234DA4D5C576994F30F7D7BB9C1DEA99 [email protected]
458,262,241 *2E8E7BEAA530A7E8149CA9FB3B48E093B8F663C3 SPIRIT.OF.LAWS,.THE
458,262,242 *2E872D173152A314DF5127991927B2BA0843F78B SPLAT!~ ~D-B
458,262,243 *2E8AAB4ED118689441DFC646B6B87CC70AA3AD7F b####p.~.`.)x(
458,262,244 *2E8944FDEC3C3CCBE06604AF8890329B28D5B4D4 [email protected]
458,262,245 *2E8AA4B77E0DA2131AE70159A0B8E81248B52927 1likenifikasyona
458,262,246 *2E8FD3985ADC4916892FF20736154A01EAC15E79 bradleytomidy
458,262,247 *2E8742000FE0D5B98CB35AEC1B4970784D071CEB s+r080sc0pically
458,262,248 *2E86029D671D1F0FEB65148338E527F9C646A505 brentonschraub
458,262,249 *2E8D4A8ED9C641EC157DF6A97D6954279262239E brentthygerson
458,262,250 *2E815107C267A31443544374088F50E287D78B2B 1NOVEMBER1609
458,262,251 *2E873EF656919D65F1F585AE5F5C3EAFE74A129E 1outrage
458,262,252 *2E87EB66505DEFEE70080F0E33D4A3F5E72B4A35 brmj/
458,262,253 *2E86406E34EC3F58B111FE85509D37F6A2258B77 1 SCHULDENSTREICHUNGEN
458,262,254 *2E863D6242B05CAD2ADBE8E0DA7A6E4805046094 YEANDRA-ISAAC-REYS
458,262,255 *2E83D51B969922DA5CD2598F47C5D1E5497049A9 1SIZIENTE
458,262,256 *2E85109050AEF7E8E46D1D06B5BA199E2A012F52 [email protected]
458,262,257 *2E8B394608ABED4618F5CE1EDA2052301BEBEB45 1TNASINIM
458,262,258 *2E8353B4722888F3E0AF58C5B124552F578E9348 BS,C%
458,262,259 *2E80A14EC6F7D5C44C4CC29B6484C3094D7C63DE [email protected]
458,262,260 *2E8AA25A9113FE735104ACC476D54E3914C3DDEF 1-UNI-ALLTAG
458,262,261 *2E839C82A57521FDEDEBC61BFC1447FF1D692D0E BSNUU
458,262,262 *2E89ECD57EF0DF3E4CE9547C75A22F17217D1CB7 1.VIRU-KATUA
458,262,263 *2E811EEED82C77E68C18DAFDFBC3A7B504EFBB8D 1.VOLUNARILY
458,262,264 *2E8C0D005E585BAAC16DBFF7A2B90BE639F91B9F bta
458,262,265 *2E8498B927E3138C1705719B27683033CCAF1E83 yoo.kyung.joung
458,262,266 *2E8083CEB6375FE364F7DC03F44C2A0745508567 YORGO-BOUGAS
458,262,267 *2E80A34C90C4031D0FA17E16867C8E082A1416D4 YOSEMIE4
458,262,268 *2E83BF9F2C5C73F3DCB102E044550150D30453F2 STETSON»
458,262,269 *2E82897AC4C6EA288B03EE870D5251732C281985 2080948 PITIH
458,262,270 *2E8C82E49E2AB079E7651581E72C50167B81AB2A [email protected]
458,262,271 *2E8E31D639E45C9DCCA52F2723E0B2175E2E1154 your.history.is.mine:.2002-2009
458,262,272 *2E8BC5598C9BA81B09107CFDFE85B3A932A051CB STREUSSELN
458,262,273 *2E87BF1E7EDF027FB39F93BDFB0F3A03F5758FDF YW_GF
458,262,274 *2E8C4DC34A989DE88D92E53D45AAF6A6A8B80990 STRUTTURARMENTI
458,262,275 *2E85A71428D349BBC9CDDB449D230AF9150D78EF b--->`~ `~uu
458,262,276 *2E86029AF00300396EB7CC80CB9E1462330DEA5F Z4*W
458,262,277 *2E829346E374CC5CD1A47C1D4EBE1506FE4ACB73 successcasio
458,262,278 *2E8A7703A30AA640AAF45B0B481FED513C9B219A SUNG.MCGAW
458,262,279 *2E8BFA1CC9312D4FD86F4FECB2931D9FBFC2194B 26255 ".HYDROGEN.IS.HIGHLY.COMBUSTIBLLE..
458,262,280 *2E8361210F17EA1109E02F3FAE1F313E8B9F5D22 2627978 opiskelijamme ovat menestyneet erinomaisesti n
458,262,281 *2E83CEB839A8B83FE094F7D63587CAF81F18DAC2 SUOECALIGRA
458,262,282 *2E8DF8F2F541A213B30248B6DB7A349D0B024CFE 2699003 SCHROEDER.KOMMT.URSPRUENGLICH.AUS.NORDRHEINWESTFALEN..
458,262,283 *2E83FF417D8F554A689E89FB75EC75A832D8D831 [email protected]
458,262,284 *2E8E464E175529AF1E7BD8EDD0F8F5D920B0DF5C zhanleexie
458,262,285 *2E8D970FC4859D2CF451DCBE4D65D90EE15B5E2B [email protected]
458,262,286 *2E86AA83879F315593B476D83E8451F1A79D3B75 sydneydowtin
458,262,287 *2E855B72BA8D8DD156AE078E1012243259E7BAEF 2.darussaade
458,262,288 *2E88F6ECCE4336F795082EEA88257EACCBD74686 C1)9
458,262,289 *2E8D20954AFFE514636EA3503CE1043C7BEA7A00 2DIESEL-BOOM
458,262,290 *2E8EBB5883D69784149B14C890C2AF19CC7FBC68 2-dortmund-ems-kanal
458,262,291 *2E8295727713C2BE477F9117D51C5B87DBF2E73B ZHZNPYLGJE9BK
458,262,292 *2E8120333DD3766A402F49579DFD61D9521AF521 T6458571
458,262,293 *2E8232DF6DF1FBD35181168A41FE791450BB28C2 ZOMERDAGEN6
458,262,294 *2E8EA7D1F3A5DCF56CB8F97FD867B4AAC1A23793 TAHDONLAULAA
458,262,295 *2E823C15FE2DCAF53FF67CF7B88FE94CF1D8BD71 TALK85.165.130.189
458,262,296 *2E8CC2165AA553E262387EEFA8A68D5E7A5CC833 ZULFIANAHADI
458,262,297 *2E8A9AF259EC98C144076FE54655C2AEE2184E90 2MAFDAL
458,262,298 *2E8D98EFB98B26279A0AF39AA5E39F695FD1DB3F TALKTHEDAILYPRAVDA
458,262,299 *2E8D5370C5CEE3F8B1A6C88EA7887ADB639D5C0B C6FDF
458,262,300 *2E81031487B1396ADFE79020C8B89CC949E79CA9 tammy.stemmet
458,262,301 *2E8C7ADA3B955F9A89D4FFD36BA2B493F53FED50 c6k(h
458,262,302 *2E814F42DCC73A322AE7EBB8F77F4CA271E3BC86 2-schachkrone
458,262,303 *2E8443427EFDF6956D6608C8202172564BD60EF7 2.sechskommanull
458,262,304 *2E88722297323005EFDF5C20321AABB6B84DBB0B ΑΝΉΛΙΚΑ
458,262,305 *2E8C1A7F9F53A9125A807AEC0F8596968FE2AC48 C8HHK
458,262,306 *2E8CC461D4E7550B4C31D18B7BBFBC96C3021DB7 TASHAALLEN8
458,262,307 *2E8CCA3A52F808054B31DEE48796729932D4D5EB 2.verkehrsschulung
458,262,308 *2E8A328C3DD4734BD2FB9447101CA98184470EC8 TCEPSADL9
458,262,309 *2E869B846E8270D42B364C97632FD41A3A6E1562 TCHANTING
458,262,310 *2E864AEE4E1005DA348C18E4A42829EE37DF3D3A c9wkq
458,262,311 *2E8E0C66A47EBD92EE399FC68355692A5589988D встарь
458,262,312 *2E88E457546CD3356593673F29C1C3E176AE7393 CABRA DE JUAN FERN
458,262,313 *2E85E6125DDC22D79AF8F63CE08886CBB6BF09B8 TENDENSROMANS0
458,262,314 *2E8BA70BC2F8023F82C6001EAF720378E6E44138 [email protected]
458,262,315 *2E8725C8DB9E5441B9B16E9133DE60F3D649C98F ЂЕЗА
458,262,316 *2E82563ADD0D434A7DD6D7A18037392BE4BDF988 377E6178-A141-3D11-9DD8-A657B3696789
458,262,317 *2E89A8305CF88F5A8FCB44BB36AC1707DBEB0066 39.ENTMACHTETE
458,262,318 *2E8D97FB06B54CFF613CE88646818849272995B8 calebterry
458,262,319 *2E826D62809910D899C3ABDBADB1B57CF70F974C TERRANCE.ERPELDING
458,262,320 *2E897A5BA8B8918215CC0469573D43DE6036176F TERRELL.HEAD
458,262,321 *2E8890EA4DB5E2E16D1394CAB59CA7B493403DE7 3B<-*-*-*q==8
458,262,322 *2E8B49156B200F9F8D2C73369ED407F612D2DC16 линдстрёмом
458,262,323 *2E81D2DDC5AA3CC0264F0D22C0DB371AB5F7AC14 3ETAULAVER
458,262,324 *2E80B533618A46E42D33A7B0BA7302F695E4B7B2 НИЯЗОВЕ
458,262,325 *2E8D036B81DECDFFA1A597D10127A835B8965E1A ОКУЛЯРИ
458,262,326 *2E8C3B489EB1033121B9DFE697AF3C20A788F46A thanhmerryweather
458,262,327 *2E809CE3AD329BCC3AB06B966E999B0BDA9F120D CAREY.FAZENBAKER
458,262,328 *2E8FCE89A66CDA31C94FAB34B2B34D3876E9603C CARL.FEEZELL
458,262,329 *2E8BE45D265F9EA5DEA585C1E1E89D00710EA99E thatpigeon53
458,262,330 *2E8BE771918A3251F9E17135CE82EA8B96458A33 CARLYMCKENNA
458,262,331 *2E8A54CED5E5E213057FB67E9EFCE3EB935A2F7D CARMINE.VANDERZWAAG
458,262,332 *2E873E36185AE032AFC3E2C33D95E22CE4444B7C the-big-construction-game
458,262,333 *2E8FAC65BF09AE24C545BAD94B574F94137D9CC3 РОЗАРИЙ
458,262,334 *2E858BA3E5C284146124478FC45640BEF49B11FE САМОУБИВА
458,262,335 *2E874C01DAE952972596096E188E7E70B0745F66 «СЕВЕРСТАЛЬТРАНС»
458,262,336 *2E8D079792F7A2017D0B3621D523530B01737EA5 3.KOSMONAUTTIA
458,262,337 *2E8CD3B2A4ECC86FCB0D840B80FFF29D7BC742A5 3LASTDIST
458,262,338 *2E850E02608B0A69AD68B63BE7BABE1A97C2411E 3PIKAVOITON
458,262,339 *2E8DD1434546D8F1EDD0C8D5E8989EFBBBB218DD 3P~.~.~)O(
458,262,340 *2E86CEBC7D7C8CFE73F32B4DF42B747BE001D80C ThePainthatNoOneKnows(EightYSix)
458,262,341 *2E8CB9BABA5F0DC2A088634248452FEDA5870F51 thereggie95
458,262,342 *2E8FC03F1B520124A983CBC8A3F368E71FD7130E CD2F2
458,262,343 *2E8A09F17D452BBEF9DD0195AD59D9181C54C46D 408957 NO : 99 KARAKOY / IST
458,262,344 *2E88B3E5AF1315C1D0C956B51374725E928E77C6 THETANYA34
458,262,345 *2E8ECD3C72D8F3EB4B12BA5E77790AAA119E330F CELESTIAL MEDITATIONS, PART 1
458,262,346 *2E846856FE86AAA47DC02FCF1204DBB8F47922A0 ceratopsian1
458,262,347 *2E85FBDA365DF685DB161612255F43A92A4F9B7C C,GOW
458,262,348 *2E89388EDF289449B8C9CE0F718906F3742B7166 4CC14!M3R$
458,262,349 *2E868607B2103E280842924030A95100303864E0 TIMMYSTAFFEN
458,262,350 *2E83A233219330974783DD18C9819B704C972FF4 CHADWICKOTTINGER
458,262,351 *2E8A8701B0F624273FA29AD7A2FA87CA9AF2D8B7 4HEKTICK
458,262,352 *2E8D28E7448AA03AC29944AB04C4E70CF41047E1 4.HENKIL
458,262,353 *2E8EC7DB11F38F32CCB54DDE83F06737B6FEC627 TLAATEBFA3
458,262,354 *2E809D411CC55CAACE17C00E1527A36217C658F3 4L3UR0N1C
458,262,355 *2E88B2559D7A0724DCA18408899A5FDE5DF7A186 4LOBAREH
458,262,356 *2E8B6A2C8882E0AFCE7DA0DD6080758D70DC5617 4NAMANDA
458,262,357 *2E84D2303231F041E95BB389DA5FBDAA91F6FB79 TNDAVIDSON
458,262,358 *2E86BE202D9313E2CC8BE86BB217B77A53C26F81 chbh
458,262,359 *2E8F77BC295A643544B6AC3E72057606C0CECC59 4-P
458,262,360 *2E834BA2D10579F62890D2B7385A584BCB619684 TOMMYCARNEGIA
458,262,361 *2E874C262188B758E6C993322219064672F02391 chincloted
458,262,362 *2E8496A0B4724C454C14A197E8AC5D9ABC7700BE 4ZETKNELI
458,262,363 *2E8E79D0ABD1A063EA56B166DD21C278ADB71ABD tournen
458,262,364 *2E8A01330DBAAD84DA1559BEE2AD0BC00BD6FEBD TPVLQPOVNR8C
458,262,365 *2E8B69C4AB0DF20CABAB94A8CBE71797EC9D71C6 TREASUREWALTZOP.418
458,262,366 *2E84751D3A34F38C473B6D7B8A291C7F1C1A1964 clauderoadcap
458,262,367 *2E81274FB46DC4F6BC02A2E8337C714D786060D0 CLAY.CANONICO
458,262,368 *2E86899FFC06CAD5F2D18507DEDF470E12C1E63C CLAYTON.YOVINO
458,262,369 *2E8EBC089FA501C0A68A556B9779EA6751CCA1E8 TREVOR.STARVISH
458,262,370 *2E80907E809F4755B26295DA7FE96E16D96A393B 5DRXTYRK
458,262,371 *2E872EE4BE5F870BBB563CA5B85CA54884CBD347 CLETUSCELLIO
458,262,372 *2E8B0DEF8E4402DAFFE95170AB14B70121F3FDFD CLEVELANDCLEMANS
458,262,373 *2E804CC1AADBD75825892AE4079DB4A29865BD34 5ENSTRUCK
458,262,374 *2E80CE935C468BF0DBCB3D8488CFEBEC33FBB926 [email protected]@n
458,262,375 *2E82EC58BD03BFF5B170829FDD0577054CC4042F 5EREHCEUB
458,262,376 *2E845C7D8259B4609097158DBE0DA7381F42B5AE 5EZOLREDUO
458,262,377 *2E8AC492AB6E8C7907B6089F52E7B4B0880A6802 TRINADEBUSK
458,262,378 *2E8868F5E0D7BBA4A6A4BFCDA61E761FF0D37B81 CLINT.MARUS
458,262,379 *2E895A2CA2A4FC4CE4F4CDBD6BC3C97E8DB267E5 TRISTANTHILGES
458,262,380 *2E8D4A0A7269B1696D4AE9867C1608A6DDCED05E CLOPPEN7
458,262,381 *2E85FA86973A1919AF6530A57C39898092BA87DA cloy,
458,262,382 *2E8AF7180A932920D5DFF1F6D5D2D16143A802F6 TRUCKFOUNTAIN0
458,262,383 *2E8AA42E8F3BDE1C92E22FEAA4FF062EE10FACFB C,Mm
458,262,384 *2E84FC2916B222F889655D95DFB0C62BFE3E77AA CMOLF
458,262,385 *2E8E9ACBA900EA0B3B0AA67EDDD5E30A73E62761 5NORMANNAPOLEON
458,262,386 *2E8DB52684F0ECEBF3D97C1EDFA1CCC2E4FA059B 5NOTUSEDKINDER
458,262,387 *2E8F5E5F16376E76D8A5538D5A2D2CA083102556 C&NZ
458,262,388 *2E890E1ABFD014EE0D158CA358F7FC7789F798AD COBLER
458,262,389 *2E89811B8AD64A12FE8EBC41BF3C7F410DC6181C C+OIU
458,262,390 *2E843968BA64DF2BCD822828AA9F852441B61D45 TURGDT3S
458,262,391 *2E8D5888C02962E0C908C42D3D53A3B4D0CD84E4 COLEMANCOSTEIRA
458,262,392 *2E8C2077AF2D1FD4FF2C195BBF59965B57617165 5SLODGE
458,262,393 *2E872C04B0FABD57CF6012529A1C7313D1E13618 colleen.hearn
458,262,394 *2E89008A85306C86E366A821508B32C62F1A3801 collinhedtke
458,262,395 *2E8B79E2648118C0A68C3446242488BB6FA5D4E6 5TEARTNIE
458,262,396 *2E8C57F5D17835052C0E3C173099BB6A03535218 TWEBAZE MICHAEL
458,262,397 *2E8600C6EF0DAFFCD3469B5D30A93981B1D74E34 5TIGGERSAMPLER
458,262,398 *2E879A914FF8844C742DEC31AC45B54C87E2E40B TXN974A
458,262,399 *2E860A0BAD2399E6BDE04C47DB1A84C5EAA4CE59 TYLERANIMALSED
458,262,400 *2E8504CB24B4C2BB4CF7E3BE3E250B242934F045 TYLER.PORT
458,262,401 *2E8C171A532FBE4A4BD8199ACEC1F0257A20FE9A TYPERYKSEEN5
458,262,402 *2E85B390E7C71693A4D97B5E9C9E602A420C3825 TYRELL.WEATHERBEE
458,262,403 *2E832FF8C3FCBE116B0AF43D38FA7989516669E6 650TERRANCE
458,262,404 *2E81E4CDD691536987F35B12520840E462BE50FB 662848 konya.greater.city.mun..
458,262,405 *2E84E2524C89FE755E7FC3E2423E28DBD2D0B666 [email protected]
458,262,406 *2E8EB71368C093A65C534B3420EAAF8292E9B674 u4線維多利亞
458,262,407 *2E895144A9E4F51AF9DB8AE85402A17CA57D8F7A CONSOCIATOCI
458,262,408 *2E8A12133A411B0BEF850F561FA59291D392E48C cookbook!
458,262,409 *2E87BB6D7147D7C1840B728BF1B6780E03AD7026 6CUOVEROF
458,262,410 *2E8876079ABC1EDAD006FF72EF3EADE59E5B9B73 (-_0).*.*(-b
458,262,411 *2E808342CBC6AEBADBB4E75E195D376A98260C06 0g」グレードと同様の本皮シートが標準装備となっていたのだが、後期の「3
458,262,412 *2E865241A29DF3DB0A50FCAF76E7BBB4123010D1 umair-tecktonic
458,262,413 *2E8EC7135B66D4D2E861513490F8D1857A44D8FD cortezkamiya
458,262,414 *2E87CB7107037B5133713E9CC37371B7E7A46DEB corysexauer
458,262,415 *2E81A4D9E12C8CAF34F5E12CFE386F41E67416D9 [email protected]
458,262,416 *2E8698AA1F08C82CC8594181F4DA3CFAF660A015 unenthro4
458,262,417 *2E874A6B854D304047AD71F7D248385EAF6F00E0 [email protected]
458,262,418 *2E8BB6A59ED046E7B2073B3A97359905C760292A UNMERCHANDISEDA5
458,262,419 *2E8B7E9A67B99AFD4D7B65E18D6F750E435BAC0F 6EPPIRGEB
458,262,420 *2E8B58B09C0596958CA428B1331CC32449A29A3D 6fender5
458,262,421 *2E8D04F1A59DA9A1CDDCF2FFDB37CFD9F0377C35 UN$U$CEP718LE
458,262,422 *2E8ACD3CA5EA67BCB197BA1663C1053DBC2A7279 c:\program-files\microsoft-visual-studio-90\vc\vcwizards\smartdeviceappwiz\atl\atlproject\html\1033
458,262,423 *2E83169D37415F23AC3E19414759692111B91D01 [email protected]
458,262,424 *2E8796CA6E6BB3DB9D2333022CBF84052B3E9A8B C#Q
458,262,425 *2E89E315FFDB3F3CF4E18EE311E532DE57AB5C2B U.S.C.160CH.17PRODUC
458,262,426 *2E84DFCB8BEC1F66774F46B093AAE110D6802242 1340875 SOPIMUKSEN-TAITEILIJAPALKKIO-ON-50-000-MARKKAA-
458,262,427 *2E8A64080CB590D9AD52CCF2F7DF24E16BD17B62 6SCHEINARGUMENT
458,262,428 *2E857EDAD8BBED7D86F1BD4C59128A03F320E9DD USHA-MOHNOT
458,262,429 *2E8ABF0E533F6141F0C5C22DDA34FFBA08BA53EB CQ)_S
458,262,430 *2E856B62543E2E24C944225C0C7187D2E31E7519 1528009 turun.ja.kaarinan.seura.kuntayhtym
458,262,431 *2E87E769FB25E216D9367D703110FDBB8F6E921C 153GILBERTO
458,262,432 *2E814873C81500DDEC8A84E4E544B7787949E061 V(AE
458,262,433 *2E8D642D3DFA0D7C1FFDE17D0ECE294E7D226204 VALERIEMCWILLIE
458,262,434 *2E81B0C4D779251826F3A36759C843C887D42F87 7ALIENSCOYOTE
458,262,435 *2E8FC791F87977F70FAF230EE6720801FF4A04C0 181771 kollarinindermanikesilmeye.
458,262,436 *2E86068EA1F9A0C5BDBC790B2DE16E85EDBA34F2 VAMPYYRIPRINSESSA
458,262,437 *2E8B4ECFD3EB96FD4B79A106C706D053FF76C9B2 vandurmen
458,262,438 *2E88AF3ED160738AA06A2D942B1D4E9545D8640C [email protected]
458,262,439 *2E8D65AB49E3DB085C65472F5C3F315E722BFFFD ct7ms
458,262,440 *2E84B2EF0EA48C1243BB5B2315491ED4CCA00989 7GNITACIDEDREVO
458,262,441 *2E80E6CB206E202CB584A8AC800C036531DB1A65 CtTP
458,262,442 *2E8585B7C838E7BE584573342EA7E4AF2080D744 1.ANOMUSKIRJEIT
458,262,443 *2E8EE2CEE61F57023CDBD4A3B548C924FB2F498C cuhdh
458,262,444 *2E8ACA160A8CC9A3DF00F0EEE2FCA878824E51F1 1AUSREISSERQUARTETTS
458,262,445 *2E898363C86539E01D29CFB6CFA39E124F545D9B Vederkv
458,262,446 *2E80B14C5AC1664416DB5B2EC2B0EFE3277D9586 verdicali1
458,262,447 *2E8E25C8F454A137FBDBA7CCF71D4391C47C5828 7PESKOIT
458,262,448 *2E8748529216428C11573F2C6C461F69E52105CE [email protected]
458,262,449 *2E841F0905C9F803F56891A666673DA04F09B385 7rimandi
458,262,450 *2E8247E71017D00C20CE5903DE68F8C4571A5611 7unmeekly
458,262,451 *2E84F4D5324C5A4D0DF50BA1EB24F9208EFD2958 1IIBCPGYPI
458,262,452 *2E85CEB6D665DF83AC5C1BC65545A7F2108E3AEE VIDA.ESMAILPOUR
458,262,453 *2E88E57F743F61A0F22F705DA49EB72F044184EF VIDHU SREE
458,262,454 *2E8F4980272239C443F2E34C3C20DA67A2C5EE4B d0ip;
458,262,455 *2E88DA85BC8B606FB7634D876A245F0875F8C843 868483 bedavahavaifiSekizlemekgibi.
458,262,456 *2E8767FE9454DE35AA83A989246BFA4858D1186D D1BV
458,262,457 *2E86C4E8FC1979D88998FDF73986981A34B6F21E D#2b
458,262,458 *2E83299B1BABABBD4F27BD4F43C925A6709A02FF (><) ~ ~ d######3
458,262,459 *2E886E10A1C91E503979A6CD1AA325A82D731504 1 KRATIVITAET
458,262,460 *2E8F2BA4EE2BA25DA2E908BC0D8976FF9135AD9B d36%
458,262,461 *2E8646641B8180A14C4C324AB58CE5714C6AADE2 d4=u_
458,262,462 *2E8918BE4DAE5E048C2868DC146E6D05BA0B0375 d8a:e
458,262,463 *2E8FB7A52FD57304BC354406266D6AE0A8F29CF6 da&/0
458,262,464 *2E89E4E4DCE6ED44DE87A2A42C61B727B423BAA2 VIRAL-GUPTA
458,262,465 *2E85091CC610D1D72120B8F4ACC00EC1373B85B2 $1N9U1AR1T1E$
458,262,466 *2E84F1B8CA12803B5A7BC17451C030812578B7AF 8BSWPENDOUGLASBSW
458,262,467 *2E8E3D80F106C42A273B507F1217514A1C169BD6 1-nuorisokuorot
458,262,468 *2E8C020603414C3BDA6E739FC20366CC90D6EF35 @1!$on
458,262,469 *2E803EFEC52F3071292C814C877E9BD0652AA3A6 1outscore
458,262,470 *2E8EA2826968080BA04F36914BBCFDDFA64EB843 VJUMAI
458,262,471 *2E81AF9D97B179DC309A7715F95992FFAE88561B [email protected]
458,262,472 *2E8EDA1C4A2EFDA9A3F7C5ED9E6DEFE2DFE5C1A2 1RESTRICTIEF
458,262,473 *2E8E0AC0012F75DE40069F37414DAEB85CA7F0A4 VON.HAMDAN
458,262,474 *2E81F0DACA96B37463ED95AAAC15DDD3487D3B4B DANNIENAYSMITH
458,262,475 *2E83442BF3A1E2D3DA75FC2D81B24C276FC16758 8KRAMARSKYBSW
458,262,476 *2E8CD0C3D8D2407338D30D42F56519EB5ED9E4C2 1spieloekonomie
458,262,477 *2E8F7915F0BE3834BE54B7ECFCDD6ED85AEE9C32 DANWG
458,262,478 *2E8CFDA44A537156DE3403C14E102E0BF974EAC1 VRINDADEVI
458,262,479 *2E84FA562B3C66AFBCE12D4B793E117DC54D4737 1THEN-SUPERIOR
458,262,480 *2E8B6048526A221D215F3931F54AB5E08FA3E7FC DARKNESSFACES
458,262,481 *2E88B2601EC0A95DF3CAF346FE28985FD4016219 8----P**(>_<)
458,262,482 *2E8243215E209326F6B79CE06B2E3B74E8BB4868 wahidahashmat
458,262,483 *2E85FA7B7EA4950C8D17947C538A379A9FAE7AE6 1.whiskey-laced
458,262,484 *2E833EECA12BFECAE4286EF0A9B614525D97CDF1 D$;AT
458,262,485 *2E8B3D48EE7EDF714C33ECBB451CE4412B66E487 DAVE.BRIARE
458,262,486 *2E8BE8CFD26B29FAEC3811C68CAE6CD1E56AF11A wandaphullwomanyoushouldknowestherrolle
458,262,487 *2E8CD9897F65C7C5AC6AA7E5E0C3928052122FF4 [email protected]
458,262,488 *2E8637C31093C8102E0DC1C918235343845B517A DAVE.WIMPY
458,262,489 *2E8C164AFFBD46625D78B444C57E631E912E52DC david.everton
458,262,490 *2E821C4E9EBB83886F3CBCCAA30F897F1FD17716 DB7M2
458,262,491 *2E84B7AF1941DC9A87ACEBF0D0BF5E47D4E160EE WATEE JUMADI
458,262,492 *2E81C157F456224FC57E8EED69E130DDCD1E13BE wavealbum
458,262,493 *2E8E946BFC7BB8EC91A543CEC0281F35A616C8B4 21 j
458,262,494 *2E8BF6F89C214393B5681747D526F9354FBB676D dduts
458,262,495 *2E821B13CA139E1B41D90815F24D04A8A5EF15D3 de;3:
458,262,496 *2E8532D43C0080A1D037BBA4D49AB277DACC6555 [email protected]
458,262,497 *2E8232CBF0DA750533D8EEA80DD8914E2A4BD413 [email protected]
458,262,498 *2E8644B7CCC36F4A5021079F2FAF96307AFB03E8 DECIDAIS4
458,262,499 *2E896AB50F3BD0570A0A8B8A9038BF0549B374E0 DELVANNI
458,262,500 *2E8070F33AC8A03DA1648A3BB7A4C65AD6CF25B0 WILBURNANGELOU
458,262,501 *2E8F0FC21B282F70C37DC721CFE08F30A8BF3E7D dennyhirao
458,262,502 *2E881D60A9957A3C8A26FBE416AA75AF0C2A7A3C wilecayote
458,262,503 *2E805D67FEDD87D861E940AD9C4E0704E138F5AE WILLARD.STEMPERT
458,262,504 *2E848F2FB466F228A6C92B77190521CAE6058FF5 DERICK420
458,262,505 *2E89CE0D7B9395C1B6EFBCBBEB9F0E848E5CEB15 DERISTYAWANPRANANTO
458,262,506 *2E8021E25D030F443481E579B26BA0656F6ABC95 DERPRINT4
458,262,507 *2E8163D21CCD36FC023B5129A2AC3CD94AC52B62 DESMONDNICKS
458,262,508 *2E81D2AFED718383AA4625C5C74D146A914F32F7 27AQL
458,262,509 *2E810005C0FAA12D9F4765A5ED71F078A26A4E90 WILLIS-S.
458,262,510 *2E8C5F488A3261F9533860EC138F03D5440C675F wilma.pardinas
458,262,511 *2E809AE3B35A4895A61AD51686B78D47B308E0CE DEXTER.SONIER
458,262,512 *2E83BBC3502F78DF570991304831A4BC84086FF9 de,zj
458,262,513 *2E89D78AEBA7F95E80460562C7624677FA81E2B4 winterwinter
458,262,514 *2E8BD1F2934ABEFC7E0D772CDCADC102E67CBA1F D$gR
458,262,515 *2E80C1C7B0CEC7223A1DE9373A458AA88E57BD89 [email protected]
458,262,516 *2E85EDB2A3C8A0E9AC9085C131D3B103ADBF4173 9suprachoroid
458,262,517 *2E82C30C67039CEA56F907AC3EDA4F08889693FA 9XQFHWDGXS
458,262,518 *2E8F1B1E11E52E4378529F9812EAD12E39D83402 a,!&_
458,262,519 *2E804E4665A45085344D21F5B8224B4A0CE305BC 2.AINEN
458,262,520 *2E839EE350EB03EF07EFC286D828D876C517F4C7 a0,qg
458,262,521 *2E856BB82E36F7401924BF27EDC8F3D08914E99C A1?
458,262,522 *2E8DA7A3CD0543365B76CED7FF45B035DA14A6E6 2ANIUHLOK
458,262,523 *2E8FFFD9692C29BB4A8B5D00905083F1BEF63BF3 a2k2e
458,262,524 *2E8138C96317D1EC6C7D0AF0B9CBE4CA0E9D210D A3F2E495E8B019539955BBA9C9D23AF1
458,262,525 *2E879DEA3598A56A1344E32AC21548A7143D3357 2DAMYBOT
458,262,526 *2E88A5AE0CBFEB3C27050B34604745957AAC1DCF WWEENIE4
458,262,527 *2E8397EDD9D18E568DB2AE37D47EEB8FC74D3190 [email protected]
458,262,528 *2E84EB06BF28DA66C8F4BE1B8C10FAEEACCE1613 a8hs.
458,262,529 *2E8D1423F57358741F6730378253AD68FF48ED9B a92ez
458,262,530 *2E8B87EBA100F289356790DB0B89338D182ADAEE W|Y
458,262,531 *2E8A533A3DC29BF042F1C93A77618E360CCD3370 DIVAROBBIE
458,262,532 *2E86D6C3A9DB83475F751D334286B7FA6F6E26CE 2YLNGILT
458,262,533 *2E8976DDD5A0AB7BD5A7F9067BDB8980AC8D8B8A DL!UU
458,262,534 *2E8979FEE52127C6B975312E8E6D59E14F764594 AAHI
458,262,535 *2E85D81C5DFFA82E31DE1109A73F5A3B34742904 aanvoelde2
458,262,536 *2E81AF827BA921E19C35CBFC2C9B5CCFF6080C06 }x{[email protected]
458,262,537 *2E8EE971286985FC156992D10C2F52137C6CB128 dodgersfrederic
458,262,538 *2E88AD2312DA859A9456E769ED953DB7955EAB47 DOI10.1074JBC.M01129
458,262,539 *2E8941E4452CFB45C07B9A1A6084A74D714E3990 [email protected]
458,262,540 *2E855115F1EEAE855F2E6A347E356D888E0E8930 3-ASUINK
458,262,541 *2E81BD782540CDE37EB4B48C0FDFF1DE73389C85 abitj
458,262,542 *2E8743D8A1372A81FA5097CFD487D0C4C2E3F6CD Y1_(
458,262,543 *2E8C57005DC0B3096A87FE5592A1C6A00A1A7BAE AB_QQ
458,262,544 *2E8E7853584C6BBF2FD148692E9879A5F68C38B6 YAHYA TUKIJAN
458,262,545 *2E8B405607491BBFF9CF6C2C0A1CF6E11DF3CDCD ABREGMENT9
458,262,546 *2E8837B244978F6B0636F48FE3AA311D11E8F45B ABSTRUSAS3
458,262,547 *2E8D7E4226E5B32F5C38E713E92EE33680888A84 ACADCI
458,262,548 *2E8FCEB558C3DDBBB19DD4C05AC8D774AF618E42 DONNELLPRAY
458,262,549 *2E8B5FD8566880BD6ADFB7ECF8862B3E871CB0D9 Yb83Yg01Yl04
458,262,550 *2E888165BBD2E45B617997605A01FD3CA06679ED ybhyhasf46
458,262,551 *2E81D37B7F10E4E84957981F587611275ED02E2B DON'TWORRY,BEHAPPY.
458,262,552 *2E84B99E7E3FA19FB8B88A3305B1E58B55D052E2 YELLOWYOWLEYS
458,262,553 *2E87BD2EE96B37CA25D949C37BD41BA243EA56C1 yenumulapalli
458,262,554 *2E82C89DD98ED53E08E5A43A3DAA820D39A146EA dorianmccormik
458,262,555 *2E8EBDE5115DA5175CAC9D7824E03D55D896C7CB DOROTHY-SOLIS
458,262,556 *2E88B778C5036F29EB565CBDE019D806B76C7E4F DORY.JOHNSON
458,262,557 *2E8397D020F261A69963AE0B80D1DEC59CE32B1F ADALBERTONEAVE
458,262,558 *2E8170AC1F5CCD499262309FE54F079461CF17BA [email protected]
458,262,559 *2E83AC83AE1E811E8DAB4722F6C7C92D47119B25 3SIMASYA
458,262,560 *2E8FD672D17E5B4166D9740DF41632849B5252C7 adbd?
458,262,561 *2E81FA9FBE0B828A8ADF29D976DB0FA3EC15AD2F 3V0LUT10N3
458,262,562 *2E887C7E0397BDF1ACC1B648DB30AD36299D5BED 3>~`(X)
458,262,563 *2E89CAF876346BFF0362CBC026CC51CCF1058160 3YST
458,262,564 *2E8C45CC18E544FD73661C1A1898B529910E3B0A yotambendavid
458,262,565 *2E83132B33FEE8EDDC80191725FFBD152F4B651C 415795 DATCHANG ANASAYFASI ICIN TIKLAYINIZ . .
458,262,566 *2E8308AD431398EDC32690B17A4989255AFC6E83 a!dpf
458,262,567 *2E8133E03AF795D8099BFFEF254DEAF6B2A8BF16 dpeter
458,262,568 *2E84DACD8049DEF3662A444985B74064CC90F9CE AEB%0
458,262,569 *2E80F686F5037AE98EB3A3774812C9C9D6D0AD06 AEKG
458,262,570 *2E8EE0AADE2F237D45EF4F46CE40DAFFC3BAB564 dqwo
458,262,571 *2E881DBDD124BAFD641187D9C08266EFF99B95E3 af!gc
458,262,572 *2E8B7F1C58947AE1E8DECEB257B8CD49D50073E7 ZACHARY.CARLIN
458,262,573 *2E8741F7F5F9B397F818ABB6E9518ABD21A3436C zackboocock
458,262,574 *2E8E4A708223FCCF0781EB25251B906ECD660CB3 ZACK.JOSEPHS
458,262,575 *2E8FF569C5542CA50657C56DBB6AE7D760CF44DE agco+
458,262,576 *2E8DCD4A4498B7C92511DEDA22A6C77A08104D43 AGNUSAC
458,262,577 *2E8E7C74EAF34EF77177C2B2F51F6562A53F61D1 agranulocyty
458,262,578 *2E8A783DD455878910ED973BD197E30083BCFA21 agy4l
458,262,579 *2E854F2E09574E8892FB0CBC63AFB1C3643EC0B2 dshbtrnt1
458,262,580 *2E88F1E12770A6CCE84212ACD3F8F7C4ED1DFADE ZEKIRIYA.MANDIRALI
458,262,581 *2E8950C68353B17EF1D2638C84FACA744F45F222 [email protected]
458,262,582 *2E86DC049DDCED70C1F20F139AA940119FA56167 a=hdb
458,262,583 *2E803CDA6176E998EAA4968227F60FDCAA93C636 4NETWAREPACKARD
458,262,584 *2E848BB284B53FDAB7F33B3C713BD43DAB6EBEF0 4NTRIEBEN
458,262,585 *2E80859510D0EB93C1F2AC9D6ACBB4613F2CC6A6 D,TW7
458,262,586 *2E842B8CE112C25D8A3894456C5AEBEB992588BC AINNVQPPRS
458,262,587 *2E8C65AD66A9CDDAAC61F18C0E2C6A4FD9EA69BB 4SOELVTOEJS
458,262,588 *2E823A14728FF404F6968E63A8CD4175734EE8E7 AJ3C,
458,262,589 *2E828CCC8BF37EA6B09B8F06AD4BAB46EF554A93 DU(CT
458,262,590 *2E8F66D895873546B01C0E4358D521FC66E52B01 4SULKYZKI
458,262,591 *2E8E75945F068FC1CA54FA1EFEC1564AC83C063D 4-TASA-ARVOSUUNNITTELU
458,262,592 *2E8184F0703124BF17C1F21E2F60F842D7EC2EE1 akademihuset
458,262,593 *2E8FDCE2C12B0CC37002413612B06598176B6E10 ZWLGPRTJED
458,262,594 *2E8C262A31A39F5704A853475C6B91F081C6681A ΑΛΒΈΡΤΟΣ
458,262,595 *2E8DBF31B42B24C7A55CC6945FF274C46878BEC7 θεωρειται
458,262,596 *2E870881D9ECB3B5C96405A82B45422B12641FB8 АДАШЕВСКИЙ
458,262,597 *2E89F95FC5F34398311EB4412346A185BF84EF0B d.!y2
458,262,598 *2E83408529D41733F005627D1E7455C276887B59 572REYNALDO
458,262,599 *2E800DFC20A819D895A14AE43E9F5AF7ADB0A2CD 598KALIYAH
458,262,600 *2E8686441A8F4541D4950FADDB73B3215600AA15 ГАЗЕТНИЦА
458,262,601 *2E88511CFB322C1D57A5A1C22BA13837AB9208A7 ГВАРГВАЛЕ
458,262,602 *2E8901D1CDA0F05AA5B661A9AD08CDA44162BA36 E567348
458,262,603 *2E8D19A550859D7B41CD65E39C6A52D607648AF8 5BSWDISTRIBUTOREB
458,262,604 *2E8AFFCABA77F6DAB9DD9EFA82D099A9C1E6C76D [email protected]
458,262,605 *2E8C818B9252DA10963BAC9144C6336BAFE00683 ЖИВОТНОГО
458,262,606 *2E8C059F12776FC23BA0F1EDD0CEE8BECA0AD2A5 5CLUBBLADENS
458,262,607 *2E85B0054EF46270C23122937E63F723546AF6CB 5COMPLAINTFUL
458,262,608 *2E8D70A0B31CC18B23399A0B869D3D4D1202B7E9 5exploitons
458,262,609 *2E85C73CC5F8C7DC5277F771C30FC858E071BE32 5HAROLDDOOGIE
458,262,610 *2E830794636C0346CDD17E8E6803A3ACD90FB70E ebad+
458,262,611 *2E896135A95EC87B0A6B5F6F16D36BEA1D367ADD allerweltsinformationen
458,262,612 *2E8B0C2A2F35F1FBE5587AE73B8773929B270048 МАЛОУЗНАВАЕМ
458,262,613 *2E8520A53AC19C6221E29EFC06A6825E1872BA37 EDEN(INSTRUMENTALVER.)
458,262,614 *2E8201D2F73E171E6CFADD7C26FF0E1B0E001365 ALL THOSE KISSES
458,262,615 *2E87DDA50F0D38C92B81A06F7CA7201C4DADB340 ALR,L
458,262,616 *2E8362782FF02BD77000FE0D3F7F45CFA89EFEA0 5+RILLA5+I
458,262,617 *2E87FB5B4E9C42669FC453969908A9CC508A9566 ALYSSAHILLYER
458,262,618 *2E800ACDE53A2D50340A4933CCF81B40AC81FE5D 5SKULLDUGGERIED
458,262,619 *2E8B9418B24D819B1B72EE1FDF41E022770A7B5D effacing
458,262,620 *2E8CC8FEDA130F7C70D0CA7693A30FCED310F404 ТАПЧЭЎСКІ
458,262,621 *2E83E743ECC6B56AFA82AEFAC5C0A8FEE8904360 [email protected]
458,262,622 *2E8A3112C81A763E5B685806FBC8059229306FBB 5TTTYYLIN
458,262,623 *2E8036E956884A120F8620344A4D9FA81FB3CD41 a&md7
458,262,624 *2E83DDD52889A73028B8B118D8AE8505AF9E1A4F eg:"b
458,262,625 *2E88684314B57CD7250A86FE1E5262D35C1C3C43 EGIDLEV9
458,262,626 *2E88FFD122A5B354BDE5B403A06A41E20CD4225C 5VOEDSELT
458,262,627 *2E849E9A55105CBFA3CDDC52C3BF3158E5682C0F 5WEASELHANSOLO
458,262,628 *2E8BA7566260447FB4997BF4283F0F0104C8AA87 ЧЕРНЯХІВСЬКОГО
458,262,629 *2E8A0E890B4A4785A302D459AB32778670023826 ehb5i
458,262,630 *2E8943F66F08302432984F5D361A4F8BA41E5570 EKBI/
458,262,631 *2E8BE80F10F6114C9E97E554E5AC4E0A679C672F ekx(3
458,262,632 *2E8C6221AB4C5309EF6E7DA38B872D0CA9E72A25 ANDREA.HELENA
458,262,633 *2E84CFADEC8AC48D1499E2B77B985D3CD6909298 ANDREAS.BERSAW
458,262,634 *2E82362AE6C98803480868067421D8C0DE523BAA ANGELO-DEBARRE-&-TCHAVOLO-SCHMITT
458,262,635 *2E81F0AFD5462C90E1218C27FE33D02B77861C01 ELISEOKNETSCH
458,262,636 *2E8A99F679F1DA6A4E235018DB414BA5D8CEC9EB elite)は
458,262,637 *2E8E7BB5D79988F4630ABCAE1134330ED16EA905 6COVENSES
458,262,638 *2E80C4FEBEC086F67D649760B0C2FDDF663E4836 ELMERMONNET
458,262,639 *2E8FECA31BCA4FC9B490C3099B1C0CCE734CAD9B 6DOUGLASINFORMIX
458,262,640 *2E8342035220D8C9A00114741FE67AA15C56B217 6FANESTILBSW
458,262,641 *2E87E118AE264AC7CFC8B58CE0B7708378545485 6GEFIONBSW
458,262,642 *2E80A38CC12CC6EACAAAB45AC0F60608C6DF673D 6ILOVEBLESSED9
458,262,643 *2E81B879A1D6F0EC9CF895FFF7C4CF99AAF5C286 6mymoose5
458,262,644 *2E8298A06CDFEDA27C1180FB16845D727D0F012C ao1)
458,262,645 *2E88C3664071F60AB2652150E15BE3E1E0FA682E 6PRESENTENTBSW
458,262,646 *2E85F9181CBF6BA85553EA797020D446B9159AA1 emorystarner
458,262,647 *2E879F4CA142AD1241795A9B8167CAD6CD7A3879 emporialis
458,262,648 *2E819265B5A435FC834418CD16E6AA67CE88AEB6 6SAIRASTAVUUSEROT
458,262,649 *2E8E7E6B266400821BF00FAD5E5A6AAE4C52EB29 A''PP''ELDOORN
458,262,650 *2E833396119E810307C99267455463DEDB0EBD02 ENERKKIQUEERBOY
458,262,651 *2E82AE61C24AB11F72DD80F6EB9BDCC1836C824E ENFUBAZ
458,262,652 *2E82F87C04A7B7F27C9323CB4C31B44FFB4629E6 ENNAA11
458,262,653 *2E8549E0E6C83B5CA111AB471D03A6B3010D9D1C ENNOUNCEMENTS
458,262,654 *2E8B70B8CE581E172036D5981467F5F606799C29 <7
458,262,655 *2E8108286A261DB1A7EF7392942745305898AE48 留萌駅(JR北海道旭川支社)
458,262,656 *2E840C7421A55F5ECD9CFF1A7C32A50CCC29612C ARIELISADIFFRENTERD
458,262,657 *2E8A233DBFEB2B511072F4020520240545FA6FE2 ERBIESSA
458,262,658 *2E8FE604A04615A7619F3C2DE5822E13536336E0 ARNOLDO.MACASKILL
458,262,659 *2E87A05BA50B9EA0CD8253DF26FE77277D5D0942 (0-0)-o~0~d######p
458,262,660 *2E868509C7820AE3F39C42C2C00E8EE60A2170CC 7HEADDRESSAFROCAPCHAPEAUCOIFCOIFFURECOLD
458,262,661 *2E8ECC5AD970D3133FDC31F12702D1D5D9BA675B arrongonzaga
458,262,662 *2E8422F1575653AE57FB47D807809663CD585EBB arronrubison
458,262,663 *2E8D00A2315E3975A5EBA989B9E356906BD1400B ERNESTO.MECKLEY
458,262,664 *2E855E740F9405B8AF4BFE7F025CDE07E87D4925 ERNESTO.TESAURO
458,262,665 *2E84AE5AB785503B876D3EC321AA075FD5A60822 ERNEST.PRIEFERT
458,262,666 *2E8E24D1F3950280DEC89489F61281048B423CDB 7INRAUBEN
458,262,667 *2E8FAABB96F920536E3D6265965755198F945993 artmantione
458,262,668 *2E87C030FAED2BAAEB67D64E8F1ACB4A42614B6E arum'/(@)/r/@/m
458,262,669 *2E8AB6F02CDDA9A7948B55F522D7365C03CC679F ARU,O
458,262,670 *2E89AEB7BFAED4EF220955B75AA142B227AB7E6A ASBREITE5
458,262,671 *2E820E3805EA46B44D911F340CC05F7217E016E8 asfsv
458,262,672 *2E8540680CA7B4582262FC0F70F81240E768979A ASHLEYPERFECT
458,262,673 *2E881557C6414FB44FCAA94CC11F825211DE2D5B ESN,O
458,262,674 *2E8C2F885504E0A9DB96E40135D966E1F1721257 askw_
458,262,675 *2E850370E58F925FF677EF8DAD405E09F799F68B 0f3a354f9d4c34cbaa15b61248b3a31c
458,262,676 *2E849FCB91DE7D4FC8701F80032C25D7504D35C9 0iamraven7
458,262,677 *2E8C2414BB66C195F081803804655A6EB48F0760 7SHELLSBURGS
458,262,678 *2E86C8D4DFC6FCE5B60FAB4FD3EBC691CC2E28FF ETHIRSTY2
458,262,679 *2E8EFE4F18DDC130CEB8DED57433F6BEE10A3239 AT3G12780_DRAFT
458,262,680 *2E883F87AED5326968D582913E8C9A6CBEDA3A84 ETPILGTNO9
458,262,681 *2E883160767617F749D7BD20EBD1D63C7F611497 atctwon
458,262,682 *2E8B8DF9A92A9D76ACE7BEF2BF18FDC2D2730479 10RAMSAY
458,262,683 *2E87D1402B0B172B07763FC13F3189180F3EE22B [email protected]
458,262,684 *2E81D4BF363761E4A1B657F853D2E31ED93C3B75 1158737 ceylons-met-less-demand-at-easier-rates-
458,262,685 *2E8B22A6C22F669BD88DAE9C2761D85434B5247B AULH-
458,262,686 *2E8F8709931DB80D846EF0818F52A75D8FF81EB7 ezekielyamada
458,262,687 *2E89424F8A5280BA937D7C1404F5E0FB3AA98C43 AVERYLARRIVA
458,262,688 *2E8460EEB53D5FC21050781AB05954BEE136E8B8 F4ROEISH
458,262,689 *2E8243C76EE6830C570C75DCCCF07335B04FB6BE F8{
458,262,690 *2E83A2F15396C16506450F9CE2798C38E59601A8 face-of-tragedy
458,262,691 *2E8A2EB1F73F12DB0E539726A6F2E77717471D71 1577825 JUHA.TANTTU.DIPLOMIINSIN
458,262,692 *2E84927B2CC3FCFC52FD2E3FC5FB2C5C42142557 162479 berlin(hude)
458,262,693 *2E8A61E852F6EFA128B9B4352EB2DA852B5AD101 FARTASS5
458,262,694 *2E85322851BAA977FE281E80F1FFCD26134244AF A,+XW
458,262,695 *2E807962F408469DA020D60CB18F4A450F34AFBA az+o8
458,262,696 *2E8F934BBA157C9A7CD8C5760136536A4AFCF726 [email protected]
458,262,697 *2E84452D6EC6CB2D795140A6E9B074F037CBD786 )8(O~Q====Q
458,262,698 *2E8A7CA80F42483AD3A91DACC40959209CFDC735 fischdichte
458,262,699 *2E88A1C00B4A6BE8991D8F593001BD0827D03334 1ARAMIYORDURLAR
458,262,700 *2E870E99189B953049DA3E4E551B49FF5F4E3266 8REEDUCARON
458,262,701 *2E84005D4D2EC3C9CB04554E4A5D6586216D7A65 8REGRAMMOFONSKIVAS
458,262,702 *2E8CA5804198B927EEA6DCD58AC74820492F8E53 b7%t=
458,262,703 *2E8CC93D0235E328EC46C49BEBEB6075687FE989 B879800
458,262,704 *2E894C20796622C3EFB0498C1F58A1CA06F480E7 B)9A
458,262,705 *2E8010A19DD94F225C9C9C81FCA902543698C383 1.DISNEYCARTOONS
458,262,706 *2E89167A872945E1A00CCF5A10EFCE340995C9D6 FLESSENR4
458,262,707 *2E8DF00D551B1A5F9020BB3891F66FDAAD7A3FBC badu7
458,262,708 *2E84E868E35A21AAE8A71D72EA5F5D09A385055D FLORENCIO.LAPERUTA
458,262,709 *2E8B43664FD1B8224077C663A3AD77B02EA1B6C7 [email protected]
458,262,710 *2E8E0CE149EC6B245ACA695EF24E5E20CAB4928E BALBOY15
458,262,711 *2E80DC6E5DA177E3BF1E802AC442B2267DBC09C8 baldes-de
458,262,712 *2E832CAFEFF7BAC680F2A91574A29339EDE80FB8 [email protected]
458,262,713 *2E87F7983D69BF899F515193B8E0E8908D51FBF3 9AANGLURE
458,262,714 *2E8D00570191451244C3DD39EAF8664ED9B25304 9ABLOSCHENDEM
458,262,715 *2E84F802C6708F452502D6B94B579E1293EE732C 1HEAFTROF
458,262,716 *2E841EA475B9DAA06D10E821A6E0A4E88BC8FFA9 9archinformer
458,262,717 *2E8A1E9F0DBAE3AA8B1A865638415B430C5BF37C 9BSWPARTICALLYBSW
458,262,718 *2E87B3B6D2DAF6CE83C9875D5554D7949419DCFD 1ISTEREST
458,262,719 *2E89AB10BE990BBDF5D6B99432A60B898AC6646E 1.ITILMEYECEK
458,262,720 *2E81E7EB7E901A19E843ED50E4E7C1E0B036169D 1.itsehoitoopastusta
458,262,721 *2E81E8B6E900CA124496E7F0BFDDE960440717B3 BARTEMBURY
458,262,722 *2E8AF3E790DB9C9DD15F4BC992BB5775D5B322D4 1 KASSENREPORT
458,262,723 *2E8C3DA0C803670660EA2133F92EA0B0CDBC5BD8 bascom12
458,262,724 *2E8D4C1641B32E85EC5085D52D7C506BBC260A87 9DESHABILLERIEZ
458,262,725 *2E8D562DD7574F7BE31F054542D3954C385691DF b:;bd
458,262,726 *2E897397E466A5D13A9005FE063F524DC37C12D7 FREEMANVANHAMLIN
458,262,727 *2E8B37091E5E83FA7DB8BA3F764114352D2B07F3 freezingsun
458,262,728 *2E8A90F79F8067C7D6B4985AAC5777231A785893 9NEERKNIELT
458,262,729 *2E87B4AF241CFD0857AF74DBD0453BFD9E2800D3 fv]k
458,262,730 *2E8758AA397C166D3750F01572919A913D9A8320 1.paradeone
458,262,731 *2E856F579700C3F4FF7D245E43BE0928E352D20A 1-PIEKSENDEN
458,262,732 *2E8CD6CC68FCDA20885B78C18CD7C7692C8BFD0F BDE/W
458,262,733 *2E8EBA6A0AB17B0D6260D5F47986F14601D766B3 b,dga
458,262,734 *2E805B934E8C2BC525AADD579EAEC15E246B360F gaanangal
458,262,735 *2E8BB673F63E04AAB04CF6104A627C07A9292089 G?AC
458,262,736 *2E86CEF23111EE30E4932996EEA30F7470ECBB46 1.SIIVOUSKONEVALMISTAJA
458,262,737 *2E8E156E70F49DB1301C0BC6C944FFC22E15FF1A 1 SP-PARTEITAGS-DELEGIERTEN
458,262,738 *2E831EA80E12038B9CA77D0BDC52DD83693CB8ED 1stahl-gruppe
458,262,739 *2E83E7E589CB8E7D930921F321E7A83E08FD1D2A 1 TERRY-UNDOUBTEDLY
458,262,740 *2E8ABC76334A85FE7911F4A9A570D2125AC77724 9ZEREPPOT
458,262,741 *2E85C7F6AEEB05E49BC3A06BE6C8332B197F3CD6 1-titelnamen
458,262,742 *2E89782B1A1E8420417032FD9C05F024B9ED37C6 A?%
458,262,743 *2E804BD1D21054C9E0D274E200111C4F751CD17F GARLANDMINKEL
458,262,744 *2E823F96B55E6BB6EDF4E1CA9FAA0DE55597AE02 garretlicursi
458,262,745 *2E84A9A7F4C560222F0FEE01C9B814E9E1CD8603 1UNSCHA
458,262,746 *2E80D2C1B1331E3E705C4E70C3B2EA3C420911F5 1.utilities-as
458,262,747 *2E8A0233D4AFE764EE92722E37AAFF2B708B547F A14880040
458,262,748 *2E88CB9409635AE39AA7EED1E63E48FCA849BBFA 2043401 we-also-will-move-assorted-tables-
458,262,749 *2E827415043DEC16AC771BA8367B4D961DD051E5 geitani
458,262,750 *2E8EB45837B2E6270E511060357CA57401C02DD4 gerryschramm
458,262,751 *2E88808E4858CCD23B3FAF53BB35BF8A27ABFE1E 21jun1291
458,262,752 *2E87C01D81FEDFFDA6DE2A40A9B3247EF6960B1D [email protected]
458,262,753 *2E873F819E4A02CA4BF1DAA8D424671B5675AD35 BEXCT
458,262,754 *2E8489FDCCCEA9DC73781CE1DFA170DE9F608E97 A9IN0
458,262,755 *2E87C18FD2F85DE960B44DD0AC8E354070D1BA64 2526714 TIEDOT.TARJOTTAVASTA.ARVOPAPERISTA.LUNASTUSLAUSEKE.YHTI
458,262,756 *2E81BB0DC51050C56795D7C2869143A983FEBD54 giusepperedish
458,262,757 *2E8617DB5FBF835D20D34E9CB5DE3586DCBF38E7 bg_#.
458,262,758 *2E8005C511988492C14BB0211952EE0D6DCE1AF8 glühlampenwerken
458,262,759 *2E8FA1E221C07E8CB1446D50CD18E268BC0FAAE1 [email protected]
458,262,760 *2E8DAC11B7BA0D59DE7522543018E531253B3909 bh.d1
458,262,761 *2E857384C6DD62DB3DE7F144EEF3C7519F333690 AAEW5
458,262,762 *2E83D4EE83A5210A3B926BFFD37E19679FD73B58 aankerves6
458,262,763 *2E8FE43697188F8D33A2C5F409E2E5D071EDE42A biedet
458,262,764 *2E8CAFB8FE78C9BB834F2D09EF54AFF35576BA32 AARON.GOODFELLOW
458,262,765 *2E85D3AC7A79D31A23CFF7F0B2732EBC90F2807F gorouslies
458,262,766 *2E85AE23FEED126D01A4AC0E1B1CE68F1DE0C8D5 2FORESCHO
458,262,767 *2E8E131CB3223FB655C9AED8EC98018C1AF72DB0 grc3c:300:
458,262,768 *2E8373F32A158FB8CB59ACC292706C6D9B347E75 ABHD3
458,262,769 *2E8619A38B1E303D94CE937E0ECAE60A91E978E0 2 PUBLIKUMSJOKER
458,262,770 *2E8408757D2A024BD3888F592E4FDE6286C43D25 abm-r
458,262,771 *2E82FA01B7588C697FDAAF468B3639B88AC05BAC BILLY.MUNKBERG
458,262,772 *2E86185E53C8049DCF3442C44E95A5A235740D78 bimmer4
458,262,773 *2E8F4DD66A0F531E613C8B80D8E1B65E25CB3172 BINL7
458,262,774 *2E8EB01B2C89A091EC21A4A766F13923B3A86A3B GTHCRTSL
458,262,775 *2E857ADA8EA72D9141D45FD8640E388D27119426 348082 LUE.LIS
458,262,776 *2E81ED809415615C11497D0AE2C2523175CC056E BITUMEES5
458,262,777 *2E8DA9FF4B77288699E4489E3BF9EAFF71578BD2 guettez6
458,262,778 *2E87B36F309BA19FA64B031F7FFDCD36A6060952 BJQ9U
458,262,779 *2E85C809125BB3FBDFD28FEEA8D9981D643F6706 3--B ~O~OO->-<
458,262,780 *2E88F8E2E95B7EEFB25B564FE284C4CCA1DB84FA ACTINIARIA!
458,262,781 *2E8A6A4F2B8E0E05ECB7B0C4E3E02231E8179079 ACTTALKINDOPAKISTAN
458,262,782 *2E8D7239129C914F3E2DE3AA1B57235205948E7F AD264,最重要的是该作品上传至该网站的时间是2009
458,262,783 *2E803B136FFE9ABD21049E2BAA753FC2E7BAA4A9 bleaberry4
458,262,784 *2E8DA28AD1CBB1AF53C2407C196698E96D59228A halkandes6
458,262,785 *2E80CC633EA084E94805633A095BB0350769B688 [email protected]
458,262,786 *2E8B47B41F2A43882E47E181E644EEC1B81D126D BLYBM
458,262,787 *2E81441523054D02B4495BA75C7FD83DA3F8A31B [email protected]
458,262,788 *2E80E1C88D5A4B135E5AE24CA6F03F2559F7EA62 [email protected]`-}O{
458,262,789 *2E8560471296B82D6037D708F60B95BCEC644FFF afrodudes
458,262,790 *2E875B4B059FF12FD8FBE9901DE5A7C73D55AF54 bo1h
458,262,791 *2E83BE587D6C0912C0875EEEF5CDDBAF1441A2A8 agco+
458,262,792 *2E8154403C13B436382E0CC05FFC03CD44A336AF AGOYOBSW9
458,262,793 *2E805AF24027A61ED07F4415F7D995C5705D289C ahf3n
458,262,794 *2E896ED624CEA1253A3A53C7CBF55C8E9E3ABD62 478080 d07-01nis---15nis-
458,262,795 *2E88B33C30F7E0E3562FC3D449D468D2DE9DF9D3 HEIMBRÜGGE
458,262,796 *2E8ADC9327E2789A63C802339828685FAED8F5B6 HEMALOVEYOU
458,262,797 *2E8EFDDE2C17CB717878ABD182C6D2CB74429D78 HEPATOPHLEBOTOMY4
458,262,798 *2E87F42513FA2D210114D3B70A174A6585952F30 BPGU_
458,262,799 *2E883A394F917C7F944AD9A0FA733B9F10FB9C24 B"PUO
458,262,800 *2E8D4F75F280213FCAA8EEEC9AC0EC9BFC3DD2BF BQKB
458,262,801 *2E88D8BB25F6659646CAA2C5278A44D5299CD4AD AkuV
458,262,802 *2E8E1EDFE24801381A69618119E9A8B0D846B33E HINDMAN-JR.CLERMONT-
458,262,803 *2E8E7E84FDDA4308AE7D7D9697FEBDF134EAC54A albertoabrev
458,262,804 *2E8E06E7C91B8AE25EAFC7D843F20F49F712B51A A=LC
458,262,805 *2E80B7E0DF98FCE66977B746D49632CA91E15885 brasławskiego
458,262,806 *2E890010DA7CF8F695408E9147190ADE5D2C34E6 HISTORYOFVICROADS1
458,262,807 *2E8261A2078F98BCB0EA46BCD13570EFF83E4B97 BRENT.LELIS
458,262,808 *2E8BCCB57708049125967F6F550DE49DBD47B68A HOBERLIN
458,262,809 *2E8B232EDD926E72C0F924513C5528CE8C53DD08 HOFMANNSTHAL —
458,262,810 *2E8EEC0205DDA3E16E6D04ECCDA159F47B929400 HOMER.VITERI
458,262,811 *2E82CFBA6F8258A760B8CDD641B74776CFD2E0BF BRINCAI1
458,262,812 *2E8BC7BCB184E80FF62AD7D03082C48C530ED971 ALLE9OR1T
458,262,813 *2E890673B0E23DC1BCD833EEB8C07C062AB08E04 horaceugaz
458,262,814 *2E8A7A75CD94FBE40337731E8015763920B13F3D 4SPEELMANS
458,262,815 *2E83F95265E640EC4A5F9750822B0920876A30A9 4SQUIZZIUQS
458,262,816 *2E86640C8066576254F12514BD8237AB3C806A2A 4SSIM4SS4DO
458,262,817 *2E837B7CA3933DAA565049227DCDE8160B6D2EB5 HOT.SPAIN
458,262,818 *2E838D945D3BD3A2A1479455BC2CA658AA96508F BRSW?
458,262,819 *2E897A057B5B4F4A02E70F652F4CC60D01A164F6 alvarolangon
458,262,820 *2E84212CC1E32E4CD76A07A45164E3462A0CAC86 bryantjeffs
458,262,821 *2E8988078EA675AB5235FCC44AC06735FAFD2191 4ZWECKENTFREMDUNGSVERORDNUNG
458,262,822 *2E830718F8C58E3C71C512E1B0CA6450DBE298D6 ALWAY8
458,262,823 *2E8432B464267B9D7779F1A867E2AA91E26C6BF4 alxpx
458,262,824 *2E871B0911352DFEECFA8FC9EC5A618F9E10988A hueystancil
458,262,825 *2E85692AFA231A4239E43D1F79A90110A2ECCC4C BSG9.
458,262,826 *2E8031B9127AD3E43193362EEAB975661820A030 HUMBLESSING
458,262,827 *2E89CDA0114F50DCB650A9F26F5DDAB34140F9DD amord505
458,262,828 *2E8BC1DAADEE8AAFD01FBDCC6FF154878324C60C AMQED
458,262,829 *2E85A4F2710EE17FA883854970044A4BD37FAF95 5BENHAMO
458,262,830 *2E8282B82B537AF6979934001A3B786A572EDA13 AN1D;
458,262,831 *2E8A9B7A9C9399C7EC8D187F1CB832830689B454 5CLEROMETRIC
458,262,832 *2E8B0B1EC7F42DEA28A26933658158018882EEDE ANDREA.J.MERZ
458,262,833 *2E882E1B38B40DC12F64A387449559D7631F70F2 bullitioned
458,262,834 *2E8B3D5BA39FCCF795DA0F27C90C6498F416A807 IAMPAYTON2000
458,262,835 *2E8D8A61D13BDBCC876165188E627162DA89BD99 busbilletterne
458,262,836 *2E82F7084431E73FE03BA6335072EE080B49A4CE IAN CUMMINGS
458,262,837 *2E888DB6AD865533F75B177448B5F5634FACE32C 5JUSTIERMGLI
458,262,838 *2E8E22E053645809FD3DE20BC7E4E9C33E5DE7D9 ANGELO.COLVARD
458,262,839 *2E81CB0AD6059FC703A20FC8A5C171E4E85092EC [email protected]
458,262,840 *2E8A73B99D5E24A29FD7C0ECAF5FEAFFA8D25E42 BV7KP
458,262,841 *2E879DFC278CA7279C9B7A3F214239839F61594F I=(D
458,262,842 *2E8A787A081BCBF996070D0D2C04443D1D211FF3 ANKULINA1
458,262,843 *2E8EF822BBB3A2C685D2883E15F4CB6090C913EA [email protected]
458,262,844 *2E813339344E4DB85766C371679E01F9F540C96D ANNAMISEROCCHI
458,262,845 *2E8A1F9C04541F795DBE83F78873426009742DC1 antoneautrey
458,262,846 *2E81AEAABF9DA2B290EAF904B95ADCF04E2A3EFE a?ob1
458,262,847 *2E889551DF0534137662B6E2712D4BC066344942 [email protected]
458,262,848 *2E8B8BE0A94851F6037C28DE3295C65CFF9CAF16 ii%g
458,262,849 *2E8C7D5E177ADE4080619EA8DE488694EDD1D0F2 6BISULFAAT
458,262,850 *2E8906C25D73D5DA62A6392FE19C838423B4967C 6BSWELECTORALESBS
458,262,851 *2E8FD2B35D15EDEE9665257271E03F123727A060 APPEALINGTOTHESAME
458,262,852 *2E846846C6B75BDC35E7C901F41C43F790BD7EEA 6KOMKOMMERS
458,262,853 *2E8D4F37B79C9BE5F45B51819FE742CB7410ED1A IMP473424
458,262,854 *2E8E099B1EBBAFB4EB2B42226665F345C9C9FEDC ARDNIEF1
458,262,855 *2E81A9902F4D0341FA9988D54393B33B07738877 IN73124CIN412
458,262,856 *2E8880F4F17C1FEE332555CF929C856DC090AB37 ARIEL.NESBITT
458,262,857 *2E8CE45F137982FB7DC8C3D7C9BDC5D2FECE35DD 6PFFFKTYEGIC
458,262,858 *2E834252F37328184A75BCBDAFC5EB1E29168AEF ARISVIK
458,262,859 *2E8881AFBABF8D20BEC327C6093A06DD5D573769 6REHOSTNINGED
458,262,860 *2E83F79E8E9258F9F4DA6633AD9B72FA2E5138E9 ARNOLD-FORSTERMICHAE
458,262,861 *2E8675FC4B83C0EC7E5C9CA02EC95093DCDEF07A 6THALAMBSW
458,262,862 *2E87F56BE4594AFCDC06C4A1BC5A22AB7878ABD5 c5l3q
458,262,863 *2E8D2FF1049CDB9AA345A1089FDCD71834681DFA innrednings
458,262,864 *2E8C978167588548B32472351038C9A751738486 6VYPOCETNIHO
458,262,865 *2E88BCC764B5EE1C8A3DDB88DD66FAA5C613E667 ARROTTOPPING
458,262,866 *2E8A2C7F6AEF5A169CFC5C661108C1AEF4CC119A C6BRR
458,262,867 *2E800C374FFB6B7F4AB55D1A2DE637A3791B74FF INTOME,INTOYOU
458,262,868 *2E87EC54F2E5B605113BB4905D99DD5DB8887212 invectio1
458,262,869 *2E8850C2E8E2273725057B3BB3B049DB750A5FBF IRVIN.CHARVES
458,262,870 *2E87F0CF594B6F4C4F7E2B277A6BE7A67589B3E2 as"fq
458,262,871 *2E8AF6B8B2A62EA71EC1532EFA87A08202DCA2C0 CALUBAQUIB1
458,262,872 *2E8278F9645187183F72C3F888D7B035845460FE A.SPECIAL.DEDICATION
458,262,873 *2E84594B5F0AF3F6F5897C08C3A6EF2C51F1459B CAMMELLO123
458,262,874 *2E8A43A3776A52BD6AE0AF359BEAA48AE007B168 CANARSEET
458,262,875 *2E84804AF8F7084FFE95B482228AAA00929FA6A5 I SING FOR THE THINGS
458,262,876 *2E81A10EC5B47A98EE174251A0DDE653317A9087 isnnising
458,262,877 *2E86DD116BC7C11E05374B568E8464FFAC44A461 ATPCOUPLED
458,262,878 *2E8ED54D8838AB0C67751F5C6ACFEE5C87901B8A ATTCATGAGGGCTCCATCCTCATGACCTAATCACTCCCAAAGGCCCTACCTCCAAATACC
458,262,879 *2E89EEB8A2369BB1A03E7A7EAEECD9019BC40F03 atutining
458,262,880 *2E8202583A1728ED4B3B3DAD7750B8D66316C844 7NIQJYCKCJIITD
458,262,881 *2E8EBC78FA3BFECEE1674EC846390BD0DB92772E 7PIHSLICN
458,262,882 *2E8A5860B64FCC544AFD0D072308C9924C86DE32 CAROLCHOWEN
458,262,883 *2E89DEAAFAE85454FDB4ACDB4CD0CEEB5E82DFEC 7SESINAMLLUP
458,262,884 *2E8EA8FBDD9DAE4900B07D318B6375BB207810F3 Carp3tsw
458,262,885 *2E8CBBD26A22B1A7528B93D6914CE01305ED5AC9 7VERLESENDE
458,262,886 *2E89478CF1D2D9A902523B43D34443A2F807AD4E JAE.CEDAR
458,262,887 *2E8C688044076E3447E517167C46ED2291F2F033 JAHRGANGSPATE
458,262,888 *2E875375987EE2618DEE3469F65EFEFE551F54E0 [email protected]
458,262,889 *2E8339FA78AD0EBD4DADF04EC3E86571A37CE901 868ANGELINA
458,262,890 *2E83B506E48C82508B98A14B980242CD1363E3D2 A+W"O
458,262,891 *2E8B39219468C8809B7386C79D5C2683BB4BC47A JARRETTAXTMAN
458,262,892 *2E86EECC8D707BB3038FA0563A7975EF1993B229 ayvko
458,262,893 *2E84520D39E3F846AB66C26DD4B0D1A5C94D9F10 azdmq
458,262,894 *2E8AD11FBA68AA41CE837412D50E6BAC2E492C13 CCQCN
458,262,895 *2E89045B3C803D76239C2FDC6AA2D7235261FFE2 b0u1a
458,262,896 *2E8B3C39E3362887CA1E121D2799D45ED9B0FB83 JEFFCULLINS
458,262,897 *2E864362BF33C2EC10ABD33724186A67C745A52D }8{.~.~.~.d=====b
458,262,898 *2E852649EA1270FD07047A2B4F5807ECAFF2CB70 b5;c
458,262,899 *2E8F99153FED0BA7DB7295F00F20092F0EE03619 CE(VF
458,262,900 *2E8BAEB1C3538D5BC86B7E55BC25468756A8C585 jessabsw
458,262,901 *2E8062772E84EBACB085BA74AAEBC680C7683626 }8{[email protected]
458,262,902 *2E835773C9A732DB4087EB1AB766F588E4588DF4 C:GPR
458,262,903 *2E8D9A4E8CC2D61DBE1FDD09106B31CEB8F4B336 CHANCE.EGERSDORF
458,262,904 *2E87D2AC1566FFCDBBB28FD6B5E2D6B78D1CF8C6 8SNIGGGERRED
458,262,905 *2E8FB975DF9CDE385D3813740424D9BC0A425978 JIIRAANKA
458,262,906 *2E85E32C9B854C538BEB868E302A4B60EBB503D5 CHAPTER30THEWHITETOMB_03
458,262,907 *2E8C3B98207F6A333B430F3856EBB4FB4FD2C889 8XPAPERS
458,262,908 *2E85A76C73185FF1DDC2A8BAA3DF5D7F13925FE7 BASISFORRATING:THENUMBEROFPROTOCOLBASEDMECHAN
458,262,909 *2E8DA4A1982BEBB88B561626815B1866B291622B 930452 OURFIRSTWINTERWASALMOSTOURLAST
458,262,910 *2E8064BA2C543ED7C17842112FF497C429F52A64 JNRFKSDFNMCZ
458,262,911 *2E8BDF986304CC9A54633472031DDFE19B6644CB bb6nd
458,262,912 *2E8C79357BF7FE2BB7052E1341DEAB40D9F9D892 CHENQWE
458,262,913 *2E8AD29884C1814D09BC5DF1CEDC59484C6AC377 joelfannin
458,262,914 *2E89E7AD4FABF76457C687619D4170449A176E3D cheryl.colburn
458,262,915 *2E842011A5D9FFEE3FDB8B9FBD6B07F3F84D0FDF JOE MATTUCCI
458,262,916 *2E8EB77DF4C7D7B2BB9E0C07D7F31C547FC30A54 bc;dl
458,262,917 *2E80AEDEB11C2CDE107CE6642D693CDD299981C8 CHRISTIANMOULTRIE
458,262,918 *2E8D458F37F8A1496139AC7356BAC3C8A2EA6F4B BEAUTRICHE
458,262,919 *2E8F430437E41B37A855907A1F3634DE6A91828C CHRISTOPER.MEINEN
458,262,920 *2E8C743EFECDE629F193E6492C573440C1A82B38 JOSHUA.BUSSMANN
458,262,921 *2E84E91648C5C38851A1AAC3F8ADC02090B79554 JOY RESTAURO
458,262,922 *2E886C31FD9D4A0C8DC3B3BAF2ECA8E8B127CBF9 begravelsesmyndighederne
458,262,923 *2E8EDC0DE5F5A5652A91F51C48081686F1B5E8EF julianmarcum
458,262,924 *2E829B3BB3A96807EA631F1FA006BB1CEC85D5A8 JULIUS.TRUCHAN
458,262,925 *2E8E7E2AA9CC96814DCDFCFFF159DF765DF66EF2 JUSTINBOUMAN
458,262,926 *2E872B0D707C578A2F147AAFED3CAFDE56B55515 [email protected]
458,262,927 *2E81D61B21CB191B408B2CBBE0187F5F01C214EA kacie-whalen
458,262,928 *2E83B7C75C1908972B94366280955EDE2A398E03 kamilah
458,262,929 *2E8A74C60C1F2B5F7BABEB6755EA845DE79C6824 BEIGELEGTEN4
458,262,930 *2E84FFB7CD9F05044564293B71EBFAAB7FC44852 KARTEUSERKLOSTERET
458,262,931 *2E83CA12DCA03FED847B38CEDACA2BCA3D94D4AA BEN-LOWELL
458,262,932 *2E87813ED09D5CF085191BCF90F7F04DF91258CE KAWATA1234
458,262,933 *2E837AD6AF7329E7434EF8E97FBBBBE05CCB1347 BENNY.SWEDA
458,262,934 *2E8C2F7136F257A6A05A58EABB567F7E7866684E 9PRASETYA
458,262,935 *2E81C11F270ECED63BEF1D34282163EE3283CCCE KEENAN.OTA
458,262,936 *2E8BA3EDB9988D3FE5629CC2643C35B83FAB9FBC keion47
458,262,937 *2E81BA610C6B0CDFF8F2A4CC9C12F34672C23F38 berlin16
458,262,938 *2E8ABBC88C0119EE04257828A9C5DB114A695714 9QWERTYPOLO
458,262,939 *2E816E0B30DE4BBA7E2F651265A1D420CA27DA82 berniecauthron
458,262,940 *2E88A3BE3AC47CFB002D5E5523756A6B463ACB1C kennethurlanza
458,262,941 *2E835F04E2D3D962B212F6AFBB3CDC327A40FC0B KENROYANDERSON
458,262,942 *2E80F93A92FE9209F7437E54882A72DF524E25B3 9TERRAZZOVLOERS
458,262,943 *2E8768143B0FE0EFF298B4E863B56C562F3A8E76 KERNEL 'K/[@]/RN/-/L
458,262,944 *2E83933FB815EEE0207F0475ECEA0812DB5506C5 [email protected]
458,262,945 *2E85D84D9DADDF96741DA213664684930D85C502 CLINCHER
458,262,946 *2E8DEFC2F569BDDF192AD359A624F8FA06E48C44 BEW
458,262,947 *2E8CA0C12B322A06F69E5F29DA0C7DCD63607962 bg2n6
458,262,948 *2E8DD6DD29685900031AD08D35D713544F77F070 CNAĦ
458,262,949 *2E8B02CFD9E10AFB0E0E9CF6AD2F139337704C1A kingsides
458,262,950 *2E8FE3BA132312AC0224FD397209944611216CE7 A1?
458,262,951 *2E891D597A77715DC70D4E888EBC4B892910850C A1K"R
458,262,952 *2E838BBD5599455C9D2E0BDEE865BC55110D71E4 COLBYMAUTNER
458,262,953 *2E83715D8D48B2BC44BEC97F4487D97A2E39F6A7 BIGGISH
458,262,954 *2E8B0797D1DAB7919088C85DA9B9FAFA8E4EE6CA a41bh
458,262,955 *2E8171FD8A2354B1BD539A8BBEE72F726CF997EC a?6ie
458,262,956 *2E893FA0DD554D199FAF89C9C73E373E17C32037 BJ#)B
458,262,957 *2E8237101CDA6E3604A3FD93E91D19E40EC68325 continences?
458,262,958 *2E8A11EBC5F6668069EB53A5E789AD81E1954825 BKKM
458,262,959 *2E8ED61C0EE3A0568D39E5F8941071DE1C2A93F7 AABM5X
458,262,960 *2E82F6580DD4986062BB75FC815400BDF9FFF633 KYNTTAING
458,262,961 *2E864A3C2EB3824B51466A2EE8C72F174CC3B61E CORREGATE
458,262,962 *2E8CFAECAAFD47327C811ABA9B708EA3FB22AEAD laisvalaikį
458,262,963 *2E8004CEED496202E7E752129C296C8CEC3C1E20 B,M#?
458,262,964 *2E8D9E7D8DE7F4CED588A1761AA16FCBA8EEEDFB AAXCH
458,262,965 *2E8E51AEC253039F14263DC0504E043E177E8161 LANEHETCHER
458,262,966 *2E8B6542AEBD2F3CFC61CFBF06136BDB7119E67E LARRILE4
458,262,967 *2E8E41EE65E0EAB2FA6E57B2D01E0FA55E19549A LAZAROBANFILL
458,262,968 *2E84DA4CF39FF088CFA9BB62C38E8BA21D4B0E44 LEAGUESNOBODYSHEAR
458,262,969 *2E87B3F0829D312459A56BFAEA55079999DDD4C0 LECALVEZES
458,262,970 *2E87F7C017C128FC074BC9E06788B305369BE47B LEIGH.MINALGA
458,262,971 *2E8686797011E4070975D341E43DB96600C0FE79 BOEKEGEK
458,262,972 *2E86ED44B92312DE934014F276D6318F786846E9 abet.delos.reyes
458,262,973 *2E89562901414F505D3C4EF27C19997082B96679 lesfillesdurock'nroll
458,262,974 *2E8A4DE43785602402B31600110C082BECB2A3D4 C#Q
458,262,975 *2E8606A935B74DAD1BED94713C967BD7BE2226D9 [email protected]
458,262,976 *2E833786D179F8DF7417BC76DCEF170D130D68C3 LHADYNASHN
458,262,977 *2E86AFFAC838FBC26E84A5E939797D4D9406A9C6 B(QD
458,262,978 *2E843B75799548D3D05053A574DA422811B56B5A ACTIONMICROPROSES
458,262,979 *2E8250A9F1D73E581EF932BE1F7FA63573788D0B actuarilied
458,262,980 *2E86C37CC2DCA94B3F2EBB33418F67F9BF9D1F2C ADDCOM
458,262,981 *2E801BE5B28020B0B1328B6DAC31F1B2A4565332 LITOBOZ8
458,262,982 *2E847D1959849E689AC7B7DC66FF420237DF6EFC CRAZE THIS TOWN
458,262,983 *2E854DE96C9AA72E5EF9023CECB0C02FF8536149 [email protected]
458,262,984 *2E85C2629962477008D818BCFB71B966C28CDE66 adnlc
458,262,985 *2E8AEBA5A862C34E7F0CE027A1CC395F678E5DE4 BRENDON.BOLSTAD
458,262,986 *2E8948FCA1DCC61118F721ADF895BEBA45B7DE19 [email protected]
458,262,987 *2E8CCA34A1B51A9C84D94622084DF98B10EC0977 C+RT
458,262,988 *2E84E60263707DC48E18B72E47654C0BDED8C631 [email protected]
458,262,989 *2E8EEAC427F52E1B322AE1DB7B6557EF81BFACAB bricenordmann
458,262,990 *2E8E23AFF67E3396E31BE707A0D698548BB1C2BB ag2tq
458,262,991 *2E8DE2D9C44FAA8DDD62CDEFB8EDBC3A64A05B3D CTOSADO
458,262,992 *2E8D6085C364FBE913F8735940CB2F4A0FE3827C BR#.K
458,262,993 *2E83601E5BE29C5E7DECF342180931748AA519A5 CUP7"
458,262,994 *2E86243AAB16611E78E35C5E060C8EBBCF9D5173 ahznl
458,262,995 *2E86F25F91E187CD2BC040C588C90999A2D7F7B8 c/vaaa
458,262,996 *2E860AA3A989F76FAEB329364916C2FE975A7B9F LTNOWIKIGTUNBLOCKYOU
458,262,997 *2E87F0CEECCB563961D3C1D76C28EFDE1A258FBD AJIVAS123
458,262,998 *2E81F2233B9884205A2983AE2F53CDD3794344FC a&jmb
458,262,999 *2E8F1A514C05E6458C162D801F527CC20FC558B9 LUCIO.NOLAN
458,263,000 *2E814AF5FD4EA571AF0DF7C708135D863097ACF2 c!wg6
458,263,001 *2E82678CFD750FE46529926BB758F67FD0571866 C-WPT
458,263,002 *2E8E08DA1159E864FD26CE0548B4D2DA99E557E6 AKvd
458,263,003 *2E8964676A95505E121B3CD652FE0E3F1DE11223 CYRUSFOLKER
458,263,004 *2E845E34EA50B4E724D4417F8228C91F7C7A8224 ALANCIOTTA
458,263,005 *2E8B6541D27642D14C94BABA52196CFFAC4F94AC ALANICNE
458,263,006 *2E8054A960A158472AFE7813F6F2CD477E39E3F8 albertkroner
458,263,007 *2E8837AFFC66E37B0DEBA5AB142B6D720D2B3AE7 CZK"F
458,263,008 *2E81B3054826B97180CBC1B34572DC27A57CF04D ALBUCA2
458,263,009 *2E88E63E5030D0C6EA572CB94542EAD4259DDDDB m31an5t5
458,263,010 *2E8357DC7EB75EBDE349A628210345D732949549 D36,V
458,263,011 *2E8BDFB0A3CDA57879C088C0EA3CB0B1C5968997 [email protected]$CUL1N1Z3
458,263,012 *2E86142A67D29124D2D1E360F4C84558660E5544 ALI.SUNDAY
458,263,013 *2E8244E43ACB0B95E23D6B6C651C39BFE6B27156 d5en++1n9
458,263,014 *2E8FAD8D31308B0ED059023773B9C968F4B24685 ALLERIEZ8
458,263,015 *2E89E50766FD24C25C6D5571F1BEA899CCBCB277 MALIK.HOWIE
458,263,016 *2E8793529129E9FFEE503295BB513A898D4307DD ALLPROC7
458,263,017 *2E8C3FC6EF6D30007AE642ECF48446DF2E5C3969 alluderinga
458,263,018 *2E8F395A5B11103A3FC188354B550197B10B198B MANGAVOL
458,263,019 *2E8FAF052436EBD6E5D15F1391AB97A9D77D6909 [email protected]
458,263,020 *2E8586427E29848AF4FC86F261AF92142C378C33 ALTAJIENS
458,263,021 *2E8EF90CAF696E8456FBEECE38611E111C198863 [email protected]
458,263,022 *2E8F35268C9893B01D2607E26C6D95FE82E334CA byronpennell
458,263,023 *2E86BEEBAE470A0882AA996FEB0656EEAFC89184 BYRONRAHN
458,263,024 *2E83BBB0B26D4CE445833871773BDEC56F993BB1 bytharia
458,263,025 *2E80831BA1E5759FE0781F004CAF38E4345DDABE C,0LE
458,263,026 *2E8B003BAF8ED97B4679BDF5E6327CD69F0FCBBD MARCUS.GALLEGOZ
458,263,027 *2E83501727C836EFB8EE9C67F6CFC03A1469AFDF damonshareef
458,263,028 *2E8F7408BD165961BF57AA4EF0880EAC33B97FAF DANCONKEY
458,263,029 *2E89F5FF61F60D7DA25E3B4FD56CA3ABCC17C2BD DANE.CHADDLESONE
458,263,030 *2E81919F4B188D37AC8EBD5A389FBCEECF039FFB AMBNW
458,263,031 *2E8659D4D79D01BD05E125AA4DA7D32656F2A36D AMeV
458,263,032 *2E88765F79B7E5AAA280CC2973A8012E7DEC8D6E c)2ni
458,263,033 *2E8D7012E91F6CAFD79499B8DDFFD87E25A9EAE1 [email protected]
458,263,034 *2E84EEC2C8B65C406AF686B7E5E556C4418C38BF ANCANDLE
458,263,035 *2E84372B8D3531041F7B0C97ABCF65915C5BEF34 [email protected]
458,263,036 *2E8E134EFB7E2B6A1590E7CC038BCDCE46C5907E AN.D
458,263,037 *2E8620A4827D9B28F8F773128F32A3CDCFCE8FBF MARSHALLFRIEND
458,263,038 *2E81DFF0ECF4D7CA9DABBABBF47DEDA90F48CA98 [email protected]
458,263,039 *2E8043E9AA5752D6BF7DF00D03BAF001A2CE7826 c6!/e
458,263,040 *2E8127584E2672EEDDC3B8159950E2A25FACAED8 da/rs
458,263,041 *2E8444F4834E65266265B7B40F0D867487D83FF8 MARTINHUMPHREYS
458,263,042 *2E8A967F425E0B1E0286D2726DE2BB2155576CE6 [email protected]
458,263,043 *2E85DDAC386BF4824D585CD9B6EB7032CBFB33F9 andrewtaintedones
458,263,044 *2E87263E1BD80EAD23AF40F48FD856AB0A0B137A MARY ANN EDUSMA
458,263,045 *2E8E9802C9CC99682B11BA0A2B3E04A2C82ED94B ANGEL.ALYSSA
458,263,046 *2E8AA6F553C3F2CCD98F01607525EC6D063B3E28 DAVISONLOIS
458,263,047 *2E80ED9740065A0E4D599E54AA60D881E65C402A DayDreaming(feat.Akon,SnoopDogg&T.I.)
458,263,048 *2E8A1E5C109F125185645FD64058B4C09C625A02 c9-_r
458,263,049 *2E8F3FF0F6C6CB0A1EA8C39E8D072914239E93D2 DCTFO
458,263,050 *2E8D6E9FDA152C259CB3764E5B007D8A76155592 AOTTC
458,263,051 *2E876CB1F79D1F34740C6309E8C6DB37D1B10953 CAMI3122684701
458,263,052 *2E8602077ACBCB67583CBEC5876892202669F227 a_pn5
458,263,053 *2E885922D2E54FEA306DB72DD5682CA6A24E3B65 MEDO.AMAL
458,263,054 *2E88888707675BB90A3CDA473544DEA9780CFFF5 APUH.
458,263,055 *2E8600AEC63A0DED4D8B38262C6EA5A28D57650C [email protected]
458,263,056 *2E8D5006D8B8496B6BC5957AA2F2BD43B15B5EA5 demarcusopteyndt
458,263,057 *2E8924A855E9366A15CE58A491C1B369AC2992C8 dem.hoez.b'.quadin
458,263,058 *2E85E249496399EE4B8F84A107FA7D80289FECD3 CARROLBODDEKER
458,263,059 *2E8BC34A05C4BDF5F5CC59F9B699116A924152AE ardently8
458,263,060 *2E86D0461031C2D2F7A57E700DB52A7DA661A827 ARIANIZES4
458,263,061 *2E87BDEE2F5199604B8B31D3EF87183EAC97A812 ARJWQ
458,263,062 *2E87BA8669093D6C1264E10A858F2A1CB3130D4E merrillgruba
458,263,063 *2E81637CD2E111A6A9FD0F43FAC5FEB4F0062605 deonmccleveland
458,263,064 *2E8CDFC99EC158AC8769EB0FE5C195127CBEC520 MERRILL.MAGOON
458,263,065 *2E8D80060E353C9851A8BD9CD2CC37666DC1EF4E [email protected]
458,263,066 *2E8A77BDAF2D7E854F1384C403B36F396A7A3083 casey.kramlich
458,263,067 *2E8DEF7DB79B73D8D0BF9A9E09335893B08C2C18 c+asm
458,263,068 *2E8EAB24837F438E092A8C3D1E33947FE4D4DF23 meteorologenkreisen
458,263,069 *2E84201850A49E33E1D37E73FE70475C5F8DEE61 [email protected]'
458,263,070 *2E8B2108C46AACF8CCB9B3153D6E6603C5883F8F cayden125
458,263,071 *2E80C8B35F66754DA8FB461ED9ACB4665A17B5F8 MICHEL.GUTSHALL
458,263,072 *2E88D1B760F93329B5F9C993E1E4D690FEAA2FDC C"BIY
458,263,073 *2E86FFADFF000A16EA2719FF7E60792E764430A7 artarzola
458,263,074 *2E86DED3D3EED7A3472D1CD906344B69D9B51CA3 D#FUN
458,263,075 *2E835D6AD504FA332380C1CF290AD545C35AF2FD DG:D-
458,263,076 *2E8C8E80C4C42FA6A8ED9940D5218853DF89A37D AS/A
458,263,077 *2E8299E292325CB89BF0A7F306DFB5683C75D1B8 ashley.angel
458,263,078 *2E87693784DCF38011686BFADFD90BB06B6424CA millionothers
458,263,079 *2E86EC89E2644FD5A7ECCB14743499B3312153FD didn't i (blow your mind this time)
458,263,080 *2E85C92CBE5C404BF7E6305D22AE5C5155DC2DB3 atlgrl55
458,263,081 *2E88E3090E11A8613C90431C7ECE0C3EE0CA8AAE MOBJACKSES
458,263,082 *2E80340E63068E21F5AAC30A951573A290236271 cfost
458,263,083 *2E822BBC05AD9F1FAD83ABC67B684718BF1B42F2 [email protected]
458,263,084 *2E83C6C4F2CE9889AE6CDA812830CC107FA08BAA DINTIMATE
458,263,085 *2E80F749BB2E554AF752E0E9FF08A5C765E4A55A C"$GR
458,263,086 *2E84664FDEA73085F13D581600D94E8E3743A618 moon-aziz
458,263,087 *2E8C5768943C9D0686F19976E5499478FBCB2FCA Dizme com quem andas dirteei quem és
458,263,088 *2E83D139100D2DDCA36A94D8A0B9FE392730D9C4 averykendig
458,263,089 *2E85B55CF9EFF8571D10C53860F5E990C9B43B97 CHAOSPAWNER
458,263,090 *2E8A79441369FAC4498E4921B8D5D8B54219CC8A charbinu9
458,263,091 *2E8F06A81F236AD78F5C3D29527F9C6FEC8EA41F CHARLIE PROPOSES
458,263,092 *2E8454A42929CA2C72364AA0DE274C81C1C2DC9F &mq
458,263,093 *2E8F38D4A5672A5B62C3B21F5AE6229D3E3820A0 ms14be11ed
458,263,094 *2E8ADAF6DFDD9DBBA4A77EBBC5A347DD6F63A207 mtpscpcl2
458,263,095 *2E801C23E4E3990C9985AFF941C6EFAA7C22FB50 muckhole3
458,263,096 *2E82A1F5ABE66DEABC68D957E3A911EEC064502C [email protected]
458,263,097 *2E89460146957142C15F82E68DD4657EE320B35C b=0in
458,263,098 *2E8FE8C3F3D0D428B4D7CE21AA220DBEF0694F94 B2VJB
458,263,099 *2E8709B4A1425178C6CF64BBA912754103829C05 Child.Without.Name
458,263,100 *2E8A0F71BEE8361DD03D704CC326DAB7C070ADD3 dominicsalas
458,263,101 *2E894E5CFC1D46BE5356D5E8E8CFB7D6E4433494 B4RFU1
458,263,102 *2E83E7879519A7F31931CCE0F7E45B9102DB3520 MYORANGES49
458,263,103 *2E8F20D653023C4171226F7639984E9615D5D6DD CHRISTOPER.REDHEAD
458,263,104 *2E80678E53B53406BDDA759CB5254737658CFFE0 [email protected][email protected]$
458,263,105 *2E8B89E4759B748158C53BF834133419DED6D355 N!99ARDL!N355
458,263,106 *2E84F49408FDAE05CB3B1D45FB39AB481FB3E7F7 [email protected]
458,263,107 *2E8C7AA98E720B163EE69DE59EF4461B8AD09F44 NARISTOE
458,263,108 *2E89519DA564280259D86B9CE091708FECB8C06C BADROL.HISHAM
458,263,109 *2E85F727E9E130DF9A6B44E0224B0C721D463284 CI.TE
458,263,110 *2E8068DB74DF6226DD49DADA9890B59A23671C6A baldigen6
458,263,111 *2E848515308A87147D5355585BF2BA560E543F76 BALSZÁRNY
458,263,112 *2E8F097ADF60BE0DA4216D49BBF3D1BA6C748B68 BALVR
458,263,113 *2E8CFB84595AB0D6A6C1E15789943266C4AF2F68 doppelter-korn-polka-(instr.)
458,263,114 *2E8D3AB602607D9AD2A4DBE77E519E5C8A7B0D38 ck=jf
458,263,115 *2E8497B3305B9C39E5E6D58CF9F78D8EE4632CD0 douglasfangmann
458,263,116 *2E84C911C36AB4E4D81933565F836FC64CD571A6 c-l2_
458,263,117 *2E8FFBEDBF480F4A0D7DA3E5215F167BB71A10A6 NED.BRUMLEY
458,263,118 *2E8F7E0E901D822EA9666977282100DC2816EB3B neenakuttath
458,263,119 *2E8822F421652FA687F3407A3ADD55E1C125FC6C claytonfaler
458,263,120 *2E8D52CABEA97FE4D671154CC24526A921CF30EA d-_pt
458,263,121 *2E8C2DE286AEA043E57E4F91D76ECFE544699FBD [email protected]
458,263,122 *2E83DE3992A9AB5A7D1F453F613293EDBC995EED D?r-
458,263,123 *2E8C49D757CB4D96DBFCC247A9060344F8351248 CLIFTONKASEY
458,263,124 *2E8DAC5DA6C7519D682C2C9B232E5F5ACA3CCCE4 CLINCHER
458,263,125 *2E8DD34C123CCC8F1B37A3897A796DB9CAC8A151 DREWURMAN
458,263,126 *2E84ECFE4FAE8EAB045B7102A085833C24F9D9C7 CLM:!
458,263,127 *2E8944F4A1A4C7BBBDF20044A5292F5870DCA59B nicolasrenova
458,263,128 *2E81A1E239777E80AB43FE79480CC57EDAF0BBF3 nicolasrenzi
458,263,129 *2E8164F5A47994CFCD218BAC8B8EBA66EEDAE6CF C,M8H
458,263,130 *2E88DE7FA76618E4CC8473986E1CF1E88CAF1C01 CMNVR
458,263,131 *2E89C8171897D00F4FD2E1C39652FED2D383C90F nncgntly9
458,263,132 *2E8D40A21DDF332A228AD3E1933AD87CF53EC7B9 CODYMARKSON
458,263,133 *2E845716C427ECE3AB8655296692692FD6142818 bejaards2
458,263,134 *2E8C6F6CAEEFDE5B3770E6011A1D3E0754E4022F COLDNESS
458,263,135 *2E8F574FF42B72B066B10F86386DA8DCB90E4D1E colepitts
458,263,136 *2E8E1BB425EC6C94CC31EC3CFDE1CACFD6379AF7 colincarlsen
458,263,137 *2E8F96B6596F3040119B07F40E3589177A74886A college kids forever
458,263,138 *2E8E3C0022534490B7DFA071FBA3A89C4005E439 bennettpozo
458,263,139 *2E8F70303C68163B6EA15353D5E12DFEB5207789 NOSSUAC3
458,263,140 *2E84BFF49953AA132B96F8397465FE115A0E8579 coloveyro
458,263,141 *2E8470ECCC79CAD31181500B08A792037BADEF54 NSC99
458,263,142 *2E88958B7EFC021C2C5BFD2D26E14033D23F4F55 nsfl
458,263,143 *2E8B8654AF051D49979F3C4A1FACD535C9D2E4F3 dwewo
458,263,144 *2E8859551E7ADC5A987F9D85AC1568CD09A66183 [email protected]!sm
458,263,145 *2E8C6F8E1EF1AB1986F433EAC0C765DBBCCDF908 CONTEMPLATE.REGICIDE
458,263,146 *2E8622E66D6F142F3D5868934DF45796C5C18684 cordag3-t
458,263,147 *2E870F665663BC1D7C8497747C81D01D4DD7D954 Cordag3t
458,263,148 *2E845192BCB973316F868824D3147E5994F40819 OETOY
458,263,149 *2E81A54611392BDBB2E05D96C4B6835321C11AC0 OKSELSTUKKEN.
458,263,150 *2E88E19AECC53B80C88F7832677A78AF731BD2E8 [email protected]
458,263,151 *2E84AE6B6CB3546BA3352565EA673EB14ECA48BC „COUNSELING
458,263,152 *2E8DEDDF5A7D9C4D3264CD0253C8B5CA70458696 bicze
458,263,153 *2E89D61E1FE5D574D769D69D05DF58005C1FD111 biflowe2
458,263,154 *2E823F2E139AC35E6C06FFF3EE03C8C872E3C4F2 EDDIE.BEDENBAUGH
458,263,155 *2E8E8A860BFBA0259F94FE3578E274E4313D08BD bikal.sunshine
458,263,156 *2E8A5979890ECA7DDC921F46D6C87FB0B3C9C529 BILL.ZEARFOSS
458,263,157 *2E89177891A775967634BF0339E6229B07266712 C:\Program Files\CodeBlocks\share\CodeBlocks\templates\wizard\lf\files\structured\maincpp
458,263,158 *2E84C42D3A6BE94ED00082B18D645DE73F3E5B36 c:\program files\common files\adobe\help\ro_ro\extensionmanager\20\images
458,263,159 *2E83F84FD4EEDED372EF27FAF61E8573A9C1DEB5 [email protected]@1
458,263,160 *2E85441566899E9EA0C3AB1DF5D246CC01C65CE9 E-EPSILON
458,263,161 *2E83FC9E2636318A80B20769C56028EA1509D6F6 BLAINE.JENTZEN
458,263,162 *2E84D240757852A4C7A75219D9E7DD1DD9EAD2B6 orvillekolm
458,263,163 *2E8250274F9A99227AE247AF2DCF53F70D84A7A0 BLAKE.KUBITZ
458,263,164 *2E80FFCCFDE9C38E7B6980D1256CD7332142317F BLAUUNDWEISS(AKUSTIK)
458,263,165 *2E898CA11083E9728287B2941704917142250230 paflagonia
458,263,166 *2E8294E2E0999E93C9FBDA784D3486D9012FB000 C&#Q
458,263,167 *2E83FBA39E46ED4C7D3A99A94DBB2D3A63327CB0 C&QL/
458,263,168 *2E8CC121E9983745A68D9B3B22574A285A0E7ED0 B(LU
458,263,169 *2E8105AB615C9557252A0525ED50962D4049307B CR3DITOU
458,263,170 *2E8811219DC4DA33F7DE8DF9CE3305FF4C854F78 PATRICE AKINS
458,263,171 *2E855404FB8911A9F067EDD05B566C99CFBEE0A5 CRAGSMEN
458,263,172 *2E8B21A559285889B352C78C54B2D74063986D3C EIBE:
458,263,173 *2E8D3E35431E346363687B2F6834F16D1580E218 PATRICK HIBLER
458,263,174 *2E841422B81482B755EDD83CFBBF831A5F348C39 PAULA.ROSENBERG
458,263,175 *2E87327422BA4A06152FEB5F3268A7D11BB65F29 EIRESDLI
458,263,176 *2E881685933E8D63A0265CAAF7D777AABE8B5227 C:RI"
458,263,177 *2E817FCB294860E9FE41F93C771C5B4AB4D71D56 BNG-9
458,263,178 *2E8FEBA4A7371F9246286168A910D54F9E32D70F PEAT_SPADE P/I/T_SP/EI/D
458,263,179 *2E88F02C442B6892B1A57B0D804D08750E309B03 BOBO1986811
458,263,180 *2E8FB54A7CA39DB9E24709C8AD1205E6EE60A190 [email protected]
458,263,181 *2E8AE03998CA765F03546EBA9B4B0A71B0CBD4E2 CTE(U
458,263,182 *2E8B22A1DAA4341439BA2971A779F909D8E02AFF boowahboowah
458,263,183 *2E86BC0A8143A0B02A5F6D31C789ADCC30536225 cwf;s
458,263,184 *2E82E804AB287766C53F597013D76DDC3B796F9D BPFQ#
458,263,185 *2E8AED9A4DDA6EBDD0AFDC06A97199C45353CC0A ENETALP6
458,263,186 *2E894D2C49BAE3AE24C8BACAB12FCACE10CB7A89 PIERREPRIMER
458,263,187 *2E863ABB7D92C2189115EA6EB6ABCE857D18B8C8 cytowanym1
458,263,188 *2E8C60DB10A887865F4DC8A62C47BF45964D4B5C ENRIQUEANGERS
458,263,189 *2E8A4E98AB3463FC8E219F9D59374E00C8F192DD d027eb0ee23c9fcaa2b9ce4f221c5a77saturn
458,263,190 *2E829B06F334564F321685C7ABA36718F3DCEF0B PISSOFF(I'VEPAID)
458,263,191 *2E87D0BDE6FC3734F88EE9816EA7AE2549FE350C BRESINSKY4
458,263,192 *2E863DDB2096BC6D8EE2F39790D922A319F63922 eov1w
458,263,193 *2E8E740B783F750787BB7EF6B168FAAFD6B82B7E epouvanterent7
458,263,194 *2E8C8F37E30D79720DE6858D781FB298C6EBE995 POMENEAM
458,263,195 *2E83347E337A7B242A84F93CB1AC0E77F1B65FFF PORISMOY7
458,263,196 *2E822648843D3D2A5D1830E1AA11DCB99E154BB2 [email protected]
458,263,197 *2E8D0B26FC87E79084E22F740293253FA50A419F BRYONWOIWODE
458,263,198 *2E8E165BE1A5DF60D1A525C2A45DCD2C3EB916F0 p###p~O.~o)8(
458,263,199 *2E8BC350CD3E3AE468F67B440EC9496FC5F0E748 daledenes
458,263,200 *2E8C943F7B4682DFAB4F91BC7C8EB1250379D6F8 P====P.~.~.~.SPLAT!!
458,263,201 *2E8CA1A0669E167EC937BDB039B5BCAB86242716 PR0B4BLT35
458,263,202 *2E810CAE9C51BCA06FF838AC6421E05C479A6FFC ES#JI
458,263,203 *2E8969FB468CE9AD7BD97C9E70F4748385B1A0FA Preludes Op 28: No 22 in G minor, Molto agitato
458,263,204 *2E8E9796814B46102452127F66E413773B0C0721 bta
458,263,205 *2E86D3367192FC4105CE990B6AE5A968864793BF DANIEL-REVILLA
458,263,206 *2E871491102CFF280A53D915440536064959D030 ETEJADA732
458,263,207 *2E8F4678105BC5C38E81932C761AA0E89FE80F26 etsesolf6
458,263,208 *2E8C661A223C84372C3FAF4C5C9A40A3179F0D2E ETY+
458,263,209 *2E8120C91552C02A51C57E2EBDC64C1E092EA299 PRPULTIS
458,263,210 *2E81555481AD6BA5624566D41C02403A0058D57B [email protected]
458,263,211 *2E8CB09B02FFC31D1D554E7D21141E554DA1D293 bvd)o
458,263,212 *2E80CA1529BC4E45B78CF4B97C7B12FE08CC3360 PULVERTURM-2.0-(SPACEKID'S-RESPECT-&-HONOR-REWORK)
458,263,213 *2E863E14991CE3102A58B2ABD167941DD32E60B6 bwuaj
458,263,214 *2E8B9BA9AF4E53E8D45138F4C8FA9158E7704A15 PVAIDHYAR
458,263,215 *2E83A29F5BA429C12EC2C06017AE50AFF0144132 DBFGK
458,263,216 *2E8D6071451CFE31A9D07B717E54BC72EC601374 C0B)
458,263,217 *2E8B5D8398607AABC92F257178B6CC064EF61B73 c0ng10m3r473s
458,263,218 *2E8442E9F2D19F6F10E316853277E053B248FF53 F6WR
458,263,219 *2E84B6B59C0B9C1DDAAE7FF8CA0517D96A9286F2 FAL
458,263,220 *2E8D3769888F390E878FDE79A871F904B179BBF9 C561
458,263,221 *2E87510D3187E5EB378E6B07F36F4DDA0839E101 fbk
458,263,222 *2E8318F63625CDEC037725EA459FAFC999640BD5 caden190
458,263,223 *2E8314819008A7C9398D0ECB236AD451439E3353 R{A
458,263,224 *2E8243C8779D14BEE3AAC46865274C913FBFEEF7 RABAUKENDISKO1
458,263,225 *2E829E3BC797C0D533E0874AC139F30FCA96CC5D RADULANING
458,263,226 *2E861607D41F91F8A8D7B68CB4BA336AF83EF5DA RAJIV VADVAE
458,263,227 *2E8FD82E7734EC85EE2EB1EDB0BF33FBA081725A c:a+q
458,263,228 *2E8CB0B7F27E6603345D5A06BCE5C4BD0BFF0FDE DEPMD
458,263,229 *2E8D8F2B9F558F2E8965BC6591BC267DDB42B000 CARLO.SEBERS
458,263,230 *2E84F7AE3AB5D2CBB84C04D295117554456638C4 CARLOS.MANGRICH
458,263,231 *2E81B048187807E15346346A079DA6B084EE7948 CARLTON.JAUHAR
458,263,232 *2E8EFD1FA9156DB786E013385B14ECC24BAFD009 deshawncheever
458,263,233 *2E8B84C5342191FB70D774F2720998796891A465 caroline.pogue
458,263,234 *2E83E8F640ADFC562BD0E896BDEDCD5F44F394DC despej
458,263,235 *2E87F8D9C2D2BDB949CEB28952C53B69359974C7 [email protected]
458,263,236 *2E8CC6C36A6A9637DAF211AC1418BA25BD3974E9 RASE
458,263,237 *2E84D02ACAD79ED574F462E1A713411845767035 de=tu
458,263,238 *2E84A989583BDDC28BBE7B050A0FB27CC7DD1E1F CARY.IRIZARY
458,263,239 *2E8EA30AB00B1B46417ACCCDB1B402F745B7E96B CASEYMUSINSKI
458,263,240 *2E8490F5CC19CA7F999C79C1895B6B40CEC23187 foredlin0
458,263,241 *2E8341BD7D9E58F7C26960633C39D09695B9AB05 catfishlennon
458,263,242 *2E80B4C46C954B467FFB3DD1391CA0892D5B368B DFk0
458,263,243 *2E8DC534CCC7DF1443B2F84BC28A38C4901319A3 CB2WC
458,263,244 *2E8E24AD3873E4030B3A33C40113EF97297EB6A0 frank.alford
458,263,245 *2E81D0DD9CF64EC391BC0FC028B51202FBECC491 d#hkf
458,263,246 *2E81857B7B2D23BC7655BD4BD58093AF95610385 fred-Carson
458,263,247 *2E884F4702B24E990993DFE7932A567102FF1262 REMEDIATION7
458,263,248 *2E8ABE08771B248DB83D1838599E10746C5CFC1D [email protected]
458,263,249 *2E862A2B4A214FFE319D66CDADF52418AAFF25B4 re!nstallat!on
458,263,250 *2E8BCF2DDAFFD44683BDFD7BC53F4E0AF7CDE19E ceji
458,263,251 *2E892A50F74FA67EA622E0BA70BA86B9D6FC85BF REPUBLICANN
458,263,252 *2E823DBD1F6395F9314CA56B527939CF0F572D06 reroccus4
458,263,253 *2E8665F113B2048DE543DD0AEA67C1A8DD15D73A diruasoh3
458,263,254 *2E80D2D7347AAE3C3261D80A71E8725BD2926851 cfhkx
458,263,255 *2E8A3B9DE3745274D44A352D983D16DE31E6F236 funindigo5
458,263,256 *2E87E60569ECCBB830175819BF34E969736E4BFC »chancengerechtigkeit«
458,263,257 *2E8DA15D2F82197EE1B8CA9407FDE21B57DC1F2E [email protected]
458,263,258 *2E8557AFDD64AD29A89587D181DB1254BC805441 CHARLENE MACMILLAN
458,263,259 *2E84DBFC277B2E8AF6E82A4FE02095681660105D dkgnq
458,263,260 *2E800D37DB8B40808BF79776E1995CFE25E25B71 RHEINYUDAYS
458,263,261 *2E8C5AFE41A12783014C85A6DBBDE317F97C0832 CHESTERMANUSYANTS
458,263,262 *2E808B578D19CC1772850E80B99B5A2B64455700 DM$"0
458,263,263 *2E8FA99D1BDD24C34EC1D0658C581AA8D45748F8 garrett.schulz
458,263,264 *2E8CC0BD1D5B4319FED065D29088D7FE0EB60F7B GARTHSIDDON
458,263,265 *2E812336F6993C8DEB230105561B72AF02381FE9 CHINESESINOVIETNAME
458,263,266 *2E806BCAD55DBF56EAFD5DB6CA944F059E43DE1A GARY.SMIHT
458,263,267 *2E85A799CEB3D63189DB6BA4866939B311700E23 d%mwa
458,263,268 *2E88F389CC37B08C4F58E5446B21331CB01E3F9C richiedolphin
458,263,269 *2E8EA04F5DC023263A4CB1068D946BE8FF7E7651 CHIVILLO7
458,263,270 *2E8F5BA2EA635AA2DCFAC8A4B5A392A3E216D061 RICKY-LENOIR
458,263,271 *2E8F4E57A19F668768B2805ABF3219AF51D42B00 RIDWARING
458,263,272 *2E8AF3B90D9F5054EC68C4449993C7231AB25015 CHONGKREPP
458,263,273 *2E8F698F3A9A6163EEBA1C566192CB38CA9EDAE4 CHRIS-MISNER
458,263,274 *2E8C3E6F5310A12677ED655C262017A634C2168B christina-rourke
458,263,275 *2E840A2A712A7CE1194FC50392265A2D720C839E [email protected]
458,263,276 *2E8A1EFD30A911A1EDFF618BD6A964EBB431F124 chuliganu9
458,263,277 *2E82B47633F61436F5DA9FB0CC869AD6BE08D89E chunder-thighs
458,263,278 *2E88ED451D4E9B3E3412284B2E56F57AA4C8A8A4 Don't-Be-So-Mean-to-Baby-('Cause-Baby's-So-Good-to-You)
458,263,279 *2E8CF26BABF0EACB672EC8CBFAAC63797FE4A9C6 geoffreygulbransen
458,263,280 *2E8F699E7BF43AAF55AB698AA89D3AD965BC4E6F dorianfritzgerald
458,263,281 *2E8F072C581BC03528B237EAEB0E03C9426B67AE CIRCLES(JUSTMYGOODTIME)(SPANDEXMIX)
458,263,282 *2E8B1FF107A85DCE4C78119D15E2EB9F328EE582 c;jc8
458,263,283 *2E8A136DD5EB5B68930FAACFCA6A6347C3F7AF89 robinsonr.musumarra
458,263,284 *2E80F40170ED77D84153295452800E49F8E081ED [email protected]
458,263,285 *2E85CDC1531552AAF617DBE8424CC330987FC0A4 C/K/_
458,263,286 *2E821AF37E543882CE4D0E0D148F9D60FEBAAD88 DPE19
458,263,287 *2E8A73A69A9C28D9ED1A75B29746C089592F50B2 DQ"'
458,263,288 *2E89F0360DEA43A8947A320307B88E0BBFBD9247 rodrigorauls
458,263,289 *2E88DBFF364FB780780467B577B5FC2B355EBB52 rogeliorobirds
458,263,290 *2E80364C8C46590E2182ECFD1ADAB21A7F33AB76 D=QJ+
458,263,291 *2E8E26D7CAAA93F90A95AEC9BEF9CE9A1F8BCDEF claudioleedom
458,263,292 *2E8BEA04EC02926177C8465396BE3796FC2DB3EF ROSEALYSSA7
458,263,293 *2E838766432A4C1B18D19433FE56A63ACBFE3EE8 d)s%k
458,263,294 *2E8A75299850FA11F63235C990FB39BA5C247DA6 CLh2
458,263,295 *2E8B7D4AE139C34B38FD6395BC53698963CEA2D5 CLIFTON.SONES
458,263,296 *2E84CE4B65E617D0BF647DDEA5F908DFD1CC5B17 GERONTIES5
458,263,297 *2E86BED3AB1D71204EC1F330FBB5545E7B63218B [email protected]
458,263,298 *2E8CD6D763E90697C28CEB70F111109DC7123E22 DUANE.RAX
458,263,299 *2E806727366C426ABF549D42E8EC94FA7B6ADCFB rsf}
458,263,300 *2E8E2075E136A20217BFE17A4FFB31B3DBFFB97C giavanna92804
458,263,301 *2E8AAAE00E759F1C9315F0E5DA8EEE8CA0809511 GILLY1965
458,263,302 *2E8B3C3E8AE386AD07C20BB32B166E357191B01F cm"\
458,263,303 *2E86601788AB8A27072F53F9E334A5B7A0E27D33 CNJ778
458,263,304 *2E8586AC15A5A7924024B35107DD0869B0E95C92 COC-"
458,263,305 *2E82DFA46B9BF6B629E872CC495D0A67E1024F1C [email protected]
458,263,306 *2E8075EA61FBF8D45EE5C54101C3136C1A733E49 dy%?
458,263,307 *2E8CCAF0AAFC72A5A486641DB68C81DB40E954E5 EARLE.KIMLER
458,263,308 *2E881D32045F30901500BFB832A4ECD3B7AA7529 EARNEST.BYNON
458,263,309 *2E887C2E0B1D1E927455432D3BF625EC420C700B eb/cb
458,263,310 *2E845CDA4D3EF8797162B42263216B31602C88A8 EBLIJKX23
458,263,311 *2E810C5B2E80682D3671495DE31042B70FDC7282 CODEENTRY2
458,263,312 *2E8FBB4E4D2F57F19CA66F9DA5D41A3FEF6C9D15 godi-snorri
458,263,313 *2E803136DB8DC0029BE76C593633BE1F65D9CEB8 SAMANTHA.JANE.SULLIVAN
458,263,314 *2E844DE43CD9107450111FCFAF3A458FFC9072F0 Going.Deeper
458,263,315 *2E8B681C70D04ED9299CE26C2B233E4219BD3A51 [email protected]
458,263,316 *2E8FC1AF5AEDB07D184E82465B89AB18E487AD2F colbyezzelle
458,263,317 *2E8CF9FB62D636688B9E101460933E06EC0D1420 [email protected]
458,263,318 *2E8074988ECE75E76646B03F60CB5901D0008526 edkwamen0
458,263,319 *2E869624EBF0D879CC1EB3CC9FDBD66447894443 GOOD_BEHAVIOR-G/U/D_B/I/'H/EI/V/J//@/R
458,263,320 *2E888FD5A946C657456A1B03E9834709200A5C65 SAMOHTEIBOOD
458,263,321 *2E8D3674B84B4222D3EB3F40381B11CD25E805BE EDMUNDOGAZAILLE
458,263,322 *2E87855FF67F4F3A11191BBDFD14BED859BDFCDC COMBAT12
458,263,323 *2E80F835F211A5BA10FA02CFA8D4AFBE4BCB9A4E EFREN.FURUYA
458,263,324 *2E858A0A04018BBAFA090F16D47E0FE94B96D539 egewrevl9
458,263,325 *2E80125BDCCAEF1D9C6922E61F694877FF9C4186 egmn(
458,263,326 *2E8891C85768C3F8AA53DD1FD014DE57E195C10D ELk3
458,263,327 *2E8210C5861573D004EE7BF0351FF8FE76BA8B6A ELLSWORTH.SERINI
458,263,328 *2E8BFE7BD6BB3BA2987691E102AB4BA1D4AEF479 SARA CERECEDES
458,263,329 *2E8001D81B44E1C20904F25B4865A3CD1AF20CFD [email protected]!V3S
458,263,330 *2E855236F6E321F61D8E7AF2D2A50EFFB31DBC90 CONSIDERABLY0
458,263,331 *2E888E0F74A68700DB4D5F696E6CA32DF1408233 elubu
458,263,332 *2E8B1C465FC34D8A41E1D47918156DC20C92A1EF saulptak
458,263,333 *2E816158B165EBECF36A351491FB06DAEC5D655A [email protected]
458,263,334 *2E8FDA65395EF54BE18125EFB4F0F7A2C8921E9C COREY.BOLDA
458,263,335 *2E8665503907007C6762AA8F43E7CAF35B8C973A [email protected]
458,263,336 *2E8BB9EB6D65ED86724B0220264CE91460B5B39E griffonnerait8
458,263,337 *2E8C239268D82B8B5E60101BEA9B0A1C0AD24A8F EMMANUEL.MCCRYSTAL
458,263,338 *2E873A60E0F8F2E6F2AABC251E54613B820B1498 CORRLS
458,263,339 *2E876BFAC5807EB836C32DCE4EF8E5E603B60B80 EMMETT.SIDDIQ
458,263,340 *2E854960753A9149F270AE96E6970C4D17C72DDB CORYLEON
458,263,341 *2E891812D7DAEDF7F886834615EF9FD88C4A57BE cottonwool-like
458,263,342 *2E8BAE88E8B7CDF1D695DAFDDF43A28C316D40EE scottiegulyas
458,263,343 *2E8A1FE1BE401B38A98A094E4856D8EE9CABCA52 screenngs
458,263,344 *2E8FA80BD7C6A2BB3B1258115F3D58CFD2C2DF4F SEBASTIAN.DIENST
458,263,345 *2E8380FAA60612536ACDEAB76E73E65ACAC21916 C#Q
458,263,346 *2E825B885FD0805A55D83F46331872502F0FE13F cq0t2
458,263,347 *2E8277948CD349A74DC9B741135779CF61AF3E85 ÉPIMÉRASE
458,263,348 *2E81EA358DBE8F23D68E8DE811076ED95D63425B CQQQX
458,263,349 *2E8A2CF72C672D61893B9DBB7FD099EE314C2269 [email protected]
458,263,350 *2E8B54C95A0F955EB448414D4DE5A55FFBAC8967 erags
458,263,351 *2E8016F1196BDA7E7F61213EE1E60091591BEF87 CRAIGSCOH
458,263,352 *2E8C42CA6C4F6E4132DC31A2DD62CB467CD199FF (CrawlX) Ahh And whats in it for you here?
458,263,353 *2E87FC76A037F1D500E8E3BA8436877350926838 ERICALIEBERMAN
458,263,354 *2E80D68A0B6663070596335067C3DF66B517CB76 creature.of.the.wood
458,263,355 *2E8E0D5223FAC955E25C37E57FAC3AEEFCB643B2 CREOOL1
458,263,356 *2E87ABBBD60A344BC4AD185F7FD0285C38968590 crisnewell
458,263,357 *2E8943C86F7164F7FC47CBA2231F401A99E1ECB7 crlic
458,263,358 *2E88573F81FC62410E7B037099BA7C9FF1C7FCB5 ERÒRE
458,263,359 *2E8F5F7E7B1DB4CF3E0F48F55953BCDF3CF91E76 er+p
458,263,360 *2E86BA3411C0D671B29221B26B05F00F330E13EF erstumme5
458,263,361 *2E8DBBD877725B3281742E8FD9370209576C0D24 ERWIESES8
458,263,362 *2E85B71153C267EAC78E982C8438C9A65F1F3B2A SEGUNDADIVISION
458,263,363 *2E86663E54F67D2C3161578A825E5A60B2A2B8BD ˈHAIƏRƏƱGLIF
458,263,364 *2E8830D951E07A82546F590D541E745C1544CABF HALFFULFILLED
458,263,365 *2E85EC03276037F8AE02348DCA0D53C70C8CF3E4 Selected.Random.Works.55
458,263,366 *2E811EE3D1BCF6329778F5F53C00069E90CCE28C HAMID REZA SAFARI
458,263,367 *2E8D7B552ECF9BBEAD2BB461281FB8F1D67F87C6 [email protected]
458,263,368 *2E8E283B350044EDBF79059916019A771A33A48A SELTENERESED
458,263,369 *2E8FFD624D696197393BC561B08C610A3F54FF32 cthb%
458,263,370 *2E819D2353A3466489FA75CAD88E5D96164A1A14 ESTUDIABA7
458,263,371 *2E895D1311FC2BF7EF971EFC44943BFE0A82290D ETAINALID2
458,263,372 *2E8197E9F5D0DC0259EC5AFB08AD240DC0196AFD SERTANUA5
458,263,373 *2E8514B35D04374D385EBE9C0CDA904565BC4C72 ETHERED!
458,263,374 *2E830027815C8DA1D97A9E76258D63F929C2A441 HARLEY.MONOZ
458,263,375 *2E8840F491AAEB2B5E5B85CFB39151B26556597F [email protected]
458,263,376 *2E86F98B7B46726239FD9769ABBC4A2D987C94F8 seymourplassman
458,263,377 *2E8CCCC2C2AAEBB418BFD7D8F6DDFE52B099BBDB seyo012085
458,263,378 *2E8067E0CB8C9A1DAA931C787B80FA0C3C563580 SHADOWSARIANE
458,263,379 *2E80F5F47C50AB77E42F0C737AF9CC1189783315 HAZILAS1
458,263,380 *2E8905338986C7245B751AB3F5714C09E4B0A284 evokidd
458,263,381 *2E8049ABF4F5D4504375E0DEE3443A89F2DD07AD CWNMY
458,263,382 *2E81CE88FC2ACC4098FADEA66DB241EB8FFF360B shechatt
458,263,383 *2E8B22C6E8C052390D35DCA8BAA87A062DEBA917 sheriffries
458,263,384 *2E8CB3D0576765BC3B164979E3F8CE8C60B37E6A [email protected]
458,263,385 *2E8B1CF0AD6E569F01249488BB3F00276FA60B42 [email protected]
458,263,386 *2E876BB2B92B58D0C67F9D3EEDC423D409E2FA6D czu_
458,263,387 *2E85E59947AC44CAE6A01BD76E75C989DD47DA88 HENRY.BREASHEARS
458,263,388 *2E8B62980A5CDC2144F9230C899D6155CFFDBF83 D105648
458,263,389 *2E8E91571A276643F1E876D87368ADD15C41BE51 HEOUWED0
458,263,390 *2E807159C38D53B981CEA6C77C6F816B4BC32A40 fadisaadi
458,263,391 *2E8C4CEBB0427D3949E4BC0F1693EDC75F6FDA61 sidhyantyarthaah
458,263,392 *2E89668A4CC5B2A2FF7C279E3AA11DC0FDDC3179 HILTONBOLDUL
458,263,393 *2E8F0E7BB253C20D7E299F8CF4E9BFEBD1A7B8CA D5HNS
458,263,394 *2E8A46594FC7ABDAEF3DA980E2CBB21522414C0D febre.de.funana
458,263,395 *2E8B83718E180DE612B949A42B2AA8E8AD9DD454 D(7/
458,263,396 *2E80EEA39D8FA48C506DED3436A57B7FAA7151A3 hockeydesign
458,263,397 *2E864CA19F04090CE9F34984261BB96F881DC8AA d9.p/
458,263,398 *2E8D9FADD56EADDE001426D849130EE9B3F3714E FIGHTS36
458,263,399 *2E8E305E765A72EA59F2EE9822269D7050FA949C da:m?
458,263,400 *2E89FABCF45D36C9204C8FF2C55A3465438B136A DA"M=
458,263,401 *2E8E5F0A009CB86A02353A30C64CF92C344B0326 snj)
458,263,402 *2E8E026CD846925748CD2FDA4E16EBBFB3F343A7 softball1923
458,263,403 *2E8309F6BABE43E0FEB99A4FC7E2883DA768BEEF fmwilson4
458,263,404 *2E831504F9C1591082851646E66DA989AD253FEA SOMETHINGSNEVERCHANGE(BASEMENTS+BROKENGLASS)
458,263,405 *2E859637E99A4D50F173E31FD383D1479B7C9C87 danteflies
458,263,406 *2E8B5D999C75CC967034475ECB2166FAFDB69427 FOD58SIV
458,263,407 *2E8BA5DFA247ACE507C1D7959B101F724C4105CA sonrabe
458,263,408 *2E8EBD2EE6F3E288BA2CE571C5A6B59C18FD0AEF FORRESTSPROAT
458,263,409 *2E88A2DA5301421EC33206208469C4891871B7D0 fosteringham
458,263,410 *2E82299BB589A6B45AE89B5067BE5C59A834B785 FOSTER.MELVE
458,263,411 *2E8AD01F50D1CAEBDF8967C085B357DE326B24E0 humilie
458,263,412 *2E8CA44F940FB01A4C3C5E4A1ADBFE0C9D286C1D iamaragorn28
458,263,413 *2E8C38C3F771388AA5CC95B948C2471D55410D84 iamvicki4
458,263,414 *2E852D984D38A536D03A51A9CB896DA5B9F3CEFF SPAWNI3
458,263,415 *2E8B5BE0B5F17E6246276BE19673E2BBE8D02FAA DARYLGILIBERTO
458,263,416 *2E85B9D0896CFB5D6ABD69361E92596A400D44D5 DARYL.GRILLO
458,263,417 *2E828CB3BDE14DEDCA634C75CC89E7E98B082E97 FRANKIE.FENTON
458,263,418 *2E8271DA19819408454947E1F53FC0ECB9F300DD das-piff!
458,263,419 *2E899FD61C5CCF60F921A0852AB76C17BC200F3E id}&
458,263,420 *2E89087FD91FF989A4D59DF2F40E2D67197D0EF4 [email protected]
458,263,421 *2E8770082BB550C9B0DF936735FAC6625515F5B6 [email protected]
458,263,422 *2E8C6D5F870B7AA4DBBFCBC55829D74309A078E7 IF YOU GOT THE MONEY HONEY I'VE GOT THE TIME
458,263,423 *2E845E0AD910D8EEC99E16E9F8555CB5A10B8EFC [email protected]
458,263,424 *2E850915FCDD04BC5AE8530EFE8ECB26077BC951 frngs
458,263,425 *2E89E75EB6C10AF59A5522FBABA316E49034A476 DB-AUTOBIO
458,263,426 *2E89BD86BA30E6AD1C2157C55C081E89801A4070 FSW20
458,263,427 *2E839F02DA3AA96AFB7095612F59F71B1530B80A iloveoxford32
458,263,428 *2E8E3C866C3F0339005FE89AD278BE7CC73A3702 ILUVSTUDIO22
458,263,429 *2E8B710C75C488DBF638B1E25E3E136482DE18E9 ssytomaa
458,263,430 *2E8B8A3644CD2E2D8761A06F81E3EE59A6EDC884 I'MGONNALOVEHERFORBOTHOFUS
458,263,431 *2E8946420DE8B430D0748CA1B8A372735B42412B STATOIDI
458,263,432 *2E8B5E763AE002F6FB1569CBA8D0DFCC4FF9C0EC stauplatz
458,263,433 *2E8C7ECC017365043760294210F10A418E6AD22B [email protected]
458,263,434 *2E87651409D5B57BD7DF2EB231AC2A210AF7B9F6 GARBSEN
458,263,435 *2E81F3276F047036282BCE7DC519A51B9EE752C3 garlandmaikoksoong
458,263,436 *2E899B112003AEDF94AB9881BDD5676535577953 INTERAGI5
458,263,437 *2E82B0B250D11D1CF19F97DF1722420D4A73D5A5 INTERNETTANKER
458,263,438 *2E8F9DA3EAF85B0B70B049AFE1AE7AD2147D8503 STEVENIGUANA6
458,263,439 *2E8B6CB2F540BDFBBA3935318B28F7D204D1165E STEVENSACV189
458,263,440 *2E824D3AE769CBE91CB693CA5D513E236C15B405 GARYGEIMER
458,263,441 *2E835485AAF48D6BB763567B621A162AEE54D59F STEWART.BROZESKI
458,263,442 *2E8F19A4A7EFBC0963A2D41E3E0913512F7EC50D STOOL.ST/U/L
458,263,443 *2E88D1CE3FC76745B04555614FC1DA1D3887877B stopwatches2
458,263,444 *2E8D93F332E306387B7550F5CD24CC07BF2C8F01 demetriusmccann
458,263,445 *2E8026880F61044601F8B70BCEAA75D3515DE503 GAYLE.KURZYNIEC
458,263,446 *2E8AA151761172415D27E3CDBFFE7EA1C51190F5 STRENKYLL9
458,263,447 *2E804253D39BE04279AC77349F26E4791EB6083A gb6-
458,263,448 *2E81084FC3C7D75E4B963355EB12909BA3807426 STUARTRECIDIVI
458,263,449 *2E808A8906F8007F08AFFA312962104E2DE1C7A2 gefiuuung
458,263,450 *2E8165EAE141AA9242E5D33FA6CA48EC015F962E ISAIAS.BLEECKER
458,263,451 *2E85C5967A84E80D34716D61CA850392CA4D4174 SUBINCLUDED2
458,263,452 *2E8452127B8E740A381D6AF20BDEE7F62DD931A9 it!redditfacebook
458,263,453 *2E81E86A66454E03FD7DAFBB1E301FEE79F76192 ITSNT
458,263,454 *2E8A1A7B93DF2ACFDEEFC8F7B251C57935D32F77 SÜFLA
458,263,455 *2E8E0F546E4B1069D8CE2C0FF5DBC64898EF5CC3 iy%y
458,263,456 *2E8F4BD2B1D9C596DFF66F088A58CA3C299D41BB SUKOBLJAVAMO7
458,263,457 *2E80D6BCB164A3D9A17E551885E52BD456C766E6 GERRYGUAY
458,263,458 *2E872C276E168B68814843A9D15E739CD6FB70D9 [email protected]
458,263,459 *2E8DB2499A3D7E42E8396D7AA19E3AF3D6C9AEE9 geujon
458,263,460 *2E85D5F6850C3F56582B068D60182D5140B0A758 [email protected]
458,263,461 *2E8560431083C3368A845F1E20BD33F755CF09F6 dfbr_
458,263,462 *2E8DAE41050FAB99FD681DDAC97FAB5D2ECFC4D8 dg3d$
458,263,463 *2E8C788819C76A5D782731E448FA69788B3F3C5D [email protected]
458,263,464 *2E8A1D54144EF5BBFC5D2026DF6FE22D8684750E GHAFELE
458,263,465 *2E83CE9528173CC8267BEBDA42E07710E662D1CA jamesrost
458,263,466 *2E877662C87E4F77F0727B6156CBE05B67AD7C6F jameyhautamaki
458,263,467 *2E8F6709AEC6D928B6A4E5138FC1158ADF717363 DHHGZ
458,263,468 *2E885D4F97EB0BEF63C2EB183F789F559A943F4C JASMINE.PENDERGRASS
458,263,469 *2E860AAA4C96E1C9AD4410AB7AD3EDBD24DD0C71 jasperjeskie
458,263,470 *2E83C3B04E3DDAE39D0AAA723650B638BE17AD6C digital-looking
458,263,471 *2E841A7DF70349585135C912DBBC72F9513656A4 GLASS-ROOTS
458,263,472 *2E81EEDFE1284A1662560EB896BB7FF89C288677 TABOUS »
458,263,473 *2E80FCEAFA08BFD6090BD761B2F108D07E25BF0F jayannegonzales
458,263,474 *2E8BEFFA246A29F531088555A31E02FB240AAAB6 JAYSON248
458,263,475 *2E83BC5D59FD7B391EE8DEB31D66D54ECE64D3E5 [email protected]
458,263,476 *2E80853BD779253E64C539AF89E1A1E763AC2870 DISHARMONICPOINTSINOPENING
458,263,477 *2E823FAD5F7FDF884D6174FB683A46A01F3C2E8C TALKMAGNETPLUSSTRING
458,263,478 *2E85BF0C88D34410C3B44E0F20D4F6EAC47E04BB GORDON.ERDING
458,263,479 *2E88DA6A283CE718B7B23C5CA4711FA165AEC93C GORDON.KOLEHMAINEN
458,263,480 *2E88C6764CCF15F171D0593CE343DE42AE873DEE D-J#D
458,263,481 *2E8EE41138C15B1279FA35EFFEAA7EBE683401CD DKL.6
458,263,482 *2E82841E478B6AD17633A78D8155F36336A9B0AE jenna.drury
458,263,483 *2E85690C85473128BB071EBD74D0B1D82FB6B833 TAWTING1
458,263,484 *2E8BE1E656161653330B78A64CD55C3A004BFAA8 jerefondell
458,263,485 *2E8595AE0E12E19D04E715507F3AF952FAABC076 jeremydowdle
458,263,486 *2E87E94539D77BF4E08835F9F5ED338B54A7E7D0 TECHEAGLE1
458,263,487 *2E885833E076FD65E2ED694C9A1A44A4D0AE931D technographically
458,263,488 *2E871B182A6D3538CE1CBEDD033F176DCE4A2851 JEROMY.GOOTEE
458,263,489 *2E8E9EC8C66960856F2EDFD084D0D394B18EC36C TEGROFERS
458,263,490 *2E822386B19EBA5ED6C949E29687CD63A24C0357 domingobur
458,263,491 *2E87C5DF62820C8BD8462033F863BBAFE63A2013 dominickbroady
458,263,492 *2E8BC69582A34D1C71102D45A0F343A9539C6C82 [email protected]
458,263,493 *2E8F6672A8FFAE642220A990F248DF4C55B651A8 DONALD320
458,263,494 *2E8CE3A10AC548EE7DBB2A802BDC3FE95E765273 donghendrie
458,263,495 *2E84B9CCC4488ECD4E5A575BD0EC185EC04F22DD DONKEYONE4
458,263,496 *2E826DF60EFC119B72577AE57F94B2BE93699515 donniekhouri
458,263,497 *2E8226CC4C053F44EF20F93C687D0262959D861A donnkimbel
458,263,498 *2E89B9D74763CB64BF26306C2A36FFB4B1BDEE27 gtt1
458,263,499 *2E8FA74062D73985F93232D8DE82E83CB3C1FCA7 JEWELL.GIRTON
458,263,500 *2E821D44CFF180DB8B532329059BF5D7EADE190E DOPPELLIFT
458,263,501 *2E8562CE364F5FB2E77AFF499E71E5DF69FC7704 DOQ%:
458,263,502 *2E8B1B5856C280BBA2A97F9C927C5A4935881CB7 download-killzone
458,263,503 *2E83F05BC4D3DB8B7F77F8F3B9FFBEAEC9BC5565 THADDEUS233
458,263,504 *2E8DD51BB3CA0730BAF10AC087CAA411491D0042 thankyou(deepdishunreleasedmix)
458,263,505 *2E8289D424D10903D0E86536CCAF0D1A6870436E [email protected]
458,263,506 *2E85FEB5B8BB2FB793768E682EE30717D828B82B DR5A
458,263,507 *2E8E1E6028B943F5D54350616AEC8E42B625AE40 GURM4I
458,263,508 *2E806A4577D9B1AC16A5AD4D29E4318FC1E77EF8 drea001
458,263,509 *2E81EDF85B68618011AFEFFC50FB29D289C4AF58 DRIVETRAX:
458,263,510 *2E873D91B1EA5C9C7B8A08FEB7BBFDC87C19967B [email protected]
458,263,511 *2E8046135B68172E93E876E96B86E525D56E4875 thedavid
458,263,512 *2E8618D87916FAA83B2A32AAE8FE1CC537811B0A Drop.the.Weapon./.Weekend.Girl
458,263,513 *2E8BAD7E17577DFC573B38A9485BE19975C966BD theehandel2
458,263,514 *2E8CE3A981E5FBA6F2389D011C6F8BAFF4F6BE46 JOANBRALLEY
458,263,515 *2E8057A26AF57240BB170B18FB62A2410D131979 JOAQUIN.LINCICUM
458,263,516 *2E8CB1FED8CEFC756590C76883D518D464E35D2A JOAQUIN.MARKIS
458,263,517 *2E875A9E58BF74AA0CD8FC6ADB7D97F04A2FD23D JOESPHLEYRER
458,263,518 *2E8313A0CD9D879208D0A705B475FD00F8EE875D THEGIBBONS
458,263,519 *2E88EC36C3278AB5626663618F51ACE40A3D74D4 theodorebredeson
458,263,520 *2E8882076BF565EFF463D54CCEA422CB2883BB2C hanchih9
458,263,521 *2E8B8016D24AB520695F16A257E23EE5D4BFC1D6 jonathonjoelson
458,263,522 *2E8D2B66B4F8576224B033903D1768BF68A99C70 due.to.noise...(Note.that.changes.due..to..unauthor-
458,263,523 *2E8C5AC0B9D172CF4188779B3A2046C3B9C79BB5 jordansferrazza
458,263,524 *2E836F66E7012629316E12E6ED2E77CF5E2F0688 [email protected]
458,263,525 *2E8D32F74D3EE2097F44687501A8EE8ADA2B0A6B d&uvb
458,263,526 *2E8A3946E9CC7ECE38BFC4B631CFEB4747D3DA45 timothygoerlich
458,263,527 *2E880EF6B3D4E49D4494989631BEF6764FCFBFFE DVPZL
458,263,528 *2E8255FE4F7531BFEC4C9D5064E6DB6806D45EDB judsonfaigley
458,263,529 *2E8A6A8B9BC8F8C0B855AD5EBE504984A915396A tlahciuhqui
458,263,530 *2E89737F91ED522D196F8F4C234B655748FD994B T-LYMPHOCYTE-ASSOCIA
458,263,531 *2E83A0A3A0B47EC93ECB0C43D7DE0CDAF2C71E25 TNELMESMYOUNG
458,263,532 *2E8E5A0603CAB8173D36BED50D375867DC405B23 TOBIASPARKES
458,263,533 *2E89F49CB5810949988BA1EB67CFECF9733A4E06 JULIETTE'''THANKS
458,263,534 *2E8FC186ACF5C3C564B09A731AAD6697B429B4E6 eamonn-walshe
458,263,535 *2E86F1D87247DB597FFFE4375D7583CEF25523B8 ECNECSERIV
458,263,536 *2E823B5543ED483C2427CCD6A6A46E2709BE456C [email protected]
458,263,537 *2E8D2ABD2AAF41A18046870E983DFEA57E5C1194 higidios
458,263,538 *2E8E26BA17D9975392AC1BCC8A383B3E7B8EEDD3 kansagra7
458,263,539 *2E82BFBD8465C86B53C09C0805989E8F129A8363 hiramgorecki
458,263,540 *2E889B065281EB062DABE6B89813A6A5791F25F3 HKLINKEL
458,263,541 *2E8735E4EFD76B0685C2234E040DC33FAA7D57E9 [email protected]
458,263,542 *2E8A5453EDF7E8D8350F528F3329D4E59BAAE15C hobertohland
458,263,543 *2E87B688F00A78B9998BE9A290068C14F212709A EESKOOL3
458,263,544 *2E82F2F1782A3BDB8CB2A88C6CEDD84AE6612921 kaushiksrinivasan
458,263,545 *2E88B95E968DE05F0CD1F26FF96D9AE3171E8D07 EFREN.LINEN
458,263,546 *2E856ADD32BEA7D0453F06FD10317E12E759C33D EGN(H
458,263,547 *2E85774C18BE7A5F10006999DDF00E2C4F31F0C4 KEITH.WALDMANN
458,263,548 *2E8281CD122EEDB0CEFF13EE2CADD8F5E64F1FFC [email protected]
458,263,549 *2E804FCB8A2AE2D20CD46D96A20045FB1C5D9824 TRISH DEW
458,263,550 *2E89E194F9464FBDB05C49F3D6684966F0E52025 KENNITH.HUBIN
458,263,551 *2E8A19CAF1E24E6D4FDAAB07E28041688F81F5A2 TTUANCONDOLT
458,263,552 *2E893FDF8294E2496AE1B854E732C5DB35D63717 TUE*
458,263,553 *2E875CEB2E80A2A1169B2051BA66D40E4F945D19 ELMER.NATIELLO
458,263,554 *2E8DD68175DA485B74AFAEE302C9A1AD6813979E ELMOWIENBERG
458,263,555 *2E811D6B448CF4A1FBB4F86E66F10121AAF3E824 kh_~
458,263,556 *2E8C4D6F5CC6C6C30521FF02D8AD5B7A0E479835 HTTP//WWWTNELLENCOM/CYBERENG/#ART
458,263,557 *2E8ADF502948B6F0BD35227F1DA74279E43ABB6C emihu
458,263,558 *2E819E212B6BEA8A77D6D09E3A96B699DF614390 KIP.VEVERKA
458,263,559 *2E85579BB9FFCA450FAC7FA1597359AA17D48B03 emilbickerton
458,263,560 *2E850FAB6E87B84397D00A79015CBB371D1828F2 TWINBELLS CLOSET
458,263,561 *2E87DA42FAC8C12670D329022520E42947DB823B HUANGLIANGUAN
458,263,562 *2E8B754E5B6836494DA3585C7A702634F39EF8A5 EMILROYLANCE
458,263,563 *2E8D0EAAF572C370F18DCB0C47118F872045B62F k}IWb;gx$hO
458,263,564 *2E809CE0B8DE4FA34F91FA17125C8EF3A58D6E5B tyallyn
458,263,565 *2E8C429A1A8BD25B69E9CDF2549E3352A823D4D3 HUGHBVERGER
458,263,566 *2E8707FF0F5F100171CF87F6A77DFB0599C4F109 TYLER VIGAR
458,263,567 *2E8FD14E3A9BA87AA45140A01A685B871E5BC8B1 klozertertungsingenieur
458,263,568 *2E85B1A05AECC909F479A7C211003D794A41AA83 TYRONE.HYSMITH
458,263,569 *2E8201CDC376599771E9430BE9DEF26AAD64FCEF TYSONPRIORE
458,263,570 *2E88F3229CADB3F801444D8B90DBF091DEF35B14 TYSONVIRGEN
458,263,571 *2E8270B95A79F0D1C07D61E1E7C1799F1DAF2604 TY.STOHL
458,263,572 *2E8BB0E761EFFF9B3056A1ADD1BD609F95FFF524 [email protected]
458,263,573 *2E8553373D928ACC0440B5E131A94B44E5A13ED1 enjoyer$
458,263,574 *2E86ACCBA90C60ECAE40EC571D696255BB11CE68 [email protected]
458,263,575 *2E8749BAA0E6A08FEFCAFA2E152AF33E7EDE52E7 KOROVENTSI
458,263,576 *2E87BF27F8C5ABD8F1FAAEAB53E8F9BAD6C598DE H;Z
458,263,577 *2E863FBB61B20F1A8CC223A171DCAF2B23BB3E81 iaaf
458,263,578 *2E82BFF209FDEB31DAEFB44A06D4AF9229D8674F eqh7q
458,263,579 *2E8933D345CF3221E332993CEA322182433DA6E1 erik.simonetta
458,263,580 *2E817161EAE95DE1F6399FB1F394DE9E23B1AB84 KRUPLANITZ
458,263,581 *2E8D24FCA2D9E806C95F05449B8832BB18E93F8E ERWIN.OCONNOR
458,263,582 *2E843F70E3613E56B66CD1C7B32FBCB5542599C3 KT#,
458,263,583 *2E867B48F68CF3DB3271CDEFD75EB66D6ADAE4F3 KULTTUURIOSISSA
458,263,584 *2E8DBC4B695CC7BA52573443D7969D50D8EB9920 ESRAUNAL
458,263,585 *2E82A0CA47351E041725C92726E3AD82E20173F6 [email protected]
458,263,586 *2E8E869E98082DCE36BAC0F5B1E3E6AA1DE51729 UPONYOURGRACE
458,263,587 *2E81D40214053ADC59E81A6B921A6CF830C54F58 ikdp
458,263,588 *2E83C4B3F87FF512B368A5897093C0DD4AE2C2F0 USER67.183.62.211
458,263,589 *2E814B2FFC5E998FF07C0BACE9871E5900CCA6A5 LAMELARLHES123
458,263,590 *2E8061A79FD441A49823F416E9E96BA1CB335B83 /usr/src/linuxheaders263224/arch/arm/machbcmring/include/mach/csp/dmachw_privh
458,263,591 *2E884BD057ABC96148BBE07259FC88FAB808F0D5 eu4
458,263,592 *2E8BF1C3E143F7B9B26F3DBD82C62934C7E141C5 U)X
458,263,593 *2E853C1127D30923BA302DAF1353DDC34B79F2D0 v13350
458,263,594 *2E842604B1000E10603E2BA739716F97D8F7D680 LATERUMING
458,263,595 *2E886FE961EAC16D42F10A37CA7156416FE73535 EVERETT.ZARLENGA
458,263,596 *2E85CC408DF0AD12A110BC82C9E9A8A517A261AB VALERIEVANACORE
458,263,597 *2E8330A1EA680BEB40036427F98659268F9DFC90 imamima3
458,263,598 *2E8C886AC2EE2CF18F9AF57A5209D463830EABB7 VASTGELOPEN6
458,263,599 *2E8AB62D818FFA60927B2BE9ABA4F513227FAC53 VAUGHTES0
458,263,600 *2E8847F4CEAE0DB7D59ABF81268DF4BEDA0B91A4 lawrencemckindra
458,263,601 *2E89959210A271EDF15B885B301013EF3BE2A1F7 EXPETENDIS
458,263,602 *2E8D9DE33BFABEB6CD75B6D37559DA9988987504 INDONESIASEWERAGE
458,263,603 *2E88503D10F858A875D1B31CFDE46A464436EF5A LEAVE IT ALONE (FEAT. PADBERG)
458,263,604 *2E87B14032E99A767AA393A03CFC47DE719B27E8 EZRAWISNIOWSKI
458,263,605 *2E8FD65D158389CBAB8704E7E9965BB4C142A925 informons6
458,263,606 *2E80D97BDE2E21CA73D46B7062E27D100526B572 FACULTé
458,263,607 *2E86ADAD347915607D70D0B7AA4CF2896CCC1DC6 lenteroos8
458,263,608 *2E87B5E0A53311DDDCC733EBB643F93243C2757D LEROY.BOERS
458,263,609 *2E8EAB2FDDAC97BE9656F2673EA2B14B4AC73BC6 LEROY.HONKANEN
458,263,610 *2E812EE3E6B91FCC5D0A9D9F6D7730AB4FCA1149 LESBRASSER
458,263,611 *2E85FD7F6FDAB094281374617C5221FB89E46BF8 VGS585
458,263,612 *2E895F3D09CCE8899414771F664711C2813366C9 LETITIA-DE-WET
458,263,613 *2E827541ACE3833BBE00794622C7B6073C0A43F2 FCOOPER6
458,263,614 *2E877D00E4FDD2BDE64A106262A5F766B811DB80 fechnerian
458,263,615 *2E8C2C1BFC26C3DFC78A8D4160D23C31D0ADE728 FELIXBERTRUM
458,263,616 *2E8F431AEBA359ED5FB134EB4BB15C4AA255A547 [email protected]
458,263,617 *2E80CF267E2A13C1A607BF44B7B169D64A696072 FELTON.BIRKLAND
458,263,618 *2E863FCA797CA73A9AED3D8A33647E581DED35A7 VINCENTMAGGIING
458,263,619 *2E824E6110F5810084E126EEFCE6766B7C2DF623 isaiahgreenidge
458,263,620 *2E840297E641109B04D18422702F6D04F15BE8BE ISAIASANDRUS
458,263,621 *2E836CF9B729828442AAE5B3664AB80760D7F940 FIDEL.OLLMANN
458,263,622 *2E8E5685360D6BEB16E7F22945C311CDF07E3513 FIDELROBERTO
458,263,623 *2E85A428583AF246974BA50E7B06E47AB1AED714 VIRÁGÉKNÁL
458,263,624 *2E8FD3E63B32F07AD1218DA21D6893C095E76A9B literaturinterpretationen
458,263,625 *2E80BA406E866A029D75C1FC471F207C5179E87F IVAN CABALLERO
458,263,626 *2E870106C0EC12EB86ADBE4CE8F1A60E375519EF flesh-tantrum
458,263,627 *2E88D9FAB16D69949DE5CF1C8C61D007A482F5C3 flledannekse
458,263,628 *2E85EF9DBBDCABBD22C0BDBD9982B7357DB3F3D1 FLORENCIO.BISCHOF
458,263,629 *2E8707E2A216992EC89B4D68D30E73A5E2D2AB7D VLADIMIERSKY
458,263,630 *2E8B65E8C08E8B93C767BC2FEB5F72FA53453091 LOCNLOCN6
458,263,631 *2E84B16F9D95FC20EE9BE1DC65AEAE037A621254 JACKMOINC
458,263,632 *2E88A8BE9544E50B018193CAE0891C95F1200FDD lonnyschmierer
458,263,633 *2E800607182CC113FBD46F9D46EFB45624A90400 VORZUSEHENDEM8
458,263,634 *2E8EECBCA8CC5C336F102A01DF143DA4824B895A lorentucci
458,263,635 *2E8442597208DB865B7C1EEFDB7259A08CC36510 VRMNTKTTY
458,263,636 *2E83DE195B3BBC5BCC83621CF9993F8C21C13935 lotus.heart
458,263,637 *2E816B68C1E40292C5DD9E93105AFAD5B1F2DDD2 jamedull
458,263,638 *2E81525CFA48EA9E43B191260CE14E9673027850 jamemargotta
458,263,639 *2E8203494BE28D66C9D4F75D0BC8E74E8482042C FOUNDPRODUCED
458,263,640 *2E8EE0FB1955D9E3DA5EB9C57B986F0543C250DC four(feat.risingsons)
458,263,641 *2E80AF52933FAFA76E1CDDEFFCF267765626702B LOWELLTRAC
458,263,642 *2E8B6295A9EA2433FF58A4FB8FF92E7AAF47C320 VYTEČKOVANÝ
458,263,643 *2E883DC2925D66C29937BD5BF9A0437C7C3A4B36 FR$8EE
458,263,644 *2E8433906CDC6C32FBCA94D39F002B3EE51D2E06 FRANCISB1
458,263,645 *2E849E0C6B84FDF050CB8B502D9B5D6AA2928C14 WakingCity(a)
458,263,646 *2E84FB64C8AD196838BDDC3A109E98D817D8F042 FRANK.SOLAND
458,263,647 *2E823E8B142AE3FCBE7846822AFFC25579928DF8 jaspercolvert
458,263,648 *2E8881E222314D597B3A363C3B8171BBC4C286A1 JASPER.KAUNISTO
458,263,649 *2E87C6047C5AE6A0CEB1C97063815FF31AB3BAFF JATIN NISCHAL
458,263,650 *2E859DB06F01F515B80D0B4D345C6DA9E121E482 wallacewearly
458,263,651 *2E83C989B3FCE04E9D80101616AAC47341D350D9 FREDDYGRGUREVIC
458,263,652 *2E8F043A7F1759A9378A5CEE67E4E88BD109F6AE FREDDYVARNER
458,263,653 *2E8A93FA85E664CCB7FD672D9A5720E028DD4F1C [email protected]
458,263,654 *2E80186454DD30C5A8F2CB29AAF26156041A34AB [email protected]
458,263,655 *2E813BF80DE85A82D1B9E45E3285F60AA7730360 fredrase
458,263,656 *2E8B6E07F5E3C821D2F7E224F249C49A42E593A7 jaysen.lee
458,263,657 *2E80B276C71980CC4236D9BD1B33D9D9FECB94FC freedommitch
458,263,658 *2E8F30C3CDBC3C9B0649406FBA1F202741C38C7A wanda-dichoso
458,263,659 *2E896B4BA133D6B7EDF3B8CF47E429CC3BA434B6 [email protected]
458,263,660 *2E8ED71C3448CB8E909959B1180D6F603BD3105B [email protected]@R
458,263,661 *2E8487BC065D81CB75605AEB476F166744BA40A1 WANIETA.CRATE
458,263,662 *2E8C717D97F9472A2615917D210ED01A1613703A FTDWENDE
458,263,663 *2E89FEE326BA0F30C7D6A3BC6F25ACF23635B54E [email protected]
458,263,664 *2E8478A7E839F05B59F95C62E097057AC5ECE2E2 LYNNCARILLION
458,263,665 *2E815BA95CE183D7B2AC1A46D850695B72167FB0 jeffereydoverspike
458,263,666 *2E8047C262278D0C09F234E70B292CDF18F62ADB LYNSEYHODGES
458,263,667 *2E8462B124007790CD0A1C545B99AB29D0435A53 warten.sie,.bis.sie.dran.sind
458,263,668 *2E813771B15C4D71393DD06BCC2A5722B744B7FF $m0king.c
458,263,669 *2E805BE61F30E44FF6B2ECCCF5EF35912389AC5D fyhl
458,263,670 *2E8530EA4F295B18DF8667753912DEDCB3EC9022 JENNIFERSPROSTON
458,263,671 *2E81F914A04936477A19117679C5D00452FEB2EA MA!110T5
458,263,672 *2E83FD6F1E5D46BD84FD6FFDFED7F29C7CCE7095 macbelle
458,263,673 *2E8AF72EAC71D5EC0BFD0E0E7287412BEB2D1626 G4$-PR0DU
458,263,674 *2E830B796BBB32D7044FBE332BE7186BA7AE8FD6 WENDY-J-KANIEWSKI
458,263,675 *2E81B32AEB57639B551ED1711DFDE9E5B01AA214 gagnerie1
458,263,676 *2E8E8CFCB385CD40F431C38D685A9442F1715E87 jesusboliek
458,263,677 *2E8E7EFD4A6DB821907F024985D1CD5DAA94DAF4 MAHDI IMANI
458,263,678 *2E8474A3A7AD5FA7D767F95D4DE87803CEEEE147 gailtasso
458,263,679 *2E8CB9018958C954FEDE314DF4EA695BA0396888 wengtakpoon
458,263,680 *2E8CEA2F2C4751F5CC62849E57CD11310646DBB4 [email protected]
458,263,681 *2E8AF54AFD5F129C23A496CFB5413035C18891BE MAJORDALMAU
458,263,682 *2E805EE25361508122F7B1018419426A0E702FAB west-of-the-galaxy
458,263,683 *2E8C8AA1891D7483912F2C44F0FCFC0FFA6C3B4E when.we.floated
458,263,684 *2E81D6A20B037214D9323FEE4A4148E955964A85 whenyouhotyouhot(featduginfinite&noid)
458,263,685 *2E86C2E72A35A0FB79FF4DF4194820C32D502766 GAYLEWOHLFEIL
458,263,686 *2E8CBCFB9FE7B3901BB31E39F46138103C777F30 JJERITZA
458,263,687 *2E84FC11CB9093129375E8C15E1B32B0D9A14EA3 MANOBRARTEEI
458,263,688 *2E88862FC6A6B2741A03C38097A2AC2C2426C013 [email protected]
458,263,689 *2E82BD509673212099036AF213683CAA58C7B276 mara.shelton
458,263,690 *2E84EA2254224190C31DCAFA91CE77B886990C99 GENERALVÄGMÄSTARE
458,263,691 *2E89129DA0EEFDFB0B12E0F69AD9C70F77E01AD0 GENNEMSOEGES3
458,263,692 *2E89F92078992E86A81AD146AD0EF390CE5222B5 JOE CALZONE
458,263,693 *2E8E64B895BFB68590E7170E2F67B57407ADBED2 GERESTE2
458,263,694 *2E8468603F8BD6494ADF570C3A522E8D55A403E5 GERRYMEEUWSEN
458,263,695 *2E84939808B526D7E44D3D731A4035B406569673 JOEY.REASER
458,263,696 *2E8E15A257C9A3726590DA6D212D82900C64EFBD johniemalecha
458,263,697 *2E86CD50505949F0D7456B0D8D7A240C04D34010 WINDBUIL5
458,263,698 *2E8FF94668DEE03EA1EFED252F99B81E404069D0 MARTIN.MELEAR
458,263,699 *2E83848A8E33649CF6786029BA5EC7F8A5B7613A marty.sands
458,263,700 *2E8713580DFBC581AC02FB2C89321049324E9596 WINFRED.SCHOCK
458,263,701 *2E84A54A427DD8AFFE7EBE24C3D9CFE6B2E5DEBE WINFREEDOMCOPOUT
458,263,702 *2E819079E4B62DC749EE08A8F8100A101041D15F [email protected]@ron1e$
458,263,703 *2E84FC53ED2E0AA23655BFC0A3FBDAA1B3EE4448 JRELJA
458,263,704 *2E807188D1AC704A5E5147351F83018810F4E7A9 JSERRATI
458,263,705 *2E845622F55347E5800A6F5306E4D6C48E8D0A36 [email protected]
458,263,706 *2E8324D7B2FD27C756FDA3F797A9D74C0967F3ED GLFJ03
458,263,707 *2E89620150E85102A7B10082D995E61426CE8035 [email protected]
458,263,708 *2E8954C1595F3FC531564E660E20838C6E575954 [email protected]
458,263,709 *2E8BC47A81290B92CF2F0D86354B6C48213C1375 [email protected]
458,263,710 *2E83BE33E04101A2C64696D59952656DE24897DF JULIA971
458,263,711 *2E8CF94E0A199E20F58EC7011290D0700D051DC2 julie-sanna
458,263,712 *2E8ADF330164957E9E5F0D02367B64353759D870 [email protected]
458,263,713 *2E8466767F453B4CAC9A7A60AD8AD2832042CFED WWWBOOKLETSNL
458,263,714 *2E8CE20B1FD67F28341D46B8D0E26A12FA0ABA63 JUNEAIRING
458,263,715 *2E86AC43C9E34F3B63EEC66D6A47CF4FB7E6A9D6 wwwskassociatescom
458,263,716 *2E8599A9B45CBEDDAF013EEA7DA670EA8F2AC8EB MERLEMEISLER
458,263,717 *2E884D63855D7AC67680AC1337F6DFA07018AFF6 X25C48
458,263,718 *2E8CBD871F6CBAED337702D18259E519FAAFD83D görbülete
458,263,719 *2E870FDC8853CFEBCBDE9A00222C174DCFB5C6C8 MESTENCA7
458,263,720 *2E81CD365EBAF7EDBF2CB5CF4E3EB39575221A9B [email protected]
458,263,721 *2E85D89ED7906840B052277028F39A451CC7F581 KAREN.BARTEK
458,263,722 *2E85600B5BB444F734C90652BE880BE8899BB323 GREGARINOIDEING
458,263,723 *2E8DCC8C5BF1F62D070AA965F455809A69034D1B )X(~.~.~.Q3
458,263,724 *2E87CB0DBE34B7301C1D0015D213A45C27AEE4DD micrologan
458,263,725 *2E807989EF61F5715AFBB47EA7FC89792FF9E0A9 MIKEPHILIPSON
458,263,726 *2E842112B40050E849F81D6F42BF4929D209CC18 MILLARD.DESADIER
458,263,727 *2E82B16EDC272DB578983B4251598F259325A58C MILTONFRABOTT
458,263,728 *2E8B665825C0566BA49BD268DBCF6572F40FC0C6 MINDYJESSICA
458,263,729 *2E8035FF997A1EC28AB4C4E210F45EB6AE7720DF MIRIATES4
458,263,730 *2E826EF9B2A424E0D07C81819424CB3EE03FA661 MISFERDE1
458,263,731 *2E89AC497BC76C3433DD61DD910B9FA01E6241C9 [email protected]
458,263,732 *2E846C3676A86F0D28E863D4772E5FA6465C2446 kendricklovitt
458,263,733 *2E8E90F10CA430A627BAA0593EE8D1A2027451EE [email protected]
458,263,734 *2E8D1199A390D1CDE4F55180EF5B8B81DD2F53F8 KENNETHDECOCK
458,263,735 *2E88A9ECF929ED3E6009AE16F6232C6D00F45AAE KENNITH.PIORKOWSKI
458,263,736 *2E866ACE0A228D5EAE90AC8F440B7476E6C4DCFF [email protected]
458,263,737 *2E89038A43815A4A27881C47F1FF5A95CF9CB78A [email protected]
458,263,738 *2E8A8231C5FABD806B69DF29ADE2DFAEC65E204B H001416
458,263,739 *2E8B1813BA38CF9DBA2629B320D817C05B9282A8 YENDAV-1
458,263,740 *2E80DFB56D9F55C88E0CCA4A3E67DA29702D8AE2 KEVENGOSSIN
458,263,741 *2E8437735A3891B8A6E6038D96D56F3A0A56C722 [email protected]
458,263,742 *2E8D2137191FCD64639FF03E86A68DC2ACC343A8 yes44mama
458,263,743 *2E81C6FCF04F4C4984F1EDDAE8048FA590C66076 haley.chastain
458,263,744 *2E87722C22BFEE9D78E2B05E614E61AC8A017E17 y-jf
458,263,745 *2E841964DEAB9E166F716D4B49D394A2B93A2258 YKUUYKAY6
458,263,746 *2E8A0F72AEAE0A69DDEEA5A85B57F8BD2F0EEF4F monthswide
458,263,747 *2E81D2696ED7E2740521F52F50E26538064D1EB7 montjoyeschleiden
458,263,748 *2E813A3862080BF070F856EE69AF71BDAA5202B4 YNOOTSEF9
458,263,749 *2E85DE6C35953B7AA9ED3BD478BA6A5911B5DE7A KIOLOIDE
458,263,750 *2E8D51C1F528E1FB7A4C12DA7FF26083C95F1D6A [email protected]
458,263,751 *2E8B48C7714E1B481433A3D611D9B9A8AB9F3123 KIRIS:
458,263,752 *2E86240E5EEC059730DF7D229322D381C93D3CD6 [email protected]
458,263,753 *2E8EA164088E5CF93E01F7489BC4094AA1075F04 MORRISCARINE
458,263,754 *2E891C971E94D254982BF48DB47545DC9AA36931 $HAP3TAR
458,263,755 *2E8C1A1C14688D5052A644D9434988C3B650114C yopi-gembulna-ndutz
458,263,756 *2E836E4A68A689E2E80DE95AAF077475A52368BB MOSTINFLUENTIALGOLFFIGURES
458,263,757 *2E8A2CA434CE38C46282B335B43F646C615AC8D4 MPRUTTER123
458,263,758 *2E84B69DAC2EB0B273B901CEF4A3F9C841F2EBC9 KOKKOLAS3
458,263,759 *2E8FE4EE18CD1DD5DC0DDB6E88092B268C9D826B hb{z9|
458,263,760 *2E8CE7AE01CD3FF1008E2BF870918D1176934A54 multichannelmerchant
458,263,761 *2E8C96F24AD772C5A811ABE106FD06DF27F82593 yuyr
458,263,762 *2E89C8B1B6B3F60C50ED1A7E40C7A27F2AE4C152 YVARUMAKANHTIEK8
458,263,763 *2E88CBC60330FCE01DAC7D7D732FBCB61EDB215E YVETTECLEARY
458,263,764 *2E8836911A9C8F0EA6C2814D9DB5BD13DAB2A81B YWOLFBLOOD
458,263,765 *2E8C02D52CED1E4846B4CAE7E180BB896ED1CBC2 ZACKFIGURSKI
458,263,766 *2E899D6C6546B72AB08515A9A2B3CE5A5E55FC4D KRYŽELIAI
458,263,767 *2E8FBA5EE6F62CC4333A5F5E3936A48B1CFC9CB4 MYLOVERTODAY
458,263,768 *2E8140EF67ABD5D4DA1363B0029015F3FBC39906 herbertsheftall
458,263,769 *2E89E60FFCC43853A07A2C2E25AD9595163E7361 myphoenix185
458,263,770 *2E87DFC9B29E3235A84797FD6B8F4D57CF8A6C53 N(}
458,263,771 *2E8ECC0D57482421203A279985B7629372EF394D ZECUMEI
458,263,772 *2E83E9FF10FF8720306D7D00349D00BE8AF38FB1 KZFNKZHTKZIAKZII-FMK
458,263,773 *2E85A7615FFC3F58A2F8D0803C2E810D6F948E2B [email protected]
458,263,774 *2E812AC74270E0E49D9D61D6A087140CA9DE0E8E H-G.
458,263,775 *2E8096B27BF3CD864C46586C114D838760462240 [email protected]
458,263,776 *2E8A5BA17336EC97503D8B9CEF646F91F3C525EB napoleonbooze
458,263,777 *2E80A3B3BA10F2419E21539F5E181720441299C2 [email protected]
458,263,778 *2E8B2CEE56ECA423BA438A1AEF9FA0926E232671 lambda1957
458,263,779 *2E874B022B6E67BF01C087C82D0FCF0F3B7DAB14 NAU025
458,263,780 *2E858C76A5E969E8EF8FE8E69186220D0F3693C6 NAWALUKOML
458,263,781 *2E865541CBD737CF328E872099D5B93F6909184B ZERETLOC4
458,263,782 *2E841D770393DAD41DDCD8081A61303831C5C039 LANCEYARBRO
458,263,783 *2E8A0B6DBE55168268BF577E7F816BFE2388DAB0 NCKLICHEN
458,263,784 *2E89D8B47D493E203F7101BA5DB1F9FE2DD2DFAE HNTTAIZ3
458,263,785 *2E82F8FCF485F699834401DC8D68BEC2DC55C030 zhitomir's
458,263,786 *2E88FB4A506149B7D8C0FC01215546927B402C5C [email protected]
458,263,787 *2E894A013FCFCC384B640E448C5E4A6BB7C26CB1 [email protected]
458,263,788 *2E866FF1CED6AE1CC6100CF9155848840ECBA71C LAWRENCE.HERMIE
458,263,789 *2E854798B7B15F7A773B19E406416F95D5C57E7B HOSTORISCH
458,263,790 *2E81034C0BB70735FE29392E429587241EEDAD37 ZOG7
458,263,791 *2E89F52771EB84BBB4D96B3C41049CDB31DE9C24 HPORCNAC3
458,263,792 *2E893D0349F736E2928011EAA6F2DC758272C5D3 LEESUUR?
458,263,793 *2E865DAF4F3AAAF8344E5C0FF7F5F41C011BDE9A LELANDLEVITT
458,263,794 *2E8624B8F67AE7577D346D316CA1CEFFAD87D34C ZXCVBAUSTIN
458,263,795 *2E848989B8C1E95AC2566A11C4EDC8B207611A8D „АПОКАЛИПТО“
458,263,796 *2E87B6B483077EC43A8AA0AF570B71C5A885F61D HUGHPATUEL
458,263,797 *2E8F120197BED7E8DB571D8A33EB338245B41870 non-te
458,263,798 *2E84233C663B07FECC46C7C11123088D33D5A1F2 «АУДИОВИЗУАЛЬНЫЕ
458,263,799 *2E85D81C523AD5ED4540A19694BE175DA3D65638 NORMANLEHRKE
458,263,800 *2E8335E3914AC5A8AC3B600A98E0F84391AEED97 not divine as them
458,263,801 *2E8AC7443EB06C94CDD9E5FF248FDE6114C32C9D hyakudaied
458,263,802 *2E89E9CC88D6D255CE638F99E02E26F6582CE232 LEVI.DEGENHART
458,263,803 *2E80FE04C601658607D852A5B278A06C357EFEEC LEVIMCCONVILLE
458,263,804 *2E841BF7B565DA18493891FD9E1F5FA013574EED LEYTE3
458,263,805 *2E878D3C5E681736953DD4DE52C245E48FDEE056 (~_^)O~0~Q----B
458,263,806 *2E8C0FCD67DA30A2BBA2187A54A57C9F1297545E котируемая
458,263,807 *2E85248489319F5064C5447813D035D09D1AFAD7 [email protected]
458,263,808 *2E892EA55C02AAB5CE371EB74990219862A9105B odiskurisu
458,263,809 *2E835E74D99B7BA209890659EA1440FF4A078E1D o->-<*d=====P
458,263,810 *2E8767034CAA6CA1F08D9A4F7DC67ABE45B87ADD НАРКОМАНІЙ
458,263,811 *2E8182DC19E252BAC0361D84CB352D66514575DC [email protected]
458,263,812 *2E86DA4FCE386E4A4A82F96794133659A2DBC2DD OHMOMMYOHDADDYCAN'TYOUSEETHATIT'STRUE
458,263,813 *2E8A87EF195A51C225035C19C7E6C207730EA994 ibw5
458,263,814 *2E813E66B6F7705772BDE48D7BF95FD10D44283C OLINSTARKIE
458,263,815 *2E844579A7A2CEE12ADA031F4FC178E3E6FCE0B2 СПРИЙМАЛИ
458,263,816 *2E8E415062801D3D5F2480F49F2610EE45DD0BEC OMARYASUREK
458,263,817 *2E823A41C9312CE32762BFCDB6188D9D3BCC4CB8 OMER.CHARRIER
458,263,818 *2E8D933A6AA6067E6FA6BA96415FB1ABFC666A9C цетральним
458,263,819 *2E85EE4629E7F5D25ABA630C1A7806E0A1314904 [email protected]
458,263,820 *2E8765F6665154734709C9ADFC82425B1FCA32B0 [email protected]
458,263,821 *2E89D1B7FF3E20D2464426B49D9096ADF14FEB24 [email protected]
458,263,822 *2E82B1F2AB4637983B014348A49C284838D1FB34 [email protected]
458,263,823 *2E8BA6716CBA6E2B55877DF11AFAD8DBA34DA446 [email protected]
458,263,824 *2E8937A22E32275468D8B6BB4900454AE3003E1D LLDOZOM
458,263,825 *2E84CB7C4D694321C97CBFD5F4084EA47DE335FC OPERATIONSTHECHNIK
458,263,826 *2E848D8296899839043EECA272F5CBE34054DC07 orrtqmp87
458,263,827 *2E8D21C3F726647339C2A035C4023E25E2FADA3D imanismith
458,263,828 *2E8BCA0421F315735AFC5C6DB3BE374339CEC6C4 OTTOGEHRIS
458,263,829 *2E8E1C06F841462B8BEEF92805ABE5B3093A990C OTTO.HAITHCOCK
458,263,830 *2E8E65502B827EDDB896F78B8D82CF84EAA54173 INCONTRACTION4
458,263,831 *2E88A4A589F83AAE489E1E301701370BBB573DFF O"X
458,263,832 *2E8EB69E1FF91FFF9596D545F9430D4F6332A4E5 LUGGISHES
458,263,833 *2E8EA5CA366728FD0DA55BBA7B1CF47807A11CFC p3cu14t0n$
458,263,834 *2E8EAFFA93BF8124A97313B622E0B6FC37C927C1 l'un et l'autre (disc 2: l'autre)
458,263,835 *2E832DF33796C88CCD75EDF48AFACAA0A006AD3C PAHLI-SEEDI
458,263,836 *2E83D5451D4808EA9A14F8E4A5AE707C9F9C00E6 IRVINGEDITH
458,263,837 *2E83C29950076A22C687A2001FD466295919889F 引用・転載の実務と著作権法』北村行夫・雪丸真吾編、中央経済社、2005年、ISBN
458,263,838 *2E8A3DCD1136B7E0CBFAE3B31CDE458AD2287F8B PARTY-CHILDREN-(ORIGINAL-FM)
458,263,839 *2E821AB6EB6EEA03557FF0F039F3D2B536F1B7F0 [email protected]
458,263,840 *2E8928BEA273574C087AE0D4A2399AD818BE6AD5 ISREAL.TEBBETTS
458,263,841 *2E8567178BD158090E695968DFE1E4FFA8919375 [email protected]
458,263,842 *2E859086BE991B14F135D395553C38DFEE57AE9E MAGAZINAS
458,263,843 *2E84C60C439829B0D15DB0A60DF8AAB26DD4414C ITREVNI9
458,263,844 *2E861BF4608874C3CA5A1183FBE7298AEA739D05 i..valse
458,263,845 *2E8469D0BBBA486B21BB773ED38FB71BEA6C4251 [email protected]
458,263,846 *2E86802C63FF50FE55A2624260B744D92BE56A66 J,?
458,263,847 *2E8336731BE60F6CDDF4CF71AE23F6F129615BDB JA0^
458,263,848 *2E8B52BFD3D3CF5FAA6B1F0736376724E9A8CC8E PEHALAVIP
458,263,849 *2E8E46046B086D60A4C303F38F2FFB0CF91EBFD1 MANOJARAVINDAKSHAN
458,263,850 *2E80A3A8998509FE0312BDE0EC69E87EC0462690 JACOBG1
458,263,851 *2E8B617C44B088CC1FED1A37E9496F2CBD9E5520 manuelkliem
458,263,852 *2E8FE9BCE547236754EC2E0FC7E6C3EDE2217F98 performa45
458,263,853 *2E8A1B1AD0AF486240A82A6D9FB965093FC49223 PetrPetrov
458,263,854 *2E889D9BFFA7BB64EED09CFF309714BC92B43FC1 PH070ELEC7RE7
458,263,855 *2E8B2FA02562BA9EDADF53643A1694EA41B19ADF PHAEDRA-HANSEN
458,263,856 *2E8635E13B65F3C4FACD0659DD0F91054D1A5878 PHILEPORTALCOM
458,263,857 *2E8C2D67B8C93A32B3902053829E25D9BC0F7D7C PHRDISALTOINSALTO
458,263,858 *2E8ED10604FA3E5FE01E3AC005FD027DDA9CB529 jarodkritter
458,263,859 *2E8ACB6A8C60B7DF7D75CE39B9D574D6D59417DE JASMILI4
458,263,860 *2E8B41796F90AEB410CA4F50057796B470BF61DE PIPETALKCOLORADO
458,263,861 *2E821018260586CE8A6A5AF964C54F5CA6D4C55B [email protected]
458,263,862 *2E8079FFA3B3729024F2E34DC1428D2A94A281A9 [email protected]
458,263,863 *2E8309F33D179FBE307278DFBFE9C4E2F51AD6B4 JEAN.ANTONUCCI
458,263,864 *2E8FE14F4E9B60643F9EE4048E972CC44DBC010A plasticy4
458,263,865 *2E847E0BBF2A5A8CF875195F8E16A542374D6688 JEREMIAH.MASSAGLIA
458,263,866 *2E8D04493849E36810599AF51D515CA5F593CE77 polashn7
458,263,867 *2E8BD9D4CB76C874C888C8C0405C768C780138A8 MAYNARD.GABER
458,263,868 *2E821287AA6AD725A0B639761579A6C0EA6D113E mazarrã³n
458,263,869 *2E827078375F18D9E6D504C6180BB709404DD122 POTKRALJU
458,263,870 *2E89F3A099F0C4F8A2D0C2A407CF8F965FEA0779 P----P~O~o3B<-
458,263,871 *2E87610D15FC75C5D1DACD7C2642560246EB0895 meet-the-monster
458,263,872 *2E87F4A6D23257A2E54D529B5591EDEF905D73F0 0ILUVMIRACLE3
458,263,873 *2E83323CB810D7BEC38FE1911203885721517929 0l38b
458,263,874 *2E8496FC7120386A53808DB56FCBF78B193848DB JKCBAA
458,263,875 *2E84E9D1013F14FEAAF6B4DE01B840C3F76F569F [email protected][email protected]+0N
458,263,876 *2E8B17F99B2E2479858C9899FEAD6D19718D7111 JOAQUIN.INGRAHAM
458,263,877 *2E841748BAA47D7FD077AA4E37334B9F16614BAE JOEL.LAMANTAGNE
458,263,878 *2E853DD526DDE88A0EB26A421955DD4B4D51FB87 joelstcyr
458,263,879 *2E8A823D1EDA87D892D74E282813E89087244D08 PROFOLEKSANDR
458,263,880 *2E891A470065C0B1EC4E53652191182785B62770 PROSENTENHETENE
458,263,881 *2E8F0B49FF01BF117553647622AEB82061408294 methylmorphinone
458,263,882 *2E853D5E984381F6737765811B57A1286CEB0839 JOE.TAYSE
458,263,883 *2E83C5637203C29A5CD27B1D00FE971F3E925E5B 11:.11..-#..-&...ballistics
458,263,884 *2E8F068320AB35C39D40C9DD71E477A595D771C3 MHAJIAGHAYI
458,263,885 *2E89000A5266352AC440E5DC68CBF18843FC4EC7 MICAHSWOOPE
458,263,886 *2E8A205A908DA6AEF600CB4AD50D22D2CD09180B MICAHTANTUM
458,263,887 *2E81E6DA2D30ED2C5367C03C30DA02A183819767 [email protected]
458,263,888 *2E85AC0765934A6EE077289FE0ED99AE4147EDDB puilulle
458,263,889 *2E8D34BC9F699EE4FC60B2CA0769191A1C1FAE64 PVITESTAM
458,263,890 *2E8251A29AB74A0C802F754958B68691403CB9A4 JOSEFSEIBOLD
458,263,891 *2E8B163A3CC234699987D217E51F7148DCA45465 MIKECUSATIS
458,263,892 *2E8A1B9C6A2D3779D1CA3D46A1009A8F9946BEBC JOSEPHINE703
458,263,893 *2E8A1BB99FCB1E9B489AEB6A70CA8269A4914956 JOSHFASKE
458,263,894 *2E8D1259D16332F6A3B81C037E997BC6CF9168F0 q6o\
458,263,895 *2E86244D5C62BCD18C7672C705491F4087D0FD07 1527175 THERE ARE NO WALLS , NO DOORS , NO CORNER OFFICES
458,263,896 *2E8FC87432084DC61469ABE51211678E4C1812AF [email protected]
458,263,897 *2E81294FFCE40550649C482D136BBB2517362B36 1625833 at the new school , he was a professor of sociology
458,263,898 *2E8B26A361D923BE20FF655547C17103135C37DB JRXMAN
458,263,899 *2E8F45E094CE4AB64083779318BA9D6C5A417F5C QINTONC
458,263,900 *2E8629F069AC5E897350609EA1EB50F1D7CB1B4E [email protected]
458,263,901 *2E84F3C243283960553CEC15C175EF54F778B621 MITCH.PROVENCIO
458,263,902 *2E86F505F338EE8C00488B1FBE05FE7737970D8E q=).~o.~oo><
458,263,903 *2E832DC9B885B0D5CA4D6F2CFB756B12ED975B26 MLGXSTET
458,263,904 *2E89244BDFFDA1EEB06023FFF4B618BF486B353A qxybl1zzehq7svn0
458,263,905 *2E80D4C825869192BFE858210FB071ECEB529B17 JULIE R JONES
458,263,906 *2E884D8A6AB90A39D301AA46379A7FEB33A9ECAE juliuseze
458,263,907 *2E862E8D0A32D493F9D7BA641F470BB89002D482 [email protected]
458,263,908 *2E865FE326712FAC00D84859283D877349BD554E 1964215 HANKESUUNNITTELUUN OSALLISTUI MY
458,263,909 *2E8FE46E873ED52E4EF02B4AB8295E993180F0DC [email protected]
458,263,910 *2E853D58A4479052A5CBA5C9B09D78DA4E4F126E MONICAKRISTEN
458,263,911 *2E84694473D87DD43EACC5C2AE047BF4B3E13BA9 ramports
458,263,912 *2E859A67807E8992A92A6B2038F59876DA61F600 KAMESHWARD
458,263,913 *2E8C45EAFAA56B5E3DBC7FCA309EEBE41392584F kamilah
458,263,914 *2E85F89372E506CBE1FB227AC22E456B9847F181 [email protected]
458,263,915 *2E8ECC65B2B107EB2F516FBE7AEABCF76A5A646C karadjordjevu2
458,263,916 *2E8C1337580A2CD6727DAC0E11E4268FCD850AE0 KARLO81
458,263,917 *2E8806FC61A2E2B34EBABB0709AB7141AF9FFF34 [email protected]
458,263,918 *2E8648D19A8938B1760CC8CEC8D37C59714A05B1 MRN.SURESH
458,263,919 *2E81C92DB29FD2A32BAC685CF06B1419CA6FA245 1doortrekt
458,263,920 *2E8E4951248904710BE20750AB9535150277D5C1 [email protected]
458,263,921 *2E8D0DBB9C4818B453C788DA568467E93A6C48DF M,_T
458,263,922 *2E8D346CC97E61444E22F1136C8DD00ACE3E6EB5 MUCH.-CH
458,263,923 *2E8B4BB96A4640CF62D7565BA9556821F62CD66A 1 eisuomalaisilla
458,263,924 *2E8CBB280DFD72FC019BAFB0F07FD6344077834F RDSNNBPXBNAF
458,263,925 *2E864574DB35718049E85C748F5DED08C509D66A re14+1on$h1p$
458,263,926 *2E8EAC974A38066A88CECE83C15C87EA4AA376B9 katy.baxter
458,263,927 *2E8F3F6AA3DAC8FBC0FCC3B013202503A7EF0D2D KAWAHARA5
458,263,928 *2E81767A9780A0C57DB6F5FB049E8B3BF0DCE239 KCK5T4ND5
458,263,929 *2E8D2030C60E8E9D966ACBBA7C2B0779E80468AB MUNKÁCSYRŐZSEHORDÓNŐ
458,263,930 *2E857F85FBC70417A9F679094A069E7852FADD46 KEEPEROFTHEFLAMES
458,263,931 *2E815AB9A151152BAACAC9EF95BA0E3F174AC376 REGGIEEMANUELSON
458,263,932 *2E850BF32C463422078066B4540BBFA3A595DE8B 1hellimpi
458,263,933 *2E87C63B7010C9FA62D505C12A77EF648E03DF5D 1 hillseth
458,263,934 *2E84E24BEAC9DA844E80403CE7B051D6A0AACCA6 myisrael57
458,263,935 *2E87BE511B4EEB4454DEB9FDE8988A992EC860A8 kennithwidder
458,263,936 *2E8F135D1798EEE3A8F736CDB8BA1549C6D84DF2 kentdirago
458,263,937 *2E87861171635B5492C61B9921A9D8078BA55DA8 kenunaroyit
458,263,938 *2E8FB2B9FE82CA9ED5DC7E44B3C6DE948B52633C myrondaro
458,263,939 *2E87E6DC127BE6E7F6748B8648A89059F74D9156 RELCHEREZ8
458,263,940 *2E887E5BAAA9FD5F05DC486CD1F9944792C7B3C8 mysalasana88
458,263,941 *2E858EDF6EB267AD4E6791A959525616AA4D235B renerane
458,263,942 *2E8161F296208BE230E16C2343C1F9DA79869D28 1LAMARNA
458,263,943 *2E89466E4C0778B8F50E0D5204D943B574EF9E11 KEVIN-STEMP
458,263,944 *2E8FDAC26944E54919BC28C2762CBBE6687C2A1F keyshiacole
458,263,945 *2E8FF6B50A895CBD16532085E3C27745B5222EFC [email protected]
458,263,946 *2E8D77EA02917A673EA27D5AA6B9E85AA51142F0 1LIONIZATION
458,263,947 *2E8897C3CFF4138FE1E97DA74B42492E27308005 NASALGLAND
458,263,948 *2E8F6692D0BF98CC00CA07D2A55598E02AD10B66 natve$
458,263,949 *2E80FE79B96BBCD83A653F9CF2CB2E40F7C7C2CD 1OFC-FREUNDE
458,263,950 *2E8EA4232124FC267BB6311244DA2DFC60D96A13 n-del-norte-central-paranaense
458,263,951 *2E8B5595860D0A133D5E775829A6805B561E1CA3 kloosterheide
458,263,952 *2E88C623CA4CA15F8F501ABFC0B3D4E0A615374E RHYS897
458,263,953 *2E83237C44FF3F4B33145AC42BCC30D835510D99 kollergarde
458,263,954 *2E8D022EABFA4DD8860BD1910D2D5CD91D696513 NEKNUYZ2
458,263,955 *2E8CC1FD3BFD492F97C746FADBEB02F7F8F281B3 KOMPRESSIONSSCHEMAS
458,263,956 *2E8836EE8F890013E739A519B192BFD16B8107BE RICHTERBEAMTER
458,263,957 *2E86736CD14C36B2388571F6C2C22F8E2BD5682C [email protected]
458,263,958 *2E877705ADD135E6FE210407F799B8A3A462E648 NELSONPINERA
458,263,959 *2E8601311B47C1F6C82B5523DA4623796128352F nemuvafatixo
458,263,960 *2E8614DE17F4E548EB634531B2633FD27F118E27 1peribranchial
458,263,961 *2E8D254C53F3FEA62651A76D2A4F4FD52DA9F362 KOPHENE2
458,263,962 *2E8C4F30643831193A3E5F10A7F631A13C7E4BA1 1 PRKLAUBACH
458,263,963 *2E842CFC6B711BFE7D20A8126DC65782C335095A 1RABICKI
458,263,964 *2E81DD740E6B6E9ECA826A983FF867B78E4511E0 1.rekordveraechtige
458,263,965 *2E8BE761A69AD0209D95A57D0E89B31BF70C33CC kraigkulis
458,263,966 *2E881231A3AEAA6A30C67E075D2E282BFDEAE856 ngapuhinz-maihi
458,263,967 *2E896D88B48B1D3952C9CA84E0622EF151759456 KRAPPGE
458,263,968 *2E85BE4C592138DEDA3DC699E01B92CC5B5B7B54 1ulkoistamismalli
458,263,969 *2E810508270AA2243E470B628EDF8684FF18740D 1VIILT
458,263,970 *2E8FA6E0814E5FA5024F7F8550B5427C840F3924 NICKYROST
458,263,971 *2E83F7632BB0E2AAE864752A1C7982FCFE4B868A [email protected]
458,263,972 *2E82B5E4B701E2B3B62CC053B6E7BA4F458BE007 KURT.FARRENS
458,263,973 *2E8173C5F632D2662559BD714D1E346B5972EC7D KURT.RODRIGES
458,263,974 *2E84B210F023618A91537B37DE8BAB0ABCAA4B5F RODGAU-BAHN
458,263,975 *2E8B7F8E64B1E70227421E3A50CB14ADFE91289C RODRICKTHROCKMORTON
458,263,976 *2E853687EFC2C68F09DEF089271B92A8C45524BE NIOCARLOSJOBIM,CHARLIEHADEN,ALFOSTER
458,263,977 *2E80832F2D56DF7DF6066013C050DE9FD01CB4AF NNLTRRLY
458,263,978 *2E8350F5C2E4E4CE91F40BDA65C8324F569FAC89 roloviching
458,263,979 *2E89298EE96BF0BFE8620F360593416EF266DE84 RONALDSYRACUSE
458,263,980 *2E8C46EE109FB6D950E6DABDDF653ED38D81B13E LAKIJATURVA
458,263,981 *2E894FA439FE61826DD73FC7F01EBFCE9AF21CCC ROOSEVELT.MAGETTE
458,263,982 *2E8A5FB00785A1FFB2382C2782841A2F117FF84F lamontagne(p178179)(2)
458,263,983 *2E8516866C1176E13E34ABDA5CDB96B4A544B1B2 2245977 sivunalkuunetusivulle175
458,263,984 *2E8029A5F531D5C74C17866A43118A656DC7DB7E landonkiser
458,263,985 *2E82876FDE2F5E28D424C820170C370F1B1F6EC6 ROSMA ROSMAWATI
458,263,986 *2E8204491DBFAFABC0602A451C3D728B4A28BA9C roswbbs
458,263,987 *2E8AA7F07762BA431ED6895835EE6ECFD919084F 2406422 olen-ajanut-py
458,263,988 *2E89E9682AFAC90CFD7D68801F5CEAD4BC5C3050 2415822 VISTA-CHEMICAL-SURGED-2-1-/-2-TO-52-1-/-8-.
458,263,989 *2E86A3567DFD673447CF70F8D12B851C53BF33EE laura-riggins
458,263,990 *2E86A6C5E68DCB6204EE22C107F4DADAEAC1D984 NUMBERS.HOOGHEEM
458,263,991 *2E8FBC5ED28601257408E645D8B5ABE8D791B35A NUMFREED
458,263,992 *2E8931FA612961211F6A4CC96077D1400490E35C lazaroscher
458,263,993 *2E85A0BE99ACAB65B0A3D2AE437E013CD7CEFD27 LCNCMNTS0
458,263,994 *2E8C036A119E91792989B0FC2DD5939520D1098E RUBENLOWES
458,263,995 *2E8607FB059DA0A1CD81A9DAF9D470DEE3CED420 RUBENPASCOCELLO
458,263,996 *2E84349D4B81D994A6AEDC60C063EE1355615A47 rubinulwelling
458,263,997 *2E8D089E3E439FABE12156C802272632E298649F }o{~` ~`@-----3
458,263,998 *2E8750F8A9E49E1885CF1A6DDB720FCC1F00A52B [email protected]
458,263,999 *2E8D6A3AF9462B1479D7D597E18120B77EBFAC60 RUNTIER2
458,264,000 *2E83F1FCF087169525B39701F3B69ADD1C226D92 Oceans-Running
458,264,001 *2E8740E1BA569084701BD1F1CC9FC74CDE822333 [email protected]
458,264,002 *2E8323E529B0EFD12F1D73D99D361CC7FD48EFF8 odelldelisio
458,264,003 *2E8CFB8B0026626655F9F4567D32A7BAEDA77FAA 2782641 MUNASOLUNHEDELM
458,264,004 *2E8A6557DBACEBA7CF9F312A3AA9B3455264DB61 ODWLEKA5
458,264,005 *2E8C69F01FE29B17481D32979D288898EC584CA3 2904276 SADUN PIMPULA LAUKKASI 300 J
458,264,006 *2E83BA8C9F9B7B34B5BFD1D749D0B552A92ADDD7 LEONARDOLAGASSE
458,264,007 *2E86BC2A5BA53696903C99AB70B508E55898222A leonelhendee
458,264,008 *2E8532EDAA43380177EF550D79CE28EFD8E22678 s(7q
458,264,009 *2E897B7F68B6F717752F5A459E785D8BB4EC12C6 SABELLIUS0
458,264,010 *2E8F920C4D38384EE930FB111C2756CACCF33FA7 2ADINOTYT
458,264,011 *2E81B71D17EF943EFC6D6508800872B1092A178A OMGEZEGD2
458,264,012 *2E80412D62398264A6DD8D51B095631BA664289E LESTERNAYES
458,264,013 *2E8D51093E2B50F0AD52F27C4C8A5BE8E6B2E01B 2.CEZALANDIRILMASIYLA
458,264,014 *2E87634B464ABD3F6A934097FC405D309DE32736 2 DANBURY'S
458,264,015 *2E8F9D1E35A868126D05E1BD1DF08D8D16E4F1DA SAITE0
458,264,016 *2E8D7822264F351A050AD6C19124B86D59D90478 onepalaj
458,264,017 *2E8F155D505B1138D7B29E958A3AB93F40CE669B 2.frachtgutes
458,264,018 *2E83BA4DD71BF99091BAB2505432710370AE2BB1 ONWARD TO THE BLOODFIELDS
458,264,019 *2E8BF06A8087903653273727985924097470F542 (>_<)O~O~(=====P
458,264,020 *2E8C712FD6C965D71405D574D9BA7301977C7D2C SAMMILLSTEIN
458,264,021 *2E80CD7041687245D672D55A11D0DD49E5FC3F46 [email protected]
458,264,022 *2E8988A1C81942F30917698DCBAAEA874F7ABC49 2LUETICO
458,264,023 *2E84A29773C8BB5DD8BB8E51FA2351928636B507 2-MAINOSTAJAN
458,264,024 *2E87267D276D858DA97A2D79D7A62BA92DE0C93F ligurian
458,264,025 *2E8D679C72FD44E2236DCCE1E3F78253C331482D 2-PEURAONNETTOMUUTTA
458,264,026 *2E8EDD6511DBCF3698266D3A8DE7765A9F678B23 2.roseboom
458,264,027 *2E8C1D8F4AC1DA230D206A2F2D0CBF4D7AA1C6C0 2 RUMTOPF
458,264,028 *2E877959FCF66A1012CA3E24B298BA354E24F1EF 2SMELLEDS
458,264,029 *2E8330A6384744802240FCB70D19C8D566BC7F9C orvillemusgrave
458,264,030 *2E841A26E6BEA70922988D0A679C1306BDD2F3D2 SARAHJANEROWCROFT
458,264,031 *2E883B76F4F4F1FE21FF32613C55219E34988A79 SARA WISSA
458,264,032 *2E8C82ABB217621B84BD3154F43B13EADFBBEFAA ÖSSZESZERVE
458,264,033 *2E82FE27E721E169ABF9922C7862C49AC91958D8 2YOU.ELLA
458,264,034 *2E860422CC7D4CF7DD9652898DC76438DD1C516B SASHAVOROPAEVA
458,264,035 *2E878CC10F055CF0FD4C52A74F0E5268B245F3BA [email protected]
458,264,036 *2E8D818AF7E3D22331ACBAA3B8F2BB9D613A8A8C sbavassimo8
458,264,037 *2E873A086B1D92A4971A8092F6103F377CDE6651 [email protected]
458,264,038 *2E845A5B6F021066D8E85138328A019B42C819E5 37.umerziehung
458,264,039 *2E867E59344767B6FD7B514ACF371EA6214D2642 llcrnrlat
458,264,040 *2E8F13A3659CF24BA803263E452E5E8F5A5406C6 SCHOOLBUSESED
458,264,041 *2E84483B5E72FE6470F3A9FEA0171DF2908509CC (^_~)*.*.*@======P
458,264,042 *2E8DB52221831E9DD901777CC1E4636C5F43857C 3b<- * *<==8
458,264,043 *2E8C22DED4C42B8491523B56CCFE53A740CC7D59 SCORPIONSAFETY0
458,264,044 *2E8C0301FB6A712F24DDD747759F37410E68E791 p414t3d
458,264,045 *2E81168FC021287DDDFC2DB29E99594F6238AEB3 LOPHOIT2
458,264,046 *2E817476E65FE266570A7E544CAB960D71EE7E3C 3dec1888
458,264,047 *2E8B3E03093FCB49D7AE8ECEBA1D799D988F76E0 sdemndsed
458,264,048 *2E8791FC2C2D695D65237DFDEB2589AA2F864263 3ILOVETHELORAX9
458,264,049 *2E84CD1F4F33345004EDCBABCEF3C3DAB9EE5C21 3LAFANDRA
458,264,050 *2E8D792EE43981E87736535906335422B9926392 SEANCES
458,264,051 *2E82D6AD658262E738CD3D518B9F48132EBD2A7A LORRIEBRANDT
458,264,052 *2E86EF314B8E2824CF31AC79CE6C555B0A6C327B SEILÁN
458,264,053 *2E8BC71E46B4545D51A35647F17E041B27CD3858 SEITENWAENDEN
458,264,054 *2E82AA633BFEC52616D13B204582DE38547C1C27 seitsensäkeistöisen
458,264,055 *2E8231F1F43E6B246599572A5177D0FCEB830845 lucasfriley
458,264,056 *2E8D3C79F5C974C697BC66CF973B5A2AEB46B305 PartitaNo2inCMinor,BWV826:Sinfonia
458,264,057 *2E80023B0DD86548E20E410B7C30F61029E92B4B SELBSTERNANNTER0
458,264,058 *2E871F8FD3BF48CF0C459055BFF6AD12160D6C3C PARTY-FOR-TWO-(POP-VERSION-WITH-INTRO)
458,264,059 *2E8E01F52251BC552D531499D87D4F8FEBB0B3C6 SELOSTUSTEKSTIIN2
458,264,060 *2E8047A4E767A90C27FFC12B47B42716C3CA76DB senrengapmak
458,264,061 *2E8A389E32BF1E3A76C805C865B15D2EE1D3EED9 SERAPHIM55
458,264,062 *2E8E32561E3575295CD9295827A6AE9D67659D03 SETH.ENSTROM
458,264,063 *2E8E20045DCC62105C96B4628B78139E7A3A1556 Luovutajavaikene
458,264,064 *2E8C38440F22BA0666E5DD65E4FDCCAA6F179A42 LYGNIODES
458,264,065 *2E8133D4BC93D3F91E98677FE918A6D0D59DD8A9 PCTNTLLED
458,264,066 *2E8DC3CCB82145C616A0A6568B03BF1C4D858E9C pD~0~osplat!
458,264,067 *2E8BB4C280F9D8C6E9AE2E13FD3B2807D40A8796 pedrolaugen
458,264,068 *2E845755F4196E998BFC5782199CA4B8ED209687 PENDULUMHOLD.YOUR.COLOURJPG
458,264,069 *2E8F04C50D3319A60F7BF1C1083745B7F1A80E11 4.HENKIL
458,264,070 *2E82B9EA0F5191CC60FAC399075BB5E127A7ABCF shane-mccandless
458,264,071 *2E859425109C8B9B14AC37C92711DA8113055E12 MACKMOLOCK
458,264,072 *2E88CEDC705E54AB360B12F255EB82B8286751AC 4myfidel3
458,264,073 *2E86639660D5622439E5322662A25288F3EDB8F5 [email protected]
458,264,074 *2E80A61E58122469505A945906078CF7F00322B2 4-P
458,264,075 *2E8A3130B411086533C5F0620C8CF6A274FC1CEF SHCHEPETNOVA
458,264,076 *2E89707218F2790F819C09FCF49E37165AA62B25 SHEELEN7
458,264,077 *2E8B5CB7AA8BB23AB841A7D6F0F4E4C779A2D79E 4QUIVOCAL
458,264,078 *2E86DAF62E1FC21A5F6C35C34B828082841441C0 <MAIN_ARENA+64>:
458,264,079 *2E8812E74797A7271F98FD406FE362617FC3B2D9 SHELTONTREICHEL
458,264,080 *2E8AF84B59B038BA0EE2AB3439572157AF9D08C0 MAJWEGAG
458,264,081 *2E854FC241DDF967C90EC4E0D2A55653BE7FACBB PHILLIP.BLORE
458,264,082 *2E84BA93C7548A9EEA487DA2D1AC0C89A5597886 MANDATENDRING8
458,264,083 *2E8A6FC2786FB5CF6EB2BE973CF8FF7C9C8E7470 MAN.LEQUIRE
458,264,084 *2E8DF736F0523072F1F058CE2C26888ADA922246 54.NESRIN
458,264,085 *2E8F5CAEC55F00F9BDBF1213DC0EED82DAD3FCF7 sidi.khaled
458,264,086 *2E8C6F85254223F32FB59671BD8EFEDBD680AE39 MARCELINOBYARS
458,264,087 *2E816DF10B91D7A98906E26137E0EA7EE238B62A MARIA.GOODWYN
458,264,088 *2E8EA8BD53836BE2CDCFA6C3AA6AA891E43A1A57 PLATENWISSELAAR6
458,264,089 *2E89F2A159C18718603FFC4FDFBD3A65CD53313D 5CUSACORNFLWRAOLCOM
458,264,090 *2E87EF1935CCD7048FF278823419DD26DBA2C924 5EITALLATSNI
458,264,091 *2E8F7304317E64F7B3411844BAAB9F28B6C230AA MARINIEVES
458,264,092 *2E831F2455FC6AF3AC6BD95EC9006BC2317F257A MARVIN YIP
458,264,093 *2E87655D07E534A6E7F3705C16F2516F7AF47B34 PÓRĚDA
458,264,094 *2E8B09A5277D50A2B3259040E94F3B5C8672D249 SMILECHICOS
458,264,095 *2E8C3537388238855E8E2FE14337C8CE4CF6584E MASAKAS
458,264,096 *2E8A187D3C671518934D12CC285659A30A3B0B55 SNEJYTI1
458,264,097 *2E8660159A0DA72D60E186E15CBFF9A86C03D6FF 5-PAKSUSUOLISY
458,264,098 *2E86FC8FA3D1CF1241286757146771083D0FFB44 POTRA
458,264,099 *2E876A3904866724DEDCAAECE0B9A8D195EFFA7C sober.morning
458,264,100 *2E8C7C3ECF78BEB483406C0D44B9A14A474F1075 p##p~`(_0)
458,264,101 *2E853CF553AFB0133A4F09BB25D1B3FC137FC619 SOHAIIH
458,264,102 *2E82018DACE196E9F396D4535B74A34057614FB2 PP*.*.SPLAT
458,264,103 *2E87E264A7F1F9DF45D71330FB13FEA243B7B262 MAURO.BECHERER
458,264,104 *2E8A371524945458549EDD295E96791D0C7E71B7 pr0d3m0cr4tc
458,264,105 *2E839473D0B587BACFDAC0AB897D949A985E3454 5 VOLLWAISEN
458,264,106 *2E8DC617A82FB841BBB93A4286AE56B8A87606BD MAYNARDCRANS
458,264,107 *2E8569A7E233BB8E1E225D66926B352F31D6539B PRELUDES,OP28NO3INGMAJOR
458,264,108 *2E8823B6256B2586FC67A398135EBF96A6EE7FAB SOPHIALAROCHE
458,264,109 *2E8F2C9CBEECC12DEB5F3C34296F38B74AB5B071 MCKINLEYLARRIBEAU
458,264,110 *2E8C562EAD00816A3A8827EFC78E45F195B8DC57 PRIMEEXAMPLE
458,264,111 *2E8540F4EBBB3821631059B0370EDC7744D060D8 SOVJETBURGERS7
458,264,112 *2E8F07FB1D6B7E7880BD050C7656323FEDB87064 [email protected]
458,264,113 *2E8DF57B8EC0ED6D804192A50B10660F060CDC14 MEETUBAJAJ
458,264,114 *2E863662215CBBA43EB8F0E4C7A47191343D6CE2 MELONYE9
458,264,115 *2E87CC933A4C92DAC10CDE045E9A5020CFF45758 6ABOLHASSANBANISADR
458,264,116 *2E8414B3390EC2DFEC140CD45BB37CBDC888B00C SPI1DE01I
458,264,117 *2E8E7483B3190E8C81CC52D27924BD0613D1E574 PSABATES
458,264,118 *2E8D4E14330A90180EB5607139B09CA9D131149E pscofxp4
458,264,119 *2E856BCFD32C813710B9A64C4966C6F05801BC07 PSYCHOLOGYBUSHMAN
458,264,120 *2E862A2553B118389A160D48E2E0DCAE03F4A54A 6BSWZUSAMMENAR
458,264,121 *2E8C976E803293AB467C41F5993AAD76742B498D splat.*.*.*d------3
458,264,122 *2E8FDA1F1F8EA50EFD23EE89E5DB74763D658F45 MERLIN.LAND
458,264,123 *2E8B31BA88599F1B0221C4338173EEA1404E1625 MERRILLKERVIN
458,264,124 *2E894A69B3B28760109795F7091AA536BAE51D34 purtached
458,264,125 *2E84A65FF8B0687CAB47F5FE1D05190254EE5608 splato~q------B
458,264,126 *2E8AEF30776CAB9E1F76B980B9151DA4EC388478 p) `(x)
458,264,127 *2E8315F837B8290ED9F59AD94359A24213930B10 mezhrabpom
458,264,128 *2E8EAFF1FC4A382D9450317EFD49372C5F45F787 SPRINGWATER8
458,264,129 *2E81F182593A122F3B79287EB4015D24A472082D MIAPORLAPAZYLAJUSTICIA-SANTOESELSE
458,264,130 *2E86CECE9DD4EA97A7342EC3D6961485A12FFEBA [email protected]
458,264,131 *2E8BB7C03896A06F59465878B20B713B6FDB5DBA michelleschryver
458,264,132 *2E885AC6E9626D08088129C304EC3E9B80C4279F 6OBCECACIONES
458,264,133 *2E8FC265D4DE3C39AA7763069AB1B0DE72EF0E23 6OBITELJSKO
458,264,134 *2E89C3453F572AEEE354977D42E358A224903A25 MIKEOLAVARRIA
458,264,135 *2E85DAE707BA3BE0DEFD40E129F35F3C4320FB5D stephen-heinrichs
458,264,136 *2E8885C1AB5F324514557DE4B91F2693303C4910 miltonparlow
458,264,137 *2E8DC7559D98533E20611276C54C29DAD0E5864D stevenkonz
458,264,138 *2E8DEC269091E5AE932F7667F45B938D9C97F523 6STREPEROUS
458,264,139 *2E8FA4803162DE53B8DA24023B7BE173B8057913 mishpuchah
458,264,140 *2E86C6558CC2CAB9BCBC6B483ED0FE601D92B712 MITCHELLTEFERA
458,264,141 *2E8EEA5DA391BAA6EFF93979CA6EC79DE5CABAF8 STREET-REPPIN'-(FEAT.-VORDUL-MEGA)
458,264,142 *2E801D1E1430638A77044AAB0250208DFA2747F1 mltsgmnt4
458,264,143 *2E8D2D00A83DA17BAC6F288010269E925550FEF2 struji2
458,264,144 *2E81FBD8FAF960A3D5D16BA6C7AE0EA157C5AF83 RAYMONRIPPER
458,264,145 *2E8BC30C248784E757D00857F4522C103D7B2F24 raymourad
458,264,146 *2E8830D82D06EBBFAE51976C6491FA726E2AB258 SUE HARGREAVES
458,264,147 *2E8F3E33F001BD8B0D04DE2919E05CEA7C0B0EB0 RAZZIES1234
458,264,148 *2E811E7C233AEA798DD9EA08B5F4A66E7810B651 MONROE.LESKO
458,264,149 *2E88F8E92CDD6C603E5D4C63C396539DB5EA96D9 READERSPORTSES
458,264,150 *2E8E984582893F9DEE502046AB2C417F22ABBED3 [email protected]
458,264,151 *2E87905DA04044A5CA144FDE2C8C2B4839C590A0 SUMITH.FONSEKA
458,264,152 *2E82AF35960930384B58DABD3DAB97193EBE072E montegessner
458,264,153 *2E82D1FF1398CA622EA12386BC5991B98DC93D70 MONTENOTTEI
458,264,154 *2E875CA2AAB2F2BED9D0BE7C0E9FA899907DBCD1 MONZURULISLAMAGUNCHOWDHURY
458,264,155 *2E85829BF87085CD807911C8C6622689B42C0BEA [email protected]
458,264,156 *2E828B33EB66B8348ACDA58AFDD7CC13D3C09F9A morganatisch2
458,264,157 *2E85228A66947E5E7757A790E6A2C766E6CD7B19 REDATTE2
458,264,158 *2E8D073C9217DB759B8CE283C5614115E7FB44D0 MOSBRUCHER
458,264,159 *2E8CE2AC6B5C5D9B945435C246B5F6D9D153F5E1 MOSHEHICKLIN
458,264,160 *2E89B0D7880D854905A77477365D737B6631BB72 REEBOKFRANCE0
458,264,161 *2E8A7D2FBCC8728A0C191055BD6B84BE7DE206AF MOSSES123
458,264,162 *2E857BAB090612164B3751D2DFB8D2C69A3E5BE6 MOSTAFA ABDEL KARIM
458,264,163 *2E81E67695E41BD55D25815B6F722DBD55A12734 7. kapitel: die strafe
458,264,164 *2E8763F818E0DD23F8325F6855AF0E70E6277FB6 [email protected]
458,264,165 *2E8FDB7CCAE61825C441ABB7BF302BDDB9E370A4 >mraaa
458,264,166 *2E8BF26AD307C7FB1F4116951D3EC11C87F8DB71 MTLIGERE5
458,264,167 *2E8086A9D3C94183EBE038E9732706FDFF6C6B7B MUIKAITI7
458,264,168 *2E84B2383779C15046020F3436E5F7D373A41677 SYNEDES7
458,264,169 *2E8CAC63281AEFDBB47B7474F5F07FB9D18F458C renaldomcneme
458,264,170 *2E80425F89DC2985A5C4EAA11A3A918102F25971 szubrégió
458,264,171 *2E8E235463608EF44D645B07712414D61B68C8D8 REPORT1987
458,264,172 *2E8BF079C764BFDA0E608F94AD6EAF78612C7B82 RESULTLESSNESING
458,264,173 *2E80789C2D2FD2EA337796EA2CC18DE00417211C murraymaglaughlin
458,264,174 *2E83A13890F6A2781003BAB79CDD2261482BCBEB muscle25
458,264,175 *2E8449B8DEE28A406D30C1F63B2B38D6A9959A22 MWIKRAMASINHA
458,264,176 *2E8EBD791252959CDC1B9DF6827295A973840DF3 tamarakhoury
458,264,177 *2E8063B3AD736CA826A8C1B0692034CB612140B9 mydrughell
458,264,178 *2E8ADB5F627DD6FB8B5AB34D963C78557C2249B8 RICH.CATTERSON
458,264,179 *2E8A4CD64F386290B416A06C21C2A8AAB8D52896 RICHCRAGUN
458,264,180 *2E85FC3CE65E0B44F826B4DD23606E0C1FC3ED0C tasikae8
458,264,181 *2E837EA1A0A17C74064834F2EA259B46E3FFAD49 830067 HERTURLUDAYATMAZORLAMAVEBASKIKULTURUBOZAR
458,264,182 *2E87EA73B24D9D3AAE860132C0688DC7F6332378 rickielauterborn
458,264,183 *2E886D20AEFD7A9BFABCDC8D350708774B082F4B NA"
458,264,184 *2E8CB0840D996E57824579C35A26F057D8F0CAD6 [email protected]
458,264,185 *2E8A6936EDA59942947F8E152204A4A2FD3A2576 8aa
458,264,186 *2E8FFB6E4A5C60782B6B7856A137F46983171945 TEDDYBENCIVENGA
458,264,187 *2E8C46280A18C0D44910AC6B78C72A27BA303947 RINALONEN
458,264,188 *2E8AC7FE595EDEEC561AA721F66FD210860B250B ring.r0pe
458,264,189 *2E8F89A454984E5E9776C4D815E884529B9FFCB4 nashville-shuffle-boogie
458,264,190 *2E8EE8B02003F88138568A836193EBEE71772CC1 8BSWECOASTBSW
458,264,191 *2E8E9D12883C2A0B08C54F38C972F3C2CE540990 RITAACKERMANN
458,264,192 *2E8FD2656314272BD3658C2ED0337455FCB88D59 TEMPE'RERA
458,264,193 *2E8A9141A64D4350BEB94F0B98008091EE04C3B8 ROB.BENTE
458,264,194 *2E864AAA7FB1A069834B74F69D97CBA4C08ADE9E ROBENTOS
458,264,195 *2E87F0B980EAE5E7B39FD5DABB4F6D9799C0B238 ROBERTOCOWDIN
458,264,196 *2E8C7D6EEE86A139E0603C1AB8936A06EB1E43A1 NBOGOTS
458,264,197 *2E82B2126193C63DBC35E51F3B09FD620C6ADD57 ncientificarooseveltrondon
458,264,198 *2E8E9BE8C94F9E1DAF226C23AD92564EB1CFD19F ROCKYCHIZ
458,264,199 *2E8E1928563AFBBD8F0C3842AFF8AC8965C1BDD9 8ilovemacintosh8
458,264,200 *2E8DC20EB4BF9677F197A051C145E9CC2B8E1C2A NED.ULVEN
458,264,201 *2E8AC6586DF4C746A9687B9F3FC9BAD9AB2FEFCB NEERSTREEK4
458,264,202 *2E88D7F20B6093349F5B7168C4D59526EB575007 NETWORKSCOTCH
458,264,203 *2E896896A981FF0992A7E907D5BB03267EE55E55 NEWAZASI3
458,264,204 *2E8A03700F5C82BCE02DDBBDFCDD8E9F23572E01 nextphazenetuserjew
458,264,205 *2E835AB47EFFCFB7BB8F3AE0A38D86D217984F34 )8(O~ @----P
458,264,206 *2E85FDDCED23A81F6BA53DD96A6BF42FB63D7E54 THE-FIRST-BOOKE-OF-CONSORT-LESSONS:-JOYNE-HANDS
458,264,207 *2E827657C3FB03387ECCCC67124A172524DFE1D5 nickolascahela
458,264,208 *2E80DD49C912F9666BFCE9B2E79FA0A819280B49 THEHANSON1996
458,264,209 *2E8F58741BF38040D0405BC962CF8595A0EE0C11 THEHAUNTEDROAD:TRAVELOGUEMIXES
458,264,210 *2E86F71669E5D07DFA33C886671766DC3DCBA020 röskamp
458,264,211 *2E8DA842DD24161318B1E8ABB9873E98256375A6 nimeni-on-dingo
458,264,212 *2E83C7C03AF8FED00531607FBA119B2F5DE36E2A ROYCEPFAU
458,264,213 *2E863356C16485688681426ABFD2FAC63CF074D7 RRAGOSLAGARTERANOS
458,264,214 *2E852323B426F6FAC68B5FA699E9CCCBFD666742 rsbmttd6
458,264,215 *2E8E40F47CCC92BFB894C9344944A94820714255 8ZUCSHBPEH
458,264,216 *2E85620508ECFFE3454FC0F1D68FBB35B582AA27 NM_008940
458,264,217 *2E8E97685DF2EE1FB4DBEF8C20057B1D7DE55DA7 nntttlst4
458,264,218 *2E8867599A1BDA957A35EC0216303FCECEDB83FB noblebyther
458,264,219 *2E8364CD537425EFF9CC3B38D75CE3682EE3EA2B 9ALEXISPERCY
458,264,220 *2E84024C000638A550D7D72F5A97693574155DF3 9ANYONEEVERYONE
458,264,221 *2E859225B087F3BADFE1E2323E4C270675817327 normcase
458,264,222 *2E87C12CE98882B2654BBB3C3AA5A56FA7B0FE3F thomasperreira
458,264,223 *2E84462D14B3D51F08652684BCBBDF75743FB780 9COIFFIER
458,264,224 *2E811D08B1FB3BAA3F5FA5809C6993BA304F6FB3 thvj
458,264,225 *2E8A1EC0871705E002D4E285D72CB04CD8E2CAF4 NSZINYEI
458,264,226 *2E835246AFD0B7845E0AFD9404EF0810DE243FFD NUBEAT1
458,264,227 *2E845BCE63AB369AD255D68EAF3CD0202C0198D4 9FAVOREEROVAF
458,264,228 *2E8CFEA6278A7F22F67968489BBD9FEEBFF89C49 S4KH
458,264,229 *2E866095B55381A9A5A01FDE6E95B3F8BAE7D76C NZARIWNEY
458,264,230 *2E87E02DB8A78DF221A35AE07B03C7AAE27FA65B O37P60
458,264,231 *2E800C10A327DF6237BD4F669BA3D46B074AFB3E TIMHURRY
458,264,232 *2E8AC05CEC1803D5B878A85DAAF78570C03FF36C 9majordome
458,264,233 *2E85F01142D0B2CCDF0006216125F86BC9506A33 odczytal7
458,264,234 *2E8A52C85D6BDA43C57934CE3AC63D18810576A5 OKWUDIRI9
458,264,235 *2E86851220B5125A9A30A85443C888C46B81A1D2 TOMCATNANCY9
458,264,236 *2E820199C7072A4023DB47D220A0736B572FBA65 SCHLAGKRAEFTIGSTER0
458,264,237 *2E856A389FB7BB7891C2CC12724272FBC60E880C ONNEDERLANDS1
458,264,238 *2E8A72A5725842E14148B61825154F1B8ADF1654 A1?
458,264,239 *2E83013F5130DA555B29886E9FC9F84AA34C802D SCHTICK
458,264,240 *2E8F75F213A3B549AC3B499C7D40F1B41BCE16B2 O><~(#P
458,264,241 *2E824F920A5F71D6F23010D25AAF0F92D0158A95 a5,no
458,264,242 *2E8A64CB98F030573F405C89E21CB6474F5BCB79 a6t(f
458,264,243 *2E86F2CF4EADF8D3C328D4DED42DED8C6C7F2C2B a8;ub
458,264,244 *2E88A587FE6167C6ED36B9C2258F478486E867AF AAB+|`
458,264,245 *2E8AD55643A4B9D2E9494C372862D351918D2281 sebastiankello
458,264,246 *2E827B3E854817D0BDC8CF784A38E2E5DF032327 AABCZ+
458,264,247 *2E893FEE175AA7AEB956766AF25C64757CBE2D95 OTHACONCHAS
458,264,248 *2E8A21F082068D0B795846D7A36CA004F46BFE7E [email protected]
458,264,249 *2E84F6A61B71DDA85BD1F0CEAE8AD63EF95570EE our-own-esp-driven-scene-(singles,-comps-&-outtakes:-'95-'00)
458,264,250 *2E8592510E36B6E4B35255601B8CFA728A4E08C4 OWENDURSO
458,264,251 *2E809394D16CFEE34CE0CF46C7C100E9C7DF7DDD SELECTEDOPTIONS2
458,264,252 *2E838E5EC5A3179C76B80B1150213D06759ED255 P->~0.~o>-<
458,264,253 *2E8DFC45B1A97952394537927912D30DEB75F5CF P==).~0~O(00)
458,264,254 *2E88B015FE8A1A301CB72F133AD50848AB25A877 [email protected]
458,264,255 *2E8E38D86F20B0FFF8B172CD841C31C79DBC7107 PADRECOLOMA
458,264,256 *2E8C7658ABB037216FAD4732EEE1D36EBC1B5CF6 AAQ)(
458,264,257 *2E8DC2815FE534F3C85F2A5E887DEAF72B7A4AB8 PAGGAN.BOCHHMIAN.WAALE
458,264,258 *2E8F0FA1865F3349BBF7C8BB057208224ADA03C5 Aase.Pase
458,264,259 *2E8688D634D660B98FFE706BE35429A850432ED0 AATIOMME0
458,264,260 *2E845E9A49E133EB683910722370260A8F152943 TRONQUERONT5
458,264,261 *2E88AEC22D1A9B16638A9E5BA1E113F391D44DA5 abastec
458,264,262 *2E83D16284AD9D30FBB5FEA91659A8AC7CD34DCA shahistë
458,264,263 *2E87804B104AE54C49B0EBE57EF8E7F7393C0F59 tsvetelin-bogdanov
458,264,264 *2E842C48894A936913B40614EF86CD60E1C457F1 abitj
458,264,265 *2E880ED880586EB8FE23A782329208D9D32B7157 SHELBYHASSING
458,264,266 *2E8218BA6CDB442025A08AD9BE315B774BD03D65 SHELBYWANGBERG
458,264,267 *2E877FD7D434D23562E39DCC64C3533F679742FE abt0g
458,264,268 *2E8EA9C9C2B2C4619CD7E8F31BF1AF892586D2F2 [email protected]
458,264,269 *2E851767C72181BB1A5A6DED1D99818377868955 [email protected]
458,264,270 *2E8BA3CB03C348707164ACEB631110C704D1B58E ACCENTRERESTI8
458,264,271 *2E88E97386EB67F60075223D4E04FB61DAAC7511 SHON.SLOVAK
458,264,272 *2E803CC15366A289DFF55301E16E91CE2823FF87 SHORT-STORY-A-CLEF
458,264,273 *2E852DC49E8E03471AA8FE911759047194A7FCED SHRIMPMERGE
458,264,274 *2E844ED203A72E5FAD2F1053321610E28C857EF4 PASSIFLORAMOLLISSIMA
458,264,275 *2E8275A3DAC8757D7937E482ABAC05C65572AD37 SHUTTLEBETH
458,264,276 *2E84FA2B3993A98C1A283ED4DABE1BD093D6D70A AD).
458,264,277 *2E882AD78FC2769AEBB861BAB9F38CAB5EC2755B s?ie=UTF8&keywords=potatochip&index=blended&page=1
458,264,278 *2E83A7F1C0025905A2595363077929CF8B9FF062 ADAMPAUKERT
458,264,279 *2E8242D8D868DB4937210DAD07DBBF1B9F00F53E tysonbollywood
458,264,280 *2E812C88068AE51843E5D763A83D67B32D4D68B0 tzetsetzetse
458,264,281 *2E8CB1FD2B58E11F8503B231EC6A37FCE9DB9E1F uddelegere
458,264,282 *2E89D248B6A78C6119B47A93D761CCB87A0C6C26 PBIEGELSEN
458,264,283 *2E8091A9ECB5DBFEB69C52BBF28DF5057288E441 AD=;U
458,264,284 *2E82F2E3BC554ACAB85826F67C1579A00AF5AF47 skeatta16
458,264,285 *2E8D5116E686E68260B42F06AECECE228CAEB55A affiliam9
458,264,286 *2E8A0032ECF0B2D890E704AC0238BD133A9A9013 PERCYTAYS
458,264,287 *2E80B74FB90A1B6612455632AC5BDC58ADAA354C PERIOECIANS5
458,264,288 *2E83D32B025A4BCF0EBAB9FA4E58E57C03D089E5 [email protected]
458,264,289 *2E852B3595DFE0AF4FBFDBC2B1C8F9D7878E87AB UNICORNJACKIES
458,264,290 *2E81CDC8C14FFA27477EAA12841BF2DC782D1F34 SNOWWOMAN
458,264,291 *2E8A264058723CAA4F704DFCC67E25408EDC84E5 solketchersid
458,264,292 *2E8191A081B9DE4E10816191E96A162320D2EF49 phil-rohr
458,264,293 *2E830345F7CE69B04AC8C7DA59D6B4575C8700D1 UPERHIGH4
458,264,294 *2E8F9F7757B29A17DA03E9D284FF408AF37D29ED uphills
458,264,295 *2E869C61C8620188E06EC2664788FC5F4A6507B6 sonate.nr..5.op..10.nr..1.cmoll:.ii..adagio.molto
458,264,296 *2E8683205D83982EE6E42624C87D048EB054D258 AHNEC
458,264,297 *2E8CECFE0DB7AD2FD2F85D174CAC3F3DE015D33D PINTERANDISHMAN
458,264,298 *2E8589AF534D002E793DA4CE294AE35E2A5393A5 USER_TALK72150302
458,264,299 *2E8C2A205FBFEC4B826BBF9CA1AC8EF35BB36475 AIOXB
458,264,300 *2E800C04B6BE59C887A40F20C24D99361097F360 [email protected]
458,264,301 *2E8C2F1659A11F49D097E66E40D6826173AA2BEF aiu/+
458,264,302 *2E8E9B5683C0FF7E50AA66383FC41BD93746F9BC PMNTRND
458,264,303 *2E8AD7733765E41CFDEBA3A5B365BD7488C2D777 ajn&)
458,264,304 *2E8703F0B01D62ECC25C32C2FE84D6FDA968E315 V170655
458,264,305 *2E8580100123AD8378A4F5E2996C26D27393FA46 [email protected] ~ ~ ~}o{
458,264,306 *2E8DA0ABD223C7A27336CA5091814DE91713EBF0 VADERALIENSING
458,264,307 *2E8856E68B5278A405C30F8E170E8471019EC925 POINTYPARTISAN
458,264,308 *2E8F0F1E1A0C3CE6CE1CE17651599926873BCAF8 akpy$
458,264,309 *2E86D9861FA4F345BE07564B3A7E63363E1AAB48 valentinascensio
458,264,310 *2E8A148E8488ECF018ED6F776F5CFD7A1A5F0534 [email protected]
458,264,311 *2E8314E1D7FF9FBC104A2E99E8D09CED396B0B36 ALANCEO4
458,264,312 *2E8C7A2E9C0D8A387739FB5A1A806F02DD4DC13E ALDEN.HOVSEPIAN
458,264,313 *2E8A276BC920B2F3271329753324FF2B2B11EF56 alectagge
458,264,314 *2E8DC731DA63E570DC52483A08A42196142BF228 vanessa.ann.kelly
458,264,315 *2E83E3FB98209AB2019F1623778B3EC6137A0012 POTRA
458,264,316 *2E8A3731D081ED802CDB0606B437EBC0E52500C5 p-----) ~ :p
458,264,317 *2E8E883B0AD6621CB3CEBC8202DE52B19654A6CB p==p ~0 ~o 3b<
458,264,318 *2E8230BE35DB7E85CD3C5E0E0C5866AB68389FD0 PPPFROGGED
458,264,319 *2E8AB92C675FE6361E290837213DF6A3320029BE VENERABLE.HERMANDAD.DE.NUESTRA.SENORA.MEDIADORA.DE.LA.SALVACI
458,264,320 *2E846C74BBC8A4DD2A05F666DF78423F99343282 pr8445
458,264,321 *2E8883AC3F3EF5452A617AECD5F92B3DDD24FB32 stacyshey
458,264,322 *2E85D777BFB0695608421EB2BBA255D834C839A3 vernsomerfield
458,264,323 *2E8EB4FEECE3AB1BB277E18CFAFF86081C209FB6 ALL.TIMES,.ALL.THINGS,.ALL.PLACES
458,264,324 *2E864F18B30D2C715A4358292E1F07B41848D562 VERSES78084116983
458,264,325 *2E853DB61EC9C8500367D1C44C7073D2DE078B41 VERSTREEK3
458,264,326 *2E81E8FD0FF20FFC1C2A86695EB3E6E07D564BE3 vickieklava
458,264,327 *2E8554846963B3AF5A574695B24E29A41E0CC0F7 VICO PL
458,264,328 *2E848CF00F2855D3561864CB84122880DF883242 STANMAXI
458,264,329 *2E8BEF1B39DB7C4808DCB6EB9D8EE40EBACA2F8F START-GTPROGRAMS-GTS
458,264,330 *2E85DD164A58E1FC697121A3618446B0E8B8A97F PRODUKTIONSPROCESER
458,264,331 *2E8582CCAF36F30D6CBB232B79205442858C99EA projectmohole
458,264,332 *2E874E41EBC9CADA29ACAE5F0A91671CA2D658D8 provets4
458,264,333 *2E82FFDB523AD39714B13B0DF78CEFFA621F147F amadodittemore
458,264,334 *2E86D9D924A57803AADCAFB0C07C84BD82E88462 amag
458,264,335 *2E8C6C8188911C7C4E9B0593050E84A1F5EBC7C6 AMBER GOELLER
458,264,336 *2E816DB93EC42D023280B62509DBCFBFD7186594 AMCDIEGING
458,264,337 *2E88C5BEB899F971A9A7D68EFC8FE053C7B28C5D VIVIENNEBRAMMER
458,264,338 *2E8974CC9E491F4FAB3DE411D50D27C0415E98E3 vivienneoregan
458,264,339 *2E893A709ADEF4EC9F4481B093DB08B8A5FCE1AA Vleierijen
458,264,340 *2E8895E18E2AF9B3500DE63BBF7BFBD458E60236 STRATBASKET8
458,264,341 *2E8C25ECCA901598F5F3491FC266B232CB55286B STREET CORNER NEWS
458,264,342 *2E85B38735077B9BF1BA8511B7C8B791EE1DCF76 STUBBLING6
458,264,343 *2E84B26428762D73629C6C4D2E793F0324BF055B VOKINBIR
458,264,344 *2E8F9E7F9A5272D56FF1885D7F170F84F20919EE STYRTDYKKETS3
458,264,345 *2E842FB68CF65C292B18C34680FD6DB763ACF573 VOM-TSAF
458,264,346 *2E8B5E1BA79534FE063FD195F6ADD62FCB0B1207 q~^
458,264,347 *2E89D0CE5E8EE907381EEC9A3F8C16A9D07E9763 (^_~)~.`QB
458,264,348 *2E8D4D4AD36FEA6EA126596B14385A8C84D0FED7 SUNBEAMSLUTHERANSCHOOL
458,264,349 *2E8D9A5D574562B4F9C4E4EE72F1DDBEC484B564 SUNDANCENICARAO4
458,264,350 *2E859F772F5172157C2C37381946441732852AB8 WALDHEIMAFFÄRE
458,264,351 *2E8117DB41A9ECB39754F1162F526A8FEA2D2F4B q).~O~o)0(
458,264,352 *2E8D0961B3A7ED7C40354A6693DCB741087EB4D1 susan.ernawati
458,264,353 *2E8D6CE7EA93BDDB65F0118702B96808F50C43C5 WAREZBILL4
458,264,354 *2E83B6AEA9A5DD321B2AB808E96F7E99459BDCF1 SUSCITERANNO2
458,264,355 *2E8B6ADE225FE50FA42BF28A3439AD183F985D3D SVEDJEHAMNIN
458,264,356 *2E8180ACA920AEB14E46B4ADD063730141E6E6B5 [email protected]
458,264,357 *2E8D53FF75040320202F4A6B0DC648DB2C2011B8 qq|7
458,264,358 *2E8D4AA040103DFA99A5B3DFB83E46FEFC54644D waylonpecore
458,264,359 *2E887E2FF4FF53D8BF7E3CB4AC40C32EA2207A1D SWEETCHEROKEEF
458,264,360 *2E844C1CFBA1D1F66D1D8CE6F718C9E4B4F5DCB1 QUIETENED?
458,264,361 *2E840E3C43620C69F398172035069495BE398781 WAZNEBSW1
458,264,362 *2E8A5E79C999F734426C0326073A0466B2C2479C [email protected],
458,264,363 *2E81DD4F58C3DB530592EAA0E5DE888F658620E8 [email protected]
458,264,364 *2E8035CA9341813AD8A69EDAB953696F2C501166 WCADOR
458,264,365 *2E8F15356E70CEE4FB8515B3A3FA17E694269309 quintinballan
458,264,366 *2E8A5ACF413083A63E389112E29EED6577288C96 ANTHOLO9ZE$
458,264,367 *2E8404A3F6AE9539B4DC8E7998FF2000DD7C9FCC syed.imran.fazal
458,264,368 *2E83E02587833D7423EE5E51086C72447E0ED5C9 QWER082
458,264,369 *2E8B0DA75E08789C18D0C5A6CF45791EA3911FD3 ANTITOBACONAL
458,264,370 *2E872990362F002066FB52447D440BAB4DD6022C r31nt3rpr3tat1on
458,264,371 *2E887D7734D19E05E61C670A133283D3E8A88621 RA710NA11ZER5
458,264,372 *2E819EA6643440156EEAF90B1C5C32F63581FB13 ragzteming
458,264,373 *2E89C26DC31B9627F7B894698B25021C91E9157C A$OIB
458,264,374 *2E894C0641B93F86A5EDA1554AC344A61BEE4E57 TAEVER
458,264,375 *2E89C4A0E3B61989A46F3C9F469F62CFDF3BDB6B WERTSCHÄTZT
458,264,376 *2E8262274521B2E44A0B78A09934D74FB0356CA7 wesprzygocki
458,264,377 *2E8670521B99CA3950050135DFC15EFFD1EAE030 westonogwynn
458,264,378 *2E8342DD44E365D355A1F635D9BDA1AE63C4D728 WETFLAKEYBARK
458,264,379 *2E8F83B5E282E0EC42193D98936828377CF1E8A2 ralphhirao
458,264,380 *2E81A6A9DB0D0F7859CFCDDAEF14B35290E424E4 WGMLGGNG6
458,264,381 *2E8940EBBA4BA390A7DF4FCE8E70F449F5B00EE0 APFg
458,264,382 *2E898E5A6D7DEAA3D49FF4400D61FC354D23CC20 AP-PLOCK
458,264,383 *2E8A60138EB604348BA5103A671D13A4944CB1C7 appurare
458,264,384 *2E87764BB3EE4D878E2C33C2D5BC50CFF6F4305E RASHADPATRICE
458,264,385 *2E830783DD38838FF9D0D04F11B1B84FE9478447 WILFORD.MCCLARIN
458,264,386 *2E85217E686A204A46CA784B6A3F539714596F1D wilfredoridinger
458,264,387 *2E8C00B69E6767D35378B7FE12F259AD136C44C7 [email protected]
458,264,388 *2E8FA419024C9FF5412324317B3F92F9578DC80A william-creswick-lovell
458,264,389 *2E8D1E855813D2AA10A05A2F15AAC097ACD97F25 william.h.corliss
458,264,390 *2E82B0C0AD0C04134EA1C259539F2FFA956745F9 TANIA-ABREU
458,264,391 *2E89980671282BC97AC87B17D8D513901015E50F TANYAHOLLY
458,264,392 *2E8EA5BB6678110D8C1D34C4E65C9F6B86DA8FC2 araleses8
458,264,393 *2E8EF16ED6B39D3DB015683D27865C0820B482FE wissam-akram-azzam
458,264,394 *2E8A64A8CBBC40213FFF8BF24F058F08120591D2 r.crumb'smusicsampler
458,264,395 *2E8EE9FEC40FDC302A394270A35D06A8CF4436D9 TEDŽAN
458,264,396 *2E839A30ADF53D56FA24B1E3963F0DC6A3643F72 ARNOMANS
458,264,397 *2E8ABAE1C5BA2047648F9D2C725B33605D4059D6 ARTHORY
458,264,398 *2E81F32CDB82E5190DD55C6186CE224E9878CAA1 TERRAFORUM
458,264,399 *2E8DAD7FE00960AA6F735AC1633AF417C5C085DA wrmd
458,264,400 *2E82781F5C506E972AEA85A212187EB956F1CB43 WSGRL1
458,264,401 *2E8F1F7667E5490799A43E292E74D9DC6B911120 terrymagnani
458,264,402 *2E8DF1457BBAA31CF60E16D526A58D1D0BD00AEF TERRY.MCDONNEL
458,264,403 *2E8814CBB2DC7E33C184352678C1475E79B7CDB0 asamahala
458,264,404 *2E888ACA9C6072EF422409260E45A1152A8FE543 REGNAHCYROGETAC
458,264,405 *2E85EB863C87ED5AAA4AAA244E05C02D4A22FA0D wuddala
458,264,406 *2E88B06AA52D452D4F432181F30B1F5E017BF505 WWW.1X1Y.COM.CN
458,264,407 *2E88A130FC088FD80F5C538372840E5AAC991FA4 REKONSTRUUJEME5
458,264,408 *2E8C213A05354970C9E490D1EAFA0288D4AF3979 REMEMBERDREAMS8
458,264,409 *2E86B988100BA7A106AD6B3E5647F376F1DD7EEE THANHVEITZ
458,264,410 *2E8A41F287B88775DF6F86250E65747B00B88A98 thatcody33
458,264,411 *2E88C78C720A4F486DBA8875403E5C1921FE0C3B THATPHILIPS12
458,264,412 *2E8BCC345C3F8D16B40A41DC4D7C2B343CB719CB REPROMULGATINGT7
458,264,413 *2E8D6334A0E044823B294474EBD3886C00BB8AD0 THEABIGAIL76
458,264,414 *2E827B6430AF303729077A3D8BBF7CDE5A00BE6C TheAlbumFormerlyKnownAs8LeggedDanceMoves
458,264,415 *2E809332F80F6B9A63A3B24231A1325840BB411B [email protected]
458,264,416 *2E8E408DDF9EE0B25B8C3617211D91C7991775AD restwechselwirkungen
458,264,417 *2E89D30E6D790483D5CA88AADEBEB233CB03E2EE [email protected]
458,264,418 *2E836EB3FC09508B3B863EB4F217E9FF55DACFC3 XIMENA512
458,264,419 *2E8D1DCF159023928C406C74CBDD57A2DDB85A50 ASHLEYBONNENFANT
458,264,420 *2E83F7ED3BCE79349017E61B5A9A42B48B913FCA ASIOILLEMME
458,264,421 *2E87D325601C0B29F72DCC805345D18BAAB9F57B [email protected]
458,264,422 *2E8F7F9696EAF4C71B4DEDD5620F77209620C087 asooisins
458,264,423 *2E8B01924E223E80B5B8282ED67C1DDC67B7D11B aspenf
458,264,424 *2E847828C3C22D7B12E588C88C9BB67B4D10A3B7 THELYTOKOUS-/T//I/'L/I/T/@/K/@/S
458,264,425 *2E8218C99D6E76CFCB31E031ABB2495BFFC13A91 [email protected]
458,264,426 *2E8DEC2AF5300D8825420688262DD7DF378A8D6C theogrambo
458,264,427 *2E8D6624457BA229742C86266E201EB21EEC4BE2 [email protected]
458,264,428 *2E8AD26D7BF5564968C6F7061E03D50BC529E9DB aujp=
458,264,429 *2E8E5BA11B1085284E7934D96890D60727A030D0 RKKEVIDDEBEG8
458,264,430 *2E84817D44A6478C8B483C245CA19BC98AD601AB there-you-go-tellin'-me-no
458,264,431 *2E83D6C00C4D4D11401D19F0C66A70206AE77C7D [email protected]
458,264,432 *2E8F306A1F32C749F84559DF373751DB68A7670A ROBBY.ROGGENBAUM
458,264,433 *2E897C5DE2B20D5FD595D53206C27165E40B5F07 ROCCOCHAMBERS
458,264,434 *2E8B79CF1C5936EA69AD261521B8CA50B0325B73 [email protected]
458,264,435 *2E8B55211AADDBF94A648864CDBE56D50A81BDF8 RODNEY.POPHAM
458,264,436 *2E816E3C0BE3895A8F86A7B3489592C3DE642F4D A-WHISTLE-IN-THE-WIND
458,264,437 *2E8C795D5F3C6822BC5598E5217B61A69ED7F858 ROGELIO.BLEVENS
458,264,438 *2E80F3B1CD1942271B7D824697BAE74D17D6BC1D awp=u
458,264,439 *2E83BB7B16F6701542F848D71F2162D5E0FBAC8E rolfaarons
458,264,440 *2E892E24B5A2BA09B06D150D7568DEF2B7EF9C6C ax?lh
458,264,441 *2E8605E563DE34972AE5BAA4EB50DB5372DD1C02 ROMANCEROGUITANO:CROTALO(MUSILON&DRIENERLOOSVOCAALENSEMBLE)
458,264,442 *2E8E6BAD9458B7AAA499F483EE40292233D1440A [email protected]
458,264,443 *2E8066EAAE478CAE5445A7F75814C33D8328D98B ROOSEVELTABAIR
458,264,444 *2E8B4675817FC2C38DFF7D980BEE518E585C3479 ROOSEVELT.DIGHTON
458,264,445 *2E8317C7850CEDA87FD1E50FF3B31AC090BB1C97 roridia
458,264,446 *2E89C79DF737D6452952C13A9FB894648B98CA09 rorytomson
458,264,447 *2E8036EB325D0219A562632499612C98D0059009 roscoehurde
458,264,448 *2E8D38B5A5024BD390FF19FD5B8FF4FC4B398D04 B00+11CKED
458,264,449 *2E88DD73FD528BDB453AE4275D27F7A19DC365C1 [email protected]
458,264,450 *2E8C6EA99C80726AC8EC1356E3DB6D0D91C22DB4 [email protected]~0.3B<-
458,264,451 *2E83939B8499535EF34603C130684D31091777DF YUELZQRXPGD2HTF3
458,264,452 *2E8F011135C254CB7AFE2A400FAF9B5A4C4BD7EF >-B0O~-O~-D######Q
458,264,453 *2E8136620E4F965CFEFCBDF436DBC0E34CCBA74F ROY.FISCHLER
458,264,454 *2E8EF2BE97928399898ED33B91DD4FFF500CD09A YVONDAJOHNSON
458,264,455 *2E84389271CFD027566CA63FBFF4945FA97D8F76 RQIBHVKEYZMSU7
458,264,456 *2E8A26B8E6E9603E8636792B0F6BC1321CD9BA34 rschnitt
458,264,457 *2E8C0F7E85100B1F0B81CDCE98ACEE76DE607EB5 TIMOTHY.NETTE
458,264,458 *2E8D75D537A3B4BFBB367AFCE8E289C62BA296D3 TIM.VERHOEF
458,264,459 *2E88F1D1E89A2C2560FA7A422D111B3D61859E9D B5CX
458,264,460 *2E86CDAC619E3DD2EE2C894005BEF136FF8FDD53 toàn或pau
458,264,461 *2E8FEB99EC33FC3E0675B6A8CC5EAE721FD11EF4 russellguhl
458,264,462 *2E847863A3C207B35A473E4044FB43D7747B5DF1 TONSAFAT
458,264,463 *2E85F6C443B0FB189B12492DF102755E205F8CF7 b9+tq
458,264,464 *2E86926D84278BD43AD3784A730CCD9CC7BFB638 δυσπραγείασ
458,264,465 *2E889A1125B601B183F6948FC1821AE4C2281602 κενόκε
458,264,466 *2E81A4048A0A14F3FAAFFB843883B87FA15F29B2 ἘΣΒΆΛΛΟΝΤΑ
458,264,467 *2E8176F04542D1C9F499B52E0EF051A2A94E4F7E sammalueg
458,264,468 *2E817F2C6F2B8E273374E39311F7102207294803 BARTONGALLENSTEIN
458,264,469 *2E88B2BB9BB7C42D13DC8674ACB1AAD6756BB1EB АНИСКИНСКОМУ
458,264,470 *2E886C125CA6B75E19A7E6EC327EF39F79F9A7A6 base_load-b/ei/s_l/ou/d
458,264,471 *2E8E3ED177709FA74C6194F29DE11357A3436C17 TREEDLEDUM
458,264,472 *2E8D14B0F4E46B68A45218A7D601E5AF73102D7E sanghattita
458,264,473 *2E8EEFDFF2D06651A75817AB308C08201292BBDF b!bod
458,264,474 *2E81D77FF38EDC978572A158E08A3CF1F5446121 bciv
458,264,475 *2E8A10D933C4230D604D7C6328C7AD0F6A71080E bdicimu4
458,264,476 *2E8236FBF0B6B84FFC68380ADF6C19B009687AB8 [email protected]
458,264,477 *2E8E9F9A12DB01C82258986FB3A0362B4E93F173 SBLEOBSW5
458,264,478 *2E8FCD01148D22489D7B8F39D1D870302B420456 BEANSTAL5
458,264,479 *2E85547A79F743647D290BE1E9713CCB4FF72906 SCOSCESA5
458,264,480 *2E800659332407FE4019FB9A72E92B41E48781B0 turki.ahmad.al.shaikh
458,264,481 *2E82512534179E4B089EABC069DA9674729635F4 SDAPBSWING
458,264,482 *2E8B9E97D8A17721A78D52312D9E46C5C1BF5284 BENNYKNOPF
458,264,483 *2E864838B84C49C7FCB406F50153EFEC929DC245 SE1FT0RT
458,264,484 *2E893A014693F30A9CF12E89214ED5177BCDE9D7 BERRY.JUDAH
458,264,485 *2E8E247F1E476493509BEEB055EE81DBD4C70E8B SEDOCRAB8
458,264,486 *2E874D9DE922FB1887257454B1848FDAD06775BF TYLER-BROCKOFF
458,264,487 *2E8DF8A8C531C2E23DCA595562616515A6440884 b%ew
458,264,488 *2E885AE57735260D63E3FBD082B387CA88A7D6C8 SEVVANDHIV
458,264,489 *2E89375530D826443F7952580A20DD9DC04B703F uçgan
458,264,490 *2E8D45E12AC147B9668B9BB9ACAEA60E31F6F37A bhp(d
458,264,491 *2E890790AB3E24A44ACA2763D311D21101C57675 SHAWNDAYS
458,264,492 *2E84A0E1A8CEDCBD00D3CBC599D74A386E35E71B bhw:e
458,264,493 *2E81819F256484E085C1430AE6CFB30C8CC35560 BICUSPID
458,264,494 *2E8DE4C9237ABB718D3046E083ADC78BF81088A1 [email protected]
458,264,495 *2E80707503767F8B8A83D16EA7878801371061AC SHUKKERIKAR
458,264,496 *2E84EC1685B767A6C89AD20E7AA8921D7A09956B SIDA-ASIATICA
458,264,497 *2E8F9877322CBF8783F1125B24344456A1916004 bj)rg
458,264,498 *2E8CB5FCFA5F66886A3762A71B35AD88739965F6 UMBILICI123
458,264,499 *2E8FDCA47D7416CD615D8ECE2304CE0CC8AD4970 unamuybonita
458,264,500 *2E8956CA4EE1D255CC32105215163EB34E7535E5 と共に、「mac
458,264,501 *2E8348E56BFD53E4EC0F03F8F6CF61148AA4CE6F Silence-of-the-Rain
458,264,502 *2E891061D2EBFEBECDB6AC70A220F69182B7C84A SILNICNICH
458,264,503 *2E85DC5BFD3ADB054C7B6A905828FDC6A33689F2 simonize0
458,264,504 *2E898853EAB3302C459EDD43FE276C7F9DE4CB99 SIPUNCULOIDEA2
458,264,505 *2E8F96F7FE84B0E563453E3CED0C12A960948A3F BMA8B
458,264,506 *2E89F02BCAFE5BE15A646099F40A4073E3B57428 B,NIV
458,264,507 *2E8EDC7125FE40397962034331F41D8D044340A9 UPATRIOTISK3
458,264,508 *2E8F05C5B97C50C5A4963B9F5BE31116333C4166 <SKINNY>
458,264,509 *2E84C87F78A3FF5F88856A222396EF6E8C666204 uphills
458,264,510 *2E80E0CD2529899031651E140A559E97EBF05431 upon.this.overweening.traitor's.foot,
458,264,511 *2E82294F5D5A173B4CEFE980EBB804B7861FC865 [email protected]
458,264,512 *2E88D7C15AAA4EBE18404AD36F810565EB2DC35C uraipanpromkum
458,264,513 *2E824850FFF8655A0DA8C0575EBB9605DD8ADB32 SLVSNORS1
458,264,514 *2E8BF76B5EDA3490E12D65B052509739E2C2DB4D SMSNGRTZKY
458,264,515 *2E878EC0D34F7EDED01DD29851BE20BE3C0F263A /USR/LIB/PYTHON2.6/LIB2TO3/FIXES/FIX_ZIP.PYC
458,264,516 *2E868CDA2880DF049A3E2656A2C74C1796ACD658 USUARIOS-POR-CONOCIMIENTOS-II
458,264,517 *2E8E0A8D9124DD9F293F2913241401A8C74CC267 BORRACHERA
458,264,518 *2E8A11294ABF8E0A0B3358876B6636F95A1A027E bouriolly9
458,264,519 *2E8699F8A1D4588BF4EDC9C333BF964B44BA88D5 boxwoodned
458,264,520 *2E827C079705AFAC5DC69B4DE791E38F43E3F726 boydsonner
458,264,521 *2E8AF06D6F326F36298A44032F02C95FAB871F5C b/+,p
458,264,522 *2E8E260DE8069298255A749B87B19C31BE68177C VALARINA-NELSON
458,264,523 *2E8BA7A8DC758735B3BB357B8BA2CE3289DEA81D bpo;8
458,264,524 *2E8A9F32A27E7A04ABF85D501FEA54C524E4E305 sondheimetc.:liveatcarnegiehall
458,264,525 *2E8F29AE6A6D3BBEEC5DEC9D6D99119BF410ADF4 B=QBO
458,264,526 *2E888A754FCC8E437540D7E768C91CC932F370EB SPEARRITTING
458,264,527 *2E83CA2F554B9027B2A9433748C247A25B34B894 brandonqwaszx
458,264,528 *2E8A50758B4A8E2DB70E999B880561BE8CED4740 spirits(プロモーションカードのイラスト)
458,264,529 *2E8801E69A783234833271422E3C60E7C3D035A9 splat!0~-<#b
458,264,530 *2E8B918BD5689F7602D990CE09BCC8EFC77849F4 BRITT.SPAZIANO
458,264,531 *2E8219C1855C7F4B68C9B92ACFD4DD91BBB59BD7 VERONICA.ROJAS.LOPEZ
458,264,532 *2E8E5A4819477D809AD46040D233E9F628609649 BROCK.BOLEYN
458,264,533 *2E834182AA38EF01010A25A6655D7D909DBF3A8C versibilite9
458,264,534 *2E895E550A5F314BB7BEC3079C13FE30E916FF27 vibratoires4
458,264,535 *2E874574D7DFE8E9745464809497DCA3E0D853EC [email protected]
458,264,536 *2E836EA17FF29EB42198092EDA8B7F801A6A6D31 SQUAIERA3
458,264,537 *2E8BED1AE18253293DC33C74F27130F11F7248DA SREKSUHSSECCA
458,264,538 *2E86A2B57FBD0318F6FD2ACED2D04A37205F331C VINCE.EDEY
458,264,539 *2E891F334EE195F021C655AE0E5E8ADA98C0AC0C ssecca-gnissessop-ydaerla-ton-sresu-yb-tcejbo-na
458,264,540 *2E88598FE0F06BF58BC6693F0270A920A53018CA VINXENKOH
458,264,541 *2E897751A0CFDB1F767F3B8E09C8ECBF3B4E2311 STACEY.STRANFORD
458,264,542 *2E88EC0E2E2A9EF58112085CC6E37EE01049B0A8 stagninus
458,264,543 *2E8AFA8D48D92A3FD7BC6880320BA958BDA3834F VISTAHUT
458,264,544 *2E897328660FE2A2801296A94DFDEF6C149FDA84 stanpenna
458,264,545 *2E8E9BD427FF862713425BD149CC4983236ED224 STATE-ENDSCOM
458,264,546 *2E8395B07162EB9BB5AEAC995F63046F278C23A2 BU5KW
458,264,547 *2E84253850E84814DCD25086BFA50B7581664C69 steefbulc
458,264,548 *2E8B111CA4E34462F210E3EDDF1862B2F8E7D7AB STEPHEN.FELDNER
458,264,549 *2E814982F1DC8AE5BE46FB10AC6B11D2C22F8403 stephen-silberman
458,264,550 *2E84C4301BD8A788702623119B07209B533BBC05 STEPHENSON4
458,264,551 *2E83D45DA02BE564C82EBEB138A706DC50626994 VOLKSSOUVEREINITEIT0
458,264,552 *2E8D47D6AF59E45E22AAD9ADED7386661DE3A570 STEVENCOHENUSASCOHENAOLCOM
458,264,553 *2E8E7B193E8B2D503B726B920491C39A957BD5B5 stoomtractie
458,264,554 *2E8EDE02589EE87476487887D0DAE94445AD0E71 BVU&:
458,264,555 *2E82166AD113C1A49479BFF11AF2B083A00D29BE strittigkei
458,264,556 *2E819A11AC8215F7CC1D61EF13512C8703A75909 STROMPERIE0
458,264,557 *2E8C43E7605E159CBEFAC9AE9FD94F57982CB552 wallybiccum
458,264,558 *2E8D0A4F338228B6FE1FAA0064DBB3AA838E1245 subl4ti0n
458,264,559 *2E8EEBD7B11A79A55296DC3AA5B13F58EF51B34A BYRON.MIZNER
458,264,560 *2E872A200715AB23B9AC4538A990DBD45CE747E6 [email protected]
458,264,561 *2E88DDFC5902ADEF7EF6E2B1350F9E48027D2151 [email protected]
458,264,562 *2E86995F5A27057B38C31F3D2BD7F90CC9B8BC18 wankermedical
458,264,563 *2E8F025C3FE04F8CA27B5BC1A362AC1AB0C4A70E 10praia
458,264,564 *2E8A27973EAB1C616FCF5990640A42008A916FBA WASSERHEILKUNDE
458,264,565 *2E8714862D5FB2B5462BA16491B8D32D968BC7C4 129925 normalerweisesindbeideerbittertekonkurrenten.
458,264,566 *2E8432B7D2205F674F0F4134C2DE4D5FEEA70FD8 C4&(J
458,264,567 *2E89759B3D0065A77C554F0073F4831E19B1FDB2 SVOLGE7
458,264,568 *2E83E8989CAE9914439C3DD4DA972D2864853F27 c6oef
458,264,569 *2E86B75BC5E7A394AB93E97F4C52725C63D883C3 c97si
458,264,570 *2E82DF8FEFDA1E0FD66D2E7F366FD01E581DCEF4 [email protected]
458,264,571 *2E8841AC08D19D31370AAC1F75F8C67CD68913DE [email protected]
458,264,572 *2E8944712C9993C8B421681BC6D9FE3F1646BC42 symphonyforband(symphonyno6)adagiosostenuto
458,264,573 *2E87E38C9B8E4465F93176CF50C0D1C3D71D833F camey
458,264,574 *2E8D17FD80CC8BC52EC2D7684F48E65A08E2207E CAPE-OF-GOOD-HOPE
458,264,575 *2E84FEEDA3A653CF112A85936C549D9D9159F8E4 CARMELOMEE
458,264,576 *2E8E935C89F836D118E30FFA685351B8BD662863 CARMEN MOLDOVEANU
458,264,577 *2E8AE528D9422790464561B44F9D3F8F0669F2B9 1882677 diesindblau.
458,264,578 *2E8BA69EE307182C25825393FA3F4A763543EBE8 18P
458,264,579 *2E856F64A1EE6E661BF3FBB79053E397A31A1FDC CARSONTRESCOTT
458,264,580 *2E8897BE5D363FE64A40565747E4CC8768467303 WHAT-HAVE-WE-GOT-TO-DO-TONIGHT-(BUT-DANCE)
458,264,581 *2E8022A10EBA367ED955D5EDF30C76760C1397D5 WHAT PART OF GET THEE GONE DON'T YOU UNDERSTAND?
458,264,582 *2E8DCF95C0C1CFF3181101F77126A42EE5A03B28 WHEN-THE-BELLS-ARE-RINGING
458,264,583 *2E8DAFA700756EE7F077FCE119F587549E4CC5E6 caseyminzy
458,264,584 *2E89912D547931D4D9B58E400E4945D7CEFFA2F3 TALKTAXMANFUNDAMENTA
458,264,585 *2E8AE40B91089B346BAA444C408F5B391FAA79FC WHOA,WHOA,KAY,HOLDONAMINUTEHERE
458,264,586 *2E85F2605BC6D1FCAEF4A2CD14B7EDCB79ABB159 WIBYBSA9
458,264,587 *2E8752679A25490529F7B496F8CC79C785EC456C 1-BEHANGDICHTE
458,264,588 *2E89DA72793496715451265B2BBFD0AC351E0725 wiesterman
458,264,589 *2E826223A43BB435BE73ACABA279AFD0C334EE0A [email protected]
458,264,590 *2E8A362C0D2DB3FC6A531B494367719BB71D672B CAZENOVES0
458,264,591 *2E8A55E67582AA3B3A95F35C561A864E4E569DE4 c)!?b
458,264,592 *2E8DF354F5CBAAB8C5770706BBAFDC308B9127A0 テレビシリーズTAXIで
458,264,593 *2E8F2FC987B1E4BC8D1254A5F1EB2703E51762F9 [email protected]
458,264,594 *2E86B65DAB1DE67DC26CE3D17174137F7068F357 cbk;
458,264,595 *2E81B9DD3C9463CE03A04476A6A85293276B716A tearingusapart#2
458,264,596 *2E841CA29137B1D4CDAFFD1DD844F5D6213B9FFA temeniding
458,264,597 *2E86F74CD4614349F02B9BFE5D6FB66E6EEFFF89 WILL6
458,264,598 *2E8B6486052486A85E020DF22052DA3B95E15ADF C!E0H
458,264,599 *2E8DFC184DC9B928AE0A6556EA28EB0B120F6F2C [email protected]
458,264,600 *2E816DAE2DAB1247E89F1B4A85F3D677F5002CF5 TE UND OBOE: I CALMO, CON TENEREZZA
458,264,601 *2E8FF1ED2A55A9D1CAECB32355834F4CE165FB6D willy rap 'ne k
458,264,602 *2E8356B1F58BA48A599FD2A0E72C9025E762000B WILMER.BARIENTOS
458,264,603 *2E88F12E16C5C323FE2D75CD4753D3AD94FDD794 celticsalex1
458,264,604 *2E85ED69F523C4ABEA24ED1E3F758D23447A59F7 thatvictor11989
458,264,605 *2E8127828AAB02273C08A3CA5F875EA953CAAF06 1-machot
458,264,606 *2E8ACD9E9A4E1DD39F2FF3E2502AF69806981C63 cfw9f
458,264,607 *2E8EC9DB73E8BBDB788AEF8C4E22E3C7376903C0 winnle.kwagala
458,264,608 *2E8405AEFA9122E5A508F0A6CEAA4234D9DBD14B the four seasons (kyung wha chung)
458,264,609 *2E83D72C18644525FEDCDC0C8050E272F2786FED 1-MCKEACHIE
458,264,610 *2E80F8B447B5C593119388BB3DCF5C3BF9F7B14E THEOTOKION0
458,264,611 *2E89F18BDA58B048E6554D1641A63AA7421E965A 1.motorenkooperation
458,264,612 *2E868B2969551531276FDF48C816ADCDB9B71D15 1-myyntivelvollisuutta
458,264,613 *2E81C3E7F6C44ED3192EC1189C3CB9E88067F4E1 chad.neil
458,264,614 *2E8D9526A3FD416829752CE38FA9A1DDDAF187E3 chadwickarenz
458,264,615 *2E8B4660A5A7030D100A4AF576E21EB003DDF88D 1 NS-SONDERGERICHTS-JURISTEN
458,264,616 *2E8D630AD7CB16A1D8ECF3D93C83A1BCA1AEB732 1osteuropa-handel
458,264,617 *2E833088B3F04FCC05D912900737756E531B108D CHANOYU8
458,264,618 *2E882AB751FDBE57931A15B146B961D5A84AD465 1PLAYSATION
458,264,619 *2E8CABF2DEBAECDC5735AF7983148AC3EFE29B75 CHASCOLLY
458,264,620 *2E86DF5AFA25B30EC98CB00813021C005F4CF5F3 [email protected]
458,264,621 *2E838D57BAB004AF74A38472A4F860B9F3686E76 wubangmao
458,264,622 *2E882A9E592199C4A699E567B25ED7A758269CF7 [email protected]
458,264,623 *2E86A9BC7A8BCF09E1261026F8985883FB4ABB54 tibor45
458,264,624 *2E882B408B0664C6019AC013DE02DF5118393B2E chinook55
458,264,625 *2E82E90D4996992E0E008E70B4B568732A8D0485 TJIRELAG
458,264,626 *2E8133369036A526EC01CD05DA5EB722C293E85F X8FSCK
458,264,627 *2E8E0AD36BDC4540071FDEC530E489CFA020AE01 TNATIMAN2
458,264,628 *2E8409DFD2D27A577E162E1A88578301953FAD2F 1.zweijahresbudget
458,264,629 *2E894AB38EC172A82EC6B73DBA747F8CA04D65AC [email protected]
458,264,630 *2E8BEBFBC286114A2406D0CDD093076775495489 TOD.CHAVIS
458,264,631 *2E835B7B5A952B06759ED0E7AAB751929D0FF7A1 C))HU
458,264,632 *2E83F7270F6AE28DA756785EB889D1213E64B5C7 2047219 konetta-voidaan-k
458,264,633 *2E8EAF3563CC3DC42423D039076CE937B3F269C6 2064445 RATKAISU-SAI-PILOTTIPAIKKAKUNNILLA-HYV
458,264,634 *2E8B18AFE57B1939CFD43EB86896136832172F56 to-know-him-is-to-love-him-(napsterlive-session)
458,264,635 *2E8C846F6913586A186348BD6DF0B1DA665C5BF1 xqok
458,264,636 *2E865BA9955BA988B1E6A9523603063AC3F3E7A5 [email protected]
458,264,637 *2E8BD6F1ABF7EBC46293A59C108D93C32D2B90CF TONGHAE
458,264,638 *2E8D25FECF1E2D878C7F484DB7E3C4D2005392B5 TONYBALLIONI
458,264,639 *2E8DAEFE3D9ED0A4AA9B621CCC1AA38D6CFEC28A TONY MOUTRAN
458,264,640 *2E8A073EE62E5A095000F55E92F31C58A396C6E5 TONYSTRAWBERRY
458,264,641 *2E8DF298A830172FECDB70588AF5F1EEB91B2F66 TOPHAY
458,264,642 *2E87B33D1B16A02726F2F1068B5F8667291BDDA7 Y3OR
458,264,643 *2E86B8CC2F34CFAA32D40A3B78E562813CCD2D8A CIUDAD UNIVERSITARIA DE CORDOBA
458,264,644 *2E844AE3666BDFC49C6BFC25EF2699507D42C61A CIUPUC
458,264,645 *2E8F479EAC27AAC8869188949740D1E62449BD20 cjk9t
458,264,646 *2E8D79F6AF120DECD20588D23EF5B583BDAC0C92 yaşantım
458,264,647 *2E8B1940C1AE1109DD7029679E16AD14CD311073 tracy.thomas.hunley
458,264,648 *2E8BF83C0D45529FBBF5B0C8FC081668720A6EB7 TRA$PIRA
458,264,649 *2E8C8B6403E6955B2E25D861C3E8D9A298580396 [email protected]
458,264,650 *2E8CCF72BBE29300E2439D203463C28A8BB49E69 CLARA-MCKENNA
458,264,651 *2E87D0A822D94734406C17F79321E3C36C0A69D9 clarantella
458,264,652 *2E8FF4D11E14B9E1BF0E3FEB87BE8FC12F6AC30C 2522087 RAVINTOLAN.TOIMINTA.JATKUU.NORMAALISTI..
458,264,653 *2E8D6B14A27CD79BA9F1FAF103A044BF8D86B4B4 [email protected]
458,264,654 *2E8BE241C22414260B153DE1E3B9276BB588E0B9 2671371 yhteisrahoitteinen toiminta on viime vuosina lis
458,264,655 *2E88BC5E3C791A84B84AC0670F0BDFE4C23D68EF treated
458,264,656 *2E827EB69D3D9B1C40A0704E25FF6FA79F3B28E6 CLOSEMANY
458,264,657 *2E80384D6A5500D244E9EA6B0167FF06EFFC6008 TRIMETERSESED
458,264,658 *2E87AC9F5140CD65B068A896B51A16C06904FD8B yourmindis...reckless(reckless)
458,264,659 *2E8F5E3D3B6B51889AC436AD1AC056E1A61160C7 YP!8
458,264,660 *2E8928EC37132CF9036B3F8E50D0DF50CF671F3A CMBU2
458,264,661 *2E88825FE594E3041A9722F400473C88EA596898 CMCE4
458,264,662 *2E84250278BFDD26C5ED778130099D9A27BC47F8 TRISTANUNDISOLDE:I,III"WIELACHENDSIEMIRLIEDERSINGEN"
458,264,663 *2E849323224A6E7EDF5E7291772A33C93C4316EB ZACHERY.STEINLE
458,264,664 *2E8C3725088C37B50BFABD222073FD856E078B8E ZAGREB 49
458,264,665 *2E8F4882D26314B58BDA54EF791B3F2A18787A15 2-TURVALLISUUSVAIKUTUKSISTA
458,264,666 *2E8DC165B3B852183F76EFD5264DE6D418A11B7E TSKJILEKKAMING
458,264,667 *2E823851A79B93FAFDE1528D062AED84A56E6109 ZANSONC
458,264,668 *2E81CF4A6F4FA85A10ED4F4FA4236B3D81734567 ;]2+xedni$[tsil$-=-2dnarepo$-----------------:41
458,264,669 *2E87F91746FB9DCED211F8F35381E24D63159BEE TTTTZ
458,264,670 *2E8881DB87C18A771A81CFA8228FDC4B8E39D634 327320 laajaa-investointiohjelmaa-jatketaan-,-eik
458,264,671 *2E878A0A3AA500F057BFE0A2B1D4BEBD038B1B37 collegeであったが、1953年にbritannia
458,264,672 *2E8BEAF7A7F54F8DF1E8031E293D2045E5334927 TV=AAA
458,264,673 *2E82796EAD39AA68766E4043A7EFCAD787EE0996 [email protected]
458,264,674 *2E880AA2092FACC93839FCD648CE94C44C643E77 concerto no 7 in f andante
458,264,675 *2E8B31AFEDE7904E79F98A6A06993F9A4E237046 3BINHPHAN
458,264,676 *2E8A445D6783FA3BB8BD1BA8A606D155B5F6CE06 ZHANGWILSONB
458,264,677 *2E8E649EE4E05270C983147C294F26454558D766 3DELISES
458,264,678 *2E86561290ED30C189C309C51E999FBE9F24892B 3-D.*.*.*UU
458,264,679 *2E8A727006845EA36F4E448ABB98FAFE8F9E0330 3GELADYS
458,264,680 *2E8C5D6DFFADD7095773C093AC31CE23D5BEAFE2 CONNECTJENIFER
458,264,681 *2E8F2CBB8AF30AD1F01AAF1EF12CD418BD4A258F TYONINA
458,264,682 *2E81E0B958DFDB194075A7731172A6B599C002FB zikri-messi
458,264,683 *2E831AF90F9577043E106C1D4DA7F8C3B4F11B74 CONSTELARTEIAS
458,264,684 *2E844A6FAD1B258D237CF80975D3F40AEEF5E73A zkill
458,264,685 *2E8B313453B44CC1C7D1D3390257D8C13A76647D copyrgh748l3
458,264,686 *2E8492D39AB37FA26C1D3277ABA23A913BE0DD59 $UBC0MM1$$10N3R$
458,264,687 *2E86D96EAD386EEDBA786788B2A79B1F8CB96B89 Z"QM
458,264,688 *2E87984A016B7D04198BD5DF1240F0239301B901 UCXP
458,264,689 *2E8096757F773CD9649CA3DA8102AA3527F2E0C1 4-bogatin
458,264,690 *2E8EEAF3BE010F8F2691E1BC278EB589345AB1A2 4EPROCURE
458,264,691 *2E85C602E986FB8FB001700641BC778E1890C6E5 4F06ED822CE23536AD2E52FA430DD5AC
458,264,692 *2E86E02938A42D60C40B313C9F0F7E3CCD7AD673 4.HENKIL
458,264,693 *2E824CA4AB6ED8F40908FA2A9752EDD6F3CD6EF6 zwermtijden9
458,264,694 *2E8FE7799F4E6CA3750ED84E63482525C820CAA0 uitsmyters
458,264,695 *2E866885B2AAC528A408B5BC362E6D270C19CA1C 4mypyramid8
458,264,696 *2E8E075A050F440F42B486E88A4DED25AAA54B5B C/P=I
458,264,697 *2E80273F67902669C6C54D7B9F1A3B7F28461CDD ΣΥΜΠΑΘΗΤΙΚΟΎ
458,264,698 *2E8B796A1DE389A7091B7606F5285C1E5CE279B2 ...UND.ICH.WARTE.AUF.EIN.ZEICHEN
458,264,699 *2E897A2AFBE8A542A751C24D60EFD73977923278 χαϊδεμένος
458,264,700 *2E8EC6F3FC9AB0EAB9512D815ED3DB58B23DF8FA ungsbuch
458,264,701 *2E8BF1220EFB53C8528007FFCC6FD95870D1DB5D UNN3GO+IABLY
458,264,702 *2E8899D3FDC27F4A20011ABE12CE9D151836006F unsearcheding
458,264,703 *2E8AF7EB22BBC6BF1C6331ECCE6921A73F9EB6F6 ДУБЛИРАЛА
458,264,704 *2E8572D0E15B975C6F6741526902280B7A467484 CPS4&
458,264,705 *2E8DBCCDF8F40F5ED936D2BE3354793E99899950 503541 enttaeuschtwarensiedarueberaberkeineswegs.
458,264,706 *2E80C1706AE7F7CF9FEDE24A39EFE5B36B2402A3 CPY%T
458,264,707 *2E8F87CAC6D167A3494C32A8DF3E926BCDABD64D UPFRAGRANCEFRESHENFUMEGATHERGET0
458,264,708 *2E83E0018452D3ED83A35F8D6A0C8EF4AA737979 UQ;AAA
458,264,709 *2E8FD8022070F65C40932E09C1329801E7AC8129 CRISTOBAL.CAMPUSANO
458,264,710 *2E8352CFB722138DEEB8B862D3C577991E7A7623 ОБЕДЫ»
458,264,711 *2E8B7CFFEC5860706F9C79AFE5391AB76D8AD80B 53F39AE49890DE68A9F9B9618391BE2C
458,264,712 *2E8F97431A49288344B8BEB3158A3D36A28F2F82 crpp=
458,264,713 *2E8EEE7448FED9972CA3C535102089371495CF17 5AFSTOEBES
458,264,714 *2E8C62C263A58176861DF85B8954883B6CCF5B81 crystal.conaway
458,264,715 *2E82E3B98F30DD6845B09BF2C21F09E93019825D cs0mr
458,264,716 *2E8661D2C92C46608C0DBBC8151807D60C640415 хартфорде
458,264,717 *2E80C71AEBF71E84391458ABF3DAC79E258A3970 VALENS.KUSBIANTO
458,264,718 *2E8BF46CE2EF1AE56695A3934BB8BD988BC08C7E CTD$H
458,264,719 *2E8EF1F183121B272A8CE3AB7E3512B88A6B680A C+UE/
458,264,720 *2E89EB4DE2CC1A8D7F5AE43E7B801926A31BCCAD C%W^
458,264,721 *2E89843D0F050DD06EBC2AB48894B3D3873D5A61 VERED-LEVIN
458,264,722 *2E8CE87CE96984529018EE014FAC82A91DF12298 cxus7
458,264,723 *2E8F3A85C7F8EB6A0944EF1B7E86AB170D380478 VERITAS JONES
458,264,724 *2E8D581DCED53DB4A057FA7F04663B645653ABC8 5SIDENTIELS
458,264,725 *2E86931408549EB3F9184651ADA237C42C356832 VFDMFK
458,264,726 *2E82E66CA53468A164CD5F4E8047EE79B2904611 VICKI.MUNDERLOH
458,264,727 *2E89858C2EE7F3DBADC335C1F4FCFD7E625F118E VIERITIMME
458,264,728 *2E855FD029F5D92BC3E4AD40B7B97E708674F8BA D?3F&
458,264,729 *2E8C1DAF8546080AF83B53F53E154EBD1433B2C9 d3m0cr4tizin9
458,264,730 *2E82692D7DC54D73AF791B26EB578C277157A72D 6823OHJELMA
458,264,731 *2E8941F70A6CEF55E55686902120BBC8C4355139 なお、本番組の企画は輸出され、韓国SBSにて韓国版ヘキサゴンが2007年4月から放送されている。
458,264,732 *2E8C577513038D4AE4D5424041B3F266DCB26365 6BETHOUGHTED
458,264,733 *2E86BCA283A6E3A1F45BEA09AEE269D8797D782B 6BTLZGNB
458,264,734 *2E82AD0CDE6BE55BBD19EA6DC806AABE5503427D D6!R
458,264,735 *2E8321DE2EFD1883D45802FF7048454424A82789 6INTIEMMEITNI
458,264,736 *2E8CE3995D61283319ECF1AC7E89B6DC8FC58627 6JATKOYHTEYKSILLAE
458,264,737 *2E8A24FD208632B002CBD2226CDB0372E1DD61A4 6JUN1412
458,264,738 *2E8A6CFD33FDA7A2ED108B66DB826D527BCB54B1 DALLASRETEK
458,264,739 *2E8A6D1EBAA84DA84EC03C507B8D0E3C3C13187F dallassumlin
458,264,740 *2E8A9730E8AEB579DC8519260DD1DF8947E1E58A volstaat
458,264,741 *2E81A35F3FC0C83ACD1B3D3198C7A1238F79629A 6r4p4dg4
458,264,742 *2E81E5F4715B4B5C24AC44B5283897EBCE18C11C 6SAMVIITAAN
458,264,743 *2E8C0D3414FDBCBFDA784689B4A58F4A6FA4F98C 6SCHLEYER
458,264,744 *2E8143386620189A582D35A52B7722E04E0A1B50 vu-thanh-hue
458,264,745 *2E87FA32FCA91E0A19920E4C8B3490BB115631E6 danehercman
458,264,746 *2E81ABE80D4C0B7468E8749E1879785719FCF588 6SUSANFUCKOFF
458,264,747 *2E8F8D0AB0E024A093BD029B247533EB0F8F91FC 6SWEETBADDENS
458,264,748 *2E8CC3569525C0652B03D8FA26214306DD6C867C [email protected]
458,264,749 *2E81D6AD2BE27B3CAC53282CA8A5F1E0182657A4 6TMERKMAL
458,264,750 *2E8D3697C228B06ADA0B71456D2D29C1056139B3 dǎnila
458,264,751 *2E89CDC91049AF93F574E714745823DC3FCA0616 DARIN.HIPPEN
458,264,752 *2E8E68D3D6F614035655B9BFE345FB136BC42A5B dark.chunk
458,264,753 *2E84D253C97A10E7DA51D45B49664D8D46F14CFE WALKINGINCHAINS
458,264,754 *2E8B25119AB6750E01D755B8A0DA18108573CA1A DARON.BILCHAK
458,264,755 *2E870D3DA2E83E3066AC3133CC8E33DF50247D81 775107 EURON K
458,264,756 *2E8C971D1E2AB6BA2C2ECB093E81BC9AA697224A 7BLADSYE
458,264,757 *2E88BBDD1A91E8B666E75ED61C54152DF306C782 waltonarntson
458,264,758 *2E88459E6147D9BC7BFA81BEDAB341319D1FF79A [email protected]
458,264,759 *2E88C9E7831D25D0A2D35570FF9D81A81C2A5F55 7ERALUMUC
458,264,760 *2E8FDCA4EDC1FE4744574CF8261A0567A6823B16 WATENDE HENDERSON
458,264,761 *2E8BE7C95F0596CDDE626BF728808CE826DFD492 d.bgb
458,264,762 *2E8C070987DA001CB628A33FCEF3061E4EFCB845 WAY.-LOCALZUK
458,264,763 *2E8A340E4FB3559063BAF13DB2529D6519E2F635 7MARTHACOUNTRY
458,264,764 *2E8758EB9771BD45AB26025AD0998438D802C114 7NAAJOUS
458,264,765 *2E872D700B1509DAFA9B56540A4354D22D7EE4BC WEBBYWEBB
458,264,766 *2E85BE8A613A05571B70E28EB207B3505B33B164 dd(hq
458,264,767 *2E830989E31FC891A1C497C7B4BD94BFAE3DA277 7regretteront
458,264,768 *2E8D738E4C25C2E5AB9E9D43053D180CD448634F 7THEWESLEY7
458,264,769 *2E88905F64EE42A090972BDA94FC2DE54AA809F5 7TIGERMARIPOSA
458,264,770 *2E842B06E531813F7AF6F04EDC0A0BF39791399A debkr
458,264,771 *2E8B19B7DC7BBE365EF1DE6D0D08EF2650185708 07011821
458,264,772 *2E8FBFB65EB0A5FB6068221A25DE8DC4E6A6E573 8##>.~.~(><)
458,264,773 *2E8876294AD3D5069913E06758AC53965A94F192 whicztcks
458,264,774 *2E865C14EAFF1F15D4C5CD5247FD4CD64D21BB28 wilbercoulas
458,264,775 *2E8860D3B110C7306B979B57096DD96CF1BDD770 DEMARCUS.GULKE
458,264,776 *2E89E63509416D9250A1088DE8C9E4915267A0D5 (-_0)~`.~`q-P
458,264,777 *2E8BFEE710D5F7A1386CA73714207760B8368EAC 123GO2000
458,264,778 *2E8781796922CE8338A93B2192DAC4268195542A 12DOUBT'S
458,264,779 *2E8DE3AD4BA4F62A175D33A0BE5682F977BF2F23 133jason's
458,264,780 *2E8BA9C0EA081FD30F7BAC65ECE806A45F2BCCE9 deshawngough
458,264,781 *2E8FCBD4AD89B6298B79D9A2849269364117CFFD desmondrouly
458,264,782 *2E859473206DC667DA4727C6F5BB92782032D280 desroier9
458,264,783 *2E829227B0D1801513FF0FC993E8D92129823CFC 1731773 iv.ripatti.,.marja-liisa.,.h
458,264,784 *2E884E4CC83E2CDA36409F5AAB5524537F2F1DF9 DEVIN.HORTIN
458,264,785 *2E8A27EFA8CF03A8217ABBBB34737A4D51F543BE 8ERMYSTED
458,264,786 *2E8A52991158F2E2E37AE275DC071324DF875476 1839901 VAIN MUUTAMA P
458,264,787 *2E8916FABEB1881FCD132218A761D270FD45280F woofer00
458,264,788 *2E869043B56DAF2CBE6CE3B987DE52A0141842F7 [email protected]
458,264,789 *2E8F29E7861CC18DF378F003B8E351C54C875001 wrighttina
458,264,790 *2E8C8A73AA3C2F194C36CD00A493DD4BCA5EB817 WUQIAOLING
458,264,791 *2E82DFD2B04E0202B98D6FB66398D90E8B8ACBAF 1CLUDEIRIO
458,264,792 *2E836B5A377279F5CC2FE7F1AD7F191BAA817761 WWWVESUVIOPARKIT
458,264,793 *2E828279F19D113EAD8E00F522B70269BC3C7462 8----P-*-*SPLAT
458,264,794 *2E8D7C87D96D5FE6C79FEBE8D1A02F29F4CFF6D8 wyattshula
458,264,795 *2E84D4AFDBC5E794A6E80B8D6C390CEDAFC312B3 D"HFF
458,264,796 *2E8DBC5492C379DBFAE56C501AF2493D11E1738B di2007031300985
458,264,797 *2E83ECA1391E2616167E58E521C2DC8EF02E4228 [email protected]
458,264,798 *2E8C032ABEF5B1D5EA69D5251C2F507D65FF1F02 [email protected]
458,264,799 *2E82D647F4D34E8EBB4B29305AA0C2CEDB353955 8sputnik
458,264,800 *2E88E7BB60B3E970C38646E56614A0FCB1335AC5 8THATMARLBORO4
458,264,801 *2E8D3B4391B630F743A9E24E346C725F96CD61BD [email protected]
458,264,802 *2E8EBEC301376FE88ECFD724D2A5644431151FC1 )X(.*.*.*Q#####8
458,264,803 *2E894202B8DC162B08B00C6B4F66AE01980DC30C DISLOCATEDSHOULDER
458,264,804 *2E8BF3AD7866E72A015F648F5B94C005B5BE75BE djeqc
458,264,805 *2E84F5CAC16196DF65E5A494B5E769E99F11C27D X>X+
458,264,806 *2E8369E22B558F16AF0C342EFE9EE1824BBD7636 1MARCH1912
458,264,807 *2E8365C3C5930B67521D1548EDF4059D9CD80958 9ALMOCHODEN
458,264,808 *2E862A8ABB6AF83D9EB56F8D523F6D41ECBED792 dmdq%
458,264,809 *2E8DA917BDC9D72EE07E69037C3DC610232B7E56 d?meg
458,264,810 *2E87661D0365CAA35E49A557D41D99FA13C05A52 9BSWTRIMMASK
458,264,811 *2E8935F55561FDD9A2C716132C7FFF85B6D582E4 YASMIN EMILY HOLINESS
458,264,812 *2E8E8CAC7921BBF974018B210340B3E448014C11 dm$v
458,264,813 *2E8A97392CC07BC3E8A0B21AF8850AA4502278DC 1SCAR10T1CAL
458,264,814 *2E898080D174030232D085886B28D8CCE6AD35A6 1-TELOTETTIIN
458,264,815 *2E80CCC1A175B06B1900BF8A143003319B3463B1 dominusdixit
458,264,816 *2E8E71D85B3BCB1F79B41B24E560DB5E24B040D7 YLWA
458,264,817 *2E81C2E4C49ADB1490263E03717AE0DCB14C9A1B 25JANUARY1931
458,264,818 *2E84D0DBCCCE2D6D6E5FB5B766F2433A1B93920E 298994 kaikki-raken-nukset-ovat-nykyisin-asuntoina-.
458,264,819 *2E820B0F5309D1567D3FB7F0D27EEA4B08F83568 YOYOOYOY9
458,264,820 *2E8550A0057B7F5E21247A2A5789FA174E6711DD dsrkl
458,264,821 *2E861B1DA3FAD7C654F8989B1B5116DBBEDDD846 AAB;LP
458,264,822 *2E8B101D9F13C6973FAC9BB5F7E26FA8C65E1B7D zak-mohammad
458,264,823 *2E8DD1A30326A9FB5EE704A71D8750D95C1E49CB duff44
458,264,824 *2E84D0BAF9400D21ACC17A8476656E7D11367C2D aad]v
458,264,825 *2E8B59A7EB24E00A8A5C4B8609A6F0DD986685AF 3BHMRWLD
458,264,826 *2E8D72610D9F5F2DADD006AD960A7F8B04064184 ABDULBREVARD
458,264,827 *2E85C608C8B29F9D24DED85B973D31F76F65FA18 ABDULLAH029
458,264,828 *2E832B2382610AAD24617533006B9DC7D844A734 d.:v9
458,264,829 *2E8BB609E6CE3DEB84438CDAABF7C3A9F326434A 3DSPTTSLY
458,264,830 *2E89C2CDCD10C472B168605A8B135E1D6F290B15 A&BGF
458,264,831 *2E8A83BABDE5E80A8BFE6B19EA2FFA165A7DFEBE 3-HIL
458,264,832 *2E849B3873AD8609A2A33DBD9CA3F460C660FCB5 dw3).
458,264,833 *2E8CFDEF9D13D04658907D3CE5758F6F1B3BDF77 ZHUANG!5882160
458,264,834 *2E8F0AABDF2F01FFFFAEF1278436A063F7142D3A dwkw)
458,264,835 *2E8FEA7E76B17E95A823E3E145B0BBB0DF50BF38 dyb:#
458,264,836 *2E8F376171204E640DC3C082164804BBF68E28F2 dynamenhs
458,264,837 *2E84E49F9CF8667D40F944381C22ED855A7CF46B 3thejasper3
458,264,838 *2E80E523853D52892CAE97F7E6F5276D17AF73CE adanrayos
458,264,839 *2E8B68D10999D5340834106C95500AB51AEED7B0 493935 VARAA VALOKUVA YLI KAHDEN P
458,264,840 *2E8EFF33842AB7542D10F4BBFAA05DF27ACBF17E edv9f
458,264,841 *2E8730473CB9C3A97884FCBA1C16C4FC52E19A97 ÆFÐIR
458,264,842 *2E865068053B612400747BD91C1AFCF30611C71C aej#)
458,264,843 *2E899BEC51E8FE760B7ED30059E16CFF871472C4 4KORJATTAVUUDESTA
458,264,844 *2E8FDB83D20D47E7E73E9B4E9F5CC9A6D9BA2F85 EFRAIN.PENNEY
458,264,845 *2E8ECF75B3B8751B48376AC8935D5AFA0502950A aff9q
458,264,846 *2E87F1451E5E6E0A321B039984E51FDF9D4748A5 af+nh
458,264,847 *2E826DFB41633002AC868BF1181F406939632E70 ahal
458,264,848 *2E82398793B189985FCE4E5BD7917C3DEA0FC3A6 aimforthethroat
458,264,849 *2E8432E70A17A05D0D31702E6CE71116129EE9E8 целзијевих
458,264,850 *2E860F59724CA5398B4A931FABB2202C27966A5C a[+j
458,264,851 *2E810D13FDD3E6494EF78CB72ACED91691991DD8 ELLIOTDIEKEN
458,264,852 *2E84B737CD55F950893384F3107C54C2E22F3E89 elliotspulick
458,264,853 *2E8211E651DB93183FA53D5A7CC8A028E9162522 elliskopas
458,264,854 *2E8A6CB5EAF59B37FE186280D9D3D02C4A75A919 AJOD0
458,264,855 *2E8CBA7298621C83160443A3DCDC0A86AD6423A4 ELUDESALONCOMELUDESALON
458,264,856 *2E8AB220D0CF19C1C72551E756AA1C4DD307FEE3 ELVIS.RITENOUR
458,264,857 *2E8A5D517E7B973CE8F2BDE8EF7E0A50BA8F38F2 A:KLC
458,264,858 *2E8E72AE09A9CF80FF7DB8B90F8E139675840210 A)K#V
458,264,859 *2E8526C29B963AE2CC87ED956D2865038C86F297 5MYPATRIOTS9
458,264,860 *2E8532676CEF6C20198D5B96B16ECDBCC8CC4AA3 ALHUT
458,264,861 *2E8842890055D8B86EF0504FEF214DE14F63DA1D envoyait.
458,264,862 *2E8D6D324F206EF278CB67F4F3E04BC2D10DB71A 造形教室relaxart(大阪府堺市)
458,264,863 *2E8F6D1C22A425CB929074FFDD4AF4895474540D AMANOSCA
458,264,864 *2E8C453E0EB8D85204F818E2F069CB8486E2B2E7 ERNESTBUNGARD
458,264,865 *2E81B8C0E40CB11946715DD871304D713FECA774 ernestocasabona
458,264,866 *2E873A1F8B8EBD5CF5A4DFB588F1486A0824856C amber.kocher
458,264,867 *2E8BB2FDEC067E29BAF3B5972D2FA6FEB7C5C6EC amc5e
458,264,868 *2E8040269F1C36F97C6307F0B175297E959D2F27 amirifez
458,264,869 *2E8B95167B9D99B5687E2533D16F23283915DC19 ESCAMPASE7
458,264,870 *2E8D318FDFFF647909A74CC1C4B325FA8522B0D9 esi-l-g
458,264,871 *2E8932ACECF2FD993E0B1CF251BBF031F347852A 6ENICYERF
458,264,872 *2E8D628F26C5EC56EFF1F7E8BFB6391AA0A2C01D eta^
458,264,873 *2E8330B2613E4EFB3D0EE99497BDA41C88BA2A5C anita-papa
458,264,874 *2E84F59DA610A55F1417B442454143E04E2FF831 anmol-bajwa
458,264,875 *2E8792A6A8F270BD3DD70ED64B3F66307496D237 6PHISHOLIVIER
458,264,876 *2E81FD6E41E3713697CCCA2C4BE047EA664942C4 6QATNREC
458,264,877 *2E8B300A6CA5F2CB168369D169DD45BF9E3DDF89 EVERREACE2
458,264,878 *2E811DB32A7DB4BFAA39F4C209B4BD01CEB1907C EVERYTHING-MUST-DIE
458,264,879 *2E81D6527B6029429B36107794DB4DEAF5C431BE 1318519 THE DRAMA REQUIRES ACTORS COMFORTABLE IN BOTH SETTINGS
458,264,880 *2E823DE2BB2309F95F9FB228AE0B7ABD76B6ED21 An"t
458,264,881 *2E8F594EC17C49252F62AF0BC6DE76FEA21B4CC7 6STARWHATEVE
458,264,882 *2E8E53300AF99398222309FE5520542B430C3D87 6TEILHALOGENIERTER
458,264,883 *2E8A3876067A5FE026DCC23829A3D2CB71342950 anut4
458,264,884 *2E843B4F5030212051E97B8B505AD0A9BFED2137 apasian.di.prato
458,264,885 *2E8DE325493394BDA54C25F278876E3AA1DBA34B apelavaming
458,264,886 *2E8CC2EE0518911FE5AF098D1A3264BC2E9FE07E 7BSWSHIMOKAIINJIBSW
458,264,887 *2E88BEAC99B8C157DB1F254912F5C7A3CB25FE7F ARIZONASKIES(RADIOMIX)
458,264,888 *2E86DC695DAECC570100DF9E35A7BE8DA7796D67 7HEOFENLICA
458,264,889 *2E8C8EF4D8533AE47903F11B527BADBF468B936E FETZENBACH
458,264,890 *2E8741A55C9E6A5CE6419CE033C452657545BDDD ARUONIMU7
458,264,891 *2E8321CFF39D2FA8F66CD5E5298C6D17EA253AEB 7NORTRUE
458,264,892 *2E8A6EE3139195BCC921B97C26AEB25AE2290A9E ASIMIN:
458,264,893 *2E8C31A21C96AD1C60873B3BDA218E4A9229CB73 1ANDERNFALLS
458,264,894 *2E8F9E9CCCBE5BF89205BE07FD268AF9C2848BEE ASSISI
458,264,895 *2E8DB36116572BEA74ED4A1F2AC6876C329AF126 1-CHILL-OUTS
458,264,896 *2E89FB628A0B229EC62782C81B8F28F1153DCAF1 7YTILIBATSETNOCNU
458,264,897 *2E8C48D97980892F5CBB2B87DCD2EC6AC580A805 FLORENTINO.PEELS
458,264,898 *2E8AD855A9B7CBAADD7E4B233A0B4C6A5E7B1519 aued5
458,264,899 *2E8F631A46313AC1AA857F23D50B35B58F09E7B7 1ESIOHJATTUA
458,264,900 *2E8DE63FD8778E9B52B647ED0E20A03659327DA2 1.EXTRA-POLICEN
458,264,901 *2E859E69A692E7D5064742DA43549EF33BE56B6B 1-fachhochschulbezogenen
458,264,902 *2E8D6C6F6011513F6807C99E8ED06263429919EE FORESEEABILITY7
458,264,903 *2E8D3724B96DA9E6D28E48DAEBC46D14F00D017A 8====D~.~.o><
458,264,904 *2E80C6119C954A507F5AC8FD0B953AA08C15F8AB 1.ilmastoimista
458,264,905 *2E85097DA27AA32DE59A8B71CF2E17FC92170938 ayacs
458,264,906 *2E86129156BF1C27DD9AE35BCBF060770EFE19CC 1koenigsfruehstueck
458,264,907 *2E82BB4D01D9C55F2393925C664EEE8B58AD5640 AZ4-P
458,264,908 *2E80DBA4DCE06C00BE4BF587F008F2845F2600C4 B0O.K
458,264,909 *2E8A507FB7A83BBC990651AE1B59374AAB407721 1-legitimationsebene
458,264,910 *2E893B7335BA8CB2FAFB065FC03F5AC688C6747D [email protected]~O.~o>B0
458,264,911 *2E8B5222E3828B2CCBE8F37288D7BBE593EFEE64 1-luonnen
458,264,912 *2E82488F00F51227A9BF1DADDF53DB94A56E60A6 8PARROTBULLET
458,264,913 *2E84AEAA226DBBE147F042035838D69681937A5D 1MP13GH1NO
458,264,914 *2E843B05F1217E768AB0B8BD934A72D386C013B9 B97SV
458,264,915 *2E811AC6924CA863AF2DF9DBD37537B1017945C0 [email protected]
458,264,916 *2E8A24646424C0AD593228A0BFA8CA0F9B7261EF BABYCOMEBACK(FEATALI&ROBINCAMPBELL)
458,264,917 *2E8F2F450E86C3BC1ACC6DF6C07A2AC1EA256ADA 1PAINOASUISEN
458,264,918 *2E86DA268C09B64A9ED639F689E9CFF3D0B4781B [email protected]
458,264,919 *2E8AAEFF170D8FB01F625974256D61ABF404E8F8 8TOCLEAF
458,264,920 *2E84179B2EC446B8F73DB4F0EF94BF5D47351F0E [email protected]
458,264,921 *2E869A5869BD06E8A820E20DA872AB4E618F2C8A BAKLAOVER
458,264,922 *2E8500E89ACC398CBBC8421786FAE6A51978CFA3 G1WW
458,264,923 *2E8DC683DF51CD4434CB2310E44F8F9F999C87D6 [email protected]
458,264,924 *2E841D4E8635746F3F78C8186B53EF0AFCEE2831 barótzi
458,264,925 *2E8917E699AE7B38FEB29C489EA88812A2620E39 GAIEREIER
458,264,926 *2E85CB44BF8D5092637849FB70D93A77381CE9A7 9BEDSITTINGROOMS
458,264,927 *2E88661FF54E90DA2CA7B4BEEAD5C67E3A1D6766 BASTARDANE—THE
458,264,928 *2E8FC771F55B853AEA2BF5F983B3CFE382BB259D 1SDW-CHEF
458,264,929 *2E8C4F4B8CF1F813F9AFA53F3AD626E977077A40 1shoppingweary
458,264,930 *2E80C87B3053C526191970929E3DADB13EB53CF2 1SPENDERZELLE
458,264,931 *2E87F313F0AD12CD7C4DC39B3F5C9AB890B6AF64 1 SUALDE
458,264,932 *2E825ABA31C44781840486D2A31E944810778E11 BBUSSMAN
458,264,933 *2E8085BBD19DBAEDB8974B15BBE870976986BB55 bce?,
458,264,934 *2E87BB42B02A6FAA0CB5A21E8C969E1BDBE78598 9GPSCHLP
458,264,935 *2E8C942DEF3F912E6360A087B8585824F06E1CBD 20elding
458,264,936 *2E87D1AF98D98485ADBA9A632F5088658A614B76 A4%_U
458,264,937 *2E8664E86F287AD9C4BF2A3D26211255921CDFB7 BENTON.SHADDOX
458,264,938 *2E8AB11A3C0216020F5D604FAEC658BE471A75ED a6yvg
458,264,939 *2E8B3E54EAA41BDA1494E666358BB885A2A902BB A857EN7!0N5
458,264,940 *2E8C753FB23580B6C0F4FE609FD68793473E82F9 BEW
458,264,941 *2E86101BE61455DF37CCD24FAF65FC69B6239D34 bgy:
458,264,942 *2E84FEB30DCB9ED88F32396F43553E2C17381EED aactismel
458,264,943 *2E894D0A306043D95B6E4EAC9C840B2B3D4881C4 2595LEG
458,264,944 *2E802FD26AADD1E8B099D1C67F7CBE75354B74B9 2596011 KAUHU-POIKAEIJAKSANUTKIERROKSENKIRI
458,264,945 *2E8FAFDE69B6F491F8A330A6A239EBE00FC98004 b:i)7
458,264,946 *2E85C21025FE49825DF00C44D2554D1B31498E39 BIBLIOABSTRACTS1
458,264,947 *2E83933550886BDF0EE5ACEC087AC66E9DF5846A AAETJ>
458,264,948 *2E86D0BF22ABACB37DCE778A432BE11D301CA53E GRAFICAARTE
458,264,949 *2E8A9574E4490F48FF3FA1102E14A75A3207E644 granvillethoms
458,264,950 *2E8B117A71C67EB03C0A59E45005A283766DC841 grasdrif
458,264,951 *2E82BF050048154C2CCDC896BF2AF4A9A22BCDB7 BINK11
458,264,952 *2E8253721D4C4A0BBC3469B97EFB50D1FC480D42 ABBDL
458,264,953 *2E8541ABA9A9C247FF50C664EC71244A12968309 ABEJOTINOSIOMIS
458,264,954 *2E8F70B29C8A967AB2DEB7BEBFBEC76BA3DB0F33 [email protected]
458,264,955 *2E80D894D353591DAA98D1F710D76DD493B04820 2RITIRITI
458,264,956 *2E8746A18DCB2BA5EDF1BCEDAE83955FA47429E6 BL$UH
458,264,957 *2E8A1BD5D0D45AB2F6AB32316EBF015BD3DC30CC HAAKJESES9
458,264,958 *2E8F3F4CE8F4660E353E8F887CAFCE7BAA048595 ACCULAWN4
458,264,959 *2E865B440913272309F0DF21D7E7D0A3674B461C BM$NN
458,264,960 *2E8C23F7EC0E75075A2F45DA0C25639FB3ED09BD 31.nousevista
458,264,961 *2E868DE44AF9650053B6803134DEC133B63E7DDA ACTS-OF-COURAGE-(ORCHESTRAL)
458,264,962 *2E8F9051A6A49675FF0A4D3CF0EE588C5DDBD2E1 BOBBALENE
458,264,963 *2E8651BF561AB61440BA6C9509078BE76EEADAEB HARLEY.MOORER
458,264,964 *2E8955435628427511FCCA7C5520047EF8A2A0A7 367108 konserttij
458,264,965 *2E8AC0E1EF01B7F213FC8CECED9B4FB095BE43F2 adattata
458,264,966 *2E84FBD6FBFD4AEB1904A9F81E8F8075538D3512 HARVEY.HILLERMAN
458,264,967 *2E8BB5BD7C641F07F030D864066FA42F1E53B294 3ARCHIEST
458,264,968 *2E8FCB36D53A9186788F4B5AE395207AD1D2AD9E 3##B~0 splat
458,264,969 *2E87829361B4B195E461AB348C825020D8A9A7F5 ADITIKUMARI
458,264,970 *2E8223FCC7B4A487B19E662547FA6361E7D89DFB 3CACHETTE
458,264,971 *2E8A33B0387B6CD2ADA552E7C708501D39B3802D BOSPRONG
458,264,972 *2E83ACD3DD5F636B40565797FBF1F7E13B4A7CA1 BOUFERGUINEB
458,264,973 *2E80F838DBC628ECFA5A81835333E8E8BEA19ACD adolfoengleby
458,264,974 *2E8622FB316979D0CB83D6120BE63C55A0AF1161 bp-8v
458,264,975 *2E8799D4AF2AE59227428E041D9AA8F65CB5C6AE HELPLINK
458,264,976 *2E809B5880E1E63DD58018EE84654B925C71C3B5 HERBERTTEWES
458,264,977 *2E8EEA21A0A8C6AC4926C170E5785D19053B2B01 herbkasack
458,264,978 *2E8E19CAD8205E564128688672D98474C85E6116 aeneas i-have-been-seeking-you-this-hour,-my-lord:
458,264,979 *2E85CB5248E4E151266785171B17DEB54D6B16E3 aepgg
458,264,980 *2E83873799E19DC92A62C1B25B323EAB85F17A4F heyshaloney
458,264,981 *2E8EC6559F33BEAEA02593C22A5C174A1839C75F high-proteinh/ai/_'pr/ou/t/i/n
458,264,982 *2E886DFBC4B92384EED56D57DFF123D11B1C01C3 B(QD
458,264,983 *2E877F57D9F9998DDCDB83BC349A53ED75986373 461eccb352f73306a35dc6b65c532c66
458,264,984 *2E80E35D909F6AEB7A110F8B500DED78F2FC8FD7 hlingssinfonie):.II..Larghetto..Attacca
458,264,985 *2E8A12C3B7BF0A916389CA5D536C49BFF25D4992 ho9e
458,264,986 *2E81C4653BAF4384B86C83F15B24DC8AD645B72C HO!HO!HOEY
458,264,987 *2E8DE8F092575AFE22CAB793F99A962763E2B26B 4FOPPERIJ
458,264,988 *2E8C99635D15B23505B893798D5DEA3FCD33E651 4GIFTLIST
458,264,989 *2E89515419A790C11A06CF1A628029391147A330 4GLDKWST
458,264,990 *2E873E84B576452020240180F6F3569246C4CF50 4IHAMAYOO
458,264,991 *2E88FE18224AE3919EB73C4F0825FFE7A0917985 4ILUVAPTIVA7
458,264,992 *2E8A4DE4770F768C02F3EA8624ADD46CD0D5FEE2 BRDM:
458,264,993 *2E88326A6B0F9C827A2E2DDEBDEE0570D2F5B784 housemate
458,264,994 *2E85752D4754E0CFDDCCA1CF831ED9F64C3BB6DB BRENTONCOUDRIET
458,264,995 *2E83DE4962DD337F2C1C6E908256AA88C4542B90 4NT1ZYMOT1C
458,264,996 *2E8D3334CFFB1E7D985407E8D4AE38506A2F117B [email protected]
458,264,997 *2E84C4F8111675C484656E442224D1150B81EC05 4-P
458,264,998 *2E8D0334B02B892BB5F5B077A0D7B570814EF678 BREPTATING
458,264,999 *2E882EB0B7F5BB8B84CFBB383D0321FED44B3B8D BRIDGESOFHENNEPINCOUNTY
458,265,000 *2E8C24CE76BDC88F060F5F7EA7A0EF36CB844B37 AHMADTRABUE
458,265,001 *2E8B85A39AFA69304CF8F383679897EA94A00820 BrPI
458,265,002 *2E863BE25DC87D86DB384D3781AB258E1555AF5B 518003 JUUPAJOKIYHTEISILMOITUKSETSANOMALEHDISS
458,265,003 *2E8B78919A74E4FCB4005982EA7BDE6096262C82 534411 CARACALLAN TERMEJ
458,265,004 *2E8F18610D29C0A648CD102E73142A1D4CDBF4F1 AIMIE.ROBINSON
458,265,005 *2E8EBCF4D1CFBFC98FB82B54E9B6221D076EA6E0 HYPTHLLS0
458,265,006 *2E8AA064071B106027531212056905792C8DB434 [email protected]
458,265,007 *2E85E74D2191936D5C6E3B4239E67157CBC0EA76 57653 SIGARAVEICKISIHICOLMAMIS
458,265,008 *2E8A20D7DD41CE522AD7D74FAE68744CA9E7F2E1 579ray
458,265,009 *2E85090BB1146144FB3B52917159E52FD9DB9677 598ND40Y5ZTQ
458,265,010 *2E8FAC7FCEB69858FA1E1FDED5259664323C48F3 5.AAT
458,265,011 *2E846BD9C0A1184C3BF7AA003F2E8D80177BD7CB [email protected]
458,265,012 *2E81D608616E04AF3E0B8A8EE9A31681C8D6AA49 I278_NJ.SVG
458,265,013 *2E8230C850CAFCF936E5052B365B9B0F6D1DF3ED A"JOV
458,265,014 *2E8E4BB95C521D2E5990DA3DFF2C6E34AB5C4F31 IAMPLAYER1
458,265,015 *2E80A7D30F9734DEE735E7BD5E3A93B4993BA046 AKASAKSI1
458,265,016 *2E86F4150E9E927895B49DD5BB6FABA7E82BC390 AKKQQ
458,265,017 *2E81DF6617B5F394DA582E01E60E23D55917C1AA AL:9K
458,265,018 *2E8687C6464C81191FE496FEE7ED947FE7C980AE BURTON.JAFFEE
458,265,019 *2E8CBFB7D1701F37354AF302337EA899BC45CE48 ALANPAPRANEC
458,265,020 *2E85407D27C0A010DA6E770AFB80557ED6D73CB7 5FORDELINGSPRINCIPS
458,265,021 *2E802E9F0C62D187CFC3F03CBFF47619A25AB0DE 5FOUTCHBSW
458,265,022 *2E80731CA02305F9306788C8DE998ADA7E4EFEB6 albertohouk
458,265,023 *2E87A9383220485F4350F97A69A63E315883EE47 IGGLESDE123
458,265,024 *2E8778D52AFD2EEBA54DEAD8430933169483C478 alethea-burke
458,265,025 *2E83FC1FBEEADE553F9FB7A286A45F2D2C0EDB22 IiF
458,265,026 *2E8284DA934E6710F9556DC814F85ADD1D5F5730 IKECALTA
458,265,027 *2E8C180DF6ACB3EB8355FBD42824CA9CF314C2ED IKEGUTER
458,265,028 *2E82DDFB30796CD3D2CAD115E7AF6F22D30FA33D IL.RIMEDIO
458,265,029 *2E82BCC5C7122541F4BE5031224AA9BDAD9726F1 iluvphone777
458,265,030 *2E83773D89A5D6D8E66A4A360EA111AA82615355 5SKRALDESPANDE
458,265,031 *2E8545091C61E87071481CB0F94C19D82ABFDD63 BYLFH
458,265,032 *2E8369CA5F9404FC66D76A8FC34F96DE60F05E77 BZJ/Q
458,265,033 *2E819FC200FC64F34D718AF4B0941816B9650C62 @#ALYX
458,265,034 *2E8FA62F686B1E5C98634DC867DB50DF6FEAA353 C05S9
458,265,035 *2E83D742CCCD223D4EC0131EFE9E1562BE0F81AF AMERALAM
458,265,036 *2E8CB9BF773584B0CEE153DFC565F0127AD52D7B A.MINHA.TEIMOSIA./.ALQUIMISTAS
458,265,037 *2E80AAE162041682A05213C32FA0E9ADEADEC23A 6AIKMANRICKY
458,265,038 *2E8B4AD0194499E5D4DE74AE3A5534EF26086A40 AMOSBRUSSEL
458,265,039 *2E87DCCD4B96CD2B7E5CD0A6D9A592AAFDF35DE1 C3)N,
458,265,040 *2E8E5CEBDE8040BCDADCD1193EA125E02D1C18E9 C3O)J
458,265,041 *2E85BB181B827A510B54A47D06C2F5F5EBF8B4B1 IN THE BAR AT THE MUNICH HILTON
458,265,042 *2E835B42632495EF9931D11423EB3212B3CB2F25 c8t1
458,265,043 *2E8FF08E32D3411822A8FCC8AEEBB681509D8786 6kantajuuden
458,265,044 *2E886A91EF18E2EDAAE579BAE56EF03FA686F66F 6KENRULE
458,265,045 *2E88E834F5E9AF81642DFEC95E2BE3F43E6C0C4F 6LAMPESE
458,265,046 *2E8FDFD91A8EDAE1BAE14CA529EB1505C03D91B8 [email protected]
458,265,047 *2E887FF7F10C441192DC12E5B8AC725817D882C3 6LMSIBSW
458,265,048 *2E80CC954CF2E385E044128F64A7880DEC6630E4 ANGEKESHA4
458,265,049 *2E882AF3A47114C9CFF7A6DEC39EDC0933150FC1 ISIAH.LOEWE
458,265,050 *2E8606A6938C95FE6C6B31C2CA2443F184269696 isplazihing
458,265,051 *2E8F4EA684E97B89648E9D37E0C0CB5440F0D0A4 iT...a.PaTH.oPeNS.ToWaRD.THaT.WaLL.
458,265,052 *2E82C25BF1D9955FE03170815CDDFB2B2AB19A22 IUQNILER4
458,265,053 *2E8747129FA33978D63D2362BC9F94514A08514C 6TURTLERUN
458,265,054 *2E8CA032E30BB09935D6D02BF5CA6E90D6A5FF14 6-VAHLAND
458,265,055 *2E858CA5D36E2B7EC9AA85FEFB5B34895D62728C ANTONISCHED
458,265,056 *2E8755B4F0813E0CAAF4C32D0142ECECECE29935 ja\1
458,265,057 *2E89BC4D116B5258DDE2F6DDC1129355BFF41BFC 73°58′55″w
458,265,058 *2E8D6B6F7C362DCD10CCBB0CFABE242F48C95A9B JACKSON.SCHRIEVER
458,265,059 *2E8D56F98EAEEF710C48B5166D101345F1B68802 jackwaiden
458,265,060 *2E88BA34FE3237EB1274A44BE47B5BE803A3F312 casejtrh
458,265,061 *2E88E2536E4C2575276F1449FF73B7FBBFA2D42F 798750 baslangiCta en fazla 30
458,265,062 *2E8254D5121F7D59BCA22C97124714C0FE651CEF 7ALTIGRADE
458,265,063 *2E873754C89821A1C21FEC76D846AC6F1E2E8E6F cawkb
458,265,064 *2E8EF1E9C28E5AA0B1A05224570ACA26252790D1 aqruy
458,265,065 *2E899C9BDE64C536544C599B24648DF9449A6623 7BRUTUSHORSE
458,265,066 *2E8E1AB19AB6E08ECEB207D940E5076E8C54256E cc-by-30yo
458,265,067 *2E8D6E3B87216661BF4AB584AF23F1A19487C529 ce5l
458,265,068 *2E81B38E5462214B9D174CE186EE77BBC7E8733F CE8VU
458,265,069 *2E8130BB9755920CCBE121DFC7D55ACDD67FF229 arn:3
458,265,070 *2E866F77706FBF1C295BD117C5A17395D61A8785 JAYWRIGHT
458,265,071 *2E84C654BCF27F0300D587F56291CFCEB495B607 7MAYFIEJ
458,265,072 *2E88A34B0441076C8DCA552AE517436E7A5EDB0B 7mylloyd1
458,265,073 *2E84563C6AAA2A9BB10C87BC175D0B89F16CCD19 7UNDERYOURORDERS
458,265,074 *2E8D1B530F29498BF21C470D183CE50900A2EC0B ASIHURAH1
458,265,075 *2E870A8C0A42216A485D582F49C50C9011B0F03C JEMARIEV
458,265,076 *2E8084976DC75974C60AB9DF055646BF70BFFFE6 JENAE17
458,265,077 *2E8D9DE3C1CAA76ACAD58492D069BA495A58F08C ASSENTIO6
458,265,078 *2E81B525A2B64AA2CF64C55A6A4A4468DB246446 JEROLDSTULTS
458,265,079 *2E8B70C79FAADC97DD45889B53E0C8670BF24ED8 C'est-dans-notre-paroisse
458,265,080 *2E8B5DF1B00C5011BDBC6B964910ABD4EA602E14 cge:a
458,265,081 *2E8BED5709FCD507F65B2BBF3178E0A3F78C8923 8BENNYLOVEME
458,265,082 *2E8ADA6C57A3F269FDAECFE1B5BD140BDDDC08E8 8BERSERKOSURRE
458,265,083 *2E8A0A23C82FDEE012A97B541A5ECE6D2D735BBB 8BONEYER
458,265,084 *2E860A0C1E46BC69F52CDB0188EFEB4DB106F90A =JH4
458,265,085 *2E866BF10FF446892A21E859D149DF94CFAB8064 CHASE.JOINES
458,265,086 *2E89A6240400B2A432885D88C6959BE247A9D429 [email protected]
458,265,087 *2E851D282CE4978B43E3321BA5ABD0A66BF12C86 auabw
458,265,088 *2E83A7A490728AA0E9DC189918F2D514DAE29273 augiecastillo
458,265,089 *2E85D50ED4A11AF78997BE1EE979827DCE9788CF CHERDCHUARIYASUB
458,265,090 *2E82072148FD7EA62957CD681BF852FBB99A40C6 JOHNNIE.TROMBLAY
458,265,091 *2E8EC0A560623C5B6E2E10700B81A83767E34A26 JOHN.PAUL.CABRERA
458,265,092 *2E89FD06DE4F951C73F3F3079D63627D067C2A32 JOHNSON.DEFORGE
458,265,093 *2E8C4D6ACF884CBC5F3F05D120D67EED42D9471C au.un
458,265,094 *2E812801244CA977E01B52806931C2E8694766C1 8MEHCSIBA
458,265,095 *2E81863072094B5179D6396E37BB4FC696C9D2BB JOSCEFING
458,265,096 *2E8B2EC4CBA19E7AD54303BA9F8F3DA8911A642D josefclyne
458,265,097 *2E855038DD0F5E2980467E043E6E8200976159EB aw%5-
458,265,098 *2E842B66BEE2DE844E6C8B3B5AAEC9D2476291F1 AW$ZH
458,265,099 *2E857E9C5681A385E88E189115FFCF98A0B41EF2 8PISCESCUDDLES
458,265,100 *2E88A878055D8BCD0BAAF2C2DCC2487568B049A4 [email protected]
458,265,101 *2E81BD41675F4E0B4A5F086A83CD3B38DD289091 8POSSIBILIT
458,265,102 *2E84826533B169ADF73AFC54927CC9924C11ABAD christophermilby
458,265,103 *2E86F720A13F11ED69E80D69D1F207CB9DE2A5B9 c,&ht
458,265,104 *2E8028ED9B7DE2294898DF5931A1A468E5F2E006 JUANPENNYPACKER
458,265,105 *2E845FE38F0E8E424F3D735051B8525F676778AC aydayoussif
458,265,106 *2E8DF431DC0A5944EA418DE1A94BA7A8EAF0BA6E juliusschnobrich
458,265,107 *2E8F6334EAEB3DD62281607D1581B59422E0818B JUMPY4ALL
458,265,108 *2E8E1A086F65F8F8605B3FBA5CFD6F1D27C697BB JUNIOR.SANNELLA
458,265,109 *2E81278AC66BF8D6FD9B14D8CFB478EA99AB0F85 JUSTINMCCAUL
458,265,110 *2E86371BAFE2398DECDCDBFCCA6AF1FF8436BAEE CINORDNAS
458,265,111 *2E802F0F5515E2BCB367E22B503365586B88ED7E cio$a
458,265,112 *2E8574C34127E6ABF185296A3FB0FC1952B2871F KARLBRILOWSKI
458,265,113 *2E8C337BF3F39CADA8651E80CB456DA1E461DAD3 citylory0
458,265,114 *2E832AA8A9B5BDA00F71AB90CC11945BC75F6BA4 CIURZYNSKA
458,265,115 *2E8FC472B96B65764A2B3D42DA22D8D07A6B0923 9ATILIBISSOP
458,265,116 *2E8FB913AA806BE144529C6E169E7F564B806453 CK3.K
458,265,117 *2E89A704DDC33020F0FC08F450E95BBA58D06B61 KATHRYNSIMMONS
458,265,118 *2E86307A0B34E82F68D21E50E5BBDD03CF924CB7 CLAY.NORLIN
458,265,119 *2E8D52488BEE3FC1EB2FDDB73766A049F869ABF8 9EDNEAULT
458,265,120 *2E8CE7F68A8029F061A7FCEC3EDC88B5F9E184B0 9FINIFYFINIFY
458,265,121 *2E8EB47614C465CC510E7130DC1FEEF47EE2CD66 clementnkadimeng
458,265,122 *2E82EBDF59866F30DADE09A82C897B61640AB8F9 9iluvqueenie3
458,265,123 *2E80C4595C8AFF6EC45E27EE6BD57D9975F27056 CLINCHER
458,265,124 *2E823BD88BE6103EC6AD41FDCB169684A0D3C7A4 key.cee
458,265,125 *2E89F3A3E8AA0FAAB46A8BF791CD1E633563EB3A 9PARIZYAN
458,265,126 *2E80FE30CC0FAC6B22212B1627A42B4350115340 bbb?d
458,265,127 *2E8FCDBE4EB5F00C63E54F7263F7A20872876E00 CMOO6
458,265,128 *2E8CBE126942C2C7000BDABD2E276548818FC308 9SEITAISE
458,265,129 *2E8427028CC6F749CBE38E3526DE8E0FBD0B1F6E B_D_D
458,265,130 *2E839E8201676FAD0EA676FBD567E459BDB37D5D 9VYAVASITAIH
458,265,131 *2E88FE9BB7C8167E4A0604434BBB3F797AF36EC9 COCHABAM0
458,265,132 *2E88EFF6E42AC697D8E6DDA0E1B8651F3EBFDB1F COLBYSLATTON
458,265,133 *2E8909C3E95C6100A0951E0A4E37961A9F213B3D COLDNESS
458,265,134 *2E843FC76F4C53D5295B11B1C00FE3B514984A05 a1p;l
458,265,135 *2E88E16C19E0D420308B5A9ED633151A15B97461 BEININFEKTION
458,265,136 *2E8A5AB21992712F160C3DF8381695E346057087 A5J8
458,265,137 *2E8B330BDED244A68216C16337E864EB54792AE9 kruimtoebroodjie
458,265,138 *2E88203105E9B0EBD072800CBB8703DF27E8C0A7 BERTRAM.HALGREN
458,265,139 *2E88C0C363D71F1EF7C11D0BB7F12818C811D5A0 [email protected]
458,265,140 *2E84CA972FA8DA6C5CD0EC9DABCB1511AFE1CA44 b%ew
458,265,141 *2E8D2AC359DF79587D68E92757EC843512BF1C01 Bgp+
458,265,142 *2E88E887793E65F09ADBDE35EC4A4D0EEDFD18E4 BHAWN
458,265,143 *2E8421E06960DD41E228AD65035081E11407689A COURTNEYRIESS
458,265,144 *2E8BAC000D5ECBF342E24CC30E14320979A8B89B LARAMORE
458,265,145 *2E8FEAEE3645757DCBA84F7F034C9CC854BFA0EE BICUSPID
458,265,146 *2E80109C515E8BDF1F86B7C71F8906A8A717D978 LAURENARAGON
458,265,147 *2E8322675CA439FFC094EC2D076CDE28551E1096 BI/LI
458,265,148 *2E81CBBBD64DB1627840C94FF1DEFFDBB9C28433 L\EGLISE-AUX-BOIS
458,265,149 *2E88E400EF3A0666CE45CC27E7EF4D2D064C9757 CP;
458,265,150 *2E823DF6920D4D5E2ACC4F078C8CD0AF42FEAD66 bjpzo
458,265,151 *2E8FDBFDA6BB51811823DB7F8B66E1612B154F97 LEONATUSED
458,265,152 *2E8927A7D27C9712A41762CD1B19E0408C7B825B BLACK.S
458,265,153 *2E8F206F9BEA8EC1F1DEC32134E28349A7E5359F C:\PROGRAMFILES\MICROSOFTOFFICE\OFFICE12\GROOVE\TOOLBMPS\OUTLINETOOLICONIMAGESMASKBMP
458,265,154 *2E8A0F0D74576B878D373781062EE2DC1D75E765 B(LU
458,265,155 *2E80727E949B4D880D71305590CBA118843D7F76 [email protected]
458,265,156 *2E86288C765997F687E16866C024A5105EAD055A c#qxc
458,265,157 *2E8655F0CC530CCAC4C52613E44663D5477D66CC [email protected]
458,265,158 *2E881C87A6E65F25AF3A8FFC304C4FD0ACE4DF3F ACHTWÖCHTIGE
458,265,159 *2E8BB83567861A1A83DA1C1007120BCB56725141 boowahboowah
458,265,160 *2E81C46817B32CBD0DA70C1365FD3CFE8F59065A CREATIVECOMMONER
458,265,161 *2E830224B33CF6589781ACEB541DE9288A532355 B------P.~0(x)
458,265,162 *2E8723A9C98F1B82D0A141C77D3E409C2676E454 bqiii
458,265,163 *2E89B966491CBBF87F8D3A29679D9D260F3A2703 CSYLVIA7
458,265,164 *2E8343793BF0BEF68B6A6D4ED9870E54C0BEC626 lindsaysegouia
458,265,165 *2E8FBAE5C9EEE60763EF6C7E089C172A20769CF6 [email protected]
458,265,166 *2E841227450DC024F02430EA70470E2430AA086F Brandenburg.Concerto.No.6.in.B-,.I..Allegro
458,265,167 *2E88ADA6BCF184BA65C44E5FD6837BB7DFEB7B91 cub[obs3], rough diamond|.
458,265,168 *2E8E4F5EA0D5B7200EF6B545DA0786FE2B50B9AF AE7WN
458,265,169 *2E8A5B98592F8158661E507393998E29079D2033 brendawerner
458,265,170 *2E83DFB30CFEE1D5FAC4B8DD1AB663FD0FD76D3D AFGEKRASTEN4
458,265,171 *2E874322923D8EE7B49476990517ADDEB9662089 lokanfu
458,265,172 *2E8049ECAF8B8AB807A1A3935057F4379B563E9B CYRILGALDO
458,265,173 *2E89A11ECC3D3D799E298EC9C5ECD86F089B2B0F CZ9HM
458,265,174 *2E8F7AC0150246F3161379C3FFC344E3C1EE36D2 bswjconklin
458,265,175 *2E8A10CD3D160264C2764422D9F7A9A1C7F2D37D LOVE,.TRUTH.&.HONESTY.(BALEARACIDIC.MIX)
458,265,176 *2E8DF68DA31E4FD5F732A885D97EE259EF16FEB2 bswshusshhhhbsw
458,265,177 *2E850EB2C0D41DF9A22F6209BE68CCD387536338 BTT9N
458,265,178 *2E8BF4079F7765E5A74D1EFAAFC56C7C9B6EE9E7 [email protected]
458,265,179 *2E85C5467EEA0585C042F651372F1860C1D83323 [email protected]
458,265,180 *2E8D14D61728B83A018AA5B01BD0032FA7242142 D9121970
458,265,181 *2E8122E21CCA1CD9E0CB2C5223120DF2029ED0F7 luresa
458,265,182 *2E84D3E33318E0AA7655E012B7F8EF08F522D98C DACNUSINI
458,265,183 *2E85D576C75E3228C8D34B449F6AD80E390EE09E ALAN.LUCHESI
458,265,184 *2E840AF621F0AD9A645ED45CA4AC9D1FA238CE96 DAHIPURI
458,265,185 *2E820B378021B6891A7A4998355BD31CA157302E dalegreenstein
458,265,186 *2E83C877E30300BEF77F6C141E164A3689C949D1 LYNNLENT
458,265,187 *2E800ABE220971EDC2F64A130FC6A5A806BB798B bwe)u
458,265,188 *2E8DF315678E2BFBFB2E365461A1896FD5E0BD63 DAMIANMODENA
458,265,189 *2E847BF4CE402419D407813D7A0DC4CC4FE9C243 [email protected]
458,265,190 *2E837146BDE05958561283CCC7887714106E5FB4 MABWU85C
458,265,191 *2E8B11E1FC6E4B8EE233D1577F627746A890D150 dandefouw
458,265,192 *2E8DED33B26FE94E85BEC1D082D1B6EF105FF55A macieski9
458,265,193 *2E8D4AFB8CFC4ED720979228FDC05EEB7FAE4819 [email protected]
458,265,194 *2E8EEEF2BBE47852861221F72C05126731743D5D by.oo
458,265,195 *2E87E3CDBA1E587088DD8EC659465D60546A33D3 makana
458,265,196 *2E8ED7FA959BFF0628D70F2A60A655B30F97A293 bzl.3
458,265,197 *2E801A6D6DC0BE9B6AD6A03A4D7C796224FF5120 C#0ND
458,265,198 *2E88C40351DB45E430263C170D329E555721607B darlasmyth
458,265,199 *2E89079CF3F310A568DDD186C9ED8F174BE12239 [email protected]
458,265,200 *2E8AEB77AC5EC22200A0764ED6A6D69C938467C7 c2a/o
458,265,201 *2E8D6D557754BD5CCD611D8B37E2A6DC24BE6837 DARRONSMYERS
458,265,202 *2E8F9B11DCB0B4F17FDF9706FB1F7554AB318BD1 C4i?
458,265,203 *2E840C2BD96AC004AC77F9495C6E6B75CC78D143 Das-Rap
458,265,204 *2E8B8665CD62E9FFFEC5E9AAF15A001540B4B7BC [email protected]
458,265,205 *2E8DEB308C76CB29FB6A11E3C0E5D5D0A1E880DC AMEKNARAP1
458,265,206 *2E8B750A9ADD1DAB76D4EE63D391CA3EDC0680CD c7-v
458,265,207 *2E84BB8E0C5B5371CCDC28AC8D2DE9093CAB5566 AMOSTORIBIO
458,265,208 *2E866196B8FCAAB3ED8058305B1B590532D99ABF dayinpictures
458,265,209 *2E843655A86F84C498A9F54F41F5FEC5E76EDBE2 MARKPOSPISCHIL
458,265,210 *2E8D02F6C9847C35F85D1530E256B2B4FA840726 ANAS.YASIN
458,265,211 *2E8EA4D9CF0A55500EE29B3F7ECD778336AF74AB A,NBX
458,265,212 *2E824D32DDB3EB822D707DFD0DC4F6D90E35AF81 mary-barrs
458,265,213 *2E82820DB1F1DCBD56E2FC2AE5B3AA742DB16347 CAMILLEBRADY
458,265,214 *2E8C1825F9B4954D942C5423CE156A37E801FE35 matrikel5
458,265,215 *2E82F06568D9CB3766B038BDA17913E3C4A0EB83 carl-m-kennedy
458,265,216 *2E833267E3DBDBF0E2AD27BF974AFE260BA6AB83 ANGEL.SATUNAS
458,265,217 *2E82CBD03E63615D9F26DC6F8EB274C6F9A71793 carltonstoudemire
458,265,218 *2E841A0B950F88E791664BFE301C0527F0D745F8 DEANER.AND.THE.SCHWINN
458,265,219 *2E89568A054F988A11ADAB5EA054D8EAD63BA034 [email protected]
458,265,220 *2E84B6E9C80F9EE574C13E11186E8201854C6A44 a(nj/
458,265,221 *2E881B22F301683AFEB12A196D384FC8B27D46AB DEBORJAINSISTSSABIOCITEDP
458,265,222 *2E8D5397B9B9B13AA7DD2E0FD7E354465396CFD8 [email protected]
458,265,223 *2E8A9B77209B0CAA0E41873DB03218D2F63DF59E ansaralimamalmahdy
458,265,224 *2E86F063D03FE1D3558A55229F32A592FF3CB892 antenvr0nmental5t5
458,265,225 *2E8A904775E77B6765B5C59BCA30D4465216A947 mehrabi
458,265,226 *2E8A2E35EF85F20A4383C6333640F5592F9B70D5 MENUVAIR9
458,265,227 *2E8C7EA08693945E8ECBDCEC224B390CB13081A8 DELMARCOULTAS
458,265,228 *2E845AAD2C9B3A1423FC94CDD5DD4CFB9C798F02 ANYFERNO
458,265,229 *2E804B98D321D7693998507326E6F4D0B0D685E3 metalmassacre,volume10
458,265,230 *2E8E09E9FBA0D8C72A35A9AD7B2255841A25C7EB c#ges
458,265,231 *2E8D3812B3E5EDD2C86888EFC903492AB36574EE chbh
458,265,232 *2E8E61A7B1D42E1284FD54489267F8ACF4597C23 [email protected]
458,265,233 *2E850E51320119D553CA473E585845E480DE08C9 apociyphal
458,265,234 *2E884BFB4AD52945D4DAB88DEB0BDEB9272BB94C DERROSENKAVALIER:ACTI.WIEDUWARSTWIEDUBIST
458,265,235 *2E8DCB51142791ED998A862954718ACE4A62DC4D MidwestMusicSummit2004SamplerCD(disc2)
458,265,236 *2E812063F9216B7AF6F3C78500D4BC70468185B4 chongvitalo
458,265,237 *2E83CE20219602C777EB8979E709DA861806FA05 DEVRIEZ8
458,265,238 *2E820B2E93870E1C2ACE919839D0D64F78CB28FE millarddey
458,265,239 *2E8723DE5C9E66CF9B611FD3C96D41299094B1F7 milo923
458,265,240 *2E860D71C4179D1D492D57AACFF5B2D4288E53BE dey8d
458,265,241 *2E8E9201FD397B824EA074332747E6E00C414B9E ARMY.AIR.FORCES
458,265,242 *2E8C126C1FD23C6EAA6DC687E435ADBDD5B9C0BD [email protected]
458,265,243 *2E8D86BFC36DD1A9EE6DF1B6BF51693BFEFAFF18 DGOOTEB
458,265,244 *2E815F8005D888D87E3910C512BBEE4E7F665B55 CITRUSANDCANDY.COMWWW
458,265,245 *2E81FC0B3716E7481C1C5DE2C9CE61714F07FDD3 ash__ton
458,265,246 *2E87657FF37534D865EC5ECE0A2A3EC4407F31D4 c-l7=
458,265,247 *2E8A508187D7D35C6C0AA0A3DEFDC86E724A7C22 MONROEJONS
458,265,248 *2E8AC49F708CB6FDE9CCD52827A1F7AE6F2D1D7B ASPLL
458,265,249 *2E861F7C3C311DECAC1C613A92D32AF0BDEE415A MORVEUX.
458,265,250 *2E86AF6878A84B1234528C703DA3560EEEED960E cliffordphilpotts
458,265,251 *2E89172721A24854C1D4FA30BF6216D1320324D8 dka%d
458,265,252 *2E8A96CF9CC87DCD9D19F37B69068CBD6E227C94 [email protected]
458,265,253 *2E85DFBF7C2CDA6D42E6886CA2A4648CCEB1A33E dl=qg
458,265,254 *2E8DBF3A5BA962D06895AD780DF474EF0DF6A0FA CMX#!
458,265,255 *2E851FF835824954786D058ED4558B3573F1679F DNAWMRADING
458,265,256 *2E8C49F2A1B91DA0BFC5419DD888403586ED0156 avfmw
458,265,257 *2E8F5A365D44249BEF8D05A32873C4BF2B8BECE6 AV&NE
458,265,258 *2E8AC58D96E08C1A4162BD1DB6C4F7CD2C7EE3CA awrq%
458,265,259 *2E8C9B0FA5B420BCD205D0D2E565722A2F09F88B DONALDYASUTOMI
458,265,260 *2E85D716907DD820A9C4C4359FC80BF8845A0D16 A/X)L
458,265,261 *2E86D3854E96B2815F2F13FA76D732E74E5B650F DONNIESTRAWS
458,265,262 *2E8A89BDF5DFEADA1207C7DC5CB9873AC368F9CF DONOVANHEUBUSCH
458,265,263 *2E8D5BB3E739E952B86F445E2B2A81089250C1FC n4k3d35+
458,265,264 *2E8C2E961CEFD80B1D29E9E7136B65CA3F03AC6F DORIAN.GLAZEWSKI
458,265,265 *2E812594DA54EFECE3A67CA0ED1FFE71AD5EFA86 nahpocysing
458,265,266 *2E8DE790D516BA3161D4CCB9E1DB6D987AC1EAF6 NARNARAYANDEV
458,265,267 *2E82D9F3F4831734C0BD763B99413C1FC1D95C8F CORBIN K HAY
458,265,268 *2E87DA1C40442AA38E6DD02FBFBEA9DC6E931AFC n\e
458,265,269 *2E8370ED11FFFDA46BAC196AAD466B45EA619A1A corrup7bl3n3ss
458,265,270 *2E8A5371153B07A6E38B09515A0E85E678EF5E0B NEIENDE4
458,265,271 *2E83C1A6D7F33FFFB198D0B56CE7741CA11F9E82 CP!QK
458,265,272 *2E82394B476C9FB03C67732E0D612FAC72CEA993 C#Q
458,265,273 *2E88F6E80DD59646E8190FCB61B5389D6FFFDEE7 [email protected]
458,265,274 *2E87F581903C559D053F980F4AF4BBD897ED73FE DUANEMARSEK
458,265,275 *2E81E9860821362FFD12903DD061567F3A8420AE c)qxb
458,265,276 *2E8162034456927A68A1D5E036645D5E3EF97DDD dupionied
458,265,277 *2E8C19226A58B2A4F46458105B94CFFF0B9ADB4A crni8
458,265,278 *2E8E60ED62954C0FB172BEF00F8D350C71B4783E NOBILITY—HOGARTH
458,265,279 *2E8CF313569B00F1B2B24320C15396C41D672010 BB#OD
458,265,280 *2E880E28017995882E965525706D821D46BF127E bcaui
458,265,281 *2E8B73CDE88FC5C00042B63CD8885A18F98614EC NORBERTOSCHNABL
458,265,282 *2E8F90A5CEFCEC1EC57E90DB7915C93D1EEF198E bdjd
458,265,283 *2E8DFF448CF79E7B55F90DA9B6446728A8F42A54 dwg=a
458,265,284 *2E856ABC750B497BB23E222F709323743FD22654 BEAUFORDBEAVERBEHIND
458,265,285 *2E8FE9544C3CF6DC88E2BAB42EDF2B208F14B3EB BECHEVET2
458,265,286 *2E810279675E640DD5341F7E180208CBEAB4E389 CUEVASMUNGUIA
458,265,287 *2E8F627BF2903B1299764ADD325E0267F5DE9EE1 CURSIVAS»
458,265,288 *2E8E9D26F589DEBF18E7679F62525D49E00C9A40 CV8:G
458,265,289 *2E88E5053C76B6674E927FFA77F3AFB13F54ACF1 cv+id
458,265,290 *2E824FC899B7D733EE34375706C52EEFB6B9092D cw9#:
458,265,291 *2E8DD884109556B793CCE6EE790F56FE8966271B BENJK
458,265,292 *2E8F71324246B0C53AAB96D993B7056B73B040B6 CW&LS
458,265,293 *2E8A18BE7FD27FE4686A03B8585B76E6E70465B4 cymblerne8
458,265,294 *2E8D21E308E0F2669AB4C4374D4F29F71F4D7065 besauste
458,265,295 *2E84607819D7C648EBD16DFFFF97FC3DA2F34AE0 EDMONDDAFFERN
458,265,296 *2E8B665BBD744E09488620E1DA8E38184FBF9190 edmundonurnberger
458,265,297 *2E85C8D319D327F1614BDCD869D1E0ECD90F9C57 D131199
458,265,298 *2E8EA2A2B1A865A8A7D785D7B07F8432A0CF7388 BEW
458,265,299 *2E889B0214366A91FAF8F3A2FF8E8BED32A4727C d%2p
458,265,300 *2E8EF8096B94797B9567F03B0FA32E7125ED1B51 BH/EL
458,265,301 *2E8D4EE3BFB1393798A2E9D6C7A03904E76059EF BICUSPID
458,265,302 *2E844147F1F1BD14EB9EF981B8781DF3B3EA7A92 EI0H5
458,265,303 *2E8C3C0D2BDA21818C32D681AC86CB1CC1E48910 BI%NN
458,265,304 *2E8C80467395F500C7FF5249F4090F934FCA45D7 orvalserino
458,265,305 *2E8EB21D869342DC8BB3C541346F635B28973185 EIMN{DYS
458,265,306 *2E88AC58956EE763187FD09096C9CD754EDA21E6 BIOINSTRUMENTATION9
458,265,307 *2E8F264C662A464956C80D43BEC951376F6DD996 EINONBEE
458,265,308 *2E830A97BCB55CCBED344D1382CCBF6A568F0999 OTHASWIECA
458,265,309 *2E8594E73E2A29B90027AF804AE313048087E281 DANIELMATHIASEN
458,265,310 *2E8174E5E3348D825A92E4ACF61AF2621066E067 ELEMENTMOSCOW.RU
458,265,311 *2E8C8F659F07290E88CA1AEAF88C4F7738212DC2 ELICITLY4U
458,265,312 *2E8595F13F8792CBD3EFF87EB3E0FEFA3DF24775 ELISEO.GREMMINGER
458,265,313 *2E89BADF8185A84E06D491616D9634AC6CE113FA DARIUSZULAUF
458,265,314 *2E884604503DD71537BE9ECAEA41B0B3656C3755 daronprimrose
458,265,315 *2E856D1E3D78DF58F3D4E362FA1FA58B94883B15 BLDG9
458,265,316 *2E83C04AB5F541E393FA04E38E668F7654309095 DARWINMATEO
458,265,317 *2E8E6838DB4A393CE72B109986FBE34C50C6AEAB DAVIDHAIRABEDIAN
458,265,318 *2E8E3E23A68186EC564103166FDF845FA6797F8A parisharritt
458,265,319 *2E80B9F3F36881B0A6563F09CC64C3D6D7A54F84 DBI/1
458,265,320 *2E8ABD406DC344FCA24020B2B41AE0A074D1AC2B EMILY.HERRITZ
458,265,321 *2E8E98F8D2C5EE9B49A6A927515AFC8E6C65733C PAROTIN1
458,265,322 *2E820877FE1901048564A94DCD1FFB8147949CC7 PARSKEY3
458,265,323 *2E84497EB65E8BC87FF75AE0456D649740EE0B70 EM_K
458,265,324 *2E8AC3F997F9C65E25768199AAD90AF307004B44 DCIIS
458,265,325 *2E830163283E95D2AF6A7EC77607252162F7551C PATRICKSLATTER
458,265,326 *2E8CE0081B4CA3EEC4B38F3B938538AE4D940242 PATSY-CARLSON
458,265,327 *2E8A158DC4EDA893BC542922D6660A417D4EC43E PATTIMALDONADO
458,265,328 *2E8DA65C198AF4B6D710BA46A20A75581EC9884B paul864
458,265,329 *2E8964EF00102AB74FB2B7A5C03C5D5A243458B2 EN24.45.131.185
458,265,330 *2E8FE3B716E7E0F722E0062366E1E663146C9731 enanad80918
458,265,331 *2E8E0856B43315B47F67A5561A5234AEF8F70C19 borttagen5
458,265,332 *2E8A5D49E572F9CFCD3EA7191074D4E939DB5366 dead-telepathy
458,265,333 *2E89CF437D77DADEC4F869777B420DBA7C355D6E ENROBUSTECER1234
458,265,334 *2E89826825E316937EA46978E3D7620042315ECF ENUSWSZ465
458,265,335 *2E8397387955EA73E1F3AFABA2ACA5286C976498 pérez.indarte
458,265,336 *2E83C11CF2A0E1650561E6AB673FBA98B10846BE [email protected]
458,265,337 *2E809D6ECAAEB97A7FAA6CDDBC0C55996731A65F [email protected]
458,265,338 *2E8D7AD1F09B8ED36CC8FB9D3962661760C2342A DENUDEDSING
458,265,339 *2E807231C839514E49B1D996F83D498532AC4E22 BRIGADEBOK
458,265,340 *2E87DAA65E304D25C87352BC39C16EA89D8A2C5B ETBZM
458,265,341 *2E82337538EF61883EA54F04321C41865DEC02F5 BRWAU
458,265,342 *2E8A0CCBDB41A3414C4AA9E5C7F8C5244130C971 EUSEBIO.WOODE
458,265,343 *2E861AAE4E8414D6A88A501A6DBE1DF5852E0C5C poets.
458,265,344 *2E83F7216CB95601500393606F3477A9E539B09A POLUSEGA
458,265,345 *2E8B3225DAB7FCE290426FEB85C20EC1D0647CD4 dg.,p
458,265,346 *2E8AE41135489CDF4A4189C2F6739256BCCDB11D bt)m;
458,265,347 *2E876C8CB70045B4FC7EE75D3C3B2FCCDF48473F potenco2
458,265,348 *2E87F02100650BF21E51D435C96D93FBE15A309C B_Ui
458,265,349 *2E8FB92E3AEF239310BD6FEFF353ED016EEE44BF PP*.*.SPLAT
458,265,350 *2E89D7FFEB1860B5C4F5AE2BC0C3E99C912FB94E DISPLEASEDLY2
458,265,351 *2E8430A1177176F7B124D3C64A5F985BAC5D7EF6 BYAKHEE BYAKHEE
458,265,352 *2E889ECC8ADA84C91D0EDF941D986B1D7E2228CE BYh"
458,265,353 *2E852209B9186D691674DB1426768D5770FF3A75 PRORPORCIONÁLNÍ
458,265,354 *2E85E13071EA09414F27F7D53783D1F31E3BBFFF c0mp3n5at10n
458,265,355 *2E83F31D2A5E3E5A7A134401E4100CBC3F9D0EDD doc$v
458,265,356 *2E8A55E80207F9CD31D846140DECD87CBAAA93CC Q069CUR
458,265,357 *2E8EBCC12550CBB3CD02093C50FBD67F7C492ACE c4&a#
458,265,358 *2E86882A5EBF40A853F2BCA7F5C666FEB31AE59E DON.PHILHOWER
458,265,359 *2E813F4566E6A757255DBDE11E314C7902B7E54C [email protected]
458,265,360 *2E8BF9F5E57DAF331974C2A49292B536372E77DE DONTREVITHICK
458,265,361 *2E84186570F229B4B5E05B0BDF54CD79B8BDCCAC FERRETDENISE
458,265,362 *2E89F1835CCCC9956946D98A260A8225487A506D fi1m9o3r
458,265,363 *2E86EC4E4FF63B9DB61945263BE75DC640F9561A filmfertigbearbeitung
458,265,364 *2E8A35D0D8759E36393AF48E95D99CE399661655 fiona-stephen
458,265,365 *2E88E8CFE1B3D977343102DAA87F0D25F7A72683 FIORENTINOCASTIGLION
458,265,366 *2E831A23D4F0B775BED58D69BB87809D7984B54E cantanlosni
458,265,367 *2E8EC607BE5953363A8D3A131F9B2A006A388309 quem-nao-tem-ninguem
458,265,368 *2E8EB8876BA29E925390A95D3263BC81CD3FC5AF quennie0
458,265,369 *2E89C2C2070E764AAA4103D5D38DE9EBC1FE5249 dqwo
458,265,370 *2E8561ED55CB8D15FD5DFBA9C678B1027FE49B5A CARROLL.SANDERCOCK
458,265,371 *2E86E23194EF246ABA7169A63C817C5900E3FC60 RAINAIS4
458,265,372 *2E8741CA03F65FAD02543E7B4A24E87806C32B2E [email protected]
458,265,373 *2E8932513E06FA2E9B32EC3FE85E7DADB6499AC5 fqh(
458,265,374 *2E86E5DABBE6AF7C8BBD030F813883F6D4F697DF RASE
458,265,375 *2E8AEC86624B112856844865D017E5860255A39B DUDLEY.GIRALDO
458,265,376 *2E8EFFD5A0E5972ABAC68B5073220990DDDB8651 R&^C
458,265,377 *2E8417083547F29DD4F808EC48C69860E376F496 c(e5u
458,265,378 *2E843575C8F018001FEDB3CD53010D896196CD67 cee$q
458,265,379 *2E822DA10AF77D80B3177EE87BA2B5CE7969B3C7 REALARTROADSHOWCONZWWW
458,265,380 *2E867DA6BDBD645A0F5286CDE42CCDAD3C52D458 d)!v2
458,265,381 *2E8120E6AE135EC6FD548621EAEC94D161C2A49A RECEJARA1
458,265,382 *2E8715972C49AB85DDD9B0907D171DF54BB1B87A DWAYNE.CARBERY
458,265,383 *2E8116A6D595102DC87BDE57510E9942F99C2390 FUTILENESS
458,265,384 *2E84D7721F23CAEFDD11A9811DD64B10F4CE039F REELSVILING
458,265,385 *2E8F1F88AFD7B1BF1093F4F54EFF5BD192808232 DZ0G69
458,265,386 *2E83AD858EA478BD5747CF643753FCFBEBAB1DBF reharmoned
458,265,387 *2E8E5A7B5DA2128F77039D7088E212E3EB3E133A CGM%1
458,265,388 *2E849DFA939A59AF843356973FD0897B6860224E GALEREMAK
458,265,389 *2E802CCA44FD9490EE5CD66735FA3410B6B73983 RELOCA7ON5
458,265,390 *2E841B5090BF157C97A3ABCAAE7160575685FE40 challengabcdef
458,265,391 *2E893D9C0734C3BAE7E9EF8B93308CDC023B8E8D GARCIA-ALCA
458,265,392 *2E818FEA9921799091E513358AAF98E331EA06DB chanukkahed
458,265,393 *2E88430B24613B2F3742B7247486997A67B382EE edik?
458,265,394 *2E88FC1EEFD4ABE21D990130EE69272FD6E368A5 eduardolaycock
458,265,395 *2E89F3929C6E5CD456F21D7257192E1FEE8CACAC [email protected]
458,265,396 *2E883FCE93C3965C96F66912FBD3F6E90EE3DE45 RETEPIPA
458,265,397 *2E8716B8B85A2066849DD7B99B689FFCD82A0413 GC4!
458,265,398 *2E8642EE1FACCAB9D3C0FA08205CBDD99DECE47B reynaldoimperial
458,265,399 *2E846D92136910DD1D050661F7CDB3295925093A geraldbuckbee
458,265,400 *2E84E3AA9A7C8FBE8D3AC0212A6651A96FF26AEA rhettdixion
458,265,401 *2E8B8CC281A40D5396AA870F29A5F769481980E8 [email protected]
458,265,402 *2E84AF20539FBBEC8B3EE18A5BD8598AD78282D9 RHODRI HARRIES
458,265,403 *2E8B9E7C233791AD79F7B25DAA9CBD84C83F04C0 RIA),VOLUME11
458,265,404 *2E8B9B665A8555F044AD2EE0998E9FF2176F92CE geremd.
458,265,405 *2E8C80891D922A761B58861A07ABAD663FDD8EDE GERRYKEHR
458,265,406 *2E82DBFC9EF5EF15306232CB908D25259ACDD77C ELDON.BRUMMET
458,265,407 *2E8527E44A1BFA73A31D8EA3AE08FF383351D0E4 ELECTRODIALYZES
458,265,408 *2E809E364324152F0C89887EA4FEF483E270F9CE GETSEMANEA
458,265,409 *2E866166F4BE33B4F11EAF4CFE820804BCB56AFC ELG5B
458,265,410 *2E8AF88B7D8BC0A18CCFB846CDF80D8098E4456F gillesbooster
458,265,411 *2E85C30CBD4F8E87A437390CAB832EE03A6E439F ,GKCHP也發佈一份民粹宣言宣稱「蘇聯男人的榮譽和尊嚴必須回復」,保證
458,265,412 *2E8A50BF367530579291CFEB392DBDE2AD013A87 CIMARFLOW
458,265,413 *2E8A0F35BE3B75134D5F855F5FAC1EF26C3603ED ROGELIOBRUNSTING
458,265,414 *2E84CEFE0243A166F674209F69522C6874E71953 „gminna
458,265,415 *2E866391CDF49BD392084E32EE58BA2329062BBB EMUCL
458,265,416 *2E8EB7F5FDDA6D80A5C8D25F086A51014A17D263 ROMANESCANROUT
458,265,417 *2E8430E36BA14C52B30F409EE8C543739D36091F CKUNTEMEIER
458,265,418 *2E8A95ADE4963C7BB919C47FCB6157651A59CF9E RONNYMUNL
458,265,419 *2E88924AC9C95CC011E1D0314B42C2DE2DA35F24 Cl4h
458,265,420 *2E83487DB1C72F983EE9894AB7CAE72C89DBDCB1 rosariochrestman
458,265,421 *2E808CAC795602FCF78E6BA810E09060B5847E75 ROSARIO.ISHEE
458,265,422 *2E8FCD424F8628EF7EBF8CFA85B5A92400FAEC98 GOLSPIED
458,265,423 *2E87C2FC5370FD03981A28BBBF2EE26782463BC2 CLDGFAM
458,265,424 *2E87AB435B4403842280A237FF91AEAB7B423545 rowenaabo
458,265,425 *2E813187FC12E83C1BFC1216A5B2E7B662C4D49C [email protected]
458,265,426 *2E8CC90F5F4C6E40321E928BEFE1A7CBD9BBD26C ENTLEBUCHERCATTLEDOG1
458,265,427 *2E873DA47926FFCB03AFE9DB1FB19C026552A0E2 gratitude:apathtohappiness
458,265,428 *2E86C90B3E077BAE3411F87FBCBB7B4CDB6B4EBB CMNVR
458,265,429 *2E87771468120E6CAFBC3EF3EB831B9B37DE3F7D CN3R!
458,265,430 *2E8780B6BE2C93179AB59CE313CA5659438A33C6 [email protected]
458,265,431 *2E84711CED84760CDA503F3BC4FDBCB66B44D455 sabbatdag
458,265,432 *2E8FEFA45E2B769DC94CA4AC541B54F4C8C74BD2 GXH3R4IH
458,265,433 *2E82CC10B249C91898CA80A54588CE6E5F9B3252 ESTIPULAN2
458,265,434 *2E8D724BC85B25123916A030CC0ADC9967BCA429 SAMIHOSSAIN
458,265,435 *2E8FEB027E7FB4090146BE97A6CD46CD1E70EC33 ETHAN.MARTICH
458,265,436 *2E865B9F929CDF5045C41EDB7458727A9DCFAF16 SANDERO15DCI
458,265,437 *2E894412890EF432FBF0F2048F86C6BCAAC17F8D EURDNIVED
458,265,438 *2E849D448F153507A243BB33E75BA8A5C2C9F560 connieyagues
458,265,439 *2E8F10F1C837F75AA2EF316607D19975CEAB5F3D CONOSCI.IL.MIO.STEELO
458,265,440 *2E8D2BE7212533EBF8B7F3CD38344BA83CC27EBA SANTINABETH
458,265,441 *2E87E4B19A9DA19A4D803937991F268A19C5CA5D EXQSMIF0
458,265,442 *2E8F999A1D4E75022AA4C3156869E1A9E4C2BC17 saulliska
458,265,443 *2E835069F5FF457F1A85FF6349A17AC5A36B99FB hasparent6
458,265,444 *2E8092D5EA5228247C98C2DB40AE8BBB6704087C [email protected]
458,265,445 *2E875D54FEE80E73CE9C329D2294716B8ADFB402 HAWKEYEBIGBIRD
458,265,446 *2E893A7CF16FA77D6F79F743F556BB92DF5F670C f&6r
458,265,447 *2E8AFFF952938867ADF1086B1A41B221F9F52AA4 CP;
458,265,448 *2E8728B8FF8765BD3F09EADD04A58750AC048E85 schwebendorf
458,265,449 *2E8D9272D7A809718E9C1F415F6A5EC4340942F9 SCITCALY1
458,265,450 *2E877B635A1CC0B27ACBEA3BFFD9BC78DB3691E4 SCNWRGHT
458,265,451 *2E862E3479C14E0BA3B4B65A7B29785104FC1655 SCOTT.BATTERSBY
458,265,452 *2E8E117045C4FE2F72F62505463CC07012128A6C SEANCES
458,265,453 *2E83E0299515CD08A720E81E70FD0FD07500234E SEAN-WILD
458,265,454 *2E8AC7B149744C3B4271169A3F261D647F94B27A fbk
458,265,455 *2E82BFBC407EB4516FE5CAA847B40CAAAC9B095E [email protected]
458,265,456 *2E8F55DF78BA362C954C8A0A27D78652A0F29A79 cqc#$
458,265,457 *2E80FF6A674AFD60B3BBF1DCB80ED94C1B8240C8 SEELREVING
458,265,458 *2E85FCC997B79B3A08DEF17EDC886A60C3C863B5 cranioms8
458,265,459 *2E8C1A2BDA96586F60E154771921B21B66DB50CE CRISPIONS.
458,265,460 *2E8A4A68A5AF8E8DB95B805C07DE53A1355194E0 HINDCAST3
458,265,461 *2E8442AEF7AA4C6789A5E522796AC9E610CC6B3F FIGHT-YOU-FOR-NO-REASON
458,265,462 *2E86D62C7560647312E42D7C84E7A022081D575D sharonkirkby
458,265,463 *2E8BCBB7B77A1952856B75B183ABB895AD4DD296 Hoofdstuk-09-02:-Een-veelvoud-van-culturen
458,265,464 *2E891139A51D854002E5B7041981336F8E2DF05F SHAYNELULE
458,265,465 *2E80127908EA03CCE9E6DEF110BE82322645D35E sheldoncroman
458,265,466 *2E87039B80C9573B2A5022845DF16FFC17843B7E FOCKHA
458,265,467 *2E8548B2AF223663789334E74A9A8D8E4D26A1D5 cuvx_
458,265,468 *2E8CC37CE133DF2CBA844963F4DAA8436387E390 c%v?q
458,265,469 *2E8AB78E24BFC2160C55A061462FEAE556EDD572 CWHATNOT8
458,265,470 *2E8239ED3DDEF996101FA1EBBF0BF665B10CB776 HSEZARAB
458,265,471 *2E8F29BE72A9C6647F0CA4F7CFCC041BCF0D5D2E cyruscambra
458,265,472 *2E85B80F6FAA7168972F26597531642919C49B9C FRANKIE.GOLEBIOWSKI
458,265,473 *2E8DC2A223538C2A6A4EA84D8AD6FB1C40ED7BD3 silascentrella
458,265,474 *2E8840A1BA4F505868387CF4B45408291C5FE178 SILASWOHLWEND
458,265,475 *2E827CEFDCB3554CDCC3422EB449BBC57AB761C2 fred dahm
458,265,476 *2E82D030EE479605DF753218C9D881BF3B5169A9 FREDERICKGHENT
458,265,477 *2E890ECF1F3B48B0EBE54DABC9AFB3CB1C231C17 [email protected]
458,265,478 *2E8DB722A17580C6218E167C69D5105BDE174E6D HUNGJAYCOX
458,265,479 *2E8299DD8A88A62C7A244BAA2E9609994487E5FA D2MWS
458,265,480 *2E844C8335188489CA6C629ADF394120F909ACA5 husssein
458,265,481 *2E890C863579EDC84619E8FBCA361A9D5A6D6942 HYPERBOY95
458,265,482 *2E81B5D185B86033DA12FE506EE8F657F0B52213 H;Z
458,265,483 *2E8628A9C98C2FF47AE0551323C980E980322D77 daardsalv5
458,265,484 *2E872AF8239F72C4DA02563A560C601FB9240187 sneleggif
458,265,485 *2E84BC7C71F6BA70A15237017A2E0FF4FC2D196A IAN.GARSON
458,265,486 *2E8F1385EC86D65E89515A58F840984A0D00900B galm
458,265,487 *2E8D2CCB6EE4AAD06E95FCC8E3164DB896AFFA8A ifearedcareersaysinjuredliverpooldefenderskrtel
458,265,488 *2E8A4A30C126C11EC822CB65CDE64ACD0D9ECED3 Sonata.for.Piano.No..22.in.F.major,.Op..54:.I..Tempo.di.menuetto
458,265,489 *2E8CFE97DB82EC1B5EBEE293B0BC6498C1D1C6F2 sondheimetc.:liveatcarnegiehall
458,265,490 *2E822B222913267A565A84114E09FC4338CF34C1 [email protected]
458,265,491 *2E8CC11D7B48ADA9BB1D254C56575DB6004750E4 IHKATTAB1
458,265,492 *2E8DD231AA54550633EEF62787F2C3ACEC256859 [email protected]
458,265,493 *2E86A2989A3536B0D5721F02C6A83144171C0D79 IJY
458,265,494 *2E8DC41492031C366575256FBA6A857789991096 [email protected]
458,265,495 *2E8023CD22A8A9CAF2014B7856386E84C151BFF1 DANNYLAUBHAN
458,265,496 *2E8CDA5E59EBA507A34DAA0859B46E6603795884 d!a_o
458,265,497 *2E8948B3CC34489C5D41E5B68EC0EA632CFE17C7 gerardodelausana
458,265,498 *2E8651A96815DF2503159E9DE6D567D9D1F50558 [email protected]#
458,265,499 *2E8F0D8F7E3A9DEA659221373803CDC4BA1802FC ilovett10
458,265,500 *2E8196ED323B702A04366FCC9B13DEE262A900DF iluvsamson2000
458,265,501 *2E8E2ABF566F99BD429A1A23BB6A19BDF548B22E gleasure5
458,265,502 *2E85CD5C42BEFEF0524487076F48D766848B0E05 glonth
458,265,503 *2E8FE9DC09BEE6DEE2515527B4FE8FD1C95D3EB9 DDW?1
458,265,504 *2E835DC865272A2E477D17CB6898F4F29E7D8B8A DEAO5
458,265,505 *2E88FB116E7C6FD5B085F8C0FC25894D8918A7EC GORDON.PUSH
458,265,506 *2E812700FEEFCE82B83E650E8DF669B7922A2E93 GRIBOUILLERONS7
458,265,507 *2E8905F0964107FF0A1EA55705D775CDCC760BBD inthegrandstyle
458,265,508 *2E824699320905870CB561ADD8858E54FAF22756 isaiasformento
458,265,509 *2E837C18330A0ADFFCAD9F535B06F8A6D476887B ISAIASKLIER
458,265,510 *2E8D913D45B82B81F95EF3227A086A457BE1C76A gy%w
458,265,511 *2E823967FE3F686C4731F77D29FBCE13F9E6522B DEWAYNE.BOURJOLLY
458,265,512 *2E8D713D34F8E08A95F24258849EEE06E9EC3E29 DEWITT.GRIMSTEAD
458,265,513 *2E84DF4B7A6BC769448392356FA11EE883291BBC d!ex
458,265,514 *2E81DEA57678B9E5A5B4FB00B3AC08F23E1ABF25 DF1VW
458,265,515 *2E84AF1BD52571BFF5CA3AB7B92A1A3065200138 df=#c
458,265,516 *2E81DF343ADC6A2E32E6CD68BE3014D08DCEB306 SUOMORD8
458,265,517 *2E8F660EB2A0CBD0A8781D49C286B4D786B717FA suridiwangsa
458,265,518 *2E83816599FF4DD38627425EF377F463834385D4 jamalballi
458,265,519 *2E8C43703EAE0EAF8D12310AEEFD305C70CF4AE7 jamepullam
458,265,520 *2E8613AD3597AF56471E9F962DBB41B17F77F532 SVOTRDURUW1
458,265,521 *2E82918E1F6B9920962CAC59ADE347115DF9CF2D [email protected]
458,265,522 *2E8FF899A00F51197F51252389280E6DE18714EC [email protected]
458,265,523 *2E8275EB212C69A20D4D46D4E4A5DFDE741D2351 helenjacobs
458,265,524 *2E871B472413138DA1BC1444C1390A2BF34C8D72 henrylemm
458,265,525 *2E88E21F6337463A3684966F6E1D870150A8B8E8 JASONLWHITE
458,265,526 *2E8FEC4357E9D89DFA1F584D3F14C5A63A1EFC8E herberteshelman
458,265,527 *2E86706B8FC1ACF4747A9F8058F6108A53E35B66 [email protected]
458,265,528 *2E8F149597B0F10DD19C3A8FC2CF8FF9C8088739 [email protected]
458,265,529 *2E86349072740B9934B0EF413957602930B1BFAE DKS/"
458,265,530 *2E8DA69D4EE8915962B652D5EB02BE184CFDF131 JEDMUJALLI
458,265,531 *2E851B961834E53072EA9AE82559368560F5659D JEFF DALLMANN
458,265,532 *2E824A87A37B91DE829A29C9758F0E80C5050482 tangleme3
458,265,533 *2E89116A47BA0E9FBF0C2CB46F083826FF0D58CD TANUSRIBANERJEE
458,265,534 *2E8F98B8BC209E74BAAC5BDDC0C1EE576C6C24FF DOMOSERIO
458,265,535 *2E854B4EDD448123145FE9D96BB6E847271CBF86 jerrybeaubrun
458,265,536 *2E8A4E380B40D6FAB12E69D653247BF76D76654B JERRYCAMPAINHA
458,265,537 *2E8D5F84C8591774F1D83C26B417C0BA5D9ABA75 housemate
458,265,538 *2E8E115C8A1D04724586A433878AE4AF2D515E52 TED.SPELTS
458,265,539 *2E850F3FD71BC1F400385019F171419A013A84BC jesseverant
458,265,540 *2E895BC9DD5D6338942C578061273AE7AB85AE87 jessicagoforit
458,265,541 *2E851BC61CAA8998FAABDA403E23DCF2BFBA048F doowksum
458,265,542 *2E81AFB1FB60B9CD3C1BD626B50FF10DD2765FA4 JIMHOT
458,265,543 *2E8080668B30610E245451EA5459C23094F759CE DOUG.MIGL
458,265,544 *2E83DF8F26B3FCA5DD34889E0CC880003077B8EB JJERALA
458,265,545 *2E8D9ED2177043913CDD3DE3770C9DA6FE969977 terrencefarese
458,265,546 *2E8DFC3B60D5212E3EB9D2335C97993233094725 TERRINOS
458,265,547 *2E8E91E3A9A156EC710C8F9386F327EA04FF1246 dpnh2
458,265,548 *2E82075A7D7831B665C99AA3ED7C3F9427163F4C hxr6
458,265,549 *2E8A34231EB50283929F968CBA3D66A3794ACE20 DQIe
458,265,550 *2E8DDD44DA60944D6737054C2DFCB8DF61AFE415 JOHN-MANOHARAN
458,265,551 *2E857B783207D1554BD2EC164E58C515C281706C HypnoticScenery
458,265,552 *2E81DA65DA47D079EE4F8AF6E541110948F7EB97 [email protected]
458,265,553 *2E8D7070137F329C3C97D74E257E4675D38DD4AD TGAGCATGGAATATTTTGCCGTTTGTTTGTGTCATCTCTGATTTTTTGAGCAGTGGTTTG
458,265,554 *2E8F2A5C0168BC1409DFF83F8BF020C21AFB5540 thalthan2
458,265,555 *2E890CBADFA4BBDA4023976B79EF32459D5FAABA [email protected]
458,265,556 *2E8BE9B016020156965D7A0D83D8DE39BA8CE493 DTFC8
458,265,557 *2E8F5274A9B55FC57D8E5B5EE3C2486E7F36A6DA DUDLEY.ZEITLER
458,265,558 *2E802B37F12B74566680DA05AC52EDEDC3FB27D6 IE-SUN
458,265,559 *2E8EC53736C95935E14BAC1F417602FB1254BCE8 [email protected]
458,265,560 *2E8D35225A45279334C352799AA6E221154F8715 kapitel0801:einsch
458,265,561 *2E86CC412A3B3B3C135D3EC0D37189CE40D3401D dxfkt
458,265,562 *2E8972A45697416D1637B4DE5D9F6DD54062F99F KATOOMATTOMAKSI
458,265,563 *2E89B03632466434536E5253547CDB6703911772 IMEESHB
458,265,564 *2E84973EADDC681113D7A5E368BAC45C8CDE84EA keenantewksbury
458,265,565 *2E85322BC4AAC4E20ADB4C7CBFC548516E401C66 INF0RM0S0ME
458,265,566 *2E80986183D119FD59501CB5AE32419C1D179DAF ECHELONNAIENT2
458,265,567 *2E848A32B2E4AB76476D412DA59EBBEE44470ED6 KERFIENS6
458,265,568 *2E845C0A5B5ED5793C9ED40F9809397D1EF30B5C KERRYPERMANN
458,265,569 *2E8F4514D110A9A5B6DBB2C90EC7DF51FC9BA38E EDUQ
458,265,570 *2E831E3A09E9E8BE81B209E215461C2CCB4E511A KIDDER32_64:BETHANN1
458,265,571 *2E802ADEE71DF67556B68CD124E58E374B43F66C iprokalas
458,265,572 *2E887E6EF743D4A67A9224A1376A3540CD34524A KIETHMAROSE
458,265,573 *2E8A4002B541E676087CCCF51F71270F87B479EA egofuturism
458,265,574 *2E825FC051449FF50DEEABB5FB75A82F06B4A2DC IRVINELI0
458,265,575 *2E85D91BFC75B0D0B99BC85B9FE64947CCF72B90 IRWIN.CAMPION
458,265,576 *2E8EDFFA6F09EFBE006508891E23196A834E13AD kiverchuk
458,265,577 *2E811E26DD58FE6E43988722C59D6FD5F39E1C0D TNEIGALP2
458,265,578 *2E8A002F920E3E8DD695F2837985A3BF3C04DEE2 KLARWEIN.RIVER
458,265,579 *2E8A15467C513D916E1FADD3DA91C97CE3C37593 ivanschweder
458,265,580 *2E8624A0B64DEDD6865AC31595A78B769EC5A12E tommynickol
458,265,581 *2E8DB5680778EE04A4F0EA0DF8E3B3B3C1285505 TOM.PETROPULOS
458,265,582 *2E81D076FA8C64AE7508E0363E2780A5374482FD KOREYBRANSTETTER
458,265,583 *2E8BE0D50904CD8020A1F62A74EBCF221626AAB7 KORNACKI8
458,265,584 *2E873A50D3D9890A5419B59A47FE763B3F8E88F9 torontosophie
458,265,585 *2E800568525D975C23001B457E380B9D0F464955 jaimebaxtor
458,265,586 *2E888723216BCC169098A502C227F58283D88A59 JALEE-WORK
458,265,587 *2E844A848E40A32101B3C56298E7BC5F49BF454C ENYOKSAG
458,265,588 *2E8FE51C3C7B0701CE422F459016086C1BAAB5B5 TRANSCENDENTALETUDESNO10ALLEGROAGITATOMOLTO
458,265,589 *2E8AC7069E939F41C2CE6A0C73AD0281967F53B1 epistasia1
458,265,590 *2E87CCB56980E2C79B56CC099E164EEFD75AF928 JARREDWILMOT
458,265,591 *2E82B9EAB6ED639B9986B4A47EAD7517532E6DED TREKGEREI8
458,265,592 *2E836FC47D33395841E0CFE3F5663D8AD866D5BB eq;n_
458,265,593 *2E8A97C9CC8AC9968B028E2779B88B4BAF981B93 er#e9
458,265,594 *2E81B969BE802CCFDF73CA06F9D7CD2EBFF6A1D3 [email protected]$$
458,265,595 *2E81B89B4F8D0FC9A284F19B3E3EFCD7A2B3FF63 LACY.KORFHAGE
458,265,596 *2E8718EFBA6E1C9C2AD6DDDFC73389D2D01AC073 erica.saavedra
458,265,597 *2E8921EB5E9C52D142FE95BD9695F5E03398C9D8 [email protected]
458,265,598 *2E8389B157FDA6F97EC83F6282E0BE9E9070A204 JAYLO0
458,265,599 *2E8FB6531C6D72D13DF62893AE47034CD43A9A17 lancelot9
458,265,600 *2E81AFD66162B398765014CED7246EB6238CB43F ERROL.BOVIO
458,265,601 *2E8669872AA9870B34A932A68ADE569918FD9E19 langrelshot
458,265,602 *2E81F6EE5A7842CD9E780DDD27DCB6847E91CAF2 troy.bettinson
458,265,603 *2E8C808B1E5005E4F94FCBFDFF932402AD7D9C6E JEREMY.DASTE
458,265,604 *2E80E091739D2996C7E6DABA239E4656C995097E LAURALOWAHKEE
458,265,605 *2E8C8E46FA5C60811215A34EE2747C23AC72FE46 essefbsw
458,265,606 *2E86E4A900B6B4C61DD7ED81703A25CDF07FE536 jerroldramseur
458,265,607 *2E8FC55712A3FC4F98AF39458EB026712B4E62F6 TUBEDRILLINGGED
458,265,608 *2E8C66479AECE4B0433E2C96EB4BD339D64A56C3 tumbleweed7
458,265,609 *2E883D91715961624AD6C163E65403447EF1C761 J(F
458,265,610 *2E829D72D04C54F8BC2B9EF723E27B82F737D97E [email protected]
458,265,611 *2E8A972A68C56F40200D389B7D6081F11CF9E35A JIMMIE.REMLIN
458,265,612 *2E8E3E0E78EFD927EB6D40F6C05BD30CFEA46B2E EXECSYMB1
458,265,613 *2E8436D09F96770C3737E06A2134466291433F5B EXIGUOUS?
458,265,614 *2E85F7483D37FBC661C7CFA69726C5CC64D854E6 exrombswing
458,265,615 *2E89419D5C94FBA33229D53868F4F239B5183809 J`MD
458,265,616 *2E8FC17402DDA37DBFEDAD3D7F4ED37441701456 LEOPOLDO.GAMINO
458,265,617 *2E882F09944D7553F2C3BB58B5C1FA59C799AD52 EZEQUIEL.FAUCHER
458,265,618 *2E84D57D682AE06BD3FB89335D168CD5ABA43CA4 F&;.
458,265,619 *2E820C24DBCA2563B8CA9FAB155DE271932602E6 f1u0r1da710n5
458,265,620 *2E85FBD0AC40752A7012D5ECBE8D64A44B6D1EA4 JONAH.GOLEMBA
458,265,621 *2E84B5945FEB42BBB480A109E1687D4012F93819 FAL
458,265,622 *2E8D43D89E2B3FD9ABF214FFD167571391EC21F0 familliar0
458,265,623 *2E8FB42018D3EF7546FC13AB7C2E0DB0AA9B97BB [email protected]
458,265,624 *2E88F5BBF223AF761896CAE02750102B618F9576 [email protected]
458,265,625 *2E80B45448E16EF862FCAB3B6133EA33D36DC645 JOSELYN628
458,265,626 *2E891A7E18DDDA76B7D7191BAC11E12000313101 FASHAINALOV123
458,265,627 *2E83BFCB9F510A34F609953F636B084DFC184D50 jouko laivuori
458,265,628 *2E82BBB314124DFB552826C12E316F5C698AD627 FEDERICORAWLES
458,265,629 *2E89DEC79442E9E9A9B5A67242862F5795EECEC6 LIMINESS
458,265,630 *2E881CDB3D0A17A82E1E4F5C8523C713BF16116C jumpstylestep1(disc2)
458,265,631 *2E84A795107931FBDD48FA01CF4F564B6C996F5E JUSTBELIEVE
458,265,632 *2E87489B14E9CFFDA7B05AB1C887004D237D84E6 USUALLY.BUT
458,265,633 *2E80A7F62AF551DB975D245ED71D26CF53783787 [email protected]
458,265,634 *2E886CA58A627F527E1926725F136B61DD2CB141 utegarigliano
458,265,635 *2E8BB9ADA36C7F31EDDC8D7A3C7E8172C6E1233B logchips6
458,265,636 *2E8C7E65C9256164B156D4A0D537B108DC10C57D Lonely4You(feat.Tone)
458,265,637 *2E88837D13483D40FBF918B1F474F1A745165AA1 [email protected]
458,265,638 *2E865ED1EB787593D3FF1E1364345440E3FC3CE3 KBMONTY-THE-MONTSTER
458,265,639 *2E8C3EAEE24D09A4B56FB921763171E2E8BAE90C VALIDLY.
458,265,640 *2E8A4AE91A1B24FE991048C3AA2C67B09F05328C VALLISH2
458,265,641 *2E81F553B076AFF7FA6CEA2268CEF86EE069F618 [email protected]
458,265,642 *2E855CD9D05BC846375DB33C15F5928A2915DE39 vanwhiting
458,265,643 *2E88CDE4E2E560C88F5DC7BA4E29C4142D357CE3 FRANCHESKAFERRER
458,265,644 *2E8760AA7DF088A140B2521530A5E5BF34155D6B [email protected]
458,265,645 *2E88C5B181F3519C83A0C08E28619EB62BB27E60 kennyknowlton
458,265,646 *2E82BB4B00E8B60959119FCF2841750CB9222745 KEVIN.PABON
458,265,647 *2E8B78D1B032CB3E8BFBBE5A27898E859D1923FE kingsides
458,265,648 *2E8B82D95B47A1F6215D4BD9F3CC09AE95E1D5C2 KLUPPELDEN
458,265,649 *2E8A25B466D109EE349CE3B9ED09FBE542E8C95E KRISTIEPORTER
458,265,650 *2E80EEABF23C90D72B99F09A6189C65EB5C72488 luperatner
458,265,651 *2E86CC6AFEFC3B23E93DA98F658F5E32FE7C8E25 fungiferouses
458,265,652 *2E8E86E1B409CB7E729EE16A36BBB399A6DF8709 g-1q
458,265,653 *2E8570DA10CEB2DE3981B3A97B29AAFF5841A053 LYNDON.BEDKER
458,265,654 *2E8F094FFC40CC5DA580E60FBDEAC11538C6DE7A VERONIQUE TOURLET
458,265,655 *2E8AE7EC33DF464EDF51219AFFEC60F0499A6AF7 [email protected]
458,265,656 *2E827BFEA7EEE63548DFC3E7999010EFE234FF88 M4IR4T4
458,265,657 *2E8D3957903E7E144F64AB9C6C4FA45B0D0B1A75 kumkwats8
458,265,658 *2E80306054C6FDEBEFF43DC1CFB8E29F24B69CE0 MADISONSEVEN
458,265,659 *2E868C59893136EF73B51574DEA3BA4B316337EA VICTORIALULU2
458,265,660 *2E84A5DD7FCB0833E3C132357346792E451AE9A7 GAYAN.YAPA
458,265,661 *2E8D36E8977018D230FAA874F3167CFEF652EF22 KZJO
458,265,662 *2E8BC69976650386A4FFF77ABD5D3CC0990B676E MALIA CHRISTENSEN
458,265,663 *2E82EAD6AC4BC5654F53F3AE794160152C5EC9E5 MALIKWASINGER
458,265,664 *2E8633CB32FAB27362C4A1C3A748FDC97EED2EF9 VILMA-SPRINGER
458,265,665 *2E89731501F0594CAB386BF51F513D0F88941263 VILSEKOMNA0
458,265,666 *2E8C354050A0FFB93F64D271F84584A7DC7C4E42 VINCEKUDLACIK
458,265,667 *2E861E475A1ECA34B83A030A82D51472C5852ECE MANDIEELLIOTT
458,265,668 *2E88FDB8A3C1CE4647836D49072505ABF34FBE86 LAKVERVE6
458,265,669 *2E820C34204AD8D55E35BCDF22E105A29114D7D9 GENE.RAINIER
458,265,670 *2E8EA4D18778BD4375EE14798D65D7927D5A6048 GENESIR9
458,265,671 *2E8D82D4198845B5768C20C3D1F404DB5D978A8E MARELDN7
458,265,672 *2E831BB613E957C7D2EA29E21801F769B24CB6F3 VITALIYTOMSKIY
458,265,673 *2E86C2F7258AB3F08505E42F85668E701B855648 get up, get down, get funky, get loose (live)
458,265,674 *2E8DF30BE8748EE9CC9C2F7264A0AC6D0B9A523C MARLEY-ROSE
458,265,675 *2E8E8E7FC55C28548BB766E1005D67E00B72E1FB martinaabdo
458,265,676 *2E80EC7E1C30736231386B12EBCB45BEB4EF6271 MATTDEW
458,265,677 *2E852BEBAFDB53FF7CB532BFBC0ABB1963F84A49 WALDAKADEMIE
458,265,678 *2E835D264F73E387CE8C17BAD5C689E76B2986EE MAXIHRKE
458,265,679 *2E8DC4110AE67D54BDE082B9B293B8A22AE82973 WALLY.DE.BRUYN
458,265,680 *2E89ED34254F45DD674FDF95FBBFBED8864091B9 GONVICK4
458,265,681 *2E845B3E6E2C2D841316A3DFE608C0A973FB707A [email protected]
458,265,682 *2E844DC2496238A5E94FD0E6005A503C1D0687E4 GRAPHENSATZ
458,265,683 *2E88A1BF7B50414518A4446D21B32A52552ADE26 GREG BROWNING
458,265,684 *2E8E2C3F6418973866D939CA049A171334CDDA70 gregmontejano
458,265,685 *2E89D9FDE76D87DD7735989D38223C09B03B6470 GREGORYPAP
458,265,686 *2E89B236C6BD70DD7DF63CEBC925E053B799FFA3 waynedelnegro
458,265,687 *2E8F08642849CF111321650D82B26223A59F95DE Grido.disperato
458,265,688 *2E826BB2622E1F39951B3D22F5FE1A2F9EB0DC19 *w)baa
458,265,689 *2E8FB9D021387D5A4557C5717A4E867301D51DF7 LIADEWIYANTI
458,265,690 *2E86FF5EE988C2ABC4FB274BF17130306D8F9D72 guidomiki6
458,265,691 *2E8C0D661C983A07D88FDFE00E165947A2C7B660 Guildship
458,265,692 *2E8E7B3E2B93EA61A2464A7D3C58327939ED1B99 [email protected]
458,265,693 *2E85F1D1E03AA0672853F751E927BE57DE87DAE7 [email protected]
458,265,694 *2E8612EDF988284F55C2062741EC6B7C7A0AD8DE merljawtschewitsch
458,265,695 *2E8E8367D5B56CA97C82DFF2E17EF9919E2F1595 LIBERIAMANGUSTEN
458,265,696 *2E8E0CD9B1CC6A12D54F71F4C9D9D042072F308F LIKEASEESAW
458,265,697 *2E8BA7897B05FC1181AB59210D1FC75568B01942 WEREWHATSHAPPENING
458,265,698 *2E858B032874B982B4FFF002675B73F975C7A8AC [email protected]
458,265,699 *2E842FA0F97BE6DA3B2DAFBFEEB43EE7F82EADF8 lincolnstiteler
458,265,700 *2E8802A5B7C127C3451072F23E5D5C238F55AF0E H3rp37ologs7
458,265,701 *2E82A62D6AA72D718F9D2CAC07EC2CB4BB2B6A50 LINEAL'L/I/N/I//@/L
458,265,702 *2E8C01D43161216ACE1F54D72CDA719B2F8925AC HADEERHASSAN
458,265,703 *2E86BEC639679C43777AA4AE4C5A791809C15504 HAMMURABICODE
458,265,704 *2E8EDB0D245BC617B8A327D929F7A7ECC1D784A3 mifllin9
458,265,705 *2E8D36FAF501F346C191838AC9D776F8BC3BA1C4 HARLEY-WHEATLEY
458,265,706 *2E8DE98E5709EC3A0CB43B06C17F76F58790ED21 wilthaachn
458,265,707 *2E8DF917A702E5B57A1BF93F4A2A9B77EC62BBC4 wina95
458,265,708 *2E807ACA343AA0A1D243DFF5B1E1E4955E220294 [email protected]
458,265,709 *2E89E47AA95667E2C103BB7C2A20AD7708E6E089 LONGBENJAMINQ[email protected]
458,265,710 *2E8EC8EEAB8BF4BED886552EB5A14EE2551CC7F5 winterwinter
458,265,711 *2E8844CEDE790DCCC96CF0471EBA5840D714B507 LOVE,.TRUTH.&.HONESTY.(BALEARACIDIC.MIX)
458,265,712 *2E8BECECCCA3ECE0D8D222FA185964B83C3DE10D LTOWNSEEND
458,265,713 *2E8BE5A61468F6326516DF2C36188DC7E7C2B833 LUCIEN.CUPP
458,265,714 *2E89F7DA47C672C65B81633FD597CF7292692A2A WWW.GISTFAMILYCATERING.COM
458,265,715 *2E829BDEAA564BD3431F52B37EB0B945A3DB9EC5 WWW.GRENOBLE-AIRPORT
458,265,716 *2E8C4E77EA284A33737C6D60FBF2F912409376BF wwwnotredameprepcom
458,265,717 *2E868ECF995222403509840AA092580962E67F80 herbcrumby
458,265,718 *2E841F06397EE9062243282D09B0552B8F244219 LUTHERNAHM
458,265,719 *2E892C3854F877CD413894F940BAA753C145BF5B X^4AAA
458,265,720 *2E89929CC190F0BF8F468507E5C8318CEFAD0BB1 )x(-~-`(---B
458,265,721 *2E8C552F44A196280AC8FFCE1F9CF26A00BE26D0 MOSES.MEHLHAFF
458,265,722 *2E8FC34D00B526B8247EB904C6D23C403B65C23E MOSESSOWINSKI
458,265,723 *2E8F37BCBD8C181994A2EBA4B12E2CAF67CB276D xhulia.giulia
458,265,724 *2E86BEA855FA43B2F4EF55F5045005AF03107378 xhx%
458,265,725 *2E8F720530C166B38ABE3A218CDA6D2BA619031D xpcgmo
458,265,726 *2E82C1D2AF0D92A53E436353D2A8B7B397CF8DB1 MOVIN'-ON-DOWN-THE-LINE
458,265,727 *2E8AF8470B3BC665A95046C3A151F54A310BA4B4 mpea
458,265,728 *2E8311F82F45F189CEC951F5F9FDE699510E2D7B [email protected]
458,265,729 *2E8EA33B2AECEB62D1073C23D64B463A6BFF078E majority-culture
458,265,730 *2E82D6DD2B3FAC4CDC6E987ACDF5A30D67F9486C [email protected]
458,265,731 *2E8C67F789EED2DE4936DC68E7481EDB9014D295 [email protected]
458,265,732 *2E8B8654E1D0CFFC362919B9C69A90678353EF4D Man-Behind-the-Sky
458,265,733 *2E814B90508ACB1A608BB6D6111CA82DBA701C04 how-to-make-a-pearl-(saori-yano)
458,265,734 *2E8C7FE30081D6A2A59696C22C88148560AA4539 MURRAY.MURASKI
458,265,735 *2E85D6384016459CEB2465769C9178B2BCA01CD6 MURRAYPENDERS
458,265,736 *2E82C4CB41FFC45984822159C22DA323A7E49156 mutawahed
458,265,737 *2E8CB66F2BF4B4F61CF712C8EA474E4BC1BF9C2D my.love.:30
458,265,738 *2E81613D6B74F50C4A9EA4B1DD17E98899A2E27C n4rco7!z3
458,265,739 *2E801EEA3C6E2277E449AAD16EB938B8D81147DB [email protected]
458,265,740 *2E8D053831FE2DA39EFD113DA37EE45EF7C0B69F [email protected]
458,265,741 *2E8522EC7593FC0B9D21445E2F1B8485E149C433 YERGMID2
458,265,742 *2E8334784DF8DD6C281454B59AB4AC2F6459F935 hvrfsjhpcyrgjghiq52qda
458,265,743 *2E88D1CB12DA0F794E7C950650C51B5DA7D19EF9 [email protected]
458,265,744 *2E89A89F8275644B9352D250A1002D6C58D671C6 YIRIS
458,265,745 *2E81D1441F4B5854C433F5830A8AE9FA387B4A63 HYAPPATS5
458,265,746 *2E8D362A60C4D07E7AB25ED7629F8C75030A0DD2 maryの「自転車」はシングル曲だったのでそちらを優先
458,265,747 *2E87B1BF5F59DB5897B6D495DC8CCC6A2A344EA4 masonmatone
458,265,748 *2E8C635DBA0D85440CF63ED788C62E609CAB27FE NBRTZNGGING
458,265,749 *2E8AD6BDCE0E6F25A184BCB3EFB480FA37A54F6B MATTSAVAKIS
458,265,750 *2E8B5373CEF6E3E272677FC38982103BE9276DD0 mazzeltje1
458,265,751 *2E81E12C909CEE1869333547D2958947A6D8098D NEPOLNING
458,265,752 *2E899BD81546355AB9F210F1359A35CAC04E44DF megkezdodik 4
458,265,753 *2E8AB9026809CF33B59ABF414EC87729BF894492 MELVIN894
458,265,754 *2E83F5B3C660D1F49AF52406B7622945C48D5D01 merlewire
458,265,755 *2E888C71DCF752F548FCDD483738E502D11E38F0 IKSLOROW
458,265,756 *2E8C3E86C9C1BDBC540765C8EC14024FD0C9FD90 MESUROM
458,265,757 *2E89B87BC604E1D6B547C7CA1EFB341C1FD24243 ZADELTS2
458,265,758 *2E8223579B08408DCDDCA5771CBB8E1A2B459795 ZAILA.MOHD
458,265,759 *2E892F1ADA2DCCC5E40713F791C1473CCB88D944 ILUVBONJOUR76
458,265,760 *2E82B1D3B2B7408F9ABD2C5144B81F4F72605F73 NIPPONAMIA
458,265,761 *2E88A9EDAC3FFE99BE941F30CD39EF070BCF060F ZEIRELPUCED
458,265,762 *2E897326B1A4B184BCA8F186DBF36A6CC20A30CB immunochemical0
458,265,763 *2E8503E9B1EC395BE0F73D3B6A3A711D1253FB13 MIEHITTI9
458,265,764 *2E800375EDDE2D41E42F9B52A3B302919C1F34BC mi sans famille : on m'appelle sans famille
458,265,765 *2E8053B8A8929CF303820B4444BAFC66162C65B6 [email protected]
458,265,766 *2E892DF05D13A10D0CB8B8F9F21B7E3DC72CC4E6 [email protected]
458,265,767 *2E809FDE55FA591761458567D4D0E20073D539A7 [email protected]
458,265,768 *2E8DD5FBB002E549EF9CF6554A81BBDC906E5A47 [email protected]
458,265,769 *2E8552BF93FBBA5C894F1061506C984820232B2D NSATHENDRA
458,265,770 *2E8174D861812D9940292F5E924CC6C061FAB008 NSB’ERS
458,265,771 *2E85618901D2960C32F0E7AA419F75B1FC39F1F8 [email protected]
458,265,772 *2E8E4391BBEC9E96F3D446B215A489265764E16F nsprain
458,265,773 *2E8D8254180FEBD164D451487C62D6F446DBDA3F mohammedlenoir
458,265,774 *2E80A7676CCDEEDD92FFA0E07A9714022EBBED78 MOISESTUXHORN
458,265,775 *2E8113553E9ADAE2D45D33D0357808F0963988AF molson1964
458,265,776 *2E84C754FB6093B18591508888D493F6C7781750 zoroozoroodent
458,265,777 *2E8CAC18F337540F2ECA812D17AB52085DAFB214 monkey island rock remix 2
458,265,778 *2E8E1451A8C14A9C5AC466F97251187D46E668F8 ogggenhausen
458,265,779 *2E86EC780A572DF538F1CF1EDC77ACC8225307A1 MUHD-SYAFIQ-ISHAK
458,265,780 *2E8E14FBCC96303B05E3F4A994BC0F88AAFF30B2 J1GABOO
458,265,781 *2E8A0A69FCDD141B275AC3E51853BA3C8B975D1A OLLI459012
458,265,782 *2E84CEE62DF4DA69264C943C6E05BE3BDA7B3170 JAIMECLEVINGER
458,265,783 *2E8B34AF3CAA9ED4B28A3ABAAB651A8EE9B454ED JAIMEE.FLYNN
458,265,784 *2E88D7CEBA67BFCAA4C497D69C76993A68E66DB5 БРАХМАНУ
458,265,785 *2E80803E54860238BB50544003F5040A4824AA37 ГЛАВАНЕШТИ
458,265,786 *2E852DBC86571B5B1DBD059D70CDA2A9C8EA7480 MYRON.LISZEWSKI
458,265,787 *2E8BD6F4667E9BEC8B7460CDAB6929AF32EE8CB3 JARODSELEG
458,265,788 *2E816CDC3DF7D8DCFCE4C03496B2F099BA6F18A7 JARREDASPLUND
458,265,789 *2E8756C7CFA53A1267BBC30BBB6E09FA9711B5E0 ДРУЖБА—
458,265,790 *2E8534673F7886A9F294B5F504E5CFD8A9291E40 ><.O~O~.QQ
458,265,791 *2E8D94508C48D45A007B1A299EBCE489D2601E63 ORELIEHITUSE
458,265,792 *2E88D8EB25183FAAB392A14B1EE996F13A901EF4 OREN.BARCA
458,265,793 *2E833ED5941B10F349507549A6C5D2DE14747E71 JEAPORDIZING4
458,265,794 *2E8ED0864BC1BA42EA9819C410F9B0443E47CE7F [email protected]$
458,265,795 *2E8C35D0BECBCDC3387662C97F88A2ADC1EE0224 ЛОЗИ —
458,265,796 *2E8E2114220E38FA1A96FC15712F7B141BB987D8 jessestibb
458,265,797 *2E84DDBB8617D1F1F1CF72C9A27FBC07109E4A79 ORVILLEPELOSI
458,265,798 *2E895107F1EB08C5973640CAB3D2D095D61DC6A1 намучих
458,265,799 *2E86649F239F766F8D8D12BCBDC86724EE148DD3 o-salado-bonaerense
458,265,800 *2E8EA28763EF01A06B51441150B624C2B774F8AB NACHSORGEMODELLS
458,265,801 *2E8B714B303720A5D3C23B12DB52AB8155974436 jewelsiembida
458,265,802 *2E8EE9C8FEF87C70DDF9937CC040951BB7D147B3 osvaldocomar
458,265,803 *2E85EF8ECDD222F34843787C6BE653AE03D93AA0 [email protected]
458,265,804 *2E8E6E9F8C55361189FCAF7387696F4C20640F6B OU812DAWN
458,265,805 *2E8FB488046DBED76C3AE1BB0A78430BB86FABA3 OWETUN
458,265,806 *2E80AB457D9BAC30D257CC1A69E8019B491361E8 JOAN-SAVOY
458,265,807 *2E8F076AC150C49D4DA8A5771E5DE50782A194C0 ПЕРЕДВИХІДНИЙ
458,265,808 *2E803EA2B9CE5F97CE0836361EBF7739001AA0FD NDSPRMC
458,265,809 *2E812AD864E948868D5E5FAEC878895F52D2B2C4 near-hysteria
458,265,810 *2E83FC6BCD0113FA9A9A7428629A22A8FA6F8D84 сайкикку
458,265,811 *2E8CF8F19BB8FE3D00619F5F5384B8B3871727CD P3TR0GR4PH3R5
458,265,812 *2E80246927F0D7FCCC7EB51F6B37CF3C2C34C0D0 johnathongiaccio
458,265,813 *2E807B4D9756F4BA8ED9087F3D733CB7194A7E40 PABLO.CROMEANS
458,265,814 *2E8A181D04365758292B3B30C977703D1DD8ABAE JOHNEGGART
458,265,815 *2E8C1662C1658AD7EACCA950439C9DA6AAEEE7BC paige-marie-gates
458,265,816 *2E813F0F2D156A115C27F078636CD88A2666BE3B johnnykreinhagen
458,265,817 *2E8510028305A0C701D3A2F45AF95F3CD8547ED4 nerwowi3
458,265,818 *2E832ABC00BB91136E4F2920351098AC2A17A7D1 NETHCORW1
458,265,819 *2E8B965576D8135FB4AD10623A11CD28B91C2778 PANDOR'A
458,265,820 *2E8154F3519E16FB8F752910245282B9759C3E25 ЭБРАМС
458,265,821 *2E87804E0D856B228FD86E67A9BED61E1895F43B nickyazer
458,265,822 *2E872FD05A00A0643F3F28BAF39DCA80F73299C3 pastel.genov
458,265,823 *2E81C89470202A846252DE084FEA715274C5C62D PATHSPEC3
458,265,824 *2E83924734D6647FA28C0643B668675C3C586081 JPUCKETT4
458,265,825 *2E8FCD70084B4000C193E39496DF02CC0F0A8665 ninja gaiden ~ gsm tecmo 1
458,265,826 *2E8DA30FC44B4919DE06FDC3CE0213CC751F576C JUNGWOOD2
458,265,827 *2E83C57A1AACB5B348F77F5779F70BC6189C7062 JUNIORWRZESIEN
458,265,828 *2E8C2EA907DE4047877FEBD4A9A040B4E5AF2FBA pert0neum5
458,265,829 *2E8404911B1BD7C0D63F5D4794B0C497C1E112AC noyko
458,265,830 *2E84AA61720D5CC3BCF8D3EB6A974C56D073033A [email protected]
458,265,831 *2E80617EC97CD8735D8355BB92D52E3BAF868E11 KAREN PRENTICE
458,265,832 *2E862870E3EC4048ED7E13E3C2D78D777D49BB41 O8L!9AT3D
458,265,833 *2E8D3B6EF963896F2751CC28A3F7FBAA8EA76FA3 OCSERCED5
458,265,834 *2E8C202D46DE0DD46B45A57BF6EDC521C79BFC10 play it hard (djs @ work remix)
458,265,835 *2E8CB008603C166FF02683A11AA31EF52939AEEC POLYFOLK
458,265,836 *2E842412598DE9CEF9B50A1077BBBBF8F35A19C7 [email protected]
458,265,837 *2E8204CD2BC9C2268D7FED233DB4C4EC1FAE3E86 kathy.newhall
458,265,838 *2E836E0310FA02EFE25D10AE67B8AD8FED0753E5 KCOEDIHC
458,265,839 *2E822E73B24F2FD92746C1005859E5587DF5E11A PRACAINENT
458,265,840 *2E8231B77B88C66FDC4A1E95F643D72D07CF76CD PRANIITO8
458,265,841 *2E8944E4138F712D712D9A409732D778D704B60C kenbaptiste
458,265,842 *2E84444CC742DA1E7DDC161C25445AF2C3E335E9 PREISLAGGING
458,265,843 *2E8C94A13BC947CEB914DB9F707CA536A6C7A4EC prelude:-anything-goes
458,265,844 *2E88FF4C4988D4AE8E8BFB48CBED54B7265AE987 orenchilcoat
458,265,845 *2E82AACC8085593A3BCFB515F7072B2F5C835CB8 KISMET
458,265,846 *2E8E46844D7CC94C88A56DD32F4AB532A45B71E7 KMEJ
458,265,847 *2E868F5AA634815F0ADDA3399B6DD72F18529B03 PT518
458,265,848 *2E83945ABA5D6953B87E6C7D94491E76CE1E4461 pamelax8
458,265,849 *2E8BF02D68726272AB523A09EB58CC8FF8167834 PERTHSHORE 1 0
458,265,850 *2E824A081E264ECE86E551A1F6F55E83FC6181C4 00kain00
458,265,851 *2E8C40111B833433643BF1E68CE16F1BB80DCE5B PHASMATRED
458,265,852 *2E8478902136C840AB4D88A450654F9A4E42FCB4 phonée
458,265,853 *2E8DB264C7DA26102828F2A949EE2405F87F7A6B qp*splat
458,265,854 *2E8A21ACC7A70F0E1A8FF7B10A7DAC4409803624 LAILAFITRIYAH
458,265,855 *2E81BFFFD3EAC333ABDECCA8473C05D7E825C165 PÎRLAC
458,265,856 *2E8507382E9AC8B1D5A0381ECBC2A69C12A64955 quellenstrang
458,265,857 *2E8A53B6971B3F0F94A2A9D86BCEDDA6FA1DCDE9 plumblossom
458,265,858 *2E8F5F71F5BE6BF95B29C8EE1C249407D1860F5E 0IAMGOLDEN0
458,265,859 *2E8B2394B93318F5EFE5883C338C93333A8C0068 p) `~ `~ }O{
458,265,860 *2E8F9BAC9C543F96BF0EF7CC8D6D226735F17935 postarthroscopic
458,265,861 *2E8A68B3CAAFEE4E31563F1A2528DF78C8359041 :p`.(######p
458,265,862 *2E80A1B5D0084360489A2F26944CFAEC8D319CA8 RAMON.PARISI
458,265,863 *2E864A536D7AD6228C184FC08422F9A459169AF3 12.hauchduennem
458,265,864 *2E80FFB3CF106F731E3E49C2848BAD00C3F7723B raphaelshadd
458,265,865 *2E8BAE50E619FB0FD0795F996330C7756BBA1971 PPPVICKY4
458,265,866 *2E898DC63E9574E96DB66D9E282A1DACC9A234A3 LENLISZEWSKI
458,265,867 *2E8287C10C1C67E5BCA105E1ECE7D2514A30F8E3 leonardswire
458,265,868 *2E8AD747B76784307A6F73A795AA0AE43E3A847C 1416028 FUNCHALIN KAUPUNGISSA ON HELPPO LIIKKUA BUSSILLA
458,265,869 *2E815D00BE6A3E5E3F45FD21C303F21105E1E501 leroyhilario
458,265,870 *2E86F4168F9483B7BCABC1F80EF6E34D2B4ED68F leroyrhee
458,265,871 *2E8C976DD90278E29BFD40CFCD277C981847D48D LESLIE.LAGUE
458,265,872 *2E8080B7BC313866768DD1CD2FFB297CB65D1416 leslievb4
458,265,873 *2E8ACEFED2B7F46B2DD892FDA9CAE10575A2641C PROBEKREISES
458,265,874 *2E855F9154F72579C7CD43FB3B432B0AF3FA0050 [email protected]
458,265,875 *2E8C3140D0BCD41E036A484370F096BF93A5F7ED LightUptheSky
458,265,876 *2E854BBD0CDB51372AE3264A82F3F791217E9004 178233 PATERNOSTER-FAHREN-WILL-KEINER-MEHR-
458,265,877 *2E8AA26D75565C2F946FBE1FB5556454A550D0D8 limerons3
458,265,878 *2E849E99EFCB55E602A64AAAE41DA95F07F76BC3 LIMUHIEDD
458,265,879 *2E811B971ABB52DBF8F43DF207D45AFF6E88F06D 19051449
458,265,880 *2E8F576BC0BF9AEC4A7100B438C05050EDDC7475 1.allesistrelativ
458,265,881 *2E8671FF3D4FFFE6BD71A22D821D5C603CBD2C9D LIRARMOHAMED
458,265,882 *2E8006897DE834576958F80394F2ABBF9439B3EB [email protected]
458,265,883 *2E8687F57D45D9B82163189E6038243AC2FA5293 1-auer'In
458,265,884 *2E84C976C27EBE0CB4E570EDF96782AA4A9EE8B1 rendierhouderij
458,265,885 *2E8B2ED91398807DF823E67B1F3853AAB23D61AB RESTRUKTURALIZACES
458,265,886 *2E8D3042FBABB5FBCA7FC6A20DC2EE9946B3F584 q#####p~o-~o(>-<)
458,265,887 *2E88948E7D9E5D7593E9A8D7013877D698ED7FC1 1.eviator
458,265,888 *2E815D9852617D40910726F133D62A344EA48572 1.farbsujets
458,265,889 *2E841C9A2CF27A1D332293C09F524F49689A72FE 1festivaljahren
458,265,890 *2E8B551D951BDC2A6F1574B5564A23557137DAB6 QUASI-SAN
458,265,891 *2E8FE081E00BE0EE305A592CB8D1CA105BDE63F0 QUEZONS8
458,265,892 *2E8FC34FF7A9E641BCCFE0B7D70492EBA268D5EF 1 GRUTTADAURIA'S
458,265,893 *2E812C0CA76EDD60C1783C8BE6B779069165DA3A lty0
458,265,894 *2E8351AF776BE9A39C2DE75AE042FFD62FE56401 luciochrispin
458,265,895 *2E8D96FB7498C4260B5D111D3DFD2DB9AACA0954 qwertyuiopqwer
458,265,896 *2E8809BAEB4759FB9FBE88794A0C1109926AB42F RICHIE.LOMINO
458,265,897 *2E83281566C428C4E938621F2F571FFB85346E86 richietaintor
458,265,898 *2E8C192F1DE46C4E7D13CD846FD8133BE8953F22 1-KINDERREICHSTEN
458,265,899 *2E84B256D740E0EB63F02A41CDD7055B22CA4045 1.KIRKKORAKENNUSEN
458,265,900 *2E8B089A899A905B393369FFF549AE6151F0175C 1 KORTTIPELIILLASSA
458,265,901 *2E8304552BC1D258F3371D8266949FE226288AD1 [email protected]
458,265,902 *2E8107605A792D81F7B589556F62D1DB91AD6E36 [email protected]
458,265,903 *2E853D328B40F245969BFE784F2CCE0EA8947586 randymolima
458,265,904 *2E89E6E928DB3FB8E455A45960A554235EEC69C1 RASE
458,265,905 *2E8A9635AF8C233EF77100A474054E5EB3E464F9 RAULOMAHONY
458,265,906 *2E8DF458D0E37D775D377DAE1B035F6E0E6C8F27 [email protected]!N91Y
458,265,907 *2E8656C0FA79D9FCF3FF0FED36B8A248445D8F13 MACROCELLI
458,265,908 *2E8D264173F81AEE33CE87B04F11B327902BE688 RECITATIV:.UND.VON.STUND.AN.NAHM.SIE.DIE.J
458,265,909 *2E86D8998A0F931C34F8B888597589D6B2E5AC62 ROBBIEHEART4
458,265,910 *2E8B5D88AEBB801AD01C83F755623D0A4B192EFC 1QUASI-EUROPEAN
458,265,911 *2E88E72046C6150F1DCBFC6A3D53B9BAE516B083 robert.malvarosa
458,265,912 *2E8A5B05A71EED7A7CE4DAF90BE085223975A54E ROBERTO.GIERINGER
458,265,913 *2E81EFF708A955F2EEA6B93EE7B9DCF95BE90E3D MAJOR.BELLAH
458,265,914 *2E8BA891A10D98E20CD8B76645B6A37F6DE20CC2 majorzeran
458,265,915 *2E813C3AED844A7FEEAA8D0A49C06CF70F808D75 reductase20alphahyd
458,265,916 *2E88B65BFCE4400459D46C0759306255D6F36AD4 MALCOM.HILYAR
458,265,917 *2E8398C9BB3D47CDB303A0B2D514E2C59C448EAA Rocko-&-Birdsey
458,265,918 *2E899BCDDDD51B8B7D7696613676026235631A68 maluchna
458,265,919 *2E83F4B0B608D33EA4525831D3A21470B00C4C23 1.valigursky
458,265,920 *2E860AD97AACD1D3E32EAC81F73B142148B20372 ROLFPARILLO
458,265,921 *2E816B5D4B6FC3291CA45016B15A86FB360A43B5 ROMANCOLLAR
458,265,922 *2E816C53DC9B46736C4FFFDF3156C37A6D588F22 röntgenlátás
458,265,923 *2E86E64B4A65DFC8923D72BE95DAD541F7108798 20060525: boston, ma, usa
458,265,924 *2E8FC9E67B897616A9418B6628909F0CF8EAFA6E REXRIVELLI
458,265,925 *2E86352FBB654207669944D8B8A631EFB5D04DD8 ]RPB/J9
458,265,926 *2E8EBF0655A6650AB5295409A3A486F662271FD2 RIBBONWE1
458,265,927 *2E80711FB0F51D5FAEDC04DEB96C7126B65B820E MARTYCRISCUOLO
458,265,928 *2E89DFB25BDB339952329B51452D715A221EFBF4 rubenmackler
458,265,929 *2E877C6DD5375BAC11D0C08A54FED385B87DCA5D MARXMARXENGELSFORU
458,265,930 *2E8779F60F198D2A14B463D32DD42E9B9BD9B609 RISMA14
458,265,931 *2E8D935820A98F65CC86E8B7AAFE2C71C4E9A0BE RUTH SPIEGEL
458,265,932 *2E8958E6FD2B28F9434331C911ED623DC7435059 MAXIMO.KOBRIN
458,265,933 *2E8A8DC609A6DA0BB9044AC87D9F756692393273 maxwaldhoff
458,265,934 *2E8132112A0584CB733948D071C8769EB7BC13F2 ROBERTLIZARD
458,265,935 *2E8F7FBB46A279DAC4AF4392AD2B1A7452922892 ROBICHEAU12
458,265,936 *2E8960D39C9BE1908517B2CEBAE9E1E5D2878585 roderick170
458,265,937 *2E8D00AB7B27C7BBF8B7FE86E89BC4C0FE0F36D5 [email protected]
458,265,938 *2E8E4C378CAA42897B953B1883DAE917D3320986 Sai10r10
458,265,939 *2E8D4634D09E3439355A63F22E559B57C8A5FB68 RODRIGUEZCARRION
458,265,940 *2E8E3442FFD40723C4BCEAF531D8A8D5DB88AFC1 SALLYANNE
458,265,941 *2E8A21BA624F172E5B0697742A49BE1F9CF85059 rolandopolee
458,265,942 *2E82C16552C6EED25A06AD01C0B619FB7C792FCF SAMUEL.BLALOCK
458,265,943 *2E8128A351C2F096CB206786C10E8B31B073312F MERILOPETILLA
458,265,944 *2E80ED5251873AC847BDADFBA384E500B1E8687F MERILYNS6
458,265,945 *2E8326CED6998598F479AA7E1F541FF0661C330D sangbrobeck
458,265,946 *2E837A1FE7D5C6B79FBC4C6808A7382AF1AE5145 ROVIGILD
458,265,947 *2E8286F7CF7E96B9886681704F78A3735FB61B54 savingly
458,265,948 *2E864178FBE436761B1E23A83A44789AF6F3CBC1 SCRCXTSING
458,265,949 *2E80D3A681B31CB720DAF0FE836A7C7DC32466A2 SEANCES
458,265,950 *2E8F58E2819F0C9DA9708F3A86D4AD3F25A634A8 2RUOKA-AJAN
458,265,951 *2E8BFD0001D9AD9204889DBDFCF092EF6C20BD24 RSPSCNT7
458,265,952 *2E83AEB0596C118B8613622852782F8322C6585B michalefissell
458,265,953 *2E8E9EE089378762A53F3D606325BC601ACEB422 rubiney8
458,265,954 *2E83EF05A42A037099DE20338F3634C0CF38080C 30.08.1493
458,265,955 *2E80B1CD5B487970D1B6F35BDC760B9C7381EBC8 3344YD
458,265,956 *2E8068C5ABB31D0210680508A4F27F04F33C63E8 SEMI-TROTSKYIST
458,265,957 *2E87C1B67E125E995218045EC1500BF88F31C774 [email protected]
458,265,958 *2E8E58C9018E828F371EF6A6A88FE0ADC264A67B MILESFECHTER
458,265,959 *2E8CD2C327C875CD4757FFFD038A28664A83434B [email protected]
458,265,960 *2E834F7A3EB9D498234F3F92E8BB01BDEBABFBBF MILLION-FOR-NEW-SCIENCE-FACILITY
458,265,961 *2E895F3B84CB14D514A22E2E9219E49993110901 [email protected]
458,265,962 *2E8D267AC2BFDBB6E10E6C1F607776AE10156D41 S313C7NG
458,265,963 *2E84B8AB071DEE529F0E5F929B355DD134C7E36E MINISTERGILBERT
458,265,964 *2E8B39416EF3EB42C78160442B239F875F137240 [email protected]
458,265,965 *2E8A6D13413B41D330F5153FC90CDDC7284C6955 SACK AS I TO-DAY? WILT THOU TELL A MONSTROUS LIE,
458,265,966 *2E81340B3DDA4EE5F58ADDC3484418ED5D67366E SHAQWAUN
458,265,967 *2E89BD44287A61C0D96FA785F18135D0312328B3 SALEEBSW
458,265,968 *2E807DD915177E396CEE0DF576EB00829B22C345 SALLYANNE
458,265,969 *2E84199DC58E603E6FFFD6962CD2D8B8C5005FED MOCAMI
458,265,970 *2E856107940C191733B00814A0BF6D11F58390BB 3GEUNSEONG
458,265,971 *2E8E2742A6C4A26A0E709A4E9822E796862ADA93 3HICCHIHA
458,265,972 *2E8363E7A7FA9BA8263836D46E00A85EA72EB9FE SAMMIE.CACACE
458,265,973 *2E8792D8E3C0F0B2C4C49FFE79E0F3741E4742B5 Shooting Star (feat Any Kiys)
458,265,974 *2E88BC6B40CCCCB78EC7F2117FB8BE79C668C08C sanghattita
458,265,975 *2E82498B77C0077C870B2A2FC043A8D781C535F7 savingly
458,265,976 *2E86B609210740F668C7585C696505D1706321EE 43-SECEDING
458,265,977 *2E8EF6DC0500BD0830A03A6F50F93CEB91CFB129 SIMONBALENSIEFEN
458,265,978 *2E8997EB611FD08D8CD823ACE996EFCAB45FBB47 simondemoney
458,265,979 *2E8D84D053BF883A1719F67210ACE1B42EF06513 SCHTICK
458,265,980 *2E8E7D4FE3D3DA73C2C6C048E88D900BE55211FE SIPHONOPHORE 'S/AI/F/@/N/@/,F/OU/R
458,265,981 *2E80AFCC221C90C9D4B9351E9CA8E4C09F7E2718 SIRENIANSES
458,265,982 *2E8E745E8767CC0205616ECE191270D73466117B MWAYEN
458,265,983 *2E89A9F7F6AD5C44D3AD73E18F7470898FD05AEB MYFIRETOWERFLAME
458,265,984 *2E8A41653C7BC7E5A3AD5F112464DFC4E56B34B0 myoruniru
458,265,985 *2E853215603E67B5673781B3C1425FF64248614C 4.HENKIL
458,265,986 *2E8CB4C8631C60F806CA97D8F719C7AD60BC8C0C 4ILOVEYOUSUNFLOWE
458,265,987 *2E820E346CC4C488C10BC80030BF11C0FFA61CEB myroncrumrine
458,265,988 *2E82FD0533C64180372E84EF4AE1357C41184B4A MYSABINA82
458,265,989 *2E8DDD8D5AD4FFDD06E60D8F4B0FD88016FB599D 4LINCOLNANGELS
458,265,990 *2E85ADF35ABBACC40D9221CF86A7D979742CB987 4 MIELENKIN
458,265,991 *2E8FC3230194F43D38CBD9B7F40F85F018940923 SEOHYANGGAK
458,265,992 *2E820E3DF1CDD0F61FF28DF6243CE056B337CA60 N118237
458,265,993 *2E8E45E63C93673340BFDB9484233F1954849D96 SEQUENCED-SUNSHINE
458,265,994 *2E838DD09D3232A1926CA5CD8635CAFD72079DAA SMRGSBORDSING
458,265,995 *2E847D2C5FDAC8AE9871D481F06D1855EF002AE3 4-P
458,265,996 *2E854782F90847826883835033F098FAC7599DC6 SNORIPSE4
458,265,997 *2E8006E1AFFC2A815202A3E7B47B96E773E26C59 shafiqul-islam-jabed
458,265,998 *2E8EB0C757487DC71F1549AC1C9C11C2DABBEEB4 SODA-MACHINE
458,265,999 *2E8646EE739B7D28D11FA90F7AEF10A21710CA27 SHAMOISE2
458,266,000 *2E8C29E68EA6155ACB97271466F1C2A568AFA05B SOLODANSERENSED
458,266,001 *2E809378792F4777FA9FC5232CD2D1186D7785DF SOLPESIRI
458,266,002 *2E81F3892E3554E5790F9C4B434285C21CE3BF5B SoMuchBetteratBad(FullIronymix)(featCat
458,266,003 *2E82C7F3C9EE1F9710A7CE960AA1F258FE35DA91 shawnraed
458,266,004 *2E8E7B13E22103F55E1000414E0C6AE61DA1C4B9 NEAL.CABAM
458,266,005 *2E8F0988F3D0FFE08C5F6F2DEFC600DE9D0208EA sheraykos
458,266,006 *2E82FD2384519DE539CAED9F94D768F6A2507DE3 nerguaz
458,266,007 *2E86E61DBD3FD4B9B12C0E460EFF4D883FE28EE5 SHOOTERTHEBOSS1
458,266,008 *2E85F7A160BD747DA894154CCC348BDDF5298BC3 5CELICAARCTIC
458,266,009 *2E8B47CB4A786348B8D56E689B03D2704600AB57 5CGJCORRADO
458,266,010 *2E882F6144625F62A4E019E6E5E87313C6F42877 NEWLDNA3
458,266,011 *2E8A4930B8490A41231C7A30558C09BB0CFFF387 5DECLINARETIS
458,266,012 *2E834BF5B2419BF2758FB9A51A44020A870A435B 5DERONDE
458,266,013 *2E8F4DB6AFA4FEA5C68BD69DF252773EBC3D18F8 5-DISORGANISATION
458,266,014 *2E8194520535897E79216EAFC837C873A54E11EA 5FORMATLINIETEGNETS
458,266,015 *2E80F67D30FFBFA700188645D47E255FD42D2150 splat.`.(=b
458,266,016 *2E8CDE7ADD9FB02B9F5142ED32FEAEE2C05936F4 silbada0
458,266,017 *2E8D4327ED08BE203F5274D19E4391FEE1D26B82 NICKYBENZ
458,266,018 *2E8F39CF8B47F64D6F5CBA93F034E4878F96514E SIN_INIFAP
458,266,019 *2E8F9DB7EF5E06E2E8C99590F67DB78129581EC5 niggajaybrezzy
458,266,020 *2E8B50E8B4A16ED1979248076708EEEF57192514 NIKKIBORDERS
458,266,021 *2E8B28B7561742EC4CA5624E60997807D20E446A NIRASUBEDI
458,266,022 *2E8F8B312B97B821FC81F3CEE6283193849DD59C 5PO5+AVA
458,266,023 *2E8C2D138FF5174BC67188EB23DDE0930663C0CB 5POUDIOUGOU
458,266,024 *2E8F903560EF18C13E79A4B4D3953416DEA41D92 NMCMHNRG
458,266,025 *2E8E7A2D8A416F4A68AFB881E51DD32F5B538D6D 5SELLAISIA
458,266,026 *2E835C9C83C63DC4361FA6FE994CB0AB227FE1A3 NOBLEFLITTON
458,266,027 *2E81EFCF199B5D70073B1094C9EEAD1380744579 nomenestomen
458,266,028 *2E8006044C34927008F8B99C76E74EF5CF988C6F sm.furkan
458,266,029 *2E84BF5B42AFE004E7CF95EEEAEF49C1CBC4C10D sta8!l!zat!0n
458,266,030 *2E80DB2AC5CDBC8490F0D2FB5ADAF409FA785125 5VRIJGEESTENS
458,266,031 *2E87C947EB4C9832FB4A42846E76367DAB6007CC stanbaisten
458,266,032 *2E82EBB5D79CE7A21281FE020F7327974491E771 STANTON.BOWERIZE
458,266,033 *2E8BBA604F502472B141692EDFE30D871BA7D8D2 nsfl
458,266,034 *2E86D8996A09CB57B6EA20595AD91FA1AC6F4A39 NUMBERS.GREAUX
458,266,035 *2E8B62FEA786FC141ABEE061F6E36A8A0FF95A76 [email protected]
458,266,036 *2E807871AB3AEB384DEF07AE9EBAE0C7BEBB4054 SOSPESARENS8
458,266,037 *2E8C0FA661FA2122AA80B8928810E9E7EC26F674 OBALISAS
458,266,038 *2E867AB71C90FF935C042C58A471BFEF429E665D 6AFARINEH
458,266,039 *2E8274A8AA72FC78931FBE4AF7A504FEC1682B17 6ALBERTPASCAL
458,266,040 *2E8ACDC276E995D0E00CC12E55A7853B2F55E258 space-corp1
458,266,041 *2E82CBA18370CB74523025E41BEE97CF24B44C4C octaviogeisen
458,266,042 *2E871D90306DF9EBBC5F6B2CA5C34B588F1E5416 OFJUSTINBIEBER
458,266,043 *2E8D4BBF60C95C36E72847F7D63708AB44DE5BD6 stinkled
458,266,044 *2E83E1432E51305DA4D5ECC5BDFE1A4A4E1D465F SPIRED6
458,266,045 *2E853C56A352E2A01E6786EADD947F8893D1A6F0 STRAIGHT.MIKE
458,266,046 *2E84875976BE91EC971F3CF890543BF6DE7793E3 streckenrechner
458,266,047 *2E80B048277923B9365C6B7771227359BAFA1C7E 6HILJALLE
458,266,048 *2E822B33BC16451B9E212D07BC9974B29DE2DB31 sploit ~ ~ [email protected]
458,266,049 *2E8AD3AAB0BE4A32488A921BAF4D9DD3F54E23EC STSIDIPA0
458,266,050 *2E86F5D2B0B56AEB18920348BFAC47BA233398BC SUBHOJITSHAW
458,266,051 *2E8FE8853FBA253D88691CC9CF03BC8CA1DDA6F6 OMAR.LEWINSKI
458,266,052 *2E8EC5A58985011A8575ACD54FB4F9A8E58A566B 6JACKSONBRIDGE
458,266,053 *2E8C1190367B75EE6EE65517BD92931540E333CB 6JANUARY1279
458,266,054 *2E809A81D659E5BFFE25C0F3729A9D0F941E95CB 6-marketingexperte
458,266,055 *2E88ABAB5986155CE1491D8E4C88D2909725AE9F [email protected]
458,266,056 *2E87B528E35BF9F6D24B308B80E67A87DAA901A6 (>_<)O~O~(=====P
458,266,057 *2E8E7C92C687579825BCD363A414CA6398F3259C svanhoppet
458,266,058 *2E8240641A2CD43153AF15CF131BA5B15138B9FD ortsonom
458,266,059 *2E8A6B6628431B0521716F74BC9250B4C86AB01E STAVNSBAAND8
458,266,060 *2E8E263BACE7B6724B151DC6B9D3A6537491182A 6 YL
458,266,061 *2E8A9DB8C3A49F1A842652462BC7A96BF0B78B54 OTHA.STUMB
458,266,062 *2E8981398411CE7742BDB1D0CA373733D3442D06 OTOBUKI
458,266,063 *2E8EA5223ED39FCE57C49A2036E1CE0E9C7C68AB ottomagnanti
458,266,064 *2E8F8C4F423BC257EAE0216590A1BC6F122A4206 OUGHTED
458,266,065 *2E80DDD56120953C7B12C2690DADC42C97C8376D T4D4S43
458,266,066 *2E8F03635ED667435E47ECCDEDB5685345A6264A 795788 NIIN-KAUAN-KUIN-OLEMME-T
458,266,067 *2E823763B77D182703249BE770C72DB2E73D8877 O-VOZ-E-VIOL
458,266,068 *2E855311F659EEDCA96C4E63420955A1FC0AD2ED TADOKIYE
458,266,069 *2E84819EB5451AAE188ACE2A3A988E170F0032BA OWERLOUP9
458,266,070 *2E8E20332B43125EF8A796FB6B459FAA1DF8650F OYO8XIMUP
458,266,071 *2E806075DD36773E8C175987B7C9EDD488F9F385 P0$T-CAMB
458,266,072 *2E896EB264F15C487777E47F2BD7D26C18595504 STOPME(BEFOREIKILLAGAIN)
458,266,073 *2E8ABC88F65598F442AA8390CDEED41F5ECD4877 7DEFIBRILLAATTORIN
458,266,074 *2E84A1759765D4EBE6A6DDE4AA904D2AA07D68A2 P98439
458,266,075 *2E839F81BADA1197765EC37F9B70E8B1A2114659 STRUBBELDE!
458,266,076 *2E84D4B00440395230FFF2BF775AE33AFBB27F7B SULE-AYDIN
458,266,077 *2E8952B60270815F5C40E8022A6F095BCD0AA9D2 7NONEELSEBEINGBY
458,266,078 *2E8F81B2EF1AD941D06C5CE8A277CC44C516B54A sunobstma
458,266,079 *2E8845529B81440EB2F9ED26F930D177D2884B81 superloop
458,266,080 *2E8B965305812BDC8C5CD7CD89A9228ADA11769F TELESIEGE9
458,266,081 *2E85FA74B5D6893BABCD6363A3F31BBD47FA27C7 [email protected]
458,266,082 *2E8CD38CB3A0DD8D8B60DD8901C17336CD56FFD1 7TAWDRIER
458,266,083 *2E8DC5BCE5D4F750040C496B0396E15DDC8A79D1 terrypromise
458,266,084 *2E8D229E37BE5DA9502D1D3960ADA872F0ED923B PEDRO.STREBECK
458,266,085 *2E87BCBB3828E74BDB66F7F88E8E8A28E35931B7 SYDNEYKING8
458,266,086 *2E8905F3EDFBFDA6AC01D13F0AF7DB5E909C2A89 symphonynumber5:andanteconmoto
458,266,087 *2E8D2D07E1B9B8D777C15A8FD76E33E097E3F63A PENTÉTIQUE
458,266,088 *2E8C7F070497BF490EF1CE10649C51E7398D1F05 81UEPO!N+
458,266,089 *2E82B30B235A71D80D9AFFDFBC50C0900F19AC80 syvlakke
458,266,090 *2E8956AFC365D12F2171C0ACAE63824E8497DD26 PERCY.HEDEIROS
458,266,091 *2E852A951D1DB11C770D9E9B625B51E05AB63FA6 THANKYOUFORONEMOREDAY
458,266,092 *2E81FCA519FCB85AEE0CB4E3B40417694B52AE2D THATFRIDAY70
458,266,093 *2E8E521ECBB49DAB00251368CF0029A2769400D3 the32pianosonatas/variations(featpiano:claudioarrau)(disc11)
458,266,094 *2E8B5651D242A2926011EABE1FE4EF198796ECD9 TAGSUBSCRIPTION1
458,266,095 *2E8186B451E6854077EBAD0966DABF7465667033 THEENDOFTHELINE4
458,266,096 *2E84E5CE8D4F8BB49E27B435D849166343519016 8BJRGSOMT
458,266,097 *2E85DFFBE0495132E070E4CDBDD0D2AEDACE554D TALK211.30.141.240
458,266,098 *2E8457D3790C5AEA03426C7F06DA83971F8D1153 [email protected]
458,266,099 *2E8B520A91D2D1DC7531B3705EE978D731C73AF3 PIETNA
458,266,100 *2E84E1033D58267A312591C923CE86CEBF6DB77B 8GENESISMODEM
458,266,101 *2E80BDACE5E8232754FAEE734A65FA871B24D600 taurusmolly
458,266,102 *2E88A521B6D48A922615A5E85E1B1C098E937B5F 8JIMBODIAMOND
458,266,103 *2E88B22FFB5C92F44C5863A70A74006B72D3338F teddybickley
458,266,104 *2E886FDF5C923F944FC89CC28CAC145951EA8F7C 8NEKINAZ
458,266,105 *2E822766DE87A33B031A28AE634B3C8BAA55D809 TENISOWA5
458,266,106 *2E8ABBF67C3656492A96D8C553205FCE3FC84075 8~OMI{
458,266,107 *2E8ACF5F9A7037619B947002F15561C604D235BC TENZANCLASS
458,266,108 *2E85BD9AB1AB6104609085EE4C3C342C54F37DDE POCKETBOOKOYSTER
458,266,109 *2E86E4F77CC0BAE848BE80E45D85BEF08E55CA94 TIMECAESURACALMCALM6
458,266,110 *2E80116D7D792D6B757A6D5E5BBCFB3B5F6CF5E4 PODRANILI
458,266,111 *2E876D1EF58BCB43E7F49D2E2E72E47CA78AE565 POETRYMELODECLAMATIO
458,266,112 *2E8BFB1940FD243147F18B8AAB777EFEF3D37F94 8PROVZENHO
458,266,113 *2E81C2B0962731A029C5724B5C5345504FF9F8E0 TINA.NIDUASA
458,266,114 *2E8036FF9172DA140C2E5D7B0736EDF5FD2DBC7F 8REINKASSERINGS
458,266,115 *2E83C33D3C05CC20EC08CA0578833AC0297FD9D9 titanrex10
458,266,116 *2E850CF6E6ABC7A17B5BFB9BBC1679FD2C087722 TITUSSZOC
458,266,117 *2E8B95E5C4503697158E0DABFFFA5523A43B1B0D TKAAMKUT
458,266,118 *2E894132527FD1A5DE881B9BFCFFE945353808F2 [email protected]
458,266,119 *2E8284832552EE15BFBF75969B0B78DEF46EFF5D TETEGUAL
458,266,120 *2E862941019932FE9D9367FB3B0E4236DA159435 thanh-quach
458,266,121 *2E8991CC94B04E9C81CD9B3DC122D66CB530C337 925568 BEN DE ONU BOYNUNDAN YAKALAMISKEN DONEYIM .
458,266,122 *2E833D64C90645B22A5DACE703E08F0AA0D573D6 [email protected]
458,266,123 *2E824CE959CF11352E8A990036EE28DE30EC677B 954571 BRISK.DEMAND.LED.RJR.TO.EXPAND.THE.OFFERING..
458,266,124 *2E8C539542436C7B5A3F71420958125CAF885628 The.Breathing.Out.Vapors.(single)
458,266,125 *2E83C7EBAA5731254D6D8B2FDEDD6E94C7B533F8 thedeathoftheballturretgunner
458,266,126 *2E887BB1C875067E3C5EC24FEBD8DB090B7467E1 the.great.british.punk.rock.explosion,.volume.2
458,266,127 *2E8A3745352ACF4509163F81E565EE364241F37E theorahib
458,266,128 *2E879B49FBE975B438C05F167A258C57BB33A415 9JOSEVEGA
458,266,129 *2E81607A615B7B713BE29AF7442E4288EDA1AA01 9LRDRSLS
458,266,130 *2E8CFCC7E185D4C09BE609449EBEE529216DDFC2 pulmonalisatresie
458,266,131 *2E8C6A95C2D3F4ADE5E790465D88A8D401780991 TRISTANRIVEN
458,266,132 *2E8930F5EB59A9C0151F91551494F6CB575F7D2A 9sanitizes
458,266,133 *2E841B451B2B618056278CDE07EA60EDE23418E1 TSGITRUH5
458,266,134 *2E8B9325C389AE71DEE59ED982E7536FED8FF4A5 QDEI
458,266,135 *2E8BC78A18CF8EC06C5F3D4CF352816B39FBFCD4 [email protected]
458,266,136 *2E85F05EF4346CB5E06FA4AFE613046A9FACD62F TUNGSTOS5
458,266,137 *2E8EC3392CA378B839F532BFC0A03713D2779DC8 9WRYING
458,266,138 *2E89F036FE6B232BD8421067066D053BFBD53BD3 TURNER—
458,266,139 *2E811A0E6E2FED7F47C8DB661CE2675885324206 a5.5o
458,266,140 *2E867400B04579D1BC7240A4E8278F23E4CA8A45 tylerstefansky
458,266,141 *2E82980E13A0CE68E04F6E4024050CFD36A162A1 typ"
458,266,142 *2E8D8C1CF095255E8D16C7C7F62290D654B04427 A9CI#
458,266,143 *2E8F3E3AE0AC411545A260214512FCFE677F70DA AAA_94
458,266,144 *2E88670952DEB30F07B8D88AD7CE3D9D646E8001 AAA;B)
458,266,145 *2E83956F38CE8D5DFB5429FED5F3C062D4C7457C QUINTETFOUR
458,266,146 *2E84F33249DE90E8A19AC62EBB7296DC9950A55D R0$E.GERA
458,266,147 *2E849D966D6AE587713A3D7D13F79F251C05DD9F TOLUENI8
458,266,148 *2E8171C3B57FDC8BF66AA863A46C60B4B68E2DB1 r8dn
458,266,149 *2E83807E7DED5491AD3314AAFEF2065F2BBAB826 RADIANTARKHMA
458,266,150 *2E854397F8DE9D0D134AFDDB366A09B8DC6B30DF UNFURROWABLE7
458,266,151 *2E872BDE994041691219C45E083400B796B2FC7A RAMSION8
458,266,152 *2E89AE2C0DAF03EC952DA4ABF5B06447FB94FB61 AAEH~>
458,266,153 *2E8A1A0817BA52405FCBFEFB2FFD4DDA31AE8241 aaespv
458,266,154 *2E8E30D814C64572E959BC41E8AABCC5758CAB40 aa+qj
458,266,155 *2E8114DC2D6DED0CEA60EADA081ECD770DB781D3 TROUBLEGARNETS
458,266,156 *2E8BF1714B450A34628903D3B7DC092817AE8EC4 [email protected]
458,266,157 *2E8971C1A68FB4A8BF8F8CEFE66145E5F7FE9FF8 [email protected]
458,266,158 *2E8E38B59D5A6DFF2B94EC1BA8655B9114FEC36D REDINGHEM
458,266,159 *2E8D36EAA65EC00718E456B413521BE8365641B7 REDUCENDED
458,266,160 *2E86C56ADEB0E9D566C199774A8763E5D154BC09 VÄLINPITÄMÄTTÖMÄNÄ
458,266,161 *2E849D150CE7049BB13BE3128A17003C9ACD41C6 tydthdghdtj
458,266,162 *2E83620D61C47D36EDF993AFEA73FD4FF502E374 adaptiv6
458,266,163 *2E83E6C4E0F11E350D4508915775692AA2ECF2C9 U8.O
458,266,164 *2E8AB496CCE1B5F10522039E93BFD17BB76DE63A ADOLFO.PALMISCIANO
458,266,165 *2E85666595010E6FC0D906509DC559010CD4C732 VERONTHEILIGTS8
458,266,166 *2E8ECB5BA59B2C7413F36A7F6CC6A8A63E5BBAF9 RETIUQER7
458,266,167 *2E855384BB5E3029B6F097EF33ED5A2481CBEAF7 RETORTHAPPY6
458,266,168 *2E8A90C8903CF7D15C99699F4FE1599F12953B9A VERVAARDIGER!
458,266,169 *2E86DFB2D6DBFB823F38F3367FFD998355F50A1A ULLAS.SHENOY
458,266,170 *2E8DEA4AA898C6662D5C2C219D53519D1539F4A1 a&e(?
458,266,171 *2E8BF3EF54002832F5D960E4793371F166E5B95A victoria-ibrahim
458,266,172 *2E83367112EF3C25AC3A77B6673852E45B1654C8 aehvr
458,266,173 *2E85CDF41838546E9AEAABE0B36B6AE4F0DAB1E1 AERLINSO
458,266,174 *2E898AAF3FDC6A69B0C8E0C21EC96AE59E1FF488 [email protected]
458,266,175 *2E84716AE13FB1716BA0EDEFC084698BF8DE0E3A under-a-song
458,266,176 *2E883A28CDDB0A91C0571A0267CEE4A7FC9A35AC A=%F
458,266,177 *2E89F4C3D9FCFEBA670FAD101EB98BB0F85BF505 UNPURLOINED4
458,266,178 *2E8744C0E07243B27CB0C4EF805D0EA3644DEC17 RICK.GIGANTE
458,266,179 *2E87CFF913A0F71E10BF5292B31B05E96D8EB1C2 RICKIE.PATTEN
458,266,180 *2E8131BF16DEC2A961335C29167DEE781BA96B9D Ag0$
458,266,181 *2E80D4296939DE2BF571D1FD9C086B8341D99B49 uput20828647889760
458,266,182 *2E86A4F715FC172577EEC82AD3C88D7CF82E0591 [email protected]
458,266,183 *2E8F2C31051C0BCAA8536AA69C1CAC12A1918A9C AHMAD.VANRY
458,266,184 *2E808ED0DCBB6354D1A1CB229715D1A232DB1800 ROBT.GIVENS
458,266,185 *2E8AC1A2D93A339547F090C6B895E6946A6877BB V123
458,266,186 *2E85B478C70A6BE3A0D7258B804A7C56B20A7747 VALENTINSTONGE
458,266,187 *2E887A95B333E2DCFE6BF7FBAD14963E82F0D41E waltermacknight
458,266,188 *2E8B76DD9B5EEAD4B9228201B7DECBFAA888655B AIN'T.IT.THE.LIFE.(LIVE.ACOUSTIC)
458,266,189 *2E8E8BF46599212123ED9DC6A71117AE615B02BB AK9U
458,266,190 *2E82F12387C6E21309CC0E0877EC24AE767180F8 waynelawed
458,266,191 *2E881AAD840F904EB9D9262561C3A51C75A6C6E4 ROSCOELYSIAK
458,266,192 *2E8AFC1342F23D4530259999827DE336377A1E3F VENESSA-HOR
458,266,193 *2E83CEDC722D5822E281C31F4794F0BC4DBAA406 rotary-based
458,266,194 *2E802AFD971B078BFB356EC70C820B007A7DBEF5 vergelde
458,266,195 *2E8442C11925ECF807FD8021FA0FE7C35467FFFD RPSEGJIB
458,266,196 *2E890DFF4AA51B230F107D170A82959C36392A61 ALFREDO.GUILBAULT
458,266,197 *2E86972CB19654FE3F912C9065CA39A527DF7958 weldonpacholski
458,266,198 *2E8231E210292855F681AEC257F4A2745E1440F8 WENDYLJ
458,266,199 *2E8AAC97612993CACA1AFC5B648841E7990BA49B VGQJ
458,266,200 *2E85F25F9E69516D07A6CA04B72E2994F6E02152 victorvondoom
458,266,201 *2E8B6CA03346D522AEF77214E9063B291B7F457B alqzn
458,266,202 *2E81E26ABBD52838F6E22083A737FC4560A50D1A whitneygouras
458,266,203 *2E814A5C9C5357A792CBC7EE2B952244AF42A8ED amag
458,266,204 *2E8FB569655C651B09AF6B7DE5B290CF76EAC346 s1s0n88
458,266,205 *2E8A3477823148215A6AD3396D65661FB107B5A5 VNDCTNG7
458,266,206 *2E8B2874A1DF5D566E86A2E770CD653BE8D7BDCE A##MU
458,266,207 *2E876257092F7BD0268792938E01377E728A8CFE amy/u
458,266,208 *2E88FA97F7A43C72D9A8AB1389C25621E12AAC48 sailing-p
458,266,209 *2E82B4751A5F9FE142E7E066ED53EEDB81A995BC AN.D
458,266,210 *2E8C4AD58CE1E887369358C29270F2959659244D williecrumly
458,266,211 *2E8BAF99380A49B006A7253D3AA6D4D3B971AD38 VRCHTBRDR3
458,266,212 *2E8CA19B004EDF7AD19F1C3320DF1132B047A872 VSANTANACRIADO
458,266,213 *2E84C590841FA201DC3FC90838F2E4FBF190F6C2 winnie-lutchu
458,266,214 *2E89694BB131E626796C41E4D8278971F4F67101 SAMPROKSCH
458,266,215 *2E889F220114DB4D422A1DBF26BD55DD5C289C67 samualconstable
458,266,216 *2E8ACDEB65F50D7AAB291D420BEFDA3A8940F69B WALLACETINGEY
458,266,217 *2E8E78C7783D20C0EB3433582723A8225C93EA09 SANDY.NOZUM
458,266,218 *2E8C6A2BE056BAEBC66CCDEB779A5BF8987FF278 WOLFIEALUNAN
458,266,219 *2E87AEF589A57B1AE8C8F4D664DDB0E190CC3C6D ANNY BAMBANG
458,266,220 *2E89E98C4B26FDB034150C6D4BAF6223EE9EDA2A anotherblanketdenialbylastfm
458,266,221 *2E8EF643D276A5D976338A2D6032ADEAC1F4432B WANJIRADARDY
458,266,222 *2E8ACA9D410CFB74B026F2D9A1081AA4FDCF2C66 ANTHONY-SCIRE
458,266,223 *2E89AA47722A6411AAC95BD2DBD2943EAC0167BD anthonyzebracki
458,266,224 *2E8BFA9E59F5C714A8C377FC441FCE1CD70A6BAA warracres
458,266,225 *2E892E70F337EA67BE7561871B60148BC512C4FB W=]T
458,266,226 *2E818A46AE7173AFEFB435C1C1DA659ADC13A929 ANTLHSEWS
458,266,227 *2E8582A55BC666DF7ECF25E5ACF869D63D89B76A WAYLON.SANDERFORD
458,266,228 *2E836341111BDB1941CE4749F10B79E335DF1D39 WEARHOUSEDIVING
458,266,229 *2E864E6F8EAD7949A61F7672770DDB10F318FA8B SCOTTADVANI
458,266,230 *2E879C19B1B9FA2F5C58B85CF9B0496534C2B015 SEBASTIAN.PITTMAN
458,266,231 *2E835ECAEE2A62736B73DC9BDE314036281CB611 APOMENAN1
458,266,232 *2E878688AF3B4286F5144CD12F2AFBB51AFF6CFD WHITTNEYRYDER
458,266,233 *2E87C5A2450EC5564C9A3387586D81756F3C535B [email protected]
458,266,234 *2E83EC5CF45DDB7A6E0144858D6D1797E5E8858B AP-US-NJ-WEAPONS-ARREST
458,266,235 *2E8293CD4846B88AC1D3734F4CEF4D1DB27723A9 WILDEOV
458,266,236 *2E8BB7198866B50EEF72B8F94550C8590EA142B2 ARIANE–2
458,266,237 *2E8554D1FB526F212CEFDFCCBCF5E4C4BC073A43 YAHMAN!
458,266,238 *2E8E5DE381D6061FCFD83B6CF93A0C12F06B2378 ARMANDO.LICAUSI
458,266,239 *2E8EBEA7C17910CFD7AAF5EB4D6DDBDAEE640067 WIM.VANHOREBEEK
458,266,240 *2E8155AF07F1896B9EF1F82B530E34DB4509F3DA YARAISI SOTO
458,266,241 *2E83B33B2D6F06C9AAE6AB3334DC9C67D5004D80 WIZARDOK
458,266,242 *2E8BCC06D3C239EA9CB2E7CA1F5BC42D283932BB WONGWENCHUAN
458,266,243 *2E87FD860FA263FAE9B3CDEB6EBD776A276C1EF6 [email protected]
458,266,244 *2E842A1D134F586F8726A39D0FEFD2C16892618E YINCHOA8
458,266,245 *2E8584A0E60620121F50540B604CD4BF8C9B647E YINGCHERRYWEIYINGWEI
458,266,246 *2E8734ECCDCD8BB357E5D9DBA8842AE06FAAC873 YKSEDAR4
458,266,247 *2E89DFE4F6C8B6E9B94EAAD2C8F2AD32E674298E SHERWOOD.GREENGO
458,266,248 *2E8B4E9239CCFC8DD67FC6E34518FB5E9AFFDBE0 YLSUOETNUOBREVO5
458,266,249 *2E8F26CBEEB85C62F2CB7725B34D4C0C803172C6 YOANY.CORDONES
458,266,250 *2E8C67D615A98F6A232E493414C9FFEEE3971A56 [email protected]
458,266,251 *2E8078318D2E6B797F5E889385DEC6A067001456 yogini-s
458,266,252 *2E8E07F9BD2697E6D9A2D9712C1FD1FCBB644777 as40i
458,266,253 *2E85A7471261F28B9C8988DAEE061D1040BD88EC yorlenpavon
458,266,254 *2E8C80216E637733644A9FC6E10DC17CE24095F9 ASCETIC9
458,266,255 *2E806446AE8AF699CA97D46EA67754CB47E5F0B8 shimmy-shimmy-ya-(extended-instrumental)
458,266,256 *2E883F67E9EF1483E82B0135B9C4FD4076B490BF SHON.RANSBURG
458,266,257 *2E806B3F2835DD8B94BCBABD0A20C5A929B6230D [email protected]
458,266,258 *2E8E46E7704D4A99A4DBCA01E20E88F00F671D6F wwwppooiiorg
458,266,259 *2E803D6647656F5198120BF2CD45DA45E648C875 XAVITSO0
458,266,260 *2E84FEA84723BE60006B9D90A032FD11F52B6584 yvette-griego
458,266,261 *2E8CFEF2F1E0ED93C4ADD840BFDBAE24F2C47EF1 SISTERSIAM(JAMESRUTLEDGEREMIX)
458,266,262 *2E82952E7ED33FA0A75F758C732C6A6CBE2BF45E atrairei9
458,266,263 *2E878E38B3C03714E7092003F71A9A37D99AC746 ZACHARYCANCILLA
458,266,264 *2E8149DF9BDB9486CEE0E6BAC7710DC142731DE3 ZACHARYHOLCK
458,266,265 *2E80F357FA23087A0EDD4D8442D243774E6196F1 skryter-pt-ii)
458,266,266 *2E846BD01DB34AC03B6714C362FB005FBA2BB56F aubreyjustason
458,266,267 *2E890A6FC6ECBAED0C2DA6ED1ADD2CA01F58C97D audiovisuels
458,266,268 *2E8F259C193680851999565AE3A4266EE1EE43C3 ŽENSKARI
458,266,269 *2E80771C949CE7C1CF16F9FD9B4FE1DE33550628 Y50025
458,266,270 *2E82D2C0BDF0987B377CB4224DF96EEEC786CB1F YASHWANTHYARLAGGADA
458,266,271 *2E8F0DA07F8F15BAFFAD8332EFC13AD3E76FEF3B AUZ)L
458,266,272 *2E8058711B7D1CEE922DF9B1DCAAEE7E9C30043D AVVEININ3
458,266,273 *2E8530E683BFBACE1C4BC3D9162036A99928136E AWARDSを受賞する。卒業後に映画の脚本を書くが、幻滅し、小説を書き始める。
458,266,274 *2E89CFF75091CA0A59EFF2B466D35E77E0C0CC30 ZNHFRJSJ
458,266,275 *2E84065294B8627A9384AE321A816303600BB132 ZOILLAS0
458,266,276 *2E89C2CF20FFA15E6C68F110EEBC6B473E7930CA sophia.chow
458,266,277 *2E835230EAF6DE15E0A86FFD39E66D2497F759B4 AYADNUL7
458,266,278 *2E85C0E5EBBEEAF4F6EC15342464E9138A9CD27A [email protected]
458,266,279 *2E8EEAF300730D11FBAF7568CD82E1AD69368D62 YO' MOMMA'S SO FAT, SHE HAS 48 MIDNIGHT SNACKS
458,266,280 *2E87547EF0B946373218FFAA1A4B1577D7185131 AZMATFAROOQ
458,266,281 *2E8F4B38ED966BCEE69A94B860227BAA5D334BF6 b1jk2
458,266,282 *2E864A659E5B1B0454B07A5B2F3893E987B082A8 SPECIALFUNKTION3
458,266,283 *2E8B29711854491E61A8DC15E19F869FABEFE945 ΔΥΣΧΕΙΜΈΡΟΥ
458,266,284 *2E859DE23EC09F231E3199FDEAEEEE481790FA98 b2w/c
458,266,285 *2E866350304AAC7D7AA74A9E68305C17F0012155 БАЗИРОВАНА
458,266,286 *2E8DD7E7411A92D50A04300BBBFFF31CA46F35FE splat.*.*.*@--p
458,266,287 *2E8E6317F2916A1317752DD61F5C1984EC9400E4 B,9F2
458,266,288 *2E853963BB5B4EF3F73E7F755A28CF5264047B9F ZB#Q
458,266,289 *2E8A675623001FCE86E4CC6921E13A3FB0D04466 КУЛУКДОБО
458,266,290 *2E8801FA5FFF37776B26CBCF02405740CD8104FC [email protected]
458,266,291 *2E8084B126EED95E9D9F0645706ABC758C70D613 BARJONA5
458,266,292 *2E8892C0489B9B8E600BEA0180B4848CDB14D39A STANLEYMCFATTEN
458,266,293 *2E81DE79499E6321EA77521D84EC734D9D466B32 stanleyostergren
458,266,294 *2E811DBCD4533CC1C4687BC7EC71566180B0EE46 BARTONUPONHUMBER.ORG.UKWWW
458,266,295 *2E80BAE02ADCA2DCC507623A4EDE0FC14148D2AA STATIONTRUMPET
458,266,296 *2E8A8CCA4B33D9FB72D905A738187F499B6353DA STATUKSENSAS
458,266,297 *2E8D25831910BD926CF0BB62C63C0D58ECC2282B РІТТЕРІВ
458,266,298 *2E8C39ED544CC5BD8B1CAB3E23BF3948BB4158FB bautista10
458,266,299 *2E830BB5A56770D5C861722DA726514ADF3B8187 STEHOUWER7
458,266,300 *2E892849CFEE19318342FC4D9D3EC6DDE43838FE ZYKEY
458,266,301 *2E870137BA35BDE128DAD36EF48896D7E26C9F85 STEPHEN.MCGENNITY
458,266,302 *2E898754F696C729CD71E8B8ADDFEF79CF5B14C0 УПРАВИТЕЛЕВ
458,266,303 *2E835CCF7620B778117AE3ECB64ACD368DF789E1 sterlinghin
458,266,304 *2E85A6ECB48D408C3FB4A7CA3A9EF8A8C30AD42C B(CPB
458,266,305 *2E82BFDC639CA056E8705E35AA420061BFB2FD9D «ГОНЧАР»
458,266,306 *2E824CAA5069F5477A9C3DE51336F1B23482DF20 STORESSTERENSING
458,266,307 *2E81C58B5DE43852C64175CB59CF3FC4D871EF3A bei%4
458,266,308 *2E80CD1856C5CFA48C72F9E383C45BF34D2D81B8 BERGMUN
458,266,309 *2E8395A674364A0410674F6D2C792ECD61E56DB0 [email protected]
458,266,310 *2E8DDA61A15B7BBB9FD1A424CDF58AD4CE24BEF5 семьи —
458,266,311 *2E8A665DEF814644BA0AE8D18B9CFC68E6D29A66 beslaglggelsens
458,266,312 *2E88EDE42D29B43EB8BB45E74A201E2A2182BC7C BIGGISH
458,266,313 *2E8A6BFB15BE5528E5A8C426EE534377E33D29EE TALKDROLNICK
458,266,314 *2E8117C0F4D329482A9169E34A8F9A9D89952DBD TALKSHOWHOST(LIVEINOXFORD)
458,266,315 *2E8F1AD692AEE702E568B93ADF638C4A4527C547 B~JM
458,266,316 *2E8A66E4416D196258927D2408F425465C1C6810 [email protected]
458,266,317 *2E8B1BC377F7D8C0B08BDB85C61FCDAE53F265E6 bkcpmoted
458,266,318 *2E8EE052DFCD6E3720E56CCE1647FFE98E462407 TAWARANO5
458,266,319 *2E817E66269153C92257644AD5259C1FE0EA6322 bkrdh
458,266,320 *2E87E4225B8E4A0B86F0FDC186AEAE4B24EDD9F8 tedfuchs
458,266,321 *2E88372FC7CC94CBA6787018C9BB2BAD21E9EE21 bm44k
458,266,322 *2E8969A96B82C5130E2495AF40121AFEBF78F580 bm&so
458,266,323 *2E89D2281798F564513744FC6A43ED3CE2556BFB [email protected]
458,266,324 *2E86355CCC69118AB14A443A8DB10C68D7CFEFD5 BNXBR
458,266,325 *2E84B112234FCB87E0FE9990FD5CF6E6ABAE49E8 THECHUCK1993
458,266,326 *2E81B48BDCA9292DB7F2106332608DAFB6369EB4 bornjdavid2008
458,266,327 *2E8EFB3A2F4F71F141748887F4FB1F5EF28DC780 01-17-1943
458,266,328 *2E858B3EA02ADE246BA3C64446880B27AAD9C23F THE-WILD-BULL---PART-A
458,266,329 *2E8D8587F7C5F7DD6C6A794AC37546233CBCB99E [email protected]
458,266,330 *2E871B7A96AEC9D17EADF27BB5AE13447AC4ADC7 b;pnm
458,266,331 *2E8E9EE664D89EBAA95545503756F308A7FF5E5C BRASILMARVIN
458,266,332 *2E8455B3E450AAD057B81059413A46417783C935 TIBMAGSEIGGA
458,266,333 *2E8F682CA3F3D9C952ECFB8A3D92EF8EE533999B TICKERPLAYGROUND.COM
458,266,334 *2E88BB5F7AEDFF0E62668729DCF205008320968C [email protected]
458,266,335 *2E803E30869728FF01CDEC1997532D06F2896120 03201972
458,266,336 *2E88E690AF6EB57345EEAE37627246509276A793 10V3-M4D
458,266,337 *2E8A78862C8E63756C16205BC7019BC9614FB761 11091199
458,266,338 *2E8745FAA0B4E885A9476DF97C12B8C84A1CDF5A 0IAMBROOKE9
458,266,339 *2E8EC4F25BAEEF0E27FB19CBDE26C15B9D5AF512 (-_0)*q--3
458,266,340 *2E8A8CD5192193CF8E25E9E9B799CBAEAB786556 1388073 ON MAHDOLLISTA MY
458,266,341 *2E84F31062F8A42A91572B4DE308234DB1341094 TOMLAVISTA
458,266,342 *2E84CC64A6C9237375AB761DC2AAE4E743B272F3 13.GIYABINDA
458,266,343 *2E872F7BEFABC7A2AC4303E9C08023C04ADE52F3 1466410 tero lepola mr . murphy riepottelee terri
458,266,344 *2E86CFB31D2E09BC1618FC08FC86B4DC220CEE0E 10-STAATSGUT
458,266,345 *2E8F1E33A4927BFB628D5BFCCC6425E67F7EEDC1 TORTELTJE?
458,266,346 *2E8A246F3C4854D3265FFFC1E8F5CA82D5B97150 TRACEY.CUTLER
458,266,347 *2E88D34F63430D77341628769A3D378C3AF27602 122809 DERRECHTSWEGISTAUSGESCHLOSSEN
458,266,348 *2E822B6A5E9954AE4739146A7FF0F3E46F2516AD TRACY.TAWNEY
458,266,349 *2E8778DDE3B4BEE38E2A271E385E015FDCC1F843 16.nuoruuteen
458,266,350 *2E8F64B557715185CC53E9DF1CE1CD4B2F5A1591 TRANSFLOCK4
458,266,351 *2E8EB293349EE96DD9E3618B27E33B32FD6828FC TRASPARIVO1
458,266,352 *2E8A0AEEFB2445BD6AAE9A2FE5111ECD67BAA1DA b,u(h
458,266,353 *2E88979A89AFE03BC3E8C946B8B565075BEFF6E0 1823497 spaeterkommtderfoersterundnimmtdiedatenauf
458,266,354 *2E89725E5DC12FB5A6E40F9547BC2E3BB5B8F58F TRENTONMELZER
458,266,355 *2E87983031A3DCA4A12EE5C8386CB30C69A83C0C BULCKED8
458,266,356 *2E88BD0C13D96E6566052621DAD8D5825777E7AD TRISTANWEREINSEPERABLE
458,266,357 *2E869269B1B866D9D6B4C45B98F6DC71E253DB76 TROU8LOUSLY
458,266,358 *2E87ABF987786A51829C05E8A6B03BA1D5EE5D9D buys;
458,266,359 *2E86595A3C6B0955F443E62B3D5A612DB4C377C0 TRUSSINGS
458,266,360 *2E818C2CC4269820F962806B23A9C719687C9A70 1ANTIEXPORTING
458,266,361 *2E84E79894CA67B6BD07ADF3787CB94251140771 BVYCGN
458,266,362 *2E826145DCBDA2C51963C0377480EEDF3A65B4CF 1 BERTA-KOEGER-PLATZ
458,266,363 *2E8749E029C93F6580BB6350122A1B2472F09F33 1BOSNIEN-HERZEGOWNIA
458,266,364 *2E80981F7980E6A5B553A96AC7E57EA6B16AB5A9 1DIMENNA
458,266,365 *2E8CA09B4CA67192F575CA909A8402A2B7DE5C74 1durchquerender
458,266,366 *2E88FB7E101C7461E46826557E8ABDC78F1DEB9B 16jun1662
458,266,367 *2E8CB3ACD189BC6CB172BEC2C673EEF1D30D50D5 1-FAISEL
458,266,368 *2E837655687DF50EE95610D88413D92B1201B8BF BWTNIVLA3
458,266,369 *2E8514FF1EAFB09EC93D1E8A97A418432F1A0ECB 17-12-1233
458,266,370 *2E81FCB45EF78A2C7EEE4CAE6BFFA436160CCC34 1FIA-HALTUNG
458,266,371 *2E8E2F556A46CB640618DAC2863486D283B7C478 1 followingthe
458,266,372 *2E8EF093A7BBBD08206FB9A56A3D5B08C40CAEAE bx(ca
458,266,373 *2E8D8D695180088365E13211E4CCE1D4DB593D86 tussenmu2
458,266,374 *2E82085E08FAB2331F303BBD85F1628061F6FC78 byqgklym
458,266,375 *2E8FC0DBE0ADF48D7F6161251FDDBC7D8F9A60E3 typological
458,266,376 *2E8608F4D14345F0D10A74D8924B450BA4C4DC1B 1.kielelliskulttuuriseen
458,266,377 *2E87FA6B6021CACCC0FFF00C93598DD82F0A47AA 1.KOHILMOITTAUTUMINEN
458,266,378 *2E86588ED262917E19AB6039135220E4749BD801 1 KONDITORIAALAN
458,266,379 *2E84DE387AACE80FD31A842606EE74B90D397D6E 1korthe
458,266,380 *2E808963F0884578F15A772582A3AF6CF76C6451 1-machot
458,266,381 *2E85E387F884E228AF846D62FC161EA95FFCCC65 [email protected]
458,266,382 *2E891B740C811E103127ADBDE1F49EE7A41F4DBA 1ANGIVERS
458,266,383 *2E8B2AAC48950980B3459A93FC1F93898733ADB7 1ANTOFFLE
458,266,384 *2E8B12CDFDFFED9E25819384A16211B1B50362B4 UDOLPHOISH1234
458,266,385 *2E8F5DC8D2E6F63121EEC0696EB2CCED5BEE8B87 UENDERE5
458,266,386 *2E8F4C3A4DAB4F8563E80C9FD3D246930E2B4342 1-BURCUYMUS
458,266,387 *2E843AF9FDC47BD17BFA2CD3310ADFDB5F4CDCE3 c)2ni
458,266,388 *2E803A2BC3A142A67ADFE8C6793A4CF0C8024055 c2s=m
458,266,389 *2E8FB37D60C80B2E6EFC6F5B448DA160446C929E 1 PRUDEIN
458,266,390 *2E8C1421CACAFDDC0B31D7B648AB77F6C2B4F261 1Q2W3E
458,266,391 *2E831D74CB84BF2AD5881011CA0CE5BF10263080 c46o_
458,266,392 *2E8917DE5D5E5DF49D5C76756794C88C30C52733 1.gigabellgruppe
458,266,393 *2E873177EB9A65DBCB6E5C2514800137062200C4 1-TUERMERINNEN
458,266,394 *2E8689FB31E37BDBC3258733388B81554B3D3925 1 HUBSCHRAUBERTV
458,266,395 *2E89C99C63B6B329CAFD0F3D2D75AA6AAB3F3A9F 1ilovekayla5
458,266,396 *2E867DC951A279E8C6157890862D8699283EE0F1 [email protected]
458,266,397 *2E84535BC15E17D68130E0C6A17049107CD27027 1.WOLLLTEN
458,266,398 *2E87E8643962FD63F3A3D027A1A1278A7526C046 UORDBYTES5
458,266,399 *2E885438B47D9A22A96D2937571839EF348FE80A UOVĖDĖJOS
458,266,400 *2E81CF3A3A87F490B3F4FA99D5D8D11708A6EF81 1 ZWISCHENDEPOTS
458,266,401 *2E8910A835EBB13B025262410B30A8AC78045F40 1 kopfgespenst
458,266,402 *2E8FDDCF39A08B966C9B873D4A79DE3295C28D19 1kreidetethys
458,266,403 *2E8926E602E12AEB4D7DDFDD77E01FAE037F650C CARL-CARINO
458,266,404 *2E860810BF5B02397CF26C5E11EA411F5194ED19 CAROLINA DE BORBON-PARMA
458,266,405 *2E867B4355FF7CB5A2C9703A80904C1C3FB7A4BE carol.silcox
458,266,406 *2E85FEA7D6F2029DD5EF14DB132CA5534EE3D72F 1.multireesin
458,266,407 *2E821839347B9042A474B74395A05056A2F70379 UU.*.*d-B
458,266,408 *2E8A7E4C982887F58600EC11E551B0EA2E6C6E21 [email protected]
458,266,409 *2E83EAF6741DA2466A7401DB6CA82ED19CAFD568 castigates
458,266,410 *2E86439FB59379A4580E57ADE1AD3470F162ED0D u/vp
458,266,411 *2E8C5C39118CDC3528B139D2CB0E15F0CD2C3322 1.pekkas-seminaarin
458,266,412 *2E8B66A8F7134418795B3B60B5B4B7B1D1B8CD7E CAT/Q
458,266,413 *2E8E517A9BF3860CCE3CF8D595E204DC158AC011 1-SIGHT-SEEING
458,266,414 *2E8BE57C606D6D6F316EFB8FCAEB342752CE5FF1 CCHGI
458,266,415 *2E858969A4834E4EB86DB277E3C9948F105C36FA 1sonderpolizei-einheiten
458,266,416 *2E8F54FBE1C4E27ED1D47902E57559103C92828E 2546365 osastoilla.s
458,266,417 *2E8B06EDF9CBFE48859F4C4193D9F6F1FD738EB3 1-SQJU-MISQ
458,266,418 *2E862D5E33FB334760520A4432949EEAE1C82805 2554469 ennen toimenpiteist
458,266,419 *2E854E8817A7AEEA7C4629E19F2C7265E4BF6842 VALERIELIPTAK
458,266,420 *2E873F1397C75298E3C94CAC1D14D73317E1C75D vancebertolino
458,266,421 *2E89D4CEE1043C17FAB6862A6B39596479437E11 cd=!"
458,266,422 *2E837BB549E3A1A39773C3B4F75524D7F659469C CD0BAA
458,266,423 *2E897A346F1F6D598045C95D3CD942D11759561E 1turvaj
458,266,424 *2E81FF5866ECD113EABED8002DAFE3094DEC75C3 1 usquartalsumsatz
458,266,425 *2E84E8989140083A0805FCBC3D459304BD6D3AA0 CDOFN
458,266,426 *2E867EA639652C25AC8867170BA56097853BA542 276lkjhgfdsa
458,266,427 *2E87F69788F4B984501BD4D01D168E5F1A666977 CEDRICKHENLINE
458,266,428 *2E8F41809BF2A7517953504DDB5A2FE76A023B63 CEDRICKMUNCH
458,266,429 *2E8A6A39004826D85EB1C5B23E1A627D670644E3 CEDRIC.ROSKO
458,266,430 *2E8977D2DDD620BA905D3999208BCAE20BC550FE vdhiya-gurung
458,266,431 *2E825DF525BCBDF77C88C228EC6800A648563650 2972458 silvo-tynnil
458,266,432 *2E846165BE3FD4484EAC07CC530CD86C6A4B389D CEm0
458,266,433 *2E8C7A60367870AFB863DEAC2022A075854050EA CEMJ5
458,266,434 *2E87518166915A0308C2C95CA72A02B01D7AD105 VERGELGACUTAN
458,266,435 *2E8CF5699F0FD7F796F062EAD893967E67CC2DB7 2DEVLINE
458,266,436 *2E853334855C828732D388BFC96EEC62CF3D82DC 2FAKTITIEF
458,266,437 *2E861B86D9563CAA5AAD0208E3CAF260859AA7B9 2FDSH
458,266,438 *2E836E61F40553A205A6DEB7973EEB729634E4BA CF,0F
458,266,439 *2E82A4313E53F683E33B4F0BAE62833C7022D177 2.GOETZSAMMLUNG
458,266,440 *2E8C9FDF26DDB9B1F8825848D45EBF3EBC72AF3A 2166169 erwolleerstnocheinigegespraechefuehren
458,266,441 *2E8546C51272D716811B16FF253D896D1606F8E4 cffrwrk2
458,266,442 *2E8112B7E2094076E3C58BD80361D016E3257CE5 2ILUVHEART0
458,266,443 *2E86A74DE6D8D3FF639287137F9F92AA855A8037 2X{^
458,266,444 *2E8F97DA39682209494C7262008DE7D08C3F5B14 220fr
458,266,445 *2E83CB21A6124D6AFD3ECE47A55BEF6FCD34FB16 34045 BITISIGI/ICELISMETPASACAD.
458,266,446 *2E88342611E8227414F82890F3E87CBEC2EAF30C [email protected]
458,266,447 *2E8C575C4878738290887B7AA62F5E503E073E3B CHAPPUYS
458,266,448 *2E884041C015495AD0E4A5F0432D19F5BE873E91 24 HALBJAEHRIGE
458,266,449 *2E8109C856712B30974BE935A290CC8133177AEE 39291Q2W3E
458,266,450 *2E8D5BCA1AB82792F27A0F35A75B6198CB89CF7D charliederivan
458,266,451 *2E82310C9AFBCD8E087D80173951629F17D4CDC2 vilasini.kirubakaran
458,266,452 *2E84E2517D6DFBD67CA33DAD06399C5FACCE2358 3ALOVTNOP
458,266,453 *2E8913F815C9AAF5A6C6D86F26B15824376117F6 charlotteville3
458,266,454 *2E895AF03898B93416A1AA59AC7E0CEF8AAB4C2D 265509 muttav
458,266,455 *2E8FFEC13D5509836F4D85E6CDBBEE371BD3D20E chaussons.d'amour
458,266,456 *2E8A9EC78075128DDE0DC8AB752D89D29B7C5D46 3DOMANDES
458,266,457 *2E888CDE5B1731B974368A3A1F1F5DAB7EFCC0FA 3EDAEHDAM
458,266,458 *2E8CA8E09A0318864E53259437490746F61C4185 [email protected]
458,266,459 *2E8CF6DC8AA8F5F38037092998AA08EAFF2EB3C2 277493 uudenvuoden aattona 1992 fluoridinsy
458,266,460 *2E875D385E9068ED0A0F3AFBADACE50B25AD3ABA 2824580 toinen.osa.-.tietojenk
458,266,461 *2E854992A1101AE1827B21416D67D92DBFC526D7 VITE.STROZZATE
458,266,462 *2E89C1452E4C1E1454A184E8225C237F0F3E34C1 3MMRXSVV
458,266,463 *2E81B66C16984BB3F638B4DC0528C2C1009B4D45 vivian.joy.nasayao
458,266,464 *2E8B747A7F312759B159F24B3282498D9DA6CC09 VNDIMFRANEIFEANERELOSTERALL
458,266,465 *2E8AA1E1A9165622EDF6DA172C8FE944B569026A chlamydomonadidae9
458,266,466 *2E826C3C884EA815910CD03F95B7AC4BAB030B4C chongstalling
458,266,467 *2E89FB80D27D678E5F6E4819EDAC24BC20AB5A90 [email protected]
458,266,468 *2E8F75AF1DDEC11687145C0080DB006F079FB489 chr0matcally
458,266,469 *2E8F9EDC5C910434EF9432A59C3E55555B4BE3EA 400539 TAITAVA JA TARVITTAESSA KOVA
458,266,470 *2E820C34C485B1B8742BBCBA81816960C3083DF9 CHRISTEWA
458,266,471 *2E81C102DDA80BDB9C6AEBC20282CD1DBC26D8B0 41.kouluik
458,266,472 *2E84FDBE04CE7C64AFA8848A918AC52080C8C269 CHRISTOPER.MCGAW
458,266,473 *2E83304DC95E24762D7D184C042426C9709F46C9 2duygulanan
458,266,474 *2E84D785B5E3F44860FD163F9385F5477DD230D3 CHURCH-BRIEFS
458,266,475 *2E8B0C35799743834AAFFCB1EFDCA51AA2D378C7 2 FLORIDANASUNTONSA
458,266,476 *2E877C6D6CE91796DEA7C4A0AF3156A8671E354A 46hhbq
458,266,477 *2E842EB12757B7FDA3ECEB9385882DE0F4979261 c$.it
458,266,478 *2E885A77F33DE360E12BA3AC2A53922246BDAAB9 4EPIVRJET
458,266,479 *2E83876CC0CE90C8A610E0FD14FDB6C9473210DA 4ETSINEEN
458,266,480 *2E84DA384CEC2529DD6142A81104CD30BC297DA5 4.HENKIL
458,266,481 *2E87FF4F6031DF394DDB0B2D83412DDFBA51C734 2ndjuly1994
458,266,482 *2E810249ED7425A4C1108D6A6156F66041DD87B3 WALLY.DIDOMIZIO
458,266,483 *2E8CC1C29335E0975070E3433F9C6DD7A75FA627 2paljousalennus
458,266,484 *2E895157B0380048EB63398A6B7FF9808E4A1DC0 WALLYSUNDERMAN
458,266,485 *2E88F24941D9805A20082CFB850F3DDED0AEC643 CJCB5
458,266,486 *2E8F2D3F3040F095F710B62F02509FA98B617DB5 CJW1326
458,266,487 *2E8CCEFF135DECBD775E12C59CA6357415B021C3 4-P
458,266,488 *2E8432848B6A4512B1191F84990790F00A690CFE CKLICH V
458,266,489 *2E88A6F5B1EC3606CE0C716778BD1A2F3302BBD3 4REITLEM
458,266,490 *2E86E6D48BA8EA4A9A50B8C8766587C1AAEB3393 4RMSCLLN
458,266,491 *2E886D98A67AE82161F2B5E33F819DD3FCD0607F ckusw
458,266,492 *2E8398A6B66B0FB2AE753EAABE16394D4EFA0D53 4SCHIFFSLADUNGEN
458,266,493 *2E8A63BCE85B9194E07B1C265D39448724598A9A CLAIRYARZABAL
458,266,494 *2E8628519C7FE40374D7FB8A1DDF2D2623F9999A [email protected]~.~.~(00)
458,266,495 *2E8D86EC162462BB0518DD71542C55618EA557AC 4STONB
458,266,496 *2E830A979DF9624293786DD9E3737F8853CB4367 [email protected]
458,266,497 *2E840A50230E6638CE71AB4199201FD1FC84568B WARREN.NANAS
458,266,498 *2E8B8B8DC0ACAEBE951E14E2B41FB775D987BADE CLAUDMATHUR
458,266,499 *2E8BD7FEF593D40FBE58B9803B4D85E2BEEACEC9 CLAY.BOTTORF
458,266,500 *2E8BEC41175F68469B889AC341A01F974FE7B7CF claytonann
458,266,501 *2E8277FE803B432ED81C344C1830AB5D71072291 32912 kadunnimi
458,266,502 *2E8296309098CB4A2DA5DC0DE2D1F17F43BE15CB 32 KAIKUVAT
458,266,503 *2E8D8F5F7B973F9C43DA811B84112728640396F6 cliffordreinking
458,266,504 *2E8CABE155B9CDC8EF32FD3BB2D8EEAE91143221 CLINCHER
458,266,505 *2E8B80F6FEB95FC4740FFFD1C97BBE40BD1B383B 36ea780fa5d85085cafc9a9842944636holodeck
458,266,506 *2E8AA22B80E7818488C9C7DA6DF8E2105A9E6631 WCHIEFS8
458,266,507 *2E8CF0015A9EC12B66C37720ACE8FE6121141946 [email protected]
458,266,508 *2E820FDEF7DC1A68133AB790D1C774DAE65B835A we17ng5
458,266,509 *2E805BE206397959CD41B01702705A3B8D9A13B0 3AMWERICAN
458,266,510 *2E834C16AA5D0747B5C5B0516861CBDE3FC2D27F weekaspern
458,266,511 *2E8DD6602FFA2274FA96CA6E6252729A42B9D049 WEIHNACHTEN90
458,266,512 *2E82B4FE89AC62F4E9C6C0938F3C4C62B4835931 569TANYA
458,266,513 *2E88275A15393C389A3F33BC066B47C4EF210C10 [email protected]
458,266,514 *2E8A48AC1E806211FFF4A585000C6BE7D78E20E8 WELLTONGUED
458,266,515 *2E8B1C458D04377EDD2657F65FB1D212F2F2D580 WENDELLBRINDA
458,266,516 *2E8E53B6925118465E0FB4088BBEEA0BD85BCE42 C,Mm
458,266,517 *2E8A0D96A90F86D998B608A952341A3C14022290 3ECHAFAUDIEZ
458,266,518 *2E8F559FBD0C7E880A1A29D672CC71F1E86CF357 [email protected]
458,266,519 *2E814DB70C88833562B875F5167A61AC9E2CF7D5 CN_&L
458,266,520 *2E807A2CB51CE15FB86FCB35984E49BDAC66FC37 CNVO%
458,266,521 *2E81065AD77B102B19BFA7C42688EC09438E0CF5 CO2Y
458,266,522 *2E804E460EB69A07AEC547B1E66DDECB237ACE69 3ILOVEMIKAEL9
458,266,523 *2E82B49AEF04FE8D86856A220A3C89BFD3547EEB 3IZBORNA
458,266,524 *2E8E51C7EE8239ABE78C537B7CCC4B5161D5A3E6 COLDNESS
458,266,525 *2E8E0A51AD26462486865C9EF6015E2B28F1B6CE 5BSWTCPAFBSW
458,266,526 *2E8C007D6F2E5D9DC2837284E0C4A95550C2D5FC wesleybesherse
458,266,527 *2E84E11A9AA900F9A32C9EF32C04E627063241B3 5CARAMELIZEDS
458,266,528 *2E8378114A87F5E83549EE4EF18FB2FAC8ABFD1B 5CLINOHUMITES
458,266,529 *2E84474786BFFF48BF522EAED31D4C127279C226 3-MYYT
458,266,530 *2E80BA8E52CCF17DA00CA650CA9BE859B6794AAC 3##P *}O{
458,266,531 *2E87E8A46096CC9A25CFEDB3A506A08F68F436D6 CON7R4DDII
458,266,532 *2E88A3492149A543802F97090F364D274AB66670 3VERBALISONS
458,266,533 *2E81150F9888AAFD5FB4F768524912FAC2385A68 3VTRACIE
458,266,534 *2E8F2ABA39CD125C04D38286D8C3758A12800383 confermero6
458,266,535 *2E8523BF1D786EC7D99EBB97BAA54F79EBEC37D6 4436973
458,266,536 *2E84D163E4A27D9BCD74A00730E5B60867294075 constituerent
458,266,537 *2E89494C2E132BD522000B6EE38FE656467E6062 wieweet
458,266,538 *2E837DE534E4ACE63EE50C9329E0E2E5DEBC0142 5ONDERHOUT
458,266,539 *2E8944B1FF6698669499EDF816B32F9FFDF2EA9B 5PITKPARTAISIA
458,266,540 *2E8CDA4472D2824DF26CFF281E5BAF86197BA24C 5PRAGTEKSEMPLARERNES
458,266,541 *2E88DD4DF09F16ABF7606CFC9DB6750673B040C0 william-de-la-puerta
458,266,542 *2E80954DB347113A0FEB435A0A7294C8896F0B45 CORY.BURDINE
458,266,543 *2E86BBDAACE62C32269FFAF3D4A36D23B733A42F 5ROZCHECHTAT
458,266,544 *2E814257F78FAA717FA782BADAA030F36DFF837A 5TODAYROCKY
458,266,545 *2E8C2C8FD9C08ACF9FA0E8256DAAB789B6FF781D 5TRAUMATISRENT
458,266,546 *2E8BA2F000F9CE8276B08741034B1A45259E0493 covey
458,266,547 *2E80B1E1933DC325D3CC2A152014C0CB8A505CD8 wilma.q.irlandez
458,266,548 *2E81BA0AFFE41EBE85082E4E78868E4B0E24A9BC 4MASTERSDOLLARS
458,266,549 *2E874FF4F3B53E68FC0B0360ACA215BE58B05038 4MINETINTIN
458,266,550 *2E8103504DF105653FB253C7088FE1AD4A121FE0 5VOYLESBSW
458,266,551 *2E8474AAF72FB57D8D6BB91A99333980EB64BCEF WINFRED.GOODNESS
458,266,552 *2E889B5B1D05EB3E58833F5DE39891ACC8919D88 5ZWERNERBSW
458,266,553 *2E80F5A77A9EEB71B666A4CC2514F1D1C1087DC5 616MELANY
458,266,554 *2E896B618CEC256C74A2E644A4B636A9C496DD09 4-P
458,266,555 *2E87FF8F18C5C5C8ACBC4AD30E28BEAF08239404 C:\PROGRAMFILES\WINDOWSMOBILE50SDKR2\SAMPLES\POCKETPC\CPP\ATL\AXSAMPLE\AXSAMPLEHTM
458,266,556 *2E88404C18296DAA2B88BA44E4F6576ADA0A874C cr_mh
458,266,557 *2E8491A9F4E7335191A31E4D97A4653C4C2F43E9 WREBERTE
458,266,558 *2E8347ECA7CE4B7FB649CCB7748CE8AC865587DD CRUZWREN
458,266,559 *2E8FD95C0B68FC987376F397F82B8DEF741E965A 6BSWLAXTONBSW
458,266,560 *2E83B37D0ADD3513358E72DAFB398BD83411D34F [email protected]
458,266,561 *2E86AE9601E9C9AE7F16ED105261DDF7AAF330D4 CS8RN
458,266,562 *2E8B092FCD9F1EF395F7BB085FEA8A74D2BA75CD 6D2FB9FE
458,266,563 *2E84E6DD96EADACCB8F7BBE76A7019C6DB0247BA WWW.BAYAREACLIMBERS.COM
458,266,564 *2E8038E39031E744416209EC9CE9D8F1D4D8DF32 5ACNAZZUB
458,266,565 *2E8A1221482EC87BE9F9AA70EE4E86A04715D273 wwwistoicacom
458,266,566 *2E82A3C61DC2A7A4346E4B8921A8B773D489C1D1 6EVISSECNOC
458,266,567 *2E85F99025BE5F1CEFBBB5C773E873764E956D35 CU&6+
458,266,568 *2E856E9D669C143CD282895E0DADA547201223A7 [email protected]
458,266,569 *2E8E9DBA7DA5F73C8B71410D3E54C37039F95B0D C#UPR
458,266,570 *2E8C8064780625ABB9ED0C84A28369309386F475 wwwlaughlincom
458,266,571 *2E8B4EAE14EB12DAAFBC2543AD7E5E52497A36C9 6.LIACOS
458,266,572 *2E869BB3C8D0A3D7200F19B1FB07EC6FE8B0ECCA 5CAITLINDANNY
458,266,573 *2E80B59EBDF2A5E579239E468B4EC6352630A647 5CELLULOF
458,266,574 *2E8B887B9F26163FE157C75530DBFD52D83B0583 6MOSTREMOSTRE
458,266,575 *2E8584EA6EA88BA9C7F639CCE82B7EDADF1CC010 X139748
458,266,576 *2E85F78D4C9BCC24678F4D54ADDBC251D38061F4 6PENNATHUR
458,266,577 *2E8CDAFA8CF03DDF37D978F1653641A7FE30C485 cvqgk
458,266,578 *2E8BE59FA457DA46AAE6E34F05E4126AF91311F9 6SAFETYABCDEFG
458,266,579 *2E8FDF37F2CF53CC9AA761C05AA1C4233200C9C9 XEINLIN-ROSE-PERGES
458,266,580 *2E89426D5536F865195510FFF28BFA4755D7BD29 6SBARNHAR
458,266,581 *2E8492CBF949969F6C14E2D750A1F5E142F5CBBB cxu!a
458,266,582 *2E8B37357C8718C6D6EE35883E53DE16E0307075 CZ1ET
458,266,583 *2E8DB292319F7184B1AD0B4A931196C22D16B833 )X(.*.*.*Q#####8
458,266,584 *2E899847E7E4DE02EE2F1F8F0BE0A623421F0ECE [email protected]
458,266,585 *2E811DE3525C1DFF6CF7723D15DD1A6A62A0E9EC d1%uh
458,266,586 *2E81C62B8A430119984FAB21BEEF222D4660F783 5RIJPELIJK
458,266,587 *2E8C1C9E23CCCFE71BFB9B7C7AF68B024586A3CF 5RRM
458,266,588 *2E8D99AA8B2BFDC4676C18E400D75BE708F649D4 D49J:
458,266,589 *2E8AEDA55C20607747C0C834A8AD85F743890FA0 5SCHOMPERT
458,266,590 *2E8A284313D79159497A6646BCDD1686E94F7405 Y7400
458,266,591 *2E82ADFE48151C09E2E4F3D2286CA9395563AFE5 [email protected]
458,266,592 *2E89E35B41B2A6F3DE6FC80BB4059870AEC700C7 7BSWGETCOORDINATESBSW
458,266,593 *2E81C40EBB4F1D8D91F29481FDC319E30FCE5ADB d6mk
458,266,594 *2E89F0199F05FF2C9E05A9FC34AAA86A4528895A ycyrbsw9
458,266,595 *2E81D36215050B187DE6926AF300C42AC2577300 7DSOLLERSBSW
458,266,596 *2E8CD891122255675E3C7B8402B35C3707E9D8AE dad0m
458,266,597 *2E8818CC8DAADD13EEB86C1C077A14C9560F96DF 7EFROIMOVICH
458,266,598 *2E819E912885222D00C7FE89CDBC00583F7B02DB 5-years-of-lies
458,266,599 *2E8D22B6EC84122883538C8942B09150545625F5 DA,JJ
458,266,600 *2E8F39F36570FA5BB9F14E924F3364F144228A29 65lvth
458,266,601 *2E893B3CD959699F1498518C7748FEEC449F4B5F Dance-Suite,-Sz.-77---IV.-Molto-tranquillo
458,266,602 *2E848B09709713D4BAA8BF030CC935AC62BBDEA1 DANEKASPARI
458,266,603 *2E84A8A27AC3750D44457940F0A9270ECEB70DEC danielborror
458,266,604 *2E8FAD489D6B80FC8F7EE5CBBAE69820EE6CEC3D y/mj
458,266,605 *2E8A9DCF369B0201ECB096784F31FB1E74741B88 7ODROTCIV
458,266,606 *2E804487AE5E998D4A46DF07CD42FC9FD50C76EF 7PHRATRIC
458,266,607 *2E81CEA3F5D27DB4D49912D35ECBD14DA6CEDE00 6ELWOODCOCO
458,266,608 *2E8CA31E65B57248A04A8414733D685DAAF1EEA4 DARREL.OGAMI
458,266,609 *2E8C4F8FDC4F31458D0B9A20FEE3551D46DAE556 DAVID.GRICIUS
458,266,610 *2E87E57F7A705872E4714724F6A5F41ED00509E2 dawangere
458,266,611 *2E834E955747765A6F0B9B583D1621ABD0E33FDA 7WILPATERSONBSW
458,266,612 *2E82E81D2F867718649631ADDCC865679CF5D075 dc=v/
458,266,613 *2E88619DD844839084570E834E3CF0511B20F72B ZACKARY.GEIDL
458,266,614 *2E8C4E06DFA7085B84BD3D7FD3CD583544EF98DB 6MYCAITLIN4
458,266,615 *2E83932AC4BF47E2820795E376ED0FC4353BB152 [email protected]
458,266,616 *2E81D50142C8C2044780AB581BF3107404717F06 86484 nicd:ss
458,266,617 *2E8538673DED42649A76F4F2AFC4977282A95FCE ZAIFANU
458,266,618 *2E83DADEA666E256B71AD745912E5C4E6F31D262 ZAMAZANIH
458,266,619 *2E845212D15697C502271DE2339BAA1E24D6E26F DEARDORFF170
458,266,620 *2E86B54532355DEF7C31C943DBBFCF3875DB0ED3 ZEINAB.GHADER
458,266,621 *2E8E18A5E0A242238581F9431A3AFBAE7EAB747F ZEITERMI7
458,266,622 *2E8D34E4F2CDB23F47DA672DBC6DB80D3E44FF52 6THEBETTY5
458,266,623 *2E8D5B09B4D46A6C10A473048FA38395B26B673C DE'FRANCONI
458,266,624 *2E8A8090373B59E9EA306E9BCE87F6075E02E48D DELEMER4
458,266,625 *2E8B41072801DEC1546D9EE06A3391B6CCE249D5 [email protected]
458,266,626 *2E89812C589C42FFC1EF9BFEC5AA07D64345DEC7 8BSWACCEDERE
458,266,627 *2E8ADB0652245DB4B60528C00342E977A6CC4752 [email protected]
458,266,628 *2E8F9CAEAC6A7D9986C4EE2FC30C74EFF0E372D4 7FIREBLUEBIRD
458,266,629 *2E854E8FF4365181870D40542E4BF38D63EDCC9A 8DOOMKRAMER
458,266,630 *2E848FB2F460EE8009371B64331BF1C3F06CCA33 [email protected]
458,266,631 *2E89E14CF69BE808DFA59CA6BDF224754E3A5F41 DENVERMADISE
458,266,632 *2E87B4C86ACDF7F79466517ED4801CEA294F807A de#r
458,266,633 *2E80B7F8305224ED752F38F98EADB1F315AD7401 [email protected]
458,266,634 *2E82FAE14E14BF5613254F09456A3F897763D6CF 7OVEREMOTIONALISES
458,266,635 *2E80664FED14C22D5478A2FA53A3AEE5F693FE44 7PISCESTUCKER
458,266,636 *2E812CD8A80799AC8712EED640B4B9D9394D5006 [email protected]
458,266,637 *2E8FE02D984AC4E53FAAD55B0A4457DB93B6689C 8IMUISOY
458,266,638 *2E8B4AC9208E782D28873EE2A5714CF9EA7376AF 7revisorcentret
458,266,639 *2E8A3D88A843F40FD761564DE2559B4A3D7DF2A2 DESPERATIONSLEEPS
458,266,640 *2E8D76DCBB4741C8B2EB8501A4160325CB0EB70D de=tu
458,266,641 *2E851B5317BBF8063F619DD03C8802B020B21A05 7ZCGSCGK
458,266,642 *2E878446F9A7415CEBD8A472C5A24746011DC1E6 807330 STAEDTISCHE BIBLIOTHEK ROSSERTSTRASSE 21 : 1012 UHR .
458,266,643 *2E87A1637C17436871815FAB54EECDC1C3A43C55 8#####p.~O.~o.(x)
458,266,644 *2E85BF4727DE7533519287887CAC11D67C4D8EF1 84SV
458,266,645 *2E87753968F47E8686F60F803225D2A0C3FDE4AE 8-P*-SPLAT
458,266,646 *2E8D25E30E00AED3878205597D305242B023D791 8RLSRZUEKJDTAE
458,266,647 *2E81924EDAF5B7A755BE95934B1D3999D7CE1BB6 ΆΚΡΟΪΝΤ
458,266,648 *2E83458A07858E88790D0D6FB9BF2FF3A9174817 dggeg
458,266,649 *2E8D38CC488C5D2EF5C00F44DB523B389665A0BA dgrz
458,266,650 *2E8D630EF84D8C83D6814BF08BA8C23CB6D0E63C АДИА́ФОРА
458,266,651 *2E818D2E03CC92E05A8A39DA68B14C5C7588A94B БАРАМОВ
458,266,652 *2E8BA9B0B122EAB4FC9651116BFC4C03B7BC0694 8DIALTEST
458,266,653 *2E83E1A493CD07C6B418A946F0A640E50BC54E38 908527 program.her.Sirket.iCin.beS.deGiSik.dosya.aCar..
458,266,654 *2E8274B3C30B3F120A07B479CEA47E1498C4AF17 93X160
458,266,655 *2E8AAA4392FFD362A3DD131A68FF799E5388EAD9 вудстоком
458,266,656 *2E8E53053290B41DE95E9B9F8B4B48F57BE24CD3 губернским
458,266,657 *2E831A646A5C27D28E07288831DE31F53DB88E82 DIGUSTINGSAME
458,266,658 *2E85AA136A6D605060CA2457F8654658B1F44D3A ДЕРОС
458,266,659 *2E8AAB285323C54750A4AD788609C9C528F1CF07 DIMETHYLAMINOETHYLCHLOROACETATE
458,266,660 *2E8D069D176745B7F4DB4DD6B7E7CD8ED6BC8961 [email protected]
458,266,661 *2E8F24E5EB957A23175508018A4873A5DFD2C375 ЗАТРОГНЕЛИЯТ
458,266,662 *2E887F066E22425273040CC4087ECA9B9E830143 8IADRAUG
458,266,663 *2E8A75128A8BF27798570C3D61748B12D45F732C 8ILOTTAIOCS
458,266,664 *2E84194BAAB91B03D8CF973CF482D41B7A63EB05 9DHARAANAAM
458,266,665 *2E86D9D45C91E998F8DA969A35EAD8B3D4880F9F [email protected]~O ~OSPLAT
458,266,666 *2E8647665ECB514B574B03632F5B6EE0B4830044 9iamcordelia0
458,266,667 *2E8B82ECA45F1A6FFD4CF4902E39BC70D5770483 РАЂЕВАЧКОЈ
458,266,668 *2E80B7412317FAA5EC7C2E6E42F678AF5280DE34 9ISKIERYP
458,266,669 *2E8AC6824DCB6DC0C76ECCB71D06CA16494E0946 9KRYPENE
458,266,670 *2E85B6494230AAB654A4DFBD9A1B594AAC95808C ХИЖИНЕЦЬКА
458,266,671 *2E8494F110054D67B7DD0D5D261756C64A9946DC 二十個宗(DZONGKHAG)之一,地處不丹西南部,面積達2
458,266,672 *2E8C1B3CD024D3FC7CD87F640962A3DC2AFF7097 DM?H
458,266,673 *2E81D98D7F3A7D4CBDD8A5CD58C46DC3C30C8D5D dnpot
458,266,674 *2E80E83655BDC5B3B541618A4C7C7B6BE6126303 95A4079D7FD63CFCA890389A87F81054
458,266,675 *2E8F9567F6394FA290CE23F0491423E5F50CD12A D=NTQ
458,266,676 *2E86677E1F98CF2B628DF6BB449850BD85ADE76F a2lc=
458,266,677 *2E884379C5E2FD6EF99CA2F49D48909E6AC8EA7D donniedora
458,266,678 *2E89CA15EAADA77AD4344DE2DC38689748F6BC50 DONN.ROTHHAUPT
458,266,679 *2E85E3B2C06DB79CAF7120226FA32505DF387131 DONNYBITTENBENDER
458,266,680 *2E8847BC8DAA24C72EFE4B070CE805BB8B8C4956 A3&ON
458,266,681 *2E8159562B70B124FEA27073E25DBF2BBDB8D2B0 Don'tGiveItAway
458,266,682 *2E863B35B0FCC6BBEB2BA3D7BE08881CBCA8C90E A!5RC
458,266,683 *2E845FCC0166FECBBE35B6E23244298916288150 a6+fk
458,266,684 *2E8C0C6F336201DAF747DA1383DBECD6B1818F76 9SRGFFFKVST
458,266,685 *2E82B59A629322665BD6259F236E9F7FC05E1DB6 DRUNEY
458,266,686 *2E83DD99145D94AFF3DEFCB0F257AE0F9771E8C2 9THATHAHAHA0
458,266,687 *2E84FF23AD72A6BE5AB8CBE8582CFC6C97B5D261 dsom?
458,266,688 *2E8FB7190D434492ED31B453BB3AB61EA7626A46 DTS1015
458,266,689 *2E8260A313817CF2FB7BF6AB68EBFFF96F804965 A1:A.
458,266,690 *2E826DBEEFF586FEECF7FC89AAB95EC341649F86 a1r(e
458,266,691 *2E82BB31A01236B6B1081CF59BA5D6C1C31FF318 [email protected]
458,266,692 *2E87C9BE0242E3030EEC270AAFF49030852B62A9 dunctons
458,266,693 *2E8EBBA2A2919A50128545A47B7BE006C2AC9B9C a&/br
458,266,694 *2E813691E8E94675417B358A163AF9BA2F9A4B8F 007kinsley
458,266,695 *2E80FE96B98A8990806F575B130878AF16D3B88B AdE/
458,266,696 *2E8345812C74BF6C8B57B24A96EB63E01B19716C AAEU0T
458,266,697 *2E8BCD4089400725781098AAB74AD963F11B9698 AD)"P
458,266,698 *2E8FBDC2F58D5A596ADB23FA80F0A1244BB5ED63 1003278 NYT.LAMAN.PALJOLTI.JO.V
458,266,699 *2E8F824A2D718CA439F9DD0AD0958BD350A0B8E0 1043816 paitsi.,.ett
458,266,700 *2E83A4A669EA80A630757E4AB828548E339E8183 ebzr#
458,266,701 *2E85F00FF424451F11C4C25E8D3A2C73C371C97B AELYNNEPS
458,266,702 *2E817DC3A1782FE6C323E6D979B4ECDB169E62DE ec8sw
458,266,703 *2E8099FE7043BBCD11E740D34F5AF81C36D781B6 11.maistuisi
458,266,704 *2E8864C9293286514D1526970B1C4CAED5F25246 ABBDL
458,266,705 *2E81A0C4F3268081F4409654E37FEEC4553CC067 12345677JACK9876
458,266,706 *2E852CE2E100A35E4E4EEB3D9790D19231F72A27 ederteamo
458,266,707 *2E8F547471BDA6F35DC8DD1FFC091536DCD4ACA4 AF$?R
458,266,708 *2E82DDA4F1AD1719BC950363B777BD1D7CA2C172 [email protected]
458,266,709 *2E8600AFC5B00D7B1C6D04083613A3362ABE3084 EDMUNDO.REBHOLZ
458,266,710 *2E8B7C7557C883DB156E49A43BA6BD90AC293D8D edte
458,266,711 *2E8E1BB18F2AAA541C2F92083E5D84D90705E1A0 EDWINEWIG
458,266,712 *2E8CF2CFBB6C66A1A881CDCBD3988BEFCB71BC2C EE2PI
458,266,713 *2E8274C0CC7811EFA9F0BA614BCE64F83578C4F2 agr%f
458,266,714 *2E8113D4F2773B6E13C244381A2BC574065941F7 eetrs
458,266,715 *2E8F28BA4291092B14F0D112BA2C00E25750F890 AIK89
458,266,716 *2E835A4EEE04EA2ED375B4B0740D973026002244 1843252 WIE ANDERS DAGEGEN ANGELA MERKEL
458,266,717 *2E8032E0BB0CC1A3B775DFE60C6DD435F0346442 ACHIMAASA
458,266,718 *2E8F3256EB7329DCF3DB0179EA38E19DB00EBDE6 ELBERT.RATZLOFF
458,266,719 *2E8BE844CA4A1DDF5DBE995B54CB45B437EA731F elg/%
458,266,720 *2E8F0DB882B20C08202CCB468B110966222782DC 1APR1349
458,266,721 *2E8BC369D381FF6694E3143995F4FA3703FF66BE 1B2FF482-BFAC-32B5-8572-32A90424F056
458,266,722 *2E898723F85C1CB253FBB9F5E125C1EFAAE35908 a$-di
458,266,723 *2E816095E5B4C1AE3FD169A623498C3B4DF6B74F ELLIOTT.MERCHANT
458,266,724 *2E87531249AE238F1D0D420A55035C5997A5C9ED elliottstegent
458,266,725 *2E867F11DCA34703ED705B6A5D4B1CCC10B6A483 alagiyawanne
458,266,726 *2E8B2B2C5F737F6F966ED5BF56FF3916368152A8 ADNC/
458,266,727 *2E8D2200DE4EF844E24BEEDC746C9C388ED2E927 ELOCIELO1
458,266,728 *2E8C774906FD83832DBCB80F3B6F3AC0EF768973 1CLEATON
458,266,729 *2E89F7C6B5D082D520968CFC1E8916F69A7A09F9 ADQO?
458,266,730 *2E8FA5538FBEC803BED681D3596CB0291E1677B6 1.ESIOPETUSLAIN
458,266,731 *2E89C7B33A79DEEB461BF50C4C9C8E67523FF59E 1-EXPO-KONZEPT
458,266,732 *2E82DFD20AF55DD5BD6806A641429E9387B3A147 aeh0
458,266,733 *2E82F1324D10EE960AABBB02BE63073E5B442B4D 1 GRAND-PRIX-ZUSCHAUERN
458,266,734 *2E85384ED4AF023D7349C07ED82AD4322A2FA06E ALEXANDRA ELLY
458,266,735 *2E8027D5BCEB331618B00CA9D7AD9E6761BA8947 1.highschoolage
458,266,736 *2E84E90D19819EE796C188421163B4542916DCF6 emiltuck
458,266,737 *2E88B9EBB6DA0F9B8CC56EE76A7EA4EDEF2DA724 EMMAFENNER
458,266,738 *2E82E760752A583DA91DF942A98A7100B92ABB3E 1HOMEAWAYFROM
458,266,739 *2E87505E5A90C8DCDD384FAEF7F241A802DFB474 1iamwarrior8
458,266,740 *2E8C0F24DB073E739070FE86F22BFB3EAB9CF453 ENETOGEGNI
458,266,741 *2E86C658123FA6C7C1A7A1259BC5192676F14DD6 1lankiness
458,266,742 *2E8947E949180AA1BB4F5F743DB86DA5A129BBFF ALPSDNAL3
458,266,743 *2E808FA85C5AB4B8286594EBE81EDE658E1E0C6A agzw#
458,266,744 *2E87FDCF92E032AE2488769D2B3C8B74D508F3F0 A:Lv
458,266,745 *2E83545BD05EF2EDE7456AEDC7B066D550DFDC48 alww7
458,266,746 *2E8BE29FD6DF91B212D4C6B5BA7B20A4D6C0224E alze0
458,266,747 *2E8BAB05FEABC597F20E97018AD863B3B04AD45A 1POHJOISKARJALAISLAJILLA
458,266,748 *2E893DD9F9F99B824A2E3CA70F1074547BC32CDD AHXC"
458,266,749 *2E8358E1F90A59F6A3A51038C857A147FD47DE53 AJDB9
458,266,750 *2E80FD292EA2FB09698102D67481D885FC684313 AK9U
458,266,751 *2E88E8F2E8CEA6B24986F773EEC7B8F8CE578219 ERNEST.DETERLINE
458,266,752 *2E8944720EBFB9CE2D68123371EBE8FA1E8047CD ernestrieck
458,266,753 *2E8FB79118573CC6765785342C0A18C69631FBE9 ERNST JEAN-PIERRE
458,266,754 *2E8210D9D6D6B7E05855305881C9B875F1390FD0 1-WEEREN
458,266,755 *2E8C9F03CADE764CCEC39DCE11B332A218306332 erwinzietlow
458,266,756 *2E8E059F4791B99C997F7EC9BC0EE4D61AC9A52E A=LC
458,266,757 *2E89984F14CD8B09B7196A616A3A2CC8D0A0C2F7 espeak
458,266,758 *2E8CB576E1E5341FD64F3DB5B44D7667F7971D8C estacion-de-torredembarra
458,266,759 *2E86954A9BDE8871427A95D729B123A1B2C17F11 esw3k
458,266,760 *2E8FBEF9A35A9C0A1090018D513231658012D958 alexisminot
458,266,761 *2E8F539C6BD3DDE3EDD340BCA25517AD4F629FD5 [email protected]
458,266,762 *2E8FC3F430866A04DFAAC6364CAE26000E8B0DD0 ALL.BECAUSE.OF.YOU.(ORIGINAL.MIX)
458,266,763 *2E87BA10F7CC81431F88824AAABB449C28093EF5 ANTHOLO9ZE$
458,266,764 *2E8A7DFB1DF2603B31E7CBDEE0E9B871483CEDF3 evitcaec5
458,266,765 *2E8491A7725062EA1BEFD7747001A6DE0BC7DD2E EXCILERART
458,266,766 *2E823DC8635311057F0D3FD73D759D0325AD716B All.The.Girls.Hate.Her
458,266,767 *2E81510C4024DA7237FE52FD06C16632AC53EE34 allycleveland
458,266,768 *2E8756A3553752BCD2D28644E7F2555343DF4027 EXP1O141ON5
458,266,769 *2E8E71567D57A10FB9E618735D9E144B1E360FCB alonzolenihan
458,266,770 *2E8BE89D6CD6CEEEDBB3B88EADD3D710F1CA449C [email protected]
458,266,771 *2E81A5571BD2DFB20BC9FB893C64A91A84D5A563 antwankafton
458,266,772 *2E8B03FA01E0E35C6EEA4BB376CD1697F7D50770 ALTHINGIED
458,266,773 *2E842FCA50C0F68E1C2421F6A19D068D75DE9223 ALVACASEBIER
458,266,774 *2E8EABA905813FD8956D22EBC0058E0CDC6ECD4D F%.$
458,266,775 *2E81522CCC36F5C2890F6B0DE42F51A1AD57C8B4 AP7L
458,266,776 *2E831423383CD8D096C0CF7519526F98120040BA fahlband3
458,266,777 *2E8988CFB5232B1801DDA60C94F3591FC07547D0 FALLSUEC2
458,266,778 *2E8B586E3F81177D2A9429BD6D773E7111F2F7AF A-QJ?
458,266,779 *2E8DBCA850E1FFF6C2BCDB2F2B65A8D2DF132C22 feedsins
458,266,780 *2E8F8295CF3790B1FD06B906BE4A7E1ACA906B71 2610151 diehoechsttemperaturenliegenzwischen11und15grad.
458,266,781 *2E86C27893BDD0E27D6D0B15CFED8BDBA26DB895 ARRONKNOLES
458,266,782 *2E82B0A7AA7B1FA500B01E1DE809FE4370E01A60 ARTBOLIAN
458,266,783 *2E8B3A69B9F9C855F6ADAE886764BE1E89648B7F FFEB
458,266,784 *2E830F85341D5C5407D0B50CFE6870629D12F7ED A"/=S
458,266,785 *2E80C1A5F33F0EEBCC5363F9DB93FCE1371E4F08 [email protected]
458,266,786 *2E873CA36268E4629AC3EA39AEF4B9F68DC14202 2858140 der-teufel-wurde-besiegt-.
458,266,787 *2E89A67A067A28D5A526AE2C0F937DAC3345FD80 2909817 kaikki ko . palkkausj
458,266,788 *2E8457A02E559EA1653DC74199E23B6315F64DC1 29MAR1597
458,266,789 *2E8434955AB48B6A112830573A33B623C5A5492C FLDRID
458,266,790 *2E88665B9A29E8A454C5E7761144D1428F696AF0 2-BUNDESTAGSEROEFFNUNG
458,266,791 *2E886B4C4389E0EB5712157EFE176F181A432265 FLETCHER.COVERSTONE
458,266,792 *2E856CEFCF12EC1D5EF7D58F7D094BB215777619 AS/X.
458,266,793 *2E8A9320BE9A23CB213CA0F99E14F7FF81CC2425 2DHLWNETAI
458,266,794 *2E8DAF78012BD120EA2D03A00B452FCEE2AE1DF0 A:TBW
458,266,795 *2E8226EAB83315E82D7550953EEE142A6928E088 AUBREYDENZLER
458,266,796 *2E8EB6C909B49EE5A071C833AC6D1579024928E5 aubreyelwer
458,266,797 *2E8DAF7681C3D34FAA2CCD07AA0AF66C84945A3B FRANKLIN.CARPENTERO
458,266,798 *2E8462318DD1A790119F1D7E21A163207D4240ED appyp
458,266,799 *2E8A3E0263BA63FBA0A7E1AA1F16452DEA5C4511 2.thenopposition
458,266,800 *2E8F907C4B870C807B4262F0EB5F58B874B065E9 2.worth
458,266,801 *2E868BDACC387FA87788874D760DE90B3D8FEC76 a:.um
458,266,802 *2E811565872EBC32E31A4409247D16808D222E7B AUSTINREYNOLDS
458,266,803 *2E83836B9A5CB5EB6C4C3DEA5F30123B99137291 avfil
458,266,804 *2E8F5E16138B3972A516BD96DBE1D4C292113A69 ARDENLATCHAW
458,266,805 *2E8111B12D45B102BA6FC57855159342F0A6615D 3BEWEXOS
458,266,806 *2E81071CA560ECE8BBCB565A5D593F79BF2856B5 ARETHA'SGOLD
458,266,807 *2E82C09FE59875F7A8FB21BC75B06F3DF0000DD1 3EROAMME
458,266,808 *2E8EE28A9D96B78EBDB33CCD3A93B057E1FDAC4A 3FEBRUARY1345
458,266,809 *2E8E8FC7F442EBE66EF7E01AA31B4207E2446B05 3.gozukmeyen
458,266,810 *2E893048AE1388F3377DE0E2BE897E63B4CF8625 ARORR
458,266,811 *2E833DAAB9F01038BE860B7F61F69E9B18602B8E GALHUGGLECSS
458,266,812 *2E8073E498E107A23CE5447F5D04C8F6012CDD90 garzella8
458,266,813 *2E8EC019EBDEAD53DA307A9F305AE531A65AEFB0 3.OSTOPALVELUSOPIMUKSIIN
458,266,814 *2E86E327DA7C305BB99756A8C4C1E4532BC1AEBC 3QQCAEQW
458,266,815 *2E86A31A15A2B8C778046475E637D7B5BDFDB52D >b0.~.~.~.(8
458,266,816 *2E86762A0A0F97A096E3F13D6C629922D3CF084C 3-YEARS-AGO
458,266,817 *2E8E5A06801C83C11D5E814ABB7453C03F1D7914 411KIMORA
458,266,818 *2E87C97F16DEA2DCA5AD8A8F1827EAD01B85BDF8 b3$!3g3d
458,266,819 *2E84582DAE53D6E0BDECE86674F799D34463A755 b67p"
458,266,820 *2E891DEAAF98AF3529D7790F84E3F1AC5E50AC33 GEWUHLTES
458,266,821 *2E8EDE2D34173D6287268154A3D2B6B068A08D11 AUBREY.WITTKE
458,266,822 *2E802555201BFE60D2033FCC8589D9405B476109 4betonirakentamiseen
458,266,823 *2E8BBF355B265F5B2EC744BCEB059912EC2130F3 b7eua
458,266,824 *2E8E18FE7327874F7B6B9CE8A04E3FBC4E8425ED BAD DOCTOR
458,266,825 *2E8C648ED425E60B7E37BCA64A7812BDEF1B32E5 GIVEMEONEDOLLAR
458,266,826 *2E864E860787288511BD53131EC2B7F7E1D8719D 4SOUSLOCATAIR
458,266,827 *2E83ED095EF85307B57B89D70B1AAF7E52554F92 4SPIONCINI
458,266,828 *2E804D3350C152FDFD0404698C7E8BB8F953CD57 glennollison
458,266,829 *2E8C8328D608E7D180AF1A8DDCCF1785F086ECDD AXI,0
458,266,830 *2E807EE6CB0A733B8247CF9FBE9A163AAFC15E74 4ZNAMENITO
458,266,831 *2E892D53EB66D3F1272DFBD85227D10C9DBBAD91 barneybellino
458,266,832 *2E84471258C4EE9C4CB44CFEBC61A98895F274B8 barrettgriggers
458,266,833 *2E8030BCFA1D7F4F5CA84AE442F71744331E7AA6 ayırim
458,266,834 *2E8B5B02BA7E124485BC16AE04FF2FB6ACAAC42D A$YMME+R1CA11Y
458,266,835 *2E88D6068E77051E88CCB441FB1DD39C1F64F009 [email protected]
458,266,836 *2E8273BBAD9FCC9D4415809F06AD51EFFBE5CAC4 az!g-
458,266,837 *2E8953992F95226F0DBD62C486EE90F74E55D04F AZHAR-IKBAL
458,266,838 *2E8ABF36FDBA43F17A123780144CC23E375C215F AZNIEYZ
458,266,839 *2E830C9BECF11E8823B3B6E1B7B020B0A74878DE BAwS
458,266,840 *2E89CA7071F27B4BF4BB71B02D06256701EB238E 550372 IS.PROGRAMI.YAPILIRKEN.GEREKLI.OLAN.TEKNOLOJIK.BILGILER..
458,266,841 *2E8F7A7B29E857AED1EB531427F025AD13A71AA8 560vincent
458,266,842 *2E88FDD16194652A46E4383293220E24C80FCFCF bbiyp
458,266,843 *2E834BDE2DAE60200275D70BFBC4A7974A305BCD grantbaradi
458,266,844 *2E86EEE8AC0DB4D75D64C878835C37E9E1EF19F1 5DULCIZA
458,266,845 *2E80944CEAB468EE51FD5F0E4F242AC7693BD7DC 5e!a
458,266,846 *2E80BFE8E836C88C41E22EACD0CF60516B18CEAF b;bxq
458,266,847 *2E8644061BD70F11EDE005143EAA77260E32AF10 b4wdx
458,266,848 *2E8E0582733EAE4B15040E65ECD83BCF62D8E610 BCB9S
458,266,849 *2E8D5FF21463D7063025100BC1CA9455B2EB7981 b74tw
458,266,850 *2E848D69B8130E2BAA47F2BB8D927F4A72C43D04 guinnessfrancis
458,266,851 *2E85BDD71F184F8303AF9A1788DD1CBFE75F8BDA ^B[AAA
458,266,852 *2E845B9A315B893C6B83E20AD693CA88804C1C59 babyreino
458,266,853 *2E85A857B7A5FDFFA566427408BF2962C1E4DE5C BEN DU PREEZ
458,266,854 *2E89CAF1400998AC25AD4FB6A5E2AFA746B10FD8 [email protected]
458,266,855 *2E8976992F0E80DCB16346F6152A8A8A05B18925 BAHALII
458,266,856 *2E8E5DEC48BE2E0662A286E0CE889FFB554B4FAB ben-stevens-&-paul-maddox
458,266,857 *2E87635C54F079FDE7F898226DE4C05E623C4CE3 BERATEDS2
458,266,858 *2E80251630870A98DA39446717EBBE193BD029EF BEW
458,266,859 *2E83D5D991557492CCFE8F6309881692304947C1 barneymatya
458,266,860 *2E81D70AF955CDD58257014FEB33C37D2C2AEBB1 HARLAN.DANKO
458,266,861 *2E8D64BB18D2769F6C4A794047BB73DB28B4EEA7 BARRYWEICHT
458,266,862 *2E847394776ECE52E7F5E56D34195A3AA881DF26 bfmdv
458,266,863 *2E80F898676079DC1B6B56EEFE366F282DD3BF6E ;6BAA
458,266,864 *2E8CF51CAAE77C1987D866B578E6904717A8EA16 6BUBBLESNUGGET
458,266,865 *2E88182BA48987354B61E0C079BB2997DC2A1CC3 B###B`~(_0)
458,266,866 *2E87479038B40421336C5BB28A71E2A6F9312297 HEARTOFDARKNESS(LIVE)
458,266,867 *2E8169D4ABAE616122B181A11018C8DA3B562231 HERSENMASSA
458,266,868 *2E89EC8CA1A2F6C05A7FA48ED5227B05B3628262 hexasulp5
458,266,869 *2E86CC4A2B8CE5415D8D6DD631E3486DF2D5EA6E BC_F#
458,266,870 *2E87C0EB2D8849285C1176E442092123940F2FAF billychaplin
458,266,871 *2E833B675FCCAE44AE312D9901D4615CB111F857 HIS.CROWN.BEQUEATHING.TO.HIS.BANISH'D.BROTHER,
458,266,872 *2E878B91BE453483D2701700D7A5BBD5AB589F8A HISPANICISING8
458,266,873 *2E8DFF4F1810FC2FB92081270D92842806C5CDED 6STRIDERBOOGIE
458,266,874 *2E805D0A00D445740AFFCBECBE0A7B62EB3CAD4D BERNIEDIXIE
458,266,875 *2E83E5ADEC444678BDE4D57C64F7DDDC2815069B 6WOODLANDSUBSTANCE
458,266,876 *2E801C92E92A7EF3B95FE8FF10937A8720B800BA bestanddelenes
458,266,877 *2E882C8D6D63181348B4F348314B3CC94BF1EDF7 bestiariuszu
458,266,878 *2E844B6B15657032EB05DE7157A3BCAACAE0F751 HOTNSINGLE06
458,266,879 *2E8E02E8D74949E63F40F28C9C8AC11C82D6C24F BEW
458,266,880 *2E8781F60ECC8EFA19AF337EC0EDED7FFA883A11 HTTPWWWACCUUSAORG
458,266,881 *2E8C0EDD2273C3B001B710E05E3D4703838DA458 [email protected]
458,266,882 *2E8D61DB100D021257EF3E5CB3F8AB8ACA02DD9F 7BSWMUDFLAPBSW
458,266,883 *2E876548503A54A85A568CCAD80E56D83D676110 bg;q"
458,266,884 *2E8AAF2BDF7C04216AAD462555F65C9B04278C98 bhuc0
458,266,885 *2E816CBD5E1CA696C865247CF26BBA4CB23A1077 BIGBIRDMADDOG
458,266,886 *2E8620FADC92A2AA2D3C415EC15A4BC47D52B806 7ILUVFLOWER5
458,266,887 *2E8D5575A5370AA75016002B06A9A121080F57D6 hytterhytter
458,266,888 *2E85AF122EE54457A13AD930FBA403F508C0891C BOOKERHAROLD
458,266,889 *2E849C516728DBD2453AFE09A7D1879BE5E0F6C0 billyevangelista
458,266,890 *2E8994941C754CDB32B4EA7A9C9C58B6433A6B5F BORIS.WENER
458,266,891 *2E8C0D9C6D72F6C66431FACB15FBF5771309D6B8 i*'d
458,266,892 *2E8CCC4485D3C51A9CDAFD37CDEF15A1BF914961 'bj'
458,266,893 *2E835D79B620962AAB835137744D2E6FEF5E2ED3 BJUW-
458,266,894 *2E8E5F5BFAEC94E81F62A3D8C0A05F83A155C33F 7TAMARAHOMEBREW
458,266,895 *2E8478C37169DEEC9FFCC2FFEC01FA804CA9F78A IJMINGEN7
458,266,896 *2E8AC3C3773EB70305A25F19155152A27C91116C BMBK
458,266,897 *2E8650367CA8C25B1C3443560E3C66CA6C28D887 BRENT.LABOR
458,266,898 *2E86439F5232AFAC63599C011F375E96CFE52730 8DIMEZZASSE
458,266,899 *2E8408863A553FF4C4007280E02893891D286D58 brianedwardthomas
458,266,900 *2E837B910DFD89AF3DDE794D03F91D008C3A3DE4 bobbiemignogna
458,266,901 *2E823B291F2A2D9D5098B55E6BF9675F51F59D77 bobodaca1
458,266,902 *2E887633BE59EE886623D42CB325D74801F5AEB6 BRITTBRINDGER
458,266,903 *2E895B9E817942684E7FFA13218594DF67A21136 8HARRYJOHNSON
458,266,904 *2E85E7FA312CB94B758D82EB1E8665733DE7BB7A 8HAWAIIANEREN
458,266,905 *2E82A6347FFB61C10BF667842F9B5F2FBB9A9282 INSEMINARVOS1
458,266,906 *2E8CFCB9ADFBC48FED96659CCF237BA1A753FE7E broudur9
458,266,907 *2E84395058B77E6F62C7198987497353B7631F23 BO%IB
458,266,908 *2E876CF668CF7961865BC23158F8508B62FAC4D0 8KG・M→
458,266,909 *2E8A5CB05DCAE3C9605125EFDC54F1AD5083EF48 BONGO80
458,266,910 *2E8443317B28954508F02AFA2971A3191D40A853 8MAISIEEISIAM
458,266,911 *2E8D1AD2AAB9E9FB363B96D48663FE65A9859589 [email protected] ~O ~osplat!
458,266,912 *2E8553BE49DBB38D3542606EC9BBD7ACB61E0515 bryantkallevig
458,266,913 *2E870369190B3BC85D5F2C5F7EA932647F08A339 BRYANT.KILLINGWORTH
458,266,914 *2E8B4A72C2E11E10BE01D3C99997715478087E33 bryantthorsness
458,266,915 *2E875DFC3F597676CA4961D3A5AAE25D9A70ADC0 b_os%
458,266,916 *2E8B38D0072A91DCCBE3C664DF41A1318935163D iqdf
458,266,917 *2E855943DAD38CAE8A1EC88658EA62E0BF39F57C bswdaultonbsw
458,266,918 *2E8ED600A30253FF121D3DCB983D9963BB4BB01D bpls5
458,266,919 *2E856E852F4629B2BE1C9F573B813CBEBA0317AD ISOCARDIA7
458,266,920 *2E8C6951EFA5B2518560EDE8C533E2EF54D7D489 ITAIMAGWAZA
458,266,921 *2E80BDF0BE9D7E8B56FF76B4F56DB7F2D1C270B5 it's.raining.red
458,266,922 *2E8977362F188AC555A4B113DAC5D1D593210C28 bt;i-
458,266,923 *2E8144E794DE2A0B459DE9802E420FDC68DC15A0 BQ+E
458,266,924 *2E8330AA86385B4615A59EDA256ACE026FC6782E BQKB
458,266,925 *2E8C66581A79AE9A6818114FCE9F599D508E8E06 BRADLEY.BARENTINE
458,266,926 *2E85B0BD41D6D858FD39E7EBEF23B384AA73E830 BRADLEYTHRONTON
458,266,927 *2E8CDFD7D15CE9F0D347E23262358A0952E59979 BRAHMANE/N
458,266,928 *2E8534E8B0A6CECD7DCBE0B0F5ADD0A834651F41 BUD.MICHELENA
458,266,929 *2E8B4FDEA63218D0FE73A604E76A904D98A3E856 j+-{
458,266,930 *2E8CD195BC620E823CF6D9875F8D142B8B0B6051 [email protected]
458,266,931 *2E807E76E83C04C1B306E4AB63C85489E5ADE2E9 J4123013
458,266,932 *2E84E3552ACC777B5075CC04C686C7DCC3260C36 BULBIEST.
458,266,933 *2E8BCCF2EC9D8BF6FF7E065D43E01BB4C5D3558C jacobhovanes
458,266,934 *2E8393E148034101F45E010E1919EA6A046B2472 bunkum7
458,266,935 *2E8B361E66E23A8F434AF48C4C71B6536C9146F6 jaideepjoseph
458,266,936 *2E84329963F34BDEE8F650CCC59365B5058FC787 BRIANHOBBS
458,266,937 *2E82639167F1FF6D7951401048B13C36459BAAE3 b%rio
458,266,938 *2E87C236F56F9515787BBED7D706FB4ABCE7067F 9ELLIVAGUATUA
458,266,939 *2E82A8F5AD45E8C32E1C4E3F2A268E9B59BF184C 9EROHPOMO
458,266,940 *2E8A91C5D227D4A6DF98CA5ECF5F5CD7B5A4A60F jamesbett
458,266,941 *2E8D4D063B480ACDEE9C4A7B6677513BD40D3DC9 JAMES.MCQUAY
458,266,942 *2E853B971508ED6C0D31D56C7E28E4335C02A12B 9.fiercelooking
458,266,943 *2E875441B1F3508C88DDC6DA5BEE380F9C7668C1 9FLUVIOSE
458,266,944 *2E8443A46B440189DA68C7F8747263A558F1259D bw&no
458,266,945 *2E8D2B3306641A1051064171BDDDF89F34369C41 9mypayton6
458,266,946 *2E80022AC566DB14F1E638D5B528DF12B357E707 BYSTRICĘ
458,266,947 *2E87EC395AE3B34E36A02D9C275D6F126DA0171F [email protected]
458,266,948 *2E88FC9C5EF5FD470FF639FCC118E1D1A32014D0 jcmadeja
458,266,949 *2E8D95C0CAF6B893A4AACB5B769B420D087BD1BA BZEIB
458,266,950 *2E87815D50D5E91382937BFFF12F3943307FFA7E C2M)?
458,266,951 *2E8ACE16BAE301CE4AB9CCC064293A16C29EC449 a*:
458,266,952 *2E8ED0D7E578748F7DD12A244AD5B6CC27F30411 JERROLD.ZUCCA
458,266,953 *2E8CACCF42EA85F5E1E60D08EDAD240B83FCA82A bustervirag
458,266,954 *2E82FCA8E43A6F5715B1C04A8E98443A145A4F19 c4nij
458,266,955 *2E8032AAC023F31F16E6EACC235A4AE6D248F6C2 A1U=O
458,266,956 *2E8FE150CFBB7E460F479AAA2F2F1A3B502CD185 c68fi
458,266,957 *2E89A754CDEAFAA24B6BDE0495E0948F12E97FA2 jimmymelaun
458,266,958 *2E8E75A21E59EAA2CBAC505C6C71C70CBD96EB0B a3nk)
458,266,959 *2E8BCD9F19A6969CD84DEFA9794B164010806E49 bx+u)
458,266,960 *2E8322F8CE652840C4F43000BB0512D8958DBFBB BXV9H
458,266,961 *2E88B6123DEB24009340E2D367FA7B1E120AF5ED a63s:
458,266,962 *2E8C1FDD4BBFD9916FE82E3F4E7D4F2803614EE1 A-6O
458,266,963 *2E88BC598A5386AC98152257B01D1094B29EC477 CALEBIRVING
458,266,964 *2E83D4E9D83A76C97B2344CA2E1E93AD32FAF1C0 bzu3b
458,266,965 *2E8D401AA0DB42288E0ACB05B3F80FFEE4EE46C8 [email protected]
458,266,966 *2E81127CDC794066BADF50343E5BDD2AFD896E61 JOSHJOSLYN
458,266,967 *2E8A3BBA3E144E7F69A1D7E46013CEF19EF7EB7D AAA}S
458,266,968 *2E8AF8E43DD44A99215629F402EF07A59689AD91 AABB.N
458,266,969 *2E838D02C5273737CD77529774DDCCB3DB33DCDC aab/r3
458,266,970 *2E8408071E3BA20373A9EB83ACADBF261AE0730A justwatchmenow
458,266,971 *2E8068F594F6153A79EA3F764ACB4858B2283F86 C6U#9
458,266,972 *2E8FB7DCA7364FCF90A570A73BFC88929C2E93B1 KANAKUSA1
458,266,973 *2E8DE5F01BFC6F8E248539CDDA415D86B9BE5384 [email protected]
458,266,974 *2E84F1CF3701EF249FEFA3C2743A4E8919ABDCDB [email protected]
458,266,975 *2E8CE953EF47055D4EF3FABC24160E18E317C1B6 KARENNIGH
458,266,976 *2E89B80342914DE49FCDE2F834A67DC3B6061975 katodestr
458,266,977 *2E8C71FF6CC721030BD89F255B9BF1C7CFEA3E44 KAZAJAMES
458,266,978 *2E8DB6A35C5FF70B39899FA007409E48DBE050F8 carolbrund
458,266,979 *2E8032A7B493C2DEDA7C72C1DCC31A8092E96F9A aadrde
458,266,980 *2E844E8BF7CF99489513A971507235EA263031AC calificacións
458,266,981 *2E80B2EF92596272BA793574BAC8EDD1BCE249A1 KELLEY.BICHREST
458,266,982 *2E81855B3C209DF3A8159100FE80C9950A638457 KENDALLVILLE!
458,266,983 *2E8D393EE98177F87D01A3094875DDC9C31EEA2C [email protected]
458,266,984 *2E80EB79B89BB9F2207575DEA5A3C46EC4D668F3 cassiewinkel
458,266,985 *2E875943778C8E19E95452D158BC6E234C5CED59 abbyhalloran
458,266,986 *2E8BAEBF36353A2C5CDE3F6524175F62F635D157 kerugmata0
458,266,987 *2E863BC530C7FB904EDB4D2255937C5FD9C0A49C kian638
458,266,988 *2E8A0277C96368D74968C553A10FB5165B56750D kimwaguespack
458,266,989 *2E8F36ECEEB3FA370B03EE05FEB1594FFA154D6E [email protected]
458,266,990 *2E8668BB05DAB8F760E0976F41CD87145D9620F4 KLJOEN
458,266,991 *2E8EFEB857EBB502F71C13BA750571EAEC860E6F KLUBBHISTORIK
458,266,992 *2E85F8170B2ACC4E0C4B6819A9EA81098A100D50 ce5l
458,266,993 *2E86607425F88B732F9C4D9B374A678238346236 CEDRIC.ZOMBORY
458,266,994 *2E83768C8FAC6A3076DB2D0E7BE85154C01456F4 ÇÊK
458,266,995 *2E8298046DAA1E2765B929DDB5664CD71705AA5B [email protected]
458,266,996 *2E8D71A5FA44ABA630648476C07072E8A76ED44D ACSAYBSWED
458,266,997 *2E8237C3E17751645178F2F80A48D427355099C2 adani123
458,266,998 *2E898BCB01509ACDA38A98FECFA0D88C8958C37A [email protected]
458,266,999 *2E8921BB5243BF63DD109A784D64B2AACFDDE488 [email protected]
458,267,000 *2E89D9D3DD8434F1189D83C3E6DCDE0EDCA4F2A5 [email protected]
458,267,001 *2E88056C6150F59D0696515E36B8C4B484A315E7 KYLE.COLER
458,267,002 *2E8BFF16CD27D8BA7A1B4A269251B2C311C414BE chaneldragon
458,267,003 *2E86EE6E4FB0035ABBA845BC2FC4E41296C35E7C CHAOSMEN
458,267,004 *2E88FC72E10F7D5CCA2E88F3FB42197883BF540B CCRLR
458,267,005 *2E87E874E4CC2460B882919CE553E8F4B6E0065B CDC-FUNDED
458,267,006 *2E8F050689E1993EE5E3FFFE56E53CA429CB0971 c!dt-
458,267,007 *2E81C63EBAFB4B8F12281F727D46C33C65960E65 LABOLG--A--FI--TSIXE--DLUOW--NOITAUTIS-SUOIVBO-TSOM-EHT
458,267,008 *2E85786B3C55EA622773973101AF2F77234470E9 ce4l-
458,267,009 *2E882263F00284FF9FEF55C2E00B320A14DA71A4 CEBD7
458,267,010 *2E896A561692C9A0F7D0169CBC2768E4F651E334 LADEKANONIERS
458,267,011 *2E8B447FDA1A153AE19C30AFAA4FB52BDEC608F7 laduke11
458,267,012 *2E8008DBEC7ED7D57FF10003639BA8B2F118A192 chbh
458,267,013 *2E838829CDA6B115925915FE25608E336269CA4F A=%F
458,267,014 *2E8FE4C441D6D676BCBAEF34A8AA9E1550A9BE32 A=)G
458,267,015 *2E8EC877F9C7FE6CBEF7559010D44147DDEEE60A A;GAF
458,267,016 *2E85FA49D5B0F0FDD17A72F0E367001211CCF4DD C"GAL
458,267,017 *2E891EF2BAB73D8ED10FA457BFA5CDECCADC82D6 cgpx0
458,267,018 *2E85988BF43B1F3FA0CAAF92712BDA7116A1E4FC chadandzulis
458,267,019 *2E8FB981504CE4CD9C609956837057D71C5B35FD AHÁNYHÁZ,ANNYISZOKÁS.
458,267,020 *2E8741B6ED644C30091CDDB6FEF318375EF9CFB3 chtrlpn0
458,267,021 *2E8252C7101C07392088BF60269F71EF9E189EF7 [email protected]
458,267,022 *2E84ED0A956673539E3FEF8C3610ED2A99E1F3F9 chaomae
458,267,023 *2E8EC8DBED6EA5860A167251C25308CD4E616AEC LEEKHONG
458,267,024 *2E8B51DEE905A3F84518C03B40CE92F48E683EB1 AHMADMINEAH
458,267,025 *2E8A0A0BBA5226787AD7C8267B3C5F5FF55EF65E chbh
458,267,026 *2E8B3B03D2FD6E3DDB5B4C5A18A48E714E2B431A [email protected]
458,267,027 *2E8387120911D1BD01E4665230F596F711FED436 cjpnm
458,267,028 *2E8F60A74F494C34DC2E0631577597FBA619577A AIOM6
458,267,029 *2E82FF95F4AC4CFB9C378A34C2E0A4B1B582EECE lemuelkukura
458,267,030 *2E80D1693CD4B31CFE36EF2BE659B28D997C964C A;"(J
458,267,031 *2E85ECA59EED78A0FC2F325EAE0AB7CBFAB25C70 chestermodesto
458,267,032 *2E85235564556AD0FD69F1EBBAA7BE13ECD3DDA8 ck?)w
458,267,033 *2E863AAF2BEA0505EF1F94A55BCDC0ABBE8C23BA LEONA.LEWIS..BLEEDING.LOVE
458,267,034 *2E846891718618CBD604D92B8BE2DCD53D728C6F chilopsis!
458,267,035 *2E82048B54A9EA384910696DBC517FB6DB539888 lesleyweitkamp
458,267,036 *2E8773EFC815D27FB476BF85B71C66EB191E940B LESLIELONGHI
458,267,037 *2E81CDDE453DDD8F8BC1724757A439993A69B7DB AKI2=
458,267,038 *2E83F5886708FD527F9AC100F2BA76D467E619DC CHOOSEGROUP
458,267,039 *2E8497C28941BD1F4B9EC1A672EC0C7BDBD42D68 ‘CLOUT
458,267,040 *2E830365E967EE7732C9D3E2B86148D5351AF44A c/ml;
458,267,041 *2E80075CA18810E1A0E0BE375CDA885C140FF1BB CHRISTOPHER-ST-CLAIR
458,267,042 *2E808336792E6629AAE3799944067025D57A51EC /LIB/MODULES/2.6.32-24-SERVER/KERNEL/DRIVERS/NET/WIRELESS/IPW2X00
458,267,043 *2E8A5205CFF8E8F7A0F5F27CA373448ADFDE8391 CNGLTRS0
458,267,044 *2E884118795E1A20993CB3FF3CC07BEBA13236A2 c,ia4
458,267,045 *2E88C8271988C506400EA3CA2C775A17E9E74413 [email protected]
458,267,046 *2E81E73E39AFD2AF9AD5B9DA17FAE3860487EA33 COMITATIVE
458,267,047 *2E851576EE544181D651193531DFF87DA1436C99 claire.tonry
458,267,048 *2E80542DFB51492D6705C76F31C8B478425D9417 ALODI
458,267,049 *2E8FCE955C799B37AD4C9530174F4A92A2D7FFAD CLAUDE.LAVENDER
458,267,050 *2E884C6CAB264A82993AA089707F1C1D44FB3988 [email protected]
458,267,051 *2E88F7D6D9068EA8558DFA43FB49BBCE8078B95A [email protected]
458,267,052 *2E8FAB370B2A21165070DDE1DC3E231F0A434729 [email protected]
458,267,053 *2E8D2A842371A3050F55D2DEFDD28526EF7629A7 [email protected]
458,267,054 *2E87584C472E4CF126F9A6B3AC3E8CD912A1CADA Little-Little
458,267,055 *2E82D1F6BE187151184A8084DA2B1556A5EECFF2 [email protected]
458,267,056 *2E8B28E308B453DA3BFA4C814AD469C0E9F25984 CLEMENTE.LAFFER
458,267,057 *2E88FB5D8A72A1D55F5804E301964A1B3F98551E CLEVELAND.GALES
458,267,058 *2E8520C9ECECB400F761F70798221CBA4D9A8AD5 ALYZATOR4
458,267,059 *2E8FF72DD01E3CD055839C290CDF6803B3A713B7 [email protected]
458,267,060 *2E83DDFE1CF7DFF5DBB184222DB3F3D681E65DC8 L&N1
458,267,061 *2E8E5147329EE624198B47B619E4D0F938ED38E7 LOKTEN
458,267,062 *2E8BEAACC98D63DFB07F464F059B498852948A57 LONDON.CALLING.CANCI
458,267,063 *2E80BC27CC99C25E948C156D11A76E71BE29518E [email protected]
458,267,064 *2E8230E45F57E2C00B053D2B7DA4600A5800785E c-lme
458,267,065 *2E8C25DE92FFAB2978B724E85AAFDDD61B2E1E88 amt(r
458,267,066 *2E848668456B63A54218BFB4C8D2621EE19E924A COURTNEYGEDDIE
458,267,067 *2E8F8660FAD9E8F976DCF7A73C462D8D6013E4EA anarthropteris
458,267,068 *2E87E72DA51FF310A3A69201469F4E04DD32E23D ANDREA ARCOS
458,267,069 *2E8C2A7D32E33D8A34A6DEE6F657E749C0426D1C CP;
458,267,070 *2E864F521BEC98C4BB56405B71C42D31B0DD6441 C/N0Q
458,267,071 *2E85924CF229DE3BB4B14E45AD03111F3FB81E45 lrupbsw5
458,267,072 *2E8B1E5B59DCC927781A233AAA7EA39C0156D5D2 CO5B!
458,267,073 *2E81D599650FADDBD42B1EDC51AAE8E077D558EE LUCIEN.EGLESTON
458,267,074 *2E808D54E3EDDA2F6801B4A7F2C2AB04D3ECC31D ANKORVAT
458,267,075 *2E8606CF712B11DF86304F889F92BA78DE041834 luislhommedieu
458,267,076 *2E892E991036788738F007D74049D2A45B4362E0 luiswenthold
458,267,077 *2E80803BAA2DEA4E0ACF59956EAB4B95B88F32B2 colebrackman
458,267,078 *2E8F3E218B06C4646F5A41A85BEA4F0C5EDE48DB COMITATIVE
458,267,079 *2E8B40FA5D04489E30BB961A8D4B7747682E20C6 lymanantolin
458,267,080 *2E88F9AD580BE2C8E8ABBF2D5A0E4CAB9B44982E lynwoodmadenford
458,267,081 *2E8F5F226235E0D02C44DA54942A7A55AF332793 lytishia9
458,267,082 *2E889C02E91F79A47BA8D1654E014D0DE8533498 a:nwl
458,267,083 *2E8399F0B840DEDA1799C0DD9F016799A0345938 AOGCL
458,267,084 *2E816AEFE576B6487C33470E8733367ABA43D372 madagaszkarivercse
458,267,085 *2E8DA41BC11E9FE3DE3B123ABBB9E1D9A5E489A8 APERIES
458,267,086 *2E86CF86DE241623BF356AFCBE2AF045B3955EC7 APPALLEMENT
458,267,087 *2E8A17391A4A3394E92412182195A2A5641EFB1B CSV/
458,267,088 *2E81D0BD947B269DC0626C5F549B320A20ED9888 APV9:
458,267,089 *2E82CD52608425F413296391B39FCCA3DBEBECDB AQOQF
458,267,090 *2E8E88702AE2D23AE30CF6D4A464FD399956FDAA manierede
458,267,091 *2E863018E07F529F381429621416A6822E30E2D2 archer)這位知名的偵探,並曾經獲得金匕首獎、銀匕首獎與推理大師獎。
458,267,092 *2E86D291FC0581EEC6270D7E5129F7E0DE10B307 A-REMES
458,267,093 *2E898E6B9C91C2ACF50DE3752E9594DE74045FE6 cwlħ
458,267,094 *2E8E87017AC288D64506B6BF41C8A61C97795460 arpad-soos
458,267,095 *2E8921DE7026F38EC9A631FBEF9DA62DE4B92EF5 C%TFN
458,267,096 *2E86204D0784E32E76D4366B698334EC3B8C3CDD cz7+3
458,267,097 *2E89738D800C66286F97B2A788F7CBF76341C596 cz#a
458,267,098 *2E8169BB954518F0591FACC73A472CD076D8E6D4 [email protected]
458,267,099 *2E8A7E63EFC9439C553B56C52A82A7013A5E4D42 arturofirmin
458,267,100 *2E871646DB89259232198EAC1EFBD811F135AC70 arturorenfer
458,267,101 *2E8D3F30FC29F1B03A51B629FA57793F0970E750 MARTELER!
458,267,102 *2E8B7D7CF7C6EA8D44EC3DEF918C5FFA272D01F5 D1234M7
458,267,103 *2E825AE1E3DC3A0817C6FEDA4E80318E38041B87 CURTISRIVERA
458,267,104 *2E8C56E1A200F0FF5BE4B42A7400746D1E50AE55 ASHLEYMANZANARES
458,267,105 *2E858D06502936FA970BE4072C5D2D987924FB4E MASON.TUBOLINO
458,267,106 *2E8EBBA54806D2F635C133A1BEF55286A98EFC4D asr1)
458,267,107 *2E8C870EAB18D278F376FE01D2EFAC0D28474FF8 C:\WINDOWS\SYSTEM32\DLLCACHE\SSPIFILT.DLL
458,267,108 *2E81D71838088457D586541E32A9F13F51A87CA3 cw?!j
458,267,109 *2E87AC1695395B680AE92A5D969D9323CB319AB6 MAXIMONELMES
458,267,110 *2E8B503A40DB88C25E240C35D1524BCAAA55FAF1 ATSEELEK3
458,267,111 *2E81E0B5C1A028A34902452388D3DBEE8E637D9B MB326LD160
458,267,112 *2E8F3B9446B68044829472AA965A6C866F340128 CYRSTLE6
458,267,113 *2E8FD4CD3534FF8D6387509D623F6DAA248E02C5 CZATOWNIK/THEAMBUSHER
458,267,114 *2E8C6C23C53241A1CEF4BEC07B2DE30E5630EC99 AUREA NICKERSON
458,267,115 *2E875274BC8DCC0D6A2A63559407EE27878C0DD8 danaangelico
458,267,116 *2E8C83A724B1FDE26926C2A0DC0415E6BE4B0249 DANAROGNE
458,267,117 *2E8CF50F18AF7018AE3918AEAD41E2242C6AD0DB DANIALANGLIN
458,267,118 *2E884F0D662DDD0D005C87C54FF27E673D3D57D1 [email protected]
458,267,119 *2E8843F46040828C3BAEBD0E8EAC0F7859ACDBA9 AV(#9
458,267,120 *2E83D0065825B9D5CEAFD4C792246138F55A1AB2 d$4hn
458,267,121 *2E856AC00EDAE2669DB7112568C1355705AB26A6 a=vf;
458,267,122 *2E85AB17C3D3FC77E66EC6D048E79DFBE9B53253 d:aop
458,267,123 *2E8E08E1E82BD0FE3F86CD88504A6B8B793235BF DAREN.PINCKLEY
458,267,124 *2E801B7A1A89ADC47E3ECCDCF6F2E0980505EB96 D6=QM
458,267,125 *2E81CE46DADEE240E5CEBF51D2CE4F35B3822658 awejj
458,267,126 *2E8166D3F52CD720049B3C28A3709B8AE222608D D7TNX
458,267,127 *2E8E6A464CD110880341E0DE79D97431B4795FAA da/rs
458,267,128 *2E851160A56016F686B098379E9065F1E721DD9D MICHAEL.NEESE
458,267,129 *2E8EED571D5DED941D68722A5C702A77C43B1B05 b?.
458,267,130 *2E8C18C44CD7AB170113E49FA76019CDDD5932C6 MIHAIGLIGOR
458,267,131 *2E81DFD6B959DCF46EDCEF50B428BF8CB495BE10 B1-?R
458,267,132 *2E8E491F7F127104BBD30FDFEA1BB0191DD63EC8 MILLOY1234
458,267,133 *2E8CB6BBD4298FB173A2853F2ED2F6686A28FF0B MÍMOSTI
458,267,134 *2E87AC95ECF6AB146B4E5397178F9C6E33D2E0B3 B3HZ1
458,267,135 *2E8722C1770447AC496C1AE3B0C2F357F65A06E3 B5R=
458,267,136 *2E8A8A853471C73E6A2130E855E58E565C64E6C5 B6t4
458,267,137 *2E84D18E5726D396C9553796816148B5877816B3 dd)ov
458,267,138 *2E8D2A060067E9C7D82E162C0324B6D1B6352191 DARRYLBROE
458,267,139 *2E89DA733C4C5AD33F1809640EAA2D6972D71A2D De%C
458,267,140 *2E808149E684DB6D3B9B3F42528615C761C313E6 DELBERTDUFRAIN
458,267,141 *2E82791883CCAF49EA4DEC557D1CACEA572C98E9 davidwoodliff
458,267,142 *2E897BCDC97617A74191A5BD8A47222EBF9B3012 DELE OYEWOLE
458,267,143 *2E8A1C8882CAAD270DCE40C1F27487CD951CCF4E barcasablanca
458,267,144 *2E84E8A557DE7DA41578A41F7AAA613DFA60094B DAYAN21
458,267,145 *2E8EC46848074864F81B29B7EA812AECE978D178 MONOLATRIST5
458,267,146 *2E86AB5C85F8A393904EC8ECE7CD433C18A1A629 DEMARCUSHAGWELL
458,267,147 *2E84D7112C056F9667697301E0678ED4F7A1A766 BASIL.BIELEFELD
458,267,148 *2E839E472F3A82396A7AE1335881F4C27B97D065 BASP5
458,267,149 *2E889CA8514A46F6BDF3839B089F8C3C7E83E43C B###B.~0.3B<-
458,267,150 *2E8560806D77C2960C3A6AF9B74C6953D698C4D1 b$b2$
458,267,151 *2E839F9A4130113B3E78D9439622CA7234406204 DENOPAEWING
458,267,152 *2E8E794466632821B831D4D284F7ED2C139CA875 B!BL!O+HERAP!E5
458,267,153 *2E88DCDE1E33E3D4EE62B40D2AF5045CB9EB6812 mpipg
458,267,154 *2E8D50FF5E870AD49CE49612F43391DF4467FB1B MRECHEN
458,267,155 *2E8F559A3548D146CEC7048A1D7C4FA1B028751B bciv
458,267,156 *2E879BEB8A8A7F5EC21724BE02072C7A6DCA913B DEEDAY
458,267,157 *2E811D129FBEA2E97A462E26E6CA0FB713A2FC91 MYOCARDIOPATHIQUE
458,267,158 *2E87C74F78D61B185167CF2E8F147EE29D844388 DFARSAIYA
458,267,159 *2E86E115A38AEF98C3CB3D59775FA9A1DC7FBA85 BENEDICTBRASHAW
458,267,160 *2E8B01BDAECE4E92E214EB0FAFA1AD3799233DD2 ben harper & the innocent criminals
458,267,161 *2E854135C4FE46B0A01D732B70D1F65E3C52528D d_g#h
458,267,162 *2E8577214281F57F890C8B12B754CEE3869E6828 dgt%e
458,267,163 *2E844B67D740DF249874CB26B8D446687D758D7A NAIHOUTE4
458,267,164 *2E8CC56947DB71E7A59133D366910835F11FDBBD DIARBMES
458,267,165 *2E80FD178331F9B953980CBF3DBE9736CF165BEA derrickaslinger
458,267,166 *2E841B4011900D8860ADFE6D877CA4EA174F8261 DERRICKSIMERLY
458,267,167 *2E837D0F8D32925003BD44B73FC2FEA578900DE7 derstürmer
458,267,168 *2E8A25EF8ACBA4293953D3F6D0C07CE7DBD2B8CE DICKDRÄHTE
458,267,169 *2E8CE26B6D7DE2D151E17B7837733F87B226A52D des-milliers,-des-millions,-des-milliards
458,267,170 *2E863CFDBC96ED0FC5CD45F602D4E938B073A06B DEVASTEES.
458,267,171 *2E880CB577B7F1C2BD86034AF1D4396C5BA24CCB DILLON.TOUSSIANT
458,267,172 *2E8DC2284BDDF53AF9BC54B0167C4C57283D6558 nauticaabcde
458,267,173 *2E86DEC4318A97C34E781FE95B70A7052ED116AA NAZERNY
458,267,174 *2E8B0A9AB8D917811F8491B670B7F22D5DC5BB44 DINOLYBECKER
458,267,175 *2E88F3184ADF18212ED08A0222C4C23D85FF399B NBLEBBY
458,267,176 *2E8A633A59441772D86FAD3A535EB48AB2405660 bg=7n
458,267,177 *2E8814CEAFDD041FBF216253194D9A3838ED6313 nediskriminace
458,267,178 *2E851191F267B6F0E0CA79706CFC08A3975D5DBF dg,k5
458,267,179 *2E82860C0419CAD9CF0BB3A1F7A17A5FEC465F5E di=yy
458,267,180 *2E822C685E9C1279E6F49196A68C12BD0DDB079B [email protected]
458,267,181 *2E8D12771FBAFEBEFB2CF2D7D6C487AC433E1E6C D?ji
458,267,182 *2E8BA8D8F3745C354A4A3F707C3EBD70FB016F17 nevillemeyerson
458,267,183 *2E8068A5CF094BB7D463A7894349F931A4324CF0 dkrt
458,267,184 *2E869B91A49B416769269F3C1D48B8D4E711B457 dl#z/
458,267,185 *2E80B7402A69203B2263B4B2DC75ACB412796164 DMXPE
458,267,186 *2E89769E7D2FF02C86E31B9628BCFE96FB78E5DE DIR_2
458,267,187 *2E8A47E8CFD6DCDB376B025B6C32E286919D4AE8 [email protected]
458,267,188 *2E8AD5B93678BC0FE180AAF8C4A313E4059C39B1 dirkjohnstad
458,267,189 *2E88CFE57B1B39B49BAD291DB52AA5D29E64FD5C NICOLAS.CERRATO
458,267,190 *2E8B8AC427DD3E47585CC422B57A78A0C4CDAFEE BLAIR.DREIBELBIS
458,267,191 *2E8A50AAADFA7487B0ACE25D1086EBF8E30F8A79 djx/
458,267,192 *2E847297E37E436783FD9298BE2CCFC01ECA8F64 dok:o
458,267,193 *2E8E69EA5266CA0DC5D539CF8DC1F3230A94FD60 BŁAWATKÓW
458,267,194 *2E8402C9DEF62BD46C3A98567094997F39F8E0BA domingomarando
458,267,195 *2E8EFEE30EC54E001CF86D34FBD82895CF651A51 dk;,g
458,267,196 *2E8928505156F622AFE8BEA2B1343550F8700D1D noahzenteno
458,267,197 *2E869C307C066AEDD0BF127712DA848F24300C57 B_?LU
458,267,198 *2E8FBFF0DD1E47C8EF76F20425AE4BD92FB3E635 NOFRIE
458,267,199 *2E899818D1EC0C8100C652281F8571DF5911B991 NOMADIZATIONS
458,267,200 *2E83CBD7728DEAC19CBC5CBB1C027216E7885A84 DONNELL.GLACKEN
458,267,201 *2E85329ADFEBA6090A4A97CA4BAD5DD8BC5F93D9 nonfield2
458,267,202 *2E8652AEB82BF4BAFA0A646CA570342513EF264D NORBERT.CROUTHAMEL
458,267,203 *2E842190D8B0EB37E436F5242184FB1F1B4A4138 DLSE+
458,267,204 *2E8A20AC6F1E4219BFD6E72671598E042B72C9BA DOSAREIS1234
458,267,205 *2E810F48A8695442B9808126D6C7FBE574E92FBF NOTE:THISTEXTISSPLITTEDINTOTWOPARTS.
458,267,206 *2E845CE17F20D5CC0F30B8E492FBBEAD9AF7E70E DP?RF
458,267,207 *2E826FCA266CF788CFA9E4FB13097F237017120B dreckszeug6
458,267,208 *2E8347BDE2F3961F3AA393E82F75BA49EF4316E0 NVLLRNT
458,267,209 *2E80C108BB27EE04F8A8538A5EF06E868B8DA67A nyliy0ou
458,267,210 *2E8B57E685B8EE61972A92A55CFF9DDB35E9A8BF OAQUHPLB37
458,267,211 *2E8C236C2EB78F52A6769EA501DC187D9AB791F3 OBERBERGKIRCHEN
458,267,212 *2E85AA69F796FD61E74F24E7B3C1D63D4B792A92 [email protected]
458,267,213 *2E8B0F9FB5CAF193A2AE474B4FBCD33A2DA9A022 BqsW
458,267,214 *2E840A2E89BC233CDEAE4CAC3898689961B75062 BRADY.BRONAUGH
458,267,215 *2E86482F96A5952838B055664D85AA98753DFD9B BRANDENWHISTLE
458,267,216 *2E8B3496EC0E01615A40C29B6A638A0224F827EE of-the-wide-world-dreaming-on-things-to-come,
458,267,217 *2E85BDA9F50CCAADC8FC07030D5CC6E806DB0BB4 DONNYFRUM
458,267,218 *2E86E9EA03759F082FFB53E90FBA045751ED0866 doodledbookscomwww
458,267,219 *2E8CB0EA0D7E80BFB544FE436C776534D6EFF453 bretjonnson
458,267,220 *2E853ED7F1D325EEA3A7B4EC59A74896128FEB04 old.fogey.vs..whippersnapper
458,267,221 *2E834D4DD7A7BEEBF34224B1D786892E9FF2FB19 dorianborsari
458,267,222 *2E8FBE90707527E2D1280F3B0988B82C03D90354 OMARBERTHOLF
458,267,223 *2E86C26F0E67E30439D7B63F8F94FF2F30C4B4E4 DWAIN.EGNER
458,267,224 *2E88C349EADEF6B60331821052DF72CD08709FD0 dorumazilu
458,267,225 *2E891A2A40C85F4407EAF830A527B303F7A1B5B3 DWIGHT.FERENCE
458,267,226 *2E8C0FF1A6A8A693D3F8ADCC63EBAE490AAA8F3C ONH5KDQTTG4
458,267,227 *2E88054ABB4B84A2A2FD1EE6BCC35C0B59EF2480 DOVEBBE
458,267,228 *2E8A337085EE2BC70876163AA6C4CB99FA7C7237 DwoR
458,267,229 *2E88E78D3EC11E0565706D800147DC96600FE7FE dx2mg
458,267,230 *2E88ED809E61A02A03179D6D457976A86A420E5C dpwr6
458,267,231 *2E82CA2A1A42B716727E0110A411CC58E378560A dqr4i
458,267,232 *2E84B03B4BD67CA70EF54C830CABD2A594782445 OOCTTAC
458,267,233 *2E8300DE50703E0F4EC9FE11AA0750AB9043ED70 BUFORDBOGEN
458,267,234 *2E8000B959EEE0C2F1470E79EC968491711BD793 oöpik
458,267,235 *2E86C2AD54F76F34A0365ADC1C13AF5392D39B9B BUSTED(REVIVALVOL.2-ERICB&RAKIMCOVER)
458,267,236 *2E8239A97F4CB8569272FC1CBE2F03E58AF6DD15 [email protected]
458,267,237 *2E872327086C322255710B241CFBF2B5FD3EAFE5 edbooker
458,267,238 *2E8580CB28312B1ED7F9B6B9391DA51DED041F7D du.lm
458,267,239 *2E827120A9FBDB43C17C86A4B271DAA5AEFE0112 OSTOMEDOLAJ
458,267,240 *2E83DC05648D0B07EF56D7094E2A8DBDFEA1415E otariine5
458,267,241 *2E88FAAA0502EBD07D24A25E06B6894F88804F80 ouley-diallo
458,267,242 *2E8B0DCC0946EF4D6748C1D49AEF6D92DD166919 BZXNM
458,267,243 *2E8C83321FECEF8BA19EB13765B2BCD94B3A921E C0MTZ
458,267,244 *2E82C32B48E5EE1BB6B69638B962F189FCEA666E d&w6$
458,267,245 *2E8816D75D452AAD0283AFF81D2704A0A67C2E0F dw8d3
458,267,246 *2E89238AB194C0382BB94B16EBBB653FF1D4E48D eiugu
458,267,247 *2E816012091C45AA0943822D6FBA62F9DB6BAA92 elcondorpass
458,267,248 *2E854D4FC7458E6CCF98C442D2FA42EB7707FE2E dyg3;
458,267,249 *2E8E56302B637580724A937535747FDD3FE04904 ELKEZDTÜNK
458,267,250 *2E821981CF3991646B343575A1C0F4E0E614B863 ELLAMCMILLAN
458,267,251 *2E879E98A74A6FCF3C150E20F60654D0DE4B468F [email protected]~~
458,267,252 *2E8A87F120BB6BE70D7236DE2C8CC700D6BD1CA5 ELMER.DRAPEAU
458,267,253 *2E836B5A0870AAECE016991CB64072080E9FBE51 ELMO.DZLEDZIC
458,267,254 *2E88625C103784295BFFA730960F97A6CD611DF1 elnecsetcal
458,267,255 *2E86F5C01312B9F13A1F3D4C141FDCE75F643C2E CANEGIRL3
458,267,256 *2E8D91833279E08B7791761474D875B497CB31AE ?=PAAA
458,267,257 *2E86EB10BB34A424861F90EDED795598F6E72D2E dz:oz
458,267,258 *2E8A04794F2F45FFD1F54F791A51943A1EEE39BA PADWENDA
458,267,259 *2E865EC2C7F34F47807463E07190C1DB4AD569AD CARMEN.ZOLTEK
458,267,260 *2E8698C7BF8D5B2CF31356E4FAC56955AB7E40DA E+A,
458,267,261 *2E861019651A008A14F8087EA0F8089348C33695 emmittdonerson
458,267,262 *2E8E4C556C7EA40880C4A06D4799CDE309AEC565 EMPERKJING
458,267,263 *2E8BC5F85440FFE09EB443C3CF115F65AEF3A885 EMST&
458,267,264 *2E8CA619A1041D23316E99F4F028883B8990F19B enitsuak7
458,267,265 *2E8B1753B10A3C58234AA02F1061EB2599BFEB22 eq#dv
458,267,266 *2E88713DAE22632C3A94199B38EEB783F71D5F64 ÈRBǍIBĀSHÍ
458,267,267 *2E827491A0D7B91C2599E1EDCA20D87754D0B97C CASEY.STONER
458,267,268 *2E8008F0D6A3627F0C3BC5D61D560D2B7739AA10 EDGARDOZISK
458,267,269 *2E85044169433BABA318E0B0028FED56CC7D5A43 edlekkored
458,267,270 *2E85F5E1ECC605397602B24B59C1253027765B8A ERIN.PROM
458,267,271 *2E8B71F0989549D0043F522540BC3DCCEAD623F5 erpresste3
458,267,272 *2E80EFC09C751BBD0E3A2DD4438C011800615F23 paulnazaroff
458,267,273 *2E80A5F17DF8D54FC2D320E2703A073C7E0C87FF CBFR4
458,267,274 *2E8F75A7E8B25B5DA050673CED45C59B2AD1B84B p##b~o
458,267,275 *2E879785826E117DC22A35C727507BF932178F62 ESIWREHTO.,0.---
458,267,276 *2E8BD4356DB1F506F4A1768C66E890405DE18F87 eso-esta-bueno
458,267,277 *2E8026BC6034C97B14C7AAE6550406AB901BD082 esou
458,267,278 *2E8C7E337D1908BDD2DCD9CC41305881585AA68E eiopoxym4
458,267,279 *2E8DF71E2E07A8142E925B0F3548576937172051 EIRERDIC5
458,267,280 *2E81A0B094B175A0F1F1550122D7681535DA5249 EISPARTIKELN
458,267,281 *2E819F56453D7D7E9A1176E9CBEA8D75D4A0EA26 ekcsziew5
458,267,282 *2E8E62C7F34F573E8678A0580886AF3F37BDB18E EUNICE LARBI
458,267,283 *2E8ACBFB3BB34AEF37C16E9D0B2BFABE895D2F67 EUOP?
458,267,284 *2E8F5CD6D8D983806C351B0D26E09497EAF8C562 [email protected]
458,267,285 *2E8B51E563A22220F19A196652024997CD4EB28E centralcollegiatehockeylocations
458,267,286 *2E8C8481E8E2323B27ABDFEC1CB4D0BAE63C612D [email protected]
458,267,287 *2E8629C6C0D15C738F32F2F90D1A6436C8BA16D4 elizaville
458,267,288 *2E8C2A59DAC676407D6E0B99912CFEDAABA688F0 EZEQUIEL.PENAFLOR
458,267,289 *2E8D5810E424FF32784B3DC0DF56D88E57F72C23 EZEQUIELTALMAN
458,267,290 *2E88B0855F1B3F25348DE550A635F4412F7AB1C5 piano concerto no 11 in f major, k 413: i allegro
458,267,291 *2E83BC56DB49F7AC91291D902AF1FFDC6A4C09D8 cgw!#
458,267,292 *2E886F6D2457090716F4632E305372F9F0E4136B pilotings0
458,267,293 *2E89F626C8F9BB1B376CFF0B30361DC7FACA9AF6 EM_K
458,267,294 *2E86BA633D0D23A6EF6CD3138712C73A72B1E843 FATIMA-SOLIMAN
458,267,295 *2E876D3A52EF731F2A7FDB0C80FD7E073734DB40 FATÖRZSRONCSOKAT
458,267,296 *2E872AD133F28805F89CEEF3C14BA93E34FDD5A6 PLUS.D'EXCUSES
458,267,297 *2E8CBC85ED76336DC28E0F38E1D9B70D1959AD86 enilerroc
458,267,298 *2E8FA883C5DFE120A7464A21C7CF5787E312D0A5 enjoy.every.moment.with.all.ya.got.
458,267,299 *2E83D750009D84B206A2CCF5C5D07BB4C2A29C44 [email protected]
458,267,300 *2E86D774D704DD828F86442B1312F10342515C01 PO+48!1!+Y
458,267,301 *2E82608B5B4B14B372E1A685BC8E582A834BC451 CHAUNCEY.FREDE
458,267,302 *2E8F44EA330E9AAF1D5F02CDEA6ABDCBD881EA63 [email protected]
458,267,303 *2E8469A94766A9EC86A38501776EF68FCCB85CC1 FERVILHARME123
458,267,304 *2E8924D4F5C1DEAA48282C3BD908AE511A8BF7D8 fetischt4
458,267,305 *2E81183D2742556A01DAF8DA68AD13A12C9EC0CA POM_BLAGOAAKZ
458,267,306 *2E82CEF4965B29B7DA144D125D929B8EB3A169E3 enterr
458,267,307 *2E83964C6C3923AD8380FFACE435040546CF451F FIELDBINDING
458,267,308 *2E88AA366219BE4BABE029853E86E6A67580BE2D FIFTYNI2
458,267,309 *2E87D2857A4ABD1D22B97AEFCD0577D642046423 POPRCHV9
458,267,310 *2E8CFAD127139DA9B09CE443603720FE6F3BEA65 [email protected]
458,267,311 *2E819F3D96BEA0079F94E48FED581D431EAD62F2 [email protected]
458,267,312 *2E8EDABEF1EC2EFC37A84F52F292DDBFFA14A176 [email protected]
458,267,313 *2E87B5C0E59320A0B0ECD26B182760583B49114D PORTERSALANDY
458,267,314 *2E80C6D80FB1F181C68654B8729490C6878D31C0 CHERNYAK
458,267,315 *2E8560C6986C223F326D12364A9A7CAE546154E6 CHET.ERAZMUS
458,267,316 *2E8AB3C833FBA28D7359AC5F35F7D9923CCE3A52 POTRA
458,267,317 *2E84B0563192911172DEFA1E3D4514CD09946043 equilucent.
458,267,318 *2E892D90906C650914BEE2E1EAA367C45C3DD8B9 FLYVEFISK8
458,267,319 *2E8A3595180BF29DD54C1C1F482EF0D01A4D9906 p----P~O.~o.(x)
458,267,320 *2E8D8D8B0D95B63892CCBF4DBE5A5E50093FC98A p------p~splat!!
458,267,321 *2E87487B5E7DF9CFF2DA65F38804AC2446CAA85B PR0HI8ITI0NI$T
458,267,322 *2E81135E8E574B08813A90D80D968F402728FB20 PRE7EN70U5LY
458,267,323 *2E84F8CF6CEAA19219BFB51A2D6A57DC14A82686 FOSTORIACAREY
458,267,324 *2E88BB1B2ACD2F69A3A91D6A4C66B55365C553AB PROMOTIEFEEST6
458,267,325 *2E842D87E3C68A7A0EB3D36F6691559CB5B0FAEB esou
458,267,326 *2E801694B02E47BF09BA1F4D398F3958D31B989F CHT2C
458,267,327 *2E80B723444605BA3AFDCF59CCDD5E40F51A37FF ciau
458,267,328 *2E8780D11275C87F808CD1FDF793FBB282A3B9EA [email protected]
458,267,329 *2E80EB93A6F313C5F99D42E18DC411EE6A8CFD09 cikpp
458,267,330 *2E8804D00B91F72D8A0ACDD01C03882FAAA81DAB futuresm
458,267,331 *2E8B6918DDC00800B3627E0423FE3195D7EB24F1 [email protected]
458,267,332 *2E80B930ADF1019C8CF259CC8E455788531ADE64 cjpnm
458,267,333 *2E809E3A46DC8B9851FBA9EBC20DDC982D4B14B5 gailhaaga
458,267,334 *2E8CDF078302C67682145807A07673F919A7B17C QCONARCHPRES
458,267,335 *2E8F17EB073ECBC563AB300D61F8DE87E5593314 Q---D~ `
458,267,336 *2E8B8DD455D7BCBBB47858BC3A3EC65EFB397212 EVISLUVID4
458,267,337 *2E82F68B236669FCA9DC8F1E7D027B2D089D0F2E GARETH COTTON
458,267,338 *2E8EA2099CB2FD0BF4650902C8CB9E34D4C4ADA4 EWLEAVED7
458,267,339 *2E8D60F700C49C0DC235F0A665919C4A83BA841F claudiorohlman
458,267,340 *2E825E4BC9534C35A183223F010708F4FB3BCB6C QLDNT
458,267,341 *2E8BAD69D20557ED0E31C5AD848F1F5578402790 ey:g+
458,267,342 *2E8DA3B8CC0BD3F15D7E6C28986D51774B463EFF EYNW;
458,267,343 *2E8DB844DA41EFD806A945E40A4E5D4649FF8337 CLIFF.CONNELL
458,267,344 *2E8CAE857C41305626F90BB296B729275468A096 f00f16ff3a5c17738dddad0994dc405b858ef1d3
458,267,345 *2E8434CA65151AE01C27084C882501936110CA5C f}8h
458,267,346 *2E84C5C87192D5403158C6F76CCCC40051585592 r4vfehvb
458,267,347 *2E80992623CF3C86E9D2DEF3AA1E71963FE77728 rainbowway
458,267,348 *2E8187D5F5DE77599781CC5FABA4FF49B8451321 GIACENT
458,267,349 *2E8EE1D648A720C1E08154E0F55E6AD82C0B9489 RANDYMALLERNEE
458,267,350 *2E84B786EE2B5E3C42DBECC7F77E766EFA93483A GIMENNAZI
458,267,351 *2E8ADE77E8E73B6C144CA5CCCE262B0FED3D1E6E FAL
458,267,352 *2E86C4E4EAE57CE65BAF07392C1BC5526994710A [email protected]
458,267,353 *2E8081F58B7F134DCE7B3821E42ECE6CF097C1BF FANSPALT2
458,267,354 *2E887969FDA546EA31892A1EE4774CBB1F696B1D CODY-BARTON
458,267,355 *2E894E16D48AC685FCCE0A052793C2E7C089478A CODY.CHURNER
458,267,356 *2E8D6EA3964D4E5D782CCD2F343B13DD762AC4C4 FAUSTINO.LURVEY
458,267,357 *2E80D894D0554F801A651981AB7163BD123EEAE1 COLDNESS
458,267,358 *2E86B5EA27368A65250CE64D2B170CE5FE470439 F.CHOPIN:LITAUISCHESLIED,OP.74,NO.16
458,267,359 *2E8E9EB73EE39C558086BE3092D138604D03FDAB fd.$
458,267,360 *2E8FCC214BE2E46DDBB25C7ED32A364B4B73C480 COMPROMISE-BASED
458,267,361 *2E8439E9C83C753D3487A6E84A25AB068C586CFB gps.bbs
458,267,362 *2E8D08C8952442E861BB45B8D4212C766D821C5C RECORD-CHRISTINE-MCVIE-GOT-A-HOLD-ON-ME
458,267,363 *2E88A8BA7255D4E616D0FA949610BE19F0AE1F1A redsendit
458,267,364 *2E8E831DC6C7879C9A7D119E2B417C4FA67ECDE1 REFIABLE5
458,267,365 *2E8423E9098D1CD25EAC2D7C56835988AF387C63 COÖRDINAATPERMUTATION
458,267,366 *2E89E55D27CF6A84D3C7CD9062F9CF176B25B408 feverfews0
458,267,367 *2E85D69DDB657845C2CAA00EFA673FECBB3D5F32 COREY.BARTLOW
458,267,368 *2E8E9E3F5C0241D4DA42FA641AA7D89832F76190 [email protected]
458,267,369 *2E881157E41C1E5E63B025E703826EB82CF9B7F6 REGINALD.DENSLEY
458,267,370 *2E8AD0AAD7CCD00AEAE52BB77B03A54C7E2F666C REINFORTIAVA
458,267,371 *2E8C8F18F89CDCBEAF520289D7761429DAD5823D [email protected]
458,267,372 *2E8DF3B2031FC0027ED4FEA489E3F02864E26731 RELOOCREDRIEW
458,267,373 *2E83B8D3DC43ECF50D844D637EF29FCA9CEA34D7 REMYGOLDSTEIN
458,267,374 *2E81C51F3CFB46C6776E46DA8D17FD39F345F454 CORY.MATAMOROS
458,267,375 *2E84D519E4975D9364897CD920C9AFC4F4EEBD51 [email protected]
458,267,376 *2E867BE3C3A7E6E257E44ADADA1E21D3DF84C9B0 guqtnksr12
458,267,377 *2E8118BC0E8C0C45366F0916058954A49D3416BC REOVREVGEW9
458,267,378 *2E847D1927A28D24940950A82A56DF3710797466 courageislikelove;itmusthavehopefornourishment
458,267,379 *2E872D41B59EBA371DEA4B40AE378B5BAC51577F CP;
458,267,380 *2E80982B1A7162F8A5AAD8F7B8778CD35A639F85 C:\PROGRAM FILES\COMMON FILES\ADOBE\COLOR\PROFILES\RECOMMENDED\SRGB COLOR SPACE PROFILE.ICM
458,267,381 *2E86FAD53293C8BD6CDEFD2126CBF1C460632B4A REPOKNETSEEB
458,267,382 *2E824122D12A3FDF6BA4972210C639AC49F48167 RESINLIKES1
458,267,383 *2E879BEB3EDA97C156A1BB2D6F6A1410AC730118 FLIRTER6
458,267,384 *2E8F3BF758BA4F48A996CE0CDA5472B708D92609 FLORENTINO.DIIULIO
458,267,385 *2E8B3EEDC2DE0803E7A012EB5893CF736EA14097 cpwmn
458,267,386 *2E8F71BE436DCD06778057BFD3308DFC1CDBE719 C#Q
458,267,387 *2E813FB0266443776DFFB412A6C4B37969304C32 folkmoods
458,267,388 *2E8F38266C242533EB8B674031EBA6BA4EF7D7D5 forcets
458,267,389 *2E8E646E929ADA063C13FE886A57F1E13B30F01D [email protected]
458,267,390 *2E8147050F51C390F1E4A013F707B5296F82B19D [email protected]
458,267,391 *2E849A09903081526C160707366DE1B3BE5BA6D7 haredale6
458,267,392 *2E8D63EC4A1D53FC88C64BEBC2D7AEDA3B828C6D CRISTOPHERLICK
458,267,393 *2E808AFF91C22FCFB9A9D16C2B4AB5CC1804EDD8 CRR.$
458,267,394 *2E848BAD604725F64EB77F846FD4CFB102DBE7D9 RKNK
458,267,395 *2E8C45F839A134B133CFB3E5D44A4F519677696E rldfbsw6
458,267,396 *2E8DFC6F561C74C76E7112E8E86A6F64D784C4FD HARRISONVENEMA
458,267,397 *2E8AB7AEBE3AF3ECB00C0ACB94AE04A8BA045CD5 fosterjanus
458,267,398 *2E8C1EBFF3B96889AA76C40CA5430D00BC5FDAB2 ROBEREYMARIA
458,267,399 *2E86B78694A1F9358123D95BE4ECE3512398FA52 ctncphls2
458,267,400 *2E84229BDCF18F51502108783B9AFC3A29FEA861 c:u0
458,267,401 *2E83B001CC4BD4E11E89AB7C3E3AE5EF2A31DDF6 rodenfrancisco
458,267,402 *2E88AF069C3DB1E7963DC1E931685BA1CBE502B3 rodrickbarberian
458,267,403 *2E86A9C308363E14FC5000CE9430EBD447F54B5B hcimonok6
458,267,404 *2E8E4E635488F1A75FBAFAA37CA82B3A95A48937 ROLAND.BOLANTE
458,267,405 *2E8743EEA6F38B3DA6216BA27DF9957E2BC58077 roleofhonour
458,267,406 *2E8530ED5A93EEED7C9B291C62E0079F278C7831 RONDVENTENSING
458,267,407 *2E8F684F10931AA8F04084B58789A25B4F6CB0F9 RONNIE.DEMETREE
458,267,408 *2E8193B2161E7BBB3DD815D21C59D71BDE49E09B [email protected]
458,267,409 *2E8D75188BB8C49E40FB7C405EAFBBE21F6BA10D CUVXW
458,267,410 *2E8470F8894B162BA01B64157E5350C1DC7E94F2 cv;/m
458,267,411 *2E8D7485D61D62C47BEE67D855DE37467E2ED1E8 r'}p
458,267,412 *2E84C4640BD272E8592123A6F2D80F50D8E53827 [email protected]
458,267,413 *2E8C11370F30003A77141699561B587DE6CC7D43 RUPERT.BURL
458,267,414 *2E8111D2F1C5D9B582ABBD6BD8907A532ADEDCF8 HERIBERTOCANA
458,267,415 *2E8C991A2A8035B825E86B017010F17C178B3B23 FRUCTIFEROUSNESS
458,267,416 *2E84568A1764BF803E30E0611C307C0D551B9E54 HERTBURN
458,267,417 *2E870B8D3CDFF3B4A577F2B0D64E9EF93E70A6EB [email protected]
458,267,418 *2E824FB45EB5661E0A82B35E911C3DB26B4F8025 HFDKSSNING
458,267,419 *2E873A3BBD767F08402185F0DE41F4C2726280AA FURIOUS.FI
458,267,420 *2E8B0A41009488161BD09FDF332F58E11BBFBBED „HINTERWURTH“
458,267,421 *2E84FA0167CCFA8D64316B79BC225160D85D2A50 RYAN.TOMSHACK
458,267,422 *2E867898151D14551A8528A674A4A79BA15012E6 [email protected]
458,267,423 *2E8C73DB414467604FB2C8803776F2BCFC6A7F34 RZKNP
458,267,424 *2E8CB06AED3DF81DE09C414376682ADCA135BF76 HISTORYYELLOW
458,267,425 *2E8683887EA2C952F850EF60545628117F9F865D GABRIEL.PUTHIYAMADAM
458,267,426 *2E8B26584C49677E4057DF2B26CD56237913EF92 s1s0n88
458,267,427 *2E83E823DD0811F6A4DBCF5A5FEA3A081B7705CB gardanord
458,267,428 *2E8120FAE38AEE1971738A714737D7026A083712 SAFETYFILM
458,267,429 *2E8CB55728109051C62979845DD9074EB33DED45 [email protected]
458,267,430 *2E8CAFD19940167B98EFBC8CCA06DB5B45A9134A D4RKPIKX
458,267,431 *2E87BDAD39CCCCCC662E4B34206A2DC3C50E0FB7 SAINTMARTINDEVALGALGUES
458,267,432 *2E826ABB7DE218D254FB8C66A71390DA05BCC2A1 SALLYANNE
458,267,433 *2E86B7FD0C65C04CE33DA5A2DAC53D517B0D4094 D8PA
458,267,434 *2E8B8F43463A0E2F177B0B3A3BB2D68A328A2E6E Dalek.Empire.IV:.The.Fearless:.Part.2:.Track.2
458,267,435 *2E80CF2D2AFA506E1F44932342CDA7E0C49E4311 saltoun4
458,267,436 *2E8928FE198563D362A0C9858454B0E91E077ACB HTTPDANCESINDOBASE
458,267,437 *2E8B245A58730783C93B338FC4B3B93ED89B7648 httpwwwmcccalicuto
458,267,438 *2E867C45A7AC921542325DD9ED9D61F968CE3458 DANIELCUSUMANO
458,267,439 *2E8D764004ECC5174FDF400AFD7623B0F96544FA GENINEJOHNSON
458,267,440 *2E85F0B26D695BDAB489E219EC72563EC8F61C9D DANILOOUZTS
458,267,441 *2E818A4FED3DBDF80BBF67E379F347EA6EED7AD8 samualstutesman
458,267,442 *2E89B26CB904D63059A897C16886C4747CAC83E4 samuel"
458,267,443 *2E8485C205712D88CEE66A9C1440F42DFB5DAB8A Da-Raw-Shit
458,267,444 *2E8E07E2AB45913487E6F117EC8454752E236FE1 dariomoneymaker
458,267,445 *2E836DD64B26986BBDD548DC38291174F3A7C054 darrellnoell
458,267,446 *2E845CF4EA5242D8396AB77D08A7C2173EB1DD82 SANTEECARAINSTORM
458,267,447 *2E8FE5FA49813A80D4E07E2A753581686411FD66 SANTHOSHCH
458,267,448 *2E8599BEA247FFA5E9AEB3B19A30954C47AAA4A7 hugohovsepian
458,267,449 *2E8BA019CDB8D58841FE2C60166B6879548795AD GIG IN THE SKY
458,267,450 *2E86BBF0D2A035663F97636C46D6D94DEA94C4F2 DARRYL.PRICER
458,267,451 *2E85A51776FC4D41E28C1EC260C05FBE3EF1CABE DARSHDEEP5
458,267,452 *2E869D6E869741FC19B9C1F47F9E1F4513F21DBD HUMBERTOMOTONAGA
458,267,453 *2E857D7A74B6AC98EDEA1BB748C33FA55B760032 hungweissenborn
458,267,454 *2E8B2E096C19185FDC6AFF3802D6C02A7D453822 SASA-DRAGIC
458,267,455 *2E8CC0F099D2611CA73E6E7BFE8AFCA45A6C3693 savingly
458,267,456 *2E84BF9E1EB757FB6B3B464614DC4208BC0CB61C GLASSEPATIENCE
458,267,457 *2E821407381A086F08DF2D0E7972CEEDA273E7A9 hy;t
458,267,458 *2E842B2D6A1ED43F26D16A2189E889E55235DD0F glenscripture
458,267,459 *2E81EE5B62FF7D8E96E12E1B371090180F8D62CC IAMCHRISTY12345
458,267,460 *2E88BB23D0B98DA6BA1B8F3A8BEBCE39D0B7969E SCHEITERBSW3
458,267,461 *2E8E8DBD069796270DFE570121C40A4AB7B0F1EF SCHOOL)。瑞秋·懷茲後來進入
458,267,462 *2E83E471FB15233B955620F2639A84FAC1546966 GNISSOLG2
458,267,463 *2E859E0392E8959B0B7F54A565B82187F64254DB IDADAY
458,267,464 *2E824AD0137B5E7BCCB69D6DA1BBF11D9DE20436 GONELIEA
458,267,465 *2E89F71C5315F0983CF559F5773B0BFE18D8D07B scott-keadle
458,267,466 *2E82D20914468FE67E4B41B20D561ADAC13419C4 ienixet3
458,267,467 *2E896399DFC3680FE771C3EB6672213097472749 DE5MB
458,267,468 *2E864260F87D5BA43FF103C70809F060428D1223 greatwhitedopealbadefacesoklahomacity
458,267,469 *2E8128EA8A31B7878C30528520F58487B5DAF84E GREGGOVARD
458,267,470 *2E80384DF418201142F58C98E8AE0344D9265976 DEBATSELIER
458,267,471 *2E8B5B3E3E1F2B7415A8DF560477871244274224 GROEZIGGING
458,267,472 *2E8254CF50CCD0AE047EA39E8504EB57972CAAAB guadalupegorenberg
458,267,473 *2E88ABA26B1898D9FD683A639462EE18DC7BAD15 GUERWIN4
458,267,474 *2E844B708F15EA15EC54C6E4D0662B5FEB90985F guezsan.pedro.bezares
458,267,475 *2E8B3E4641F87FEC25D4055794FF98B5273E776B selfestablishing
458,267,476 *2E8C82EF7EB3F39A730E3FDFDD6C21CF02BE3C81 guinnessfrancis
458,267,477 *2E8F13ED05573C1CF8DC2B665620DF734DCB013C [email protected]:AA
458,267,478 *2E8212125E9D7E1AB53134BC5D3BC9267A9E7F7E ILUVFRIDAY8
458,267,479 *2E8A2948DF89BF65528891CFC29BF3B61715DF8C [email protected]
458,267,480 *2E847F519A64AD493BA9A8E3899C87F068593CE8 IMPLEMENTIEREN.
458,267,481 *2E86954F435F464ADA123DBB44F0FF0A5105FC4C [email protected]
458,267,482 *2E80CA9A1347EDDE45E8B02CC359C4DE21851354 INDIGENOUSANGEL
458,267,483 *2E8982D2FF26865FD124C95ECCC31BDC141ABD14 [email protected]
458,267,484 *2E86642DEC72ACFE042AB883DC6FB7D835D7DED8 DENVERGERALDS
458,267,485 *2E8CD07DDC1DE394FE14DADF93B88C88E7BE3098 SHARPTIES
458,267,486 *2E8939AA75A78A08143CCEC4D4F1BD2F47B8BA72 SHAUNBABULA
458,267,487 *2E8363AE9B51F6C38DAE95E07581F2B523F0DE17 derickmartiez
458,267,488 *2E8FAFA160450E88750D2C9CAA07987739252AF3 dermatorrhoea7
458,267,489 *2E816FE41415F3F09FCF0E477D733812C7733FE8 INSCHRIJVER
458,267,490 *2E85E77AD44B70AC2F228B1290FA53723C715B56 INSTRUIR4MOS
458,267,491 *2E8DB1892296DAC5F2DA1F9EF3B80470B775D188 [email protected]"
458,267,492 *2E8F95AD070A761D1F6CBFBE0C3B848D13893CDB [email protected]
458,267,493 *2E8243AB730479A82BEF3BFA81DD92F425B4D8C8 HEIMDALSHAVE
458,267,494 *2E847E361016C3FDE9659B5B6C0E0A1BA95CF7A2 despej
458,267,495 *2E8DFCED23F52C89937E420B8090AD8A8343F412 HENDRORIZKI
458,267,496 *2E83D0887E2D41C1D28805346457C9A088971745 isarret5
458,267,497 *2E8787D7E4567C8F8F1C7F7F494FE67FB4FF4551 SIDERATI5
458,267,498 *2E8DAA9D99E09DA6EFB77ECA6B087FBEF79CD57B DEVONGRUMAN
458,267,499 *2E86A424F73D872E99DF645EB6556A587244B1B2 DEWEY.BAROLDY
458,267,500 *2E8E9DCBDE7D4EC63FEE2B19B186C427AD64C8AF [email protected]
458,267,501 *2E822E4BCEB74A87C1BC252FE6A04D553201C6EE hif:
458,267,502 *2E84E5AB527A34D5B340BAAA48090979D21A2ACB HILTONGARZONE
458,267,503 *2E8AEDEE5C92C9EF065AFB7FBAF3F64EE605E37C SIGJNERES4
458,267,504 *2E8AB7D4DCBC3C4648049B6EB1212ED68CF33C26 HIMEKAWAEKI
458,267,505 *2E892BECE8F8DA7821321B52EF43ECCBBB2A386D HINDUSTANI.4
458,267,506 *2E89D908DE56A9C3ABEE3779344941A5CF9DE3CE [email protected]
458,267,507 *2E812C39771FADA06B8B20DE069998BCA35570CA SIVGUR
458,267,508 *2E87E5257A507AA45A5EE2BDC523C729487EB011 [email protected]
458,267,509 *2E88A5D800701D1AE420FAA008A0A35F644958FF «HORACIO
458,267,510 *2E8B258CE1BCA9196F6DAB2244D9B7A8FBD8652F housemate
458,267,511 *2E836CADEB4514B6710A3D1B8B21947D0C048C68 HTTPWWW.YOUNGHRT.COM
458,267,512 *2E886EDD79B6E2AB3AD873B10450FE61EF822112 [email protected]
458,267,513 *2E84B6971F1B35A7DB2D3CBF75F14CAB2437E835 IURIEVPOLSKY
458,267,514 *2E8605140E8328E2EE0D4D4578676DD9D7249934 HUGO.CHRISTIAN
458,267,515 *2E809460B49C04FBF05CABD5CC6D608AB4C69DB9 hugoderks
458,267,516 *2E8FA59F1DCB8FB569E8A8D1C0776F3DE8BC2D20 hugopurcell
458,267,517 *2E85FEA29BC5098161BFBB0576838B39C472B159 I.XA
458,267,518 *2E8120071DDB70E1D502252EAB2F9E60B7AC1E1A HUNKYASH01
458,267,519 *2E8CE0F889F526D674FDE7ACB8103705C25D1118 [email protected]
458,267,520 *2E87EF7B6999F3F924668303E9D4F0310B653F84 JACKIEMITTOO&WINSTONWRIGHT
458,267,521 *2E8F69A7CF347DACF5B6DAAD2EA4EC984F8E4B1F D=GU%
458,267,522 *2E8DEA01F3BC565379E6D44B4DE669D1384E1917 SMHANDLERENS5
458,267,523 *2E816384A4E1DF06AC087464A9C4149B183C0034 [email protected]
458,267,524 *2E8533298398C4FF1C2FEEEB8FAA6869ACC8BB4F JAKESINCOCK
458,267,525 *2E816076C499503F60E3E286F2BDC21824EAF30C DHMA2
458,267,526 *2E88B52566CEEE695B7292CBD03C2483DC44E72B iammaryjane48
458,267,527 *2E85DAB4E59465C0BB41AFD64530E23B5BCE2CA8 ianfauble
458,267,528 *2E8D9186BBE080FA24DF9483785B5F9B19C36452 DIFFRACTION.SPECTRUM
458,267,529 *2E878A935D29E2A48EB6D8D112BA2096913A9054 ibqgarnika
458,267,530 *2E8656189050E7116440C01C74432EE977C63F23 [email protected]
458,267,531 *2E8E9805E84246D391CCBB89D67CA86A3A71C5BB JAYTOMY93
458,267,532 *2E8365D9C8884B6E3AE3B8945F37DB83ADA20193 JC-Moreno
458,267,533 *2E832C258B52222139019B5590FA74C8D0FC8182 JEAN-ALMAZAN
458,267,534 *2E8FB7947619355744A4C7D8C404B9F24053B9CB somebody-knows-how-you-feel-(vrs-remix)
458,267,535 *2E8BEF3943C9B1B61842CE6678F56FEF80247A83 ilovesurfer86
458,267,536 *2E8F7E0144452A4988D13133D68E568C846DCDC5 sorry for nothing
458,267,537 *2E89B80EAC7FA6238FC782A69B25D4DCAFCDAA2D SOTILIZAR
458,267,538 *2E82533E9D9CFA3B74FF227D8A3D6F492D436E80 d)k+n
458,267,539 *2E836236C348F97ED601F4E2B9F8E0E4D1B8C219 DM?H
458,267,540 *2E85D2382CC0D091111495C449F21FDF9704EC0B dmomrev5
458,267,541 *2E80235F604ECE4C893B0F2D3A4D54FAB70F31D6 dnqbl
458,267,542 *2E8BFB4AD7C2EB24BAAF1D6B2C6BDB9E9D2FA9C0 imminents
458,267,543 *2E815A43B756C1B9FE6D5B73593E8487F929D46A INC1INAB1
458,267,544 *2E8E1EBA6F8CE0D56AAE3209B71F628213124D8F DOMENICNEALLY
458,267,545 *2E81132308B105EE4988F2AE6386F35D86D0E9CC DOMINIQUERIGGENS
458,267,546 *2E82CF2EE368876AEB3A72F23952ACE94D19D22F [email protected]
458,267,547 *2E82F9F99AE4852C8FEECED10DE73A0B796BACAE [email protected]
458,267,548 *2E81FCDE2489F96D577AA3A6D79FF0E82DC7C4B1 inggapo
458,267,549 *2E88C3EC6C58C4D81D1E5B454DB674F92BD4BCE4 DONN.MAHRENHOLZ
458,267,550 *2E8191B1C59F2A1773CE1654FF5D46D7E656A4C4 SSENDETADOMMOCCANU
458,267,551 *2E8D47477A919466E1531D629A68C14FB2D63CA7 josephzaitlin
458,267,552 *2E8F75F917DA39B7879D2F88AACFE2E4D4D62B9A stadio.mobile
458,267,553 *2E8ADA0858BD6BDA1132AD99D921B956CDC274E2 joshmazzocco
458,267,554 *2E8E7896494AAB00CA3774BCE6F398949625C60D JOSHUAROLFF
458,267,555 *2E882823844A17838D040C356342E353D2EBB882 DOUBTTHE
458,267,556 *2E8F28E37E6160C0389874ECAB401BA65F52FA2C JUHRVUEN
458,267,557 *2E8913ED8FC4FB2DA7FEE3DC7FCE146898A17F33 d/?p
458,267,558 *2E8A6723D42A17EC65980A5B766224D2F0B70A0D ~k!a
458,267,559 *2E87A36CFD55809A7D82EABE91135C0A064FD26C ISAIAH.SENECA
458,267,560 *2E8D602B9A3DE136F46E9C600BAA422D5A652602 ISAIASHOULE
458,267,561 *2E84C82FB17F203BA45B6625BAF9A0ABBB48D03D ISIAHSPILLANE
458,267,562 *2E8BA45DAB5975315A672FB6885DCF0DCE91CF50 ISIDROJESUS
458,267,563 *2E8FC0895D062B73C65BB963849E3E8473B565EB IŠJODYTI
458,267,564 *2E8006707526561286FE1AC7F6DCA7131C791B37 ISRAEL.NOA
458,267,565 *2E8DC0AA390F7A3089CEF5B1F2F4B202D75D9624 drewdanielross
458,267,566 *2E8CC31B94DE4A8DB5D2D5419941BF640DE2467F ISREAL.HELGAGER
458,267,567 *2E867961E797C30A7BBED0AE6C45C752537DBC36 isrealvichi
458,267,568 *2E883405D9693BC62484655444AF77BCFF34F1F4 Drfriend
458,267,569 *2E8D4ECB190B22072DE56C88ED9018E3E0D725BA ISURIUMING
458,267,570 *2E84CCDD989F1AEED79EE89784154026F4F5F3E7 drnru
458,267,571 *2E89B894B2D76C9D28AA80B5FC095F980F87E73A KATE ROYCE
458,267,572 *2E84152F49D7F45AD2C047AE9EEC10342C0B2CFF Dru1
458,267,573 *2E800D2F202D308327BF4E11C375D517225EAB00 STREET SMART (B)
458,267,574 *2E8027C92E72BB81CC0932E2FD241D1F563B4433 ds.:;
458,267,575 *2E8A86C40E7AF95784DAFFFE31211F887D3BE0CD KCWI
458,267,576 *2E8767220BFC890E781D71C4D306D09C21244A01 d%%.t
458,267,577 *2E883744E68BF097DB7DEC2EFBD5D95C3367E9C4 [email protected]
458,267,578 *2E8B4E17C4CAE2FC721233922A200F16B9319865 JACKYLYN LOPEZ
458,267,579 *2E8393A615B9EAFF17C60FE65A984AE00D3769A0 KENNETH.ARIZOLA
458,267,580 *2E8D369CF5071414199B3DD0BE8FA079808D6466 JAJAJJAJJA
458,267,581 *2E8394CD3D5AF748F081C87009DB06A9A48A784A dudb8
458,267,582 *2E84F2BFA0A039F0CBCD6770E27A4403D803DFAC JAMAR.TANKERSLY
458,267,583 *2E85D0155313EEFA88EBD0A3B32199FAAC0C1364 DUSTYAW
458,267,584 *2E8D287046AD8E28C1FA1555CF0586489668EA3E KEVINKREISBERG
458,267,585 *2E892BCA4D3D2176596B4640BCA4E315206DF699 DUSTYOREILLY
458,267,586 *2E86E910343BABFDC92BB2BBBD80B06550F7C37B KHALOUNI(CLAUDECHALLE&STEEVEREMIX)
458,267,587 *2E87E0E373904B4A7EF0351A4C745191655E7AAC superse0
458,267,588 *2E847865B63B5317CA156ED3B781F864082FC0AE jarodsakuma
458,267,589 *2E8792EBF867AD2CE93984F4AEE28AA99FCAA5D1 dw9fa
458,267,590 *2E82EAE522B48261300AC1739412624FC7D9C04E kingdemo6
458,267,591 *2E8475949E91A7BA6A80A608C0EB64DAD58A41AA kirchengesetzentwürfe
458,267,592 *2E83D0D07695A6F6D33E5F03033B2A2AB96C3F14 kirstenramsay
458,267,593 *2E83F0FA3705CD1D938BBEB193FD92FAFA65C01B JASON.KOZAK
458,267,594 *2E87EDE97CC6EAF7E3EC9DC40107FF883DCB13DD sylvisorex.konganensis
458,267,595 *2E8553B9826D79107C2034DAC645380181C028B5 SYMBO1ZN9
458,267,596 *2E8A86308D9F0258063BC31F1B7FCAD9FEE6708B DYLAN.WHITON
458,267,597 *2E8F3F7FADE36E787F19A79033436156FF5F27EC KOEBMANDING
458,267,598 *2E82803422E048A705E7F44DCE6C2FA56DF144A2 komm,kommweihnachtsmann
458,267,599 *2E8972053D8CD41F665A9615D0D635998224E647 t932ys4xldg3kg
458,267,600 *2E8EFFA8D3C9FE6CACA4082363155D3FD3BE0AA7 jedanse1
458,267,601 *2E8E891E9013C0E791623E5923987D73AB115A54 EAO_
458,267,602 *2E83056986AE4C5B28DBB614D7FB174249B05E0B EA#v
458,267,603 *2E895BD246D7568FBBFB37FDB8910C87A7B4EF6B EBMITWAS
458,267,604 *2E81F208493BFAD0C8C12202EA6C114D1B8CD3CF KULIUCHIN
458,267,605 *2E8255641A356B4EB1530D5E1574EDE8FC346F83 ECECD
458,267,606 *2E890A86CF1FCF38321F18BE2C2775E7E6D344A1 edlebafe3
458,267,607 *2E867397C4FC724E37862754E77293C84BA01B98 KYLEHIESERICH
458,267,608 *2E8DD8850BE9EACCC30C3DF208F36D121DDB6C05 edpewfsidu
458,267,609 *2E84DA64D7E2C7AF8EFF6F782524279C24D94187 J-FUNK.RADIO.(JBS.PLAY.JBS)
458,267,610 *2E8C5D3864D8E50D512459764CA62D84FEDFD9EC TATHESIS
458,267,611 *2E8EAE9FBC2E102F4E825A982BF81C8DD304F0ED tatyana.okatch
458,267,612 *2E8C2545E4DB390D8AE226D3492FE318C20ED8E6 JIMBOBKEITH
458,267,613 *2E82CD63544A9BF4AB49EE4842A75875FD7F0606 effacing
458,267,614 *2E8596CFFE1184AEFCEF1E9057745645C23233DB LAMERDARWIN
458,267,615 *2E8D331B6B2ED04FFF20853201812632FCB85DDF laska necestuj tym vlakom
458,267,616 *2E84F52C3D06EA335D9761E309DE8DFC6ABBB189 LAURENCE.SWEARINGEN
458,267,617 *2E881F314CEA2BAFBF944A5E7D7015C90EF7AF54 LAVERNGANJA
458,267,618 *2E87F05471E3C9BA6E7BA3A1BEF5C0182447FEC8 TEL’TAK
458,267,619 *2E8EF2FDC524D5913F61757C074CCB25C229CF07 JOHNATHAN.BILLIET
458,267,620 *2E84047F0BF0D647857EBBA9DD6AB26B40845752 LAWRENCE.GONYO
458,267,621 *2E87958112A6EBF9CB3466D63AB881214692807C lazarobruffee
458,267,622 *2E897515F96890EAB69BDF51767DD2AAB0B65FFA lazdijaj
458,267,623 *2E8BF3D99ED69FBCBC2A4684A5329BBC66FD6D89 JOHNYJACK
458,267,624 *2E808306A9E3D6C560D8A6A19BB4ED157C1DDFCD eksnemuring
458,267,625 *2E8BC608489EE9C45872DA0C8CA242DC2E673193 JONATHANSTRATE
458,267,626 *2E82AAE91741E786D3CFC5251051A8CF846161AF TERŜUTAĴO
458,267,627 *2E8166CC2865AC1DA04BDA679A75D145E37A453E ELCIHEV-DENODNABA-------A719
458,267,628 *2E8A6B61EA585E166ECB097950532C6FF9FCEB74 TEVREDENSTE1
458,267,629 *2E819549B167F50D034938AA0131E990839EEDCB el-empresario-de-pompas-f
458,267,630 *2E8561F73D15307BC09FDE95CAA881E58F8AFBDF elenusik
458,267,631 *2E8C422D0EAB227BCC5CE6D3F46EF37E80560520 JOSEFLASURE
458,267,632 *2E894029DFBFFB63D25DAC8894655870FAD2E784 THANKS.DBOY
458,267,633 *2E8D767D327DA3ACD8969EE4B39EA5F7B86A9DF3 JOSUEHOKANSON
458,267,634 *2E859229C7FFD2858448D7FD38D2084AE91C89CB LEOPARDIERENDE
458,267,635 *2E8A36ADFD664B82400F42C3B13D0F4D13174181 JUDENLIEDES
458,267,636 *2E886181DCC773AB2AEAC59469DB8254D7687DD3 TheBestofBillyJKramer
458,267,637 *2E8FE61E41A8798317DEC091AFB9F69B7CB0516E Les-sonates-pour-piano-(feat.-piano:-Yves-Nat)-(disc-2)
458,267,638 *2E89A6F8079AB91FDCFA9619DA7202E12AC184F7 ELTONGOODLET
458,267,639 *2E875296980FA26EB8F9B69952F9DA2888C159AD THE-DEEP-RED-CONNECTION
458,267,640 *2E81DDC63985F14A3B5848A3C6000C59B60802F8 LET'S-SWING-IT
458,267,641 *2E8F1863B678119878CA25216A9C0765CBBFBA4F liebesromanen
458,267,642 *2E89CF8A69C31364E5D97ED3B8DC8542BF4C787A JUUDOUBU4
458,267,643 *2E8F2839C5BA9E074B5938CC3EFC534326570714 k6(h
458,267,644 *2E86B5BEF4E8B1C57FFB1B9890FD3C5CF7FD063A EMMETTVAIKO
458,267,645 *2E85694098983B22975DABF852415CF343186515 LIMINESS
458,267,646 *2E8E43ACD4C30804FD861A89042D14B2EFE20866 KANDIDATURVORSCHLAG
458,267,647 *2E85DC6E8DC701980594093F46B18E5E0236FA3F ENFERMEREZ3
458,267,648 *2E83D42D95D1E287C742F93E5EBCA63FA4404450 LIONELYUNDT
458,267,649 *2E80FD17C2C9941167E193B342608F26D6674554 lisa.cowey
458,267,650 *2E828DFC85415D2010D09D24A4D63A801E3783E4 THETAXB
458,267,651 *2E8DEFA7CAED2AAB170FC998D620F0597769E9D0 thingscell
458,267,652 *2E89240D7FCE3C47A410B3FD94FAC24C9BADCFC8 ENXBR
458,267,653 *2E8101851DDA732334F358F2AB99480918C04CF1 keksitt4
458,267,654 *2E8DC212E25610CC7BC20676BD7273227FC34738 LLZEBB
458,267,655 *2E81F93F35D6E008873375062C65919E53497181 TIAGOTEOTÓNIO
458,267,656 *2E8C20913E9B16CDEF370C2A0F3A8D574BD97A46 LOGANPALASIK
458,267,657 *2E8D1E653FBF81ABFCB4F99A91B0ED002C0D2854 [email protected]
458,267,658 *2E83938A0A66B12567893DB5C46382165DCEA577 [email protected]
458,267,659 *2E82ADF7CD7D66502CD0315314AECF67509D8808 KENNETH.BUECKERS
458,267,660 *2E88D0868EB0C35C6CF4C81F951FA2BD782BDCE3 KENNETHFAZZI
458,267,661 *2E8C41C21561DD66FCA9AFB4E7239F3A1D6C08C0 TIENKEN5
458,267,662 *2E844F81DCF46374822AE3CB0490114652A8AC7F ERGATANDROMORPHICING
458,267,663 *2E8B13757AB87646C29E244ECAC3A200F5227A9D ERICK.CAPUANO
458,267,664 *2E83662A94E683F198F168659F41FCE9A4CEA8A7 LOUNGE O SOUND
458,267,665 *2E8C54F55FECD99DE424740BD8A127F6C14A07C5 ERNOCORNUTINA
458,267,666 *2E841DC4DA5DCD024DB6FE882E12D6CEC3B7E135 LT4LERN
458,267,667 *2E83D74EC38FED9F5DCB698D307E756743C66ACD esidallabbing
458,267,668 *2E8A5B892DD1ECE9248A5A01DFEB4D863F90119A TOBIAS.LASWELL
458,267,669 *2E8EF43F06B82A7FED2E9FDE264F36E499139DBE ESOJACAM
458,267,670 *2E838472301965F1B6A941AC7421D6A077DA125A KIRK.BODRICK
458,267,671 *2E88E357397410531DCAFDB9015DAEBD1B4BD30A essvg
458,267,672 *2E86A439B13837ACF28F189717EB35A5EBDDA9C3 luis.a.arroyo
458,267,673 *2E822790E8808D66DC6E7CAA2ACA6769B5893E8E KLAUDTMEMORIAL
458,267,674 *2E887A675EF7FA0B9B85990DFC3A51AD8967E287 [email protected]
458,267,675 *2E8A6E37112EDE2F1C5B28F5300FB075356B7E2D LUKEGUTKIN
458,267,676 *2E8DEEE238BEECE5CA8056E83DBB302DC2ADEAD9 KLUPPELDEN
458,267,677 *2E83A4BF2FB58D3966FF5EBCDF322EF60F7B6BF8 ethylxanthate
458,267,678 *2E8CFD69F046DBBC65EE41FDF09152311DD59D9A eu4
458,267,679 *2E8888D5324F9B47494D2124DF049F89A4329C7F LU-RADIO-BAHIA-BLANCA
458,267,680 *2E8899BAA4AB05E72D5467097469C7A96C7DABDB EUNINGENS
458,267,681 *2E8FEA0B30CE9AA614751DFF5820499737748048 eusebioswaynos
458,267,682 *2E8AFA72FBA1C0E8D333F63B9DEFC846545133E0 EUSEBIO.ZIEDAN
458,267,683 *2E84190F09DF8EE0AA41966EE9C0BCC4B14C003F EVAEK
458,267,684 *2E86B48DE3076A6ED493A7E146770B64294BB1E1 EVERETTAKRIDGE
458,267,685 *2E88698C7F679F38F6AD731CD553FE573FAD954F EveryoneLikesMe
458,267,686 *2E8899FA8E1B479F402756C3CBEE9122EFAC6210 transkooteney
458,267,687 *2E8DCB8CA2496EFEEABB70E9E5C179E0D704C342 M13D3
458,267,688 *2E87034BAEEA64A7067510B4A06F8E9BCCEFC6A1 m1crod1$$ect1on
458,267,689 *2E8C4D38A5BC81538F9F25791BCFDAF05C2E25C7 EXCEPTONS
458,267,690 *2E86B02A9B8ED9B16B8925F3134D7980E949D675 EXPERIMENTAREI
458,267,691 *2E84C6FCFAFCC53BCE1343DA306D363943EF8267 trawbeaga
458,267,692 *2E8FECE30EE465068854341D8DDF890DFBA8E11F Madison-Prep
458,267,693 *2E8BF7B488346268EFCEC6DBE152536B29213CAB TREIBGURT
458,267,694 *2E8252019D7BCF710B34607C6EEF342270FD82E9 eyufm
458,267,695 *2E852956FFA57ED130659FB33AB6B30E3DA68889 EZITAMGE9
458,267,696 *2E8EEAD2E06F5901815C9C2AF6C0A755033ED643 Eが設定された。ガソリンエンジンは当初、全て「平成12年度排出ガス基準25
458,267,697 *2E81AAC442B3B3127B1E2CE0EE819D3C6EE27BD6 KRISTIBONNIE
458,267,698 *2E80CEA1B2FE81DB4D38C7F3285FEE19FABD5B2A FAAN“
458,267,699 *2E8D1E4C03362834C02178C030A949D5B478D896 manarat2
458,267,700 *2E8F7C4ABB817BEB6CDB1ADB90057E751BC8C8ED MARCELLINA.
458,267,701 *2E8D1675496C7CBC1C63057052C3210699C79885 FÅRSPIL
458,267,702 *2E88ACF1B015599F8146D4CEF33D8D820FCF5CA6 TRUSTBANKBSWED
458,267,703 *2E8E5D2F6556D0D32180B11C0E5B948928FC4296 fcss
458,267,704 *2E89234C1B1BC5DA66C1EC7CCB0B027597CF5C53 TSMLEVS3
458,267,705 *2E84347947CB758BDD31902325065DB39EC39F44 FELIPEDEBRITA
458,267,706 *2E8EBF0E9439836015CBA19D5075ED624CF43F8C marivic-arciaga
458,267,707 *2E8ECC54A58ED1FC4523C88D686DEC7F220B68E1 TTPOKER
458,267,708 *2E845483E70D612E65F111ACCF7DE6A329F7A8BD MARKKINAPAIKOIKSI
458,267,709 *2E84C32851C3204266845D205894E8F551BF0CEB FERMIN.HANNIBAL
458,267,710 *2E804DF5CEFA514016E4495C26D610EA16C520CB TURLEYKFOURY4
458,267,711 *2E86205730FC1FB2714AE72B8F6E455826C04BB4 !FESCUE
458,267,712 *2E81369842D703902B365F0977FB77C7FD539867 FFEB
458,267,713 *2E81ABE6DB406B343C2F11D8FA61C259B183AEE8 Twists-and-Turns-(Robert-Edwin-Clubfoot-remix)
458,267,714 *2E831EF5A6AC75B50184E8C710538311FE7C4F28 maru_andreescu
458,267,715 *2E8A354B6F057B798D58A08B8F182D4C6B676819 TYLOR-JANS
458,267,716 *2E8E780731DB7DA26087FE90A3EE1118D4B8CAD7 fireworksky
458,267,717 *2E85BD0E80660377E893C762F65360A34D6EE27A tzimmas7
458,267,718 *2E81A66FB116FB5E965A6588074F6F7DA213B655 flipnote's
458,267,719 *2E844F2ACB6CE3AB6A9BAC5F303A9B4012396E3D MASONDETERS
458,267,720 *2E87FEFE3EDB60176D59664077371CDC1AC86190 FLORENTINO.WEDMAN
458,267,721 *2E86EC1C82A9BB16A88B953CACA67EB848B71850 UITGELIKT?
458,267,722 *2E891CE0F98D53E85E9B13C0FB8406E3545E299C UMUTONILYNETTE
458,267,723 *2E856E997BF55070C7A0C98A25C7F69B0C72D2F7 UMWALZENDEN
458,267,724 *2E8236B3A5C5899C9324D67BA22BE035FCB5E3C4