List database


# MySQL hash MySQL password
390,320,001 *27412E51DFAD75D4F40447DF53017B926C723675 [email protected]
390,320,002 *274C1A7C304246EEC3075E901E9EBCBC6D76767A SUONOITS7
390,320,003 *274EE7ACEF26EBD7AEE8A8B90B8362B93643E6D8 SUPERLATIEVES0
390,320,004 *27408118D73BC84C2B5F2B82FBE2C6F3FEB1805E xems
390,320,005 *274B400D4F545EA8DA67BED430F67D4E4267DC85 xlola.bunnyx
390,320,006 *274CD14D445A5018BB29374303BE00268C94F7EA (x) o~O~<B
390,320,007 *2749A1B93EB0D384C510BCAB0150D51D68F28837 Symphony,-No-40-in-G-minor,-KV-550:-Andante-con-moto
390,320,008 *27433DFDE07244BCB8EFEF011F91C529D3FDA733 SZAKAKIBA
390,320,009 *2743B32987E8FEFE698E2D5C236D1E2E5C5BA33F YALEBSW7
390,320,010 *274B36D4C3575A69C1464737D205A677C97BA431 [email protected]
390,320,011 *27431DE7FD0FEE3DB164A074607AFA7464514283 TALENTSMARTCOMWWW
390,320,012 *274F57DECC9314085BF5A74C40A8681CAF5AECD5 yawper
390,320,013 *2746BC6CC34FF5BFE9A36977B664E17C3F8CFF01 tamburlaine1
390,320,014 *2744706FF1A62E0D3B456EC28A088729CF81CB06 taniyashaikh
390,320,015 *2741E1C33115A17C6E0A02ECF21E00E4FBFF3436 yllwshnk1
390,320,016 *2742E36FFD8A5CA1744C2ED09CFDB7B6D950004C YOH.TAISHO
390,320,017 *274D5015D1C012FC5B3D57AEC52052C5D1FB99F5 YOKATTAN
390,320,018 *27464AE03478C097896B47D482ADE096FACB1F0B YOUNGMCCLURE
390,320,019 *274517382E267643FFF6936EA7189EC768B6FD69 you'retheman,part1
390,320,020 *2743E34291D8A61C8DF8B400BF256DCE7C68B768 YVOUNGERW
390,320,021 *2744AD29F461A1AD49A478E92E66FA247A3E88A7 YXESGFDSA
390,320,022 *274512870028B2D5DBA94C5147167DBF30289322 THANHKETCHEM
390,320,023 *27420A8DB747FB87D6E7F7033178038E07C47B88 ZACK.TEED
390,320,024 *2749473BACC4178358DA9878970648613FF88FF5 ZACK-TOUJOURS
390,320,025 *2749C5F130B0F42A6F4B605A3B974A71221274C3 thatizzy2008
390,320,026 *2740BE0B6353B624DC2A8FB174E4F62320AA5F91 TheDistortedworld-LeadtospinoffL
390,320,027 *2741C83A773F6FB0C7E9F0DC8184AE469217348D thehappiestdays
390,320,028 *2740C9B414C4FCC41A0677D0FB8D60B868484413 thesigmachi26
390,320,029 *274475802F648311BABF3ABD97EEE17D92BF9CD5 TIMRÃ¥
390,320,030 *2744098983E68929503B2A0D552D2E309CC489EA TINSYAJY0
390,320,031 *27411314D52C8B0933F41ECAD4443F714D99C3CD TIPODEAN0
390,320,032 *274DE7CED22222FE8909DC6B9F90BC833EC2B912 [email protected]
390,320,033 *2744045CAD12949DE433DD4CECEC67AB92270376 T?MX
390,320,034 *274BBE2DDA798EB246090C5BAAF7A9F2A347C2D3 TOBYPACKARDS
390,320,035 *274DFE585300A56F0BD000D411FA268BB123AC7F ΣΙΡΌΝΑ
390,320,036 *2741965D320D535F8C0A9626970CC5C2BB94B8AC toddverdier
390,320,037 *274FABEE9B9D422BE5DFEEB648ABEC390B18220A todrisha
390,320,038 *274611D331E3547363A7F71AE27241692841EEA3 toiles,i/51:iiicequiest
390,320,039 *2745F0427621E90B37A9161A427A1E375BD2DA45 TONIGHTSHIGHLIGHTS
390,320,040 *274F2CE5E8375B0BB8F25835B5B19CCF2A50B605 TORCHETSES
390,320,041 *274BE6773F8E4F361A0D4FA68BCAD10EF77440DB ЗАПРЕТНО
390,320,042 *2741ABE96AB76334EF51105F4212A83BC799423A ІКСІОН
390,320,043 *274C319BE70F2112C2B537EDA67190E8815E83DA КЊИЖEВНИЦИ
390,320,044 *274E21D4798CD0D303920F2207466CE3D1C23384 TRAVESEARESED
390,320,045 *274CA2C2D94AA13BE6EED94E1FBEBE970E118967 назарбекову
390,320,046 *27483D1B0FD7B2A99305A072E7C04D035DE90E29 TROYSPACKMAN
390,320,047 *274878B162FAD5D5CDE5D6951B20C853BABA01F1 tur4nism
390,320,048 *2740258B0B7AB53DAF33E5B4AAD1FD83FA39B050 TÜSSER
390,320,049 *274FC7684F5978FF3461C67EF80FF2AE69BBFA9F UEBERSCHULDETER2
390,320,050 *2740F2646D3BB1048BD14AD26337D2BCEB1D75D7 U>G]
390,320,051 *2741B6625448496D0C4E6EA16FB8EDA371741681 ulimuth
390,320,052 *2745E5602AFC1B852A4DE6F9F88F745DFB2E665C [email protected]
390,320,053 *2743DD07718BFFC793DCE7BB9D3DF0B99732F0D8 UN1FORM17135
390,320,054 *274C1697C20687824C724A74F60A1220F7CF47E1 UTUH.GANTENG
390,320,055 *274F9EC9BE82D797910A0C5E6079922CF7697580 valentinduckworth
390,320,056 *2742BF3963DEEB9BB51E2FA8D61A24B264B7FB0A VALENTINEHEIDEMA
390,320,057 *274764156166D454A2EB9454040E87E7A90DA2F6 valerieheitmannskoglund
390,320,058 *2745B39EC69033F7277F8C33D171DAFF234E970B VANDERHEYDN1
390,320,059 *27404D15D45B5F341F7CF8C8B1ECA7DDE56AA963 VASKEKJELLEREN
390,320,060 *274D96B5BFD1AD1CCCBC42D19E09CEC15B3AEC99 VERKNOCHTHEIDS1
390,320,061 *2740E0C710101D9C3F0891EAC0B0C3E860C43F6B vgpc
390,320,062 *274C285244FAAB402A9F50BC623703C3C1810488 VICKY.BUCKENHAM
390,320,063 *27482910E637CEEE7BB42979DA35B1E3DE15395E VIKI-BRAMMER
390,320,064 *2744EFDB13BED033B4A6221492EF9267F13E6F1F villacorta-ps
390,320,065 *2746D0991AFA8204AF3868D50615C18E99807C21 03261228
390,320,066 *27416F3A9F6F428EFC23BFFF7BBB59F2A5AD2984 )0(~ ~D=3
390,320,067 *2742E374E9B252F43CA6F23B9028FE96A2EAFB94 0ILOVEMONET1
390,320,068 *2743E0B88A67104CDEA0EE93555999DD76EECE65 132007 korkeakoulutjaelinkeinoel
390,320,069 *2743B66E1E9B1FA084C889895998EB66EC316D2B 132polo
390,320,070 *274D896189823E14A633EB02D58CB108DE7B36E6 WALLYRISHE
390,320,071 *2744D956A54BD5C9FCABA3E5D16F14EF6C894FEC walter.marshall
390,320,072 *27449CEB83699E733181C578485ECBE8D06529C0 [email protected]
390,320,073 *27404A2670CDD9B18CC5C451346A3D536A153D69 147062 tunelcd.billursk.gulhanhanno:30karakoy/ist.
390,320,074 *274429110CCDE81BC03CD22CC19EEBDB7BFA7C64 warnerhlavaty
390,320,075 *274CEDCDA653EA8758E19AA433073319E09D27A0 1557146 suom.jajohdantosimoknuuttila.
390,320,076 *274EF60530502D8CBB93FED5CF9DAC8CE8B72D08 WAYNE.SOEMO
390,320,077 *274EE406493EAD1135243751FAB8FED28632B26B waynevaughan
390,320,078 *27485847FCB79922FF0F6418FD5510C7BD27CC0E WEISSLICHEM
390,320,079 *2747E42CA112528529C349CF1FDB7CB70EA6628A [email protected]
390,320,080 *2746A9533C7E79A4A668847ECC66CC383F47F37B WENNA.LYN.VENTURANZA
390,320,081 *274AE0990E0BF5939DAE92EBA0AAD5108DEB2FC6 WENUTAH
390,320,082 *274641088E9BC1236B29EA1EE81DAB14B968C166 wernerchhabra
390,320,083 *274C7C67876E6464C8A1339198C2A145225B9805 WESLEY.GENTLEMAN
390,320,084 *274B6111806A5F610400B44FAE5E4CCAA77ECFD6 1-AIRLINE-TAKEOVER
390,320,085 *274E4B81580B48334923D7F00612E58CB816C19D 1.ALLSTOCKS
390,320,086 *274D9DA9E50046AD24BDDCD9C2C692584CE0400E WHILE-I'M-ALONE-(FEAT.-FRANKIE-BEVERLEY)
390,320,087 *27469B1CADAD15394F1AF592EB8DC64CB79ABFF4 1ASPINALL1234
390,320,088 *27441744F564186707D948294B9CA967C2D18466 1 COTTONFILLED
390,320,089 *274E1AA1DC3C5B1C68E823831EAD7DC22D45F75E 1-DELRUE
390,320,090 *274B90D169F28C58D84F6DBA1A152F013214C8C7 WILLIAMHUTCHISON23
390,320,091 *274236B3CB74C38082ECDC28045B24A6CD323C09 1 FUEHRERTREUEN
390,320,092 *2747128F4A4B5B09D8001AD0EE34874C09D9C100 1gorsier
390,320,093 *274F3C7DCD22693DE09661A9654305F1803923D5 1 HAVAINTOV
390,320,094 *274698288EBC862F22609B1A56C6979A5181EE3F 1ILJANTIN
390,320,095 *274F2B29C195BBC74D5AA5687FDCA66BB475B0C2 1-keijuva
390,320,096 *274EAED92321C18A726EA9FD7B2A67F4FED82BD9 WITHIA.WT
390,320,097 *274AD17EF63DC6844AEC05752D8ED8DAE69EA691 1-LAHNSTR
390,320,098 *274E6CAB7E1CD9E260C487EA5E9F496B2A9A3ACF WM.JANECZKO
390,320,099 *274B692AB749F66B5A3397B7F5E6353F49075382 WMSALES
390,320,100 *27438A8D8FEB0E403CAA4BC461BB7F35C70CF698 1.marttipoika
390,320,101 *274E17064F0FC39FA06C09FD30B06286A28ADE6B wongma-jewski
390,320,102 *274D6CC7A15E7C87D96B9D38C63840E5EA3D3107 1MESOTYMPANIC
390,320,103 *27461C537B2C0E5AC6CA07D6C2ED01D7BCE3A1BE workerpeasantstude
390,320,104 *27448092C111115CC72FAE8E0D56AF26708C6898 WOUND.(DEMO)
390,320,105 *27493C30DBC97B8A4DF878695DF1BF8A60CEF7D1 1-mUteSebbUsten
390,320,106 *274B64B448033862290EC71DCFE59C2B093E776F wrennidgelfayeandres
390,320,107 *27487C599F3074AE649D36CD4375E3EBC2308085 WUAFD8
390,320,108 *274316207343D95498C871A6C4CDA0348EE49F4C wubeigen
390,320,109 *274CFFFF2C6004F69483B64CA0D9A1523A6633BB 1.SABIRINA
390,320,110 *27440B560B1A658A0E2D60D6074FC6A541916896 1.schreibmaschinentypen
390,320,111 *2743C2A24C4612C01405C72A8A74A2C208584634 1STASI12
390,320,112 *2743A5E164ECAFCA175733CB48BBF24D1A12F223 1 SVEITSIL
390,320,113 *274E0EBDDDD0564326644DB693CBA38B0FA36ADC 1.youssouffia
390,320,114 *2743636952076C25AC6DB5C0F4668D1EB7B6D83E 2178346 zornig-fallen-ihm-junge-genossen-ins-wort-.
390,320,115 *274FF47537A1B25B5A4C2EADE9EEE307569118C2 2201764 TAMPERE.MINDTREK.P
390,320,116 *274742A157DB6E2D183422AFDBB7BE16C46FCB8C 227535 ESITYSKNMERKINNEEKIRKOLLISVEROKERTYM
390,320,117 *274B470039E3744B05FDCE299E59ADB2884A52E5 2368346 polttoainealtaissaeisaaollayhteit
390,320,118 *274C55B2EA05F9B7355E961D07FC3B98A3E8FA6D 24-NOSTIMEN
390,320,119 *274A4E9305F62BFB476D79B0DE26BD292DCAE290 wwwvhcncom
390,320,120 *27407B3F154D3A394E78D336D6782A982F443009 WWWZEUSCMDCOM
390,320,121 *2749772303B9E48A8B13CF2F103D8FFD99679096 [email protected]
390,320,122 *2745FAB3F5673D4246E6E64D18A5B62B089BDABE 272091 JULISTETAAN-HERRAN-IHMEIT
390,320,123 *27494C7A85AD341E5E2CB96F2ED7F14A6D99CE0E 282350 nezihkuleyinsemoras
390,320,124 *2748A80115F20889FC4A673AE6675CC33EEC98F3 X-F8
390,320,125 *2743480EF70F7592FEE6D851919671BF1B7A5A6F 2947375 vaikka avunsaantia on tutkittu l
390,320,126 *27463576D29D0C3827D34F040BEAFF4541612B0D 2951543 HE.WAS.VERY.INTERESTED.IN.US.,.WHICH.MAKES.A.DIFFERENT..
390,320,127 *274E722D83F201350145A13D7B4FF219D3435814 2955379 oletko lukenut kirjan sir vilin k
390,320,128 *274F632B4C45C64967EE57BF06FB61194C36C021 [email protected]
390,320,129 *2742F2223C8A3DAC68287D655842D59B4565BEDD 2CBRUNT
390,320,130 *2749BCF59D35068B03352E3D5DC2CA32560BEAF5 2HOMEWORKK
390,320,131 *27425AD48EF9D16C05F8B535F614E6EA4207F20B [email protected]
390,320,132 *274437699DCD7CDEF29B75521169A215CA02409D XNEXJCQAIEHPNO8
390,320,133 *274BF2D663665D1B1EF9E5F179137E379401942F (X) O~ O~ D---P
390,320,134 *274F987A80CE16FBC0B9EB2F5A216927C403BDF6 2-konsernitavoitteet
390,320,135 *274148B9EB48734EE926FBB794591E83E6213191 2.lillie's
390,320,136 *27492FF7574AAC51B7B714CA6B6F50287904D366 2menzies12
390,320,137 *2745F8C11BC5E0F52FA6CDAAF936B01C28DB4892 [email protected]
390,320,138 *2746FC3FE25F4077434A134E3E33CACB1563BD6F 2-saxena
390,320,139 *27473BD4DDF34C90E1EF7B8D08FF794999A6A67F [email protected]
390,320,140 *274133A56723E6EB40C9F3B6AFE7A6329B0D7625 [email protected]
390,320,141 *2741CF2D53699E223E32D6043FD1CCBDE7596176 2-YONELEMEMISTIR
390,320,142 *27495E47FCB7CBA9C824DD1F064C490530BE7F73 YESSYALONSO
390,320,143 *274C4C01CB2BF450EE45813FFB231345A36C2733 3azvaschinsky
390,320,144 *274D2C4E605CC60C099EEC15172B113BCE81FD80 3CORUPTED
390,320,145 *2744FAD3AC2AA00CD1EED76874E7B2F03750633E 3======D~O.~o.3B<
390,320,146 *2747F4BE83278B362877B6AC21CB18615D3E5F57 3-euro-tabloidina
390,320,147 *274903DAE43B1F4D8FA95BA0A03AA3A702153040 YONOESTABA,MECONTARON
390,320,148 *274BD7F5B1E2144C75EA0A3BA91061D76504FF9A [email protected]
390,320,149 *274E454F3A977E24B59E0730BAB7F434149C70CE 3LB4PP4C
390,320,150 *2747D4238D23D6BB82ED6F8400BA5491184ADA63 3m45cu147on
390,320,151 *274EDC6E01F7450D1DF4D3A0DDBF6DF272F6A926 3 montejuvideo
390,320,152 *2749054632D54F7896783D61B10ED25C630BED14 [email protected]
390,320,153 *2749AE2703F23B6B01D170862BAE1CB031F73C88 yulian.muhammad
390,320,154 *274B69BB0AF513ACD2176BCB557DE45CC0DAEB24 YUSIAYUKISNITA
390,320,155 *274CEE37D104F166733AA528807BA5B79661A8E5 401layne
390,320,156 *274D70185CF02533E3DDBB243E7E5364EF1408F0 zae;
390,320,157 *27478E11AB5731C75F7BA6A9EE3C4251BDE997AA 4DONMARIAH
390,320,158 *27416815E8F140139A3199B3F7B6DE095531EE0B 4IAMRAIDERS8
390,320,159 *27403113DD4B282C18A68AFF4299F230A2D94D9C ZHA.OBAR
390,320,160 *274239496EDBBCF0A18F77FC8C8D63ECAFD9D680 ZHIANNE
390,320,161 *2740877B4CC98772559B37CB269A591FC2414900 [email protected]
390,320,162 *27450D684E7F9EF033052D0B3BECFE12822FAA90 4PRTEXTERIEZ
390,320,163 *274E073CB2A0EF2D6A1292C14B961ED47AA12C3F [email protected]
390,320,164 *274E0AD8FAD2DB607B0A24268206FA81DCAD7857 4RTNECYAB
390,320,165 *2741069C6D1F505432F5709258ECEE970330DA11 4SETAVRENED
390,320,166 *2749A4DE386B5AA5FACF7AD187D9ADD94153C2CE ZOUBAKINE
390,320,167 *27427670E10F92BF961273A51A8EE4D2420B2894 4VI3SS3S
390,320,168 *274E337C8918A2697B8835F5C7B820EA5F5FA586 4WARRIORSBOOSTER
390,320,169 *274E74F84EAF898FDC07A8CAAEBABD0F000DF750 ΑΜΆΣΑΛΙΚ
390,320,170 *274762401654F55EDABA23B5EAD50218D9C13701 албанах
390,320,171 *27441B85329697DBC1133D4B7058BF36FDA82F6C 5BETARRATA
390,320,172 *274ED875297CB350B255AA08AA378AA95A6D2A8E 5BSWMANUGISTICSBSW
390,320,173 *2745B2038607FA46440FBBAB1E66C560ECB75D2F 5DANCEGRANDMA
390,320,174 *27492FDCFCF9D6FC296F71A792D261CEE8EE2FE5 5-DERNEKLERINI
390,320,175 *2748A76FA95E30407511652D558107F4AAC12FD1 ИОНОСФЕ́РА
390,320,176 *274532B6DA8AE4A1320868BF4464B31B5F3FF777 НЕДЕЙСТВЕННАЯ
390,320,177 *274F136575F0F4EBD7550DF393D5B421BF4AC4DD 5pakopiiri
390,320,178 *2749E256080FD9693DA244460306A2F81A10A589 5POLITECHNICZNY
390,320,179 *2745DE5474FB52BF27A6539CFFB07F913C527647 5S839CWEO
390,320,180 *2744ADB94479F358AD8833FBFF1894E21C9F713E 5SNAKERSNAKER
390,320,181 *274C8BD9AC6058FB74ECA115E3D2904914C85627 5THATWWW2
390,320,182 *27406137B704791CD1DCBE06241C857E3EEDF26A теляк
390,320,183 *2742F07F4316DF1FE2CDB02A2947F6CE9373030A ҰШТАРЫ
390,320,184 *274429EEE1AC6D56D8E0AACCEE0861D65FE260CF ФАРИШТАГОНИ
390,320,185 *27479B97CD3609E142F7C3BB5A27A462A71DB72A ФЛУШИНГ
390,320,186 *2748D5FDC36C28DF6C3E7CD57E3D5F0D24F271E4  СОРОКУНСКИЙ
390,320,187 *2741E17BB787F84077CEC809C39C3A1492DF3408 の上流域にあり、四方を高い山脈や高原に囲まれた大きな盆地で、面積はおよそ16万平方KM、
390,320,188 *2744A86A649593E8325CB86400D5BFAE3D21F487 690782 benim-ve-isimin-onundeki-firsatlari-dikkate-aldim-mi-?
390,320,189 *274AB8CFC574E9EA998973E8B58FB04F4EA2D395 作曲tomosuke(ギター演奏)
390,320,190 *2745FA7B3064EB413C5BFB2F5BE8D0947780F7DF 6CHICKWITTEDLY
390,320,191 *2741F0821FAA0FEFEE412FEFCFB10DC85F672DC0 6DEFABIO
390,320,192 *2744A03D7298F6BEEAA8DCD2A9A359348B34CFAE 6dfed6165cc53e57a4503f3a7e6ff60a
390,320,193 *27432B23406D10E8C55E73C452CE5F835B16A56C 6ESPANOLXFILES
390,320,194 *27481EED7A3090422D3F9AE90134D84E1D0D168C 印象深刻的作品是TV動畫出道作『
390,320,195 *274FCFDE36009F73017092C98E4A748A28549BFA 6outstorm
390,320,196 *274959CDD7E0EA44AA85F904A8DB9AE4167FFE4F 7ANTAGELSENS
390,320,197 *27420B2905EE4CB931C9630714B8F8EF709C46CA 7APPREZZATRICE
390,320,198 *274E5767DE4D76D5CDE4D1A05406572CD27D694B 7BUERGSCHAFT
390,320,199 *274DDC7EFFEE7659C66775C4F0838AE48429C79D 7DOORBLADERTS
390,320,200 *27469F1F1C62BDF8B0393053B2813B73180ACB1E 7ilovenightwind3
390,320,201 *274DC7848F75B33CDC5721AE5CAE18A334973EC3 7POMAKNU
390,320,202 *274438A426CE2080B5AC0EB09C9F021922287D00 7SUBSTRACCION
390,320,203 *274F82058F51E94804EB4082EBE198B1AFE5DBE7 7TESTIMONIJS
390,320,204 *274AA975F940019C11BBB644F4FA01BF04893B97 (00).o~.<======p
390,320,205 *2747D6DD9223CD0B0B68441893248D8F73E37387 8BERHAEL
390,320,206 *2743F8BCA1B7BA36C0629314242984E032B0BE41 8BSWCIMOTABSW
390,320,207 *2744D4B57408E323E673E01DAEF5C354B29174A2 8BSWSECINEREBSW
390,320,208 *27494BD40FE54AB2012C588734FD96489B3F768C 8E22KU
390,320,209 *2746509329C19869289E3CC579EFC8EF15017C2F 8overplumpness
390,320,210 *274385A45D780E57A2F0832C3022548C62772557 8PROPORCIONASTE
390,320,211 *274319BB09E0F95652D95421447F384B7E0C9A7B (0_<)o~ O~ qq
390,320,212 *274D9DD7FDD3EB350C3C7878790952251DC6A6AE 1047907 STALEY DECLINED TO COMMENT ON THE LEGAL ACTION .
390,320,213 *274CAA58F324C72D08FFE1692A5F30BAF563794A 1064751kenny
390,320,214 *274A8BD626E03E314D26DBD870889B79A728AC10 8VACHERAND
390,320,215 *2743877EDCBC684EB3CED59936E46CBF98418F42 8WASPSPIDER
390,320,216 *2747C65030A72A8BB41837B22496F272B30BA33A [email protected]
390,320,217 *2748219988459B8C2277FD036F7883E47814C1C2 1193608 koefer-will-in-der-"-vorderen-reihe-mitkaempfen-"-
390,320,218 *274B0952742C0B2DC476AC01AC0CA9141674D6B7 1283604 VONDENWOHNUNGENSEIENBEREITS15PROZENTVERKAUFT.
390,320,219 *27412B0CEE223E421A812AFE16897745C39827B8 9ARGUMENTERAS
390,320,220 *2747F960765D85A21274CBA66EB9F6E8BFFE88A0 9DEMORALISAIE
390,320,221 *2748692E766F3DF1323594D52CD8E383BBFA8085 9efflanques
390,320,222 *2741BCE99EF787C338B3B46C788268E15EBDFB48 13 BRUDERLAENDER
390,320,223 *27457718046A158872B44AC5B70A06204CEFC940 1541441 siksi-korten-vaatii-yhti
390,320,224 *27437D823E96292A25EA3DA3547474B3DEEAD39B 154ricardo
390,320,225 *274ABAA6D1B79A35D2C6DC3EE24E50DAB9F4F6A3 160KATHERINE
390,320,226 *27466483D2D0574BF854C38EBC7FB08FB41B6DFA 9JACOBJAPAN
390,320,227 *2746CE69014DB2576278204A5E117EE6A12BEA36 9JACOVINO
390,320,228 *274D3014E47292A9C46B46286BCA89F7CFEB5CBA 9JAZARINOS
390,320,229 *274E707FD184FFB361EF966FDD0292A128757501 9NIDIVIDLLSTEM
390,320,230 *274FB9EE48324778AFCC46106655D8E9E3F0EF6D 9PRSSIHAITA
390,320,231 *27478C1C8C469C956E757C7E16E6FA7915FC50F1 9REHPARGODILEC
390,320,232 *27443AE864800E6BB2085D90BA03786B73DB786F 1793407 KARAMI , 55 , IS ALSO A SUNNI
390,320,233 *274CEDF84DD4BA50C35DF69BCBB7E9D18AD7FB7B 9SMILESJACKIE
390,320,234 *2742837DE541E4BB76BE79C8E6740D42ABB8BE91 1912085 THE COMPANY WILL LEASE THEM BACK FOR TWO YEARS
390,320,235 *274A33EECA9302DB875F84C154EBBEFCE6C2997B 9STRICTNES
390,320,236 *274B5236CE18996F6E2F189CABCE0EC50F8D3077 1961512 THE DEBATE HAS TO BE MET HEADON .
390,320,237 *274E61223E578EC61C5D1BAE4C80ADDA3E2368DD 9THATMOTHER9
390,320,238 *27485F08857120CA20686A6E7B51EFD1DDA07584 9.UI
390,320,239 *2749D4AADCE8295B933185A397F52385A10C87F3 a-,!?
390,320,240 *27426820B5EADC5F3161CABAC73CA392F027DBC3 a#1?
390,320,241 *274F48D29D6D66516E5CE1E442B42D133501905D a2r"
390,320,242 *27498A28E52F7655F95AED081CA309BA25D6E386 a4gq7
390,320,243 *27405CD52FC1722CE39C29A26F42291B0CDCC8A0 a/5il
390,320,244 *274F24F76A7EF936F790FE49A4D73D5892A545D6 1-assembly-traded
390,320,245 *274F6B0223F88349EEBD0CA624F0F30DA5A6F611 A6mW
390,320,246 *274C9B499D8999F15311DC7014B6E1568FE4858B A7:H
390,320,247 *27450E08D63C60B27A60E20C1C2C36AD3DDAEBFC 1.BIO-KUIDUSSA
390,320,248 *274D0FEB634220E670E878464193A928C2C2680F AAAR-J
390,320,249 *274429603059B7A1252ABFBD754041342E7517B6 1.ERLENBACHTALAUE
390,320,250 *2749788592DCC917E0CE0DB189F0B3B2763AC908 AABP8P
390,320,251 *27437E1FCB34EE3B1CA0E33345E94991217636FF AADBZ\
390,320,252 *27475A8645DE4E12BD5D9C2E2CEBDA1ECA70E415 aaer/(
390,320,253 *274349DDC5C3EFD73593EA86B5C70365F28801C3 AAJJ
390,320,254 *27477C5D60EC382EA9F1C57EFF83A629852A8D19 abcdfirst9
390,320,255 *27429A5BBD580D75534F20B55F765D13056F2046 1.maya-pyh
390,320,256 *274D2453EA840A156DF105A79176372FE789061C ABIDOYE-AKINLOYE
390,320,257 *27434EE8C827ADFA133D9EAB1AEE147E41694212 abituros7
390,320,258 *274E50E472A18996A60B6F848D9D6E222D495DF4 acnsk
390,320,259 *2746C99646E283E0E861D70B7412C89DA7FBDF97 1sussa
390,320,260 *274DC1055EE5A3E96EAAC7B1032D844E01D7D554 A DOUBLE FIRE PLACE
390,320,261 *274230083435041E38E3E76AC24D0B7C812290B9 [email protected]
390,320,262 *27404A0F65F0AFB8978C55A07BEC087507F208A6 2092428 KULUI-PARIKYMMENT
390,320,263 *27469FB755C0BFD6BF529B3EC5D9F57FA7B7F6AB 2179615 DIEMUTTERHALBGELAEHMT
390,320,264 *274336DC0A09CF4F6C5055798B2E4CBDE75E22D2 2222 М
390,320,265 *2748EC3CBCEF05CBD5F1E6554F5FBB6D188CA958 2:--2---#---&---nonpracticing
390,320,266 *274E305D013BD40605824B41CAB6354CD0CF2F6A 23OCT1097
390,320,267 *274AFBF3F0CE3297AE34877303E13554E1E0C98D 27july1343
390,320,268 *2741A32161CDAF6936D937E90239590E0D3CA2C2 2806962 der-steuersatz-liegt-einheitlich-bei-30-prozent-.
390,320,269 *274994FF8475FF5BFE2770AF6A419558E59BC582 2826039 der-hamburger-sv-haette-interesse-.
390,320,270 *27463A8B0B6A7E698C69560FB8B95B98218A9928 2954 "vaikkakotiintulostanionjomuutamakuukausi,onviel
390,320,271 *274B12C6AA834933DBDC8749E35C924D999D9094 2ABBADIDE
390,320,272 *27418D4BC8469A0F8F87EDA1C7D5B79A0B583197 AETEBSW2
390,320,273 *274DB69E37D0ED3EC42042C45DA45CF5DF210AAB 2.freireligioesenfriedhofs
390,320,274 *274B5FD54A69E0D0ED48C93B7A94CCBF7BAE3C86 2.fruehrenten
390,320,275 *2749C71A400BEEE4BABE136C13F8F98C216433A6 2GNINWOEV
390,320,276 *274227054F043E67903D3868EDAF19868C7972E5 2IDAEUMQUE
390,320,277 *27412B624E4587172378563D674BEC51F924FA8C 2-MUOVIKORTTEJA
390,320,278 *2746C22EBBD6E298A7E0C2797037A245CCCBAA0D 2MYTESTER
390,320,279 *2743A19BF55B3919ABF25DF16D8274E61844A660 2RDIRDUL
390,320,280 *274611CEF435398842E466D223449EB19B2C2F1D 2.TAVOITTEESTANI
390,320,281 *2748F7DDC8DEEABE7639E8382186F3B86C3E8B37 <AHREF="#HDR13.1345">13.1SYSTEMWIDE</A>
390,320,282 *27457148DFB0C7F21BA14DF1F019A17D9A05CB15 aiksj
390,320,283 *274FDCC63779929C27DE74F9D47A0F3BDA3292A9 3ALAVIREISYYS
390,320,284 *2741C8E061C15928503F20CF94666E5F64ED77D8 3AUFWUHLE
390,320,285 *274C540FBFCC3A2FD339D44B48B9040259261BE7 a$.km
390,320,286 *274855DD15F9981ECFC9F8441B09CD52B3A8531C a(l?;
390,320,287 *2749A9F1DEFD5A4A1C1AB5FF615F8A6F970E1AE9 albertfroebe
390,320,288 *2744C62BD6BAE470498DEFD9E63E25D5D1A85710 ALFREDO.SELLIN
390,320,289 *274ADE8F4DE04446D30F8743EDB2572D92512FCB alghn
390,320,290 *27485EB74D64F2CE7FB50520B98C61055046E25F 3======P-~0-(X)
390,320,291 *274E27F3D0A1227DA681333512B7DDB11639EBBD [email protected]
390,320,292 *27456C32B26E18DBDE6BA0EF09B22B40C802CB0A alnns
390,320,293 *2747E0CAD938BB65EABA10799A88BC4B7E0703B4 406JAGGER
390,320,294 *274B8EA0E2300A3E8F45E2832E0AEF0CF89A6E25 ALVARADENSES
390,320,295 *274C381D97F9BAF952A89898531B21ADFE7B3F7E AMINA337
390,320,296 *27448CAB06BF332498C67D01069D316AB12DC172 ams%.
390,320,297 *2746DB76691865F8C77F191A4EFD09B55CB91988 AND HE ISN'T INFERIOR HE'S THE SMARTEST
390,320,298 *274D725B6979F7EB99966D99EBCEED23CBD5F688 andrclaudenicolas
390,320,299 *274977AA6D3529A94777C37AA509DC07BD9A499B 4THECHANGEME7
390,320,300 *2749876B2F8D729C12169D964FFDA3FE6F942F17 4.ut-tahrir
390,320,301 *27491707CC2C96641B2475DB9247039E8B44029D 52hklyz
390,320,302 *274834090C40526343F3C8DCEAD6D292E4119CF6 ANIBALBAZZELL
390,320,303 *274004474865A5E199DC53DCAAE8C72722FCDF30 ANN-BROOME
390,320,304 *274B156B721AFE85BCAAC4BAAE5AD4CA4C818EB6 5CINAKLAB
390,320,305 *274E10E08B0DBDD5BD44BE40ED2933AE0FE632E7 ANTARKELENJAR
390,320,306 *274A09A97309357166A44E7B2A383C583ABE340C 5CONIUGHERETE
390,320,307 *274B70B1EC06BBBE9C9A6B586CA650BAC08C65D4 ANTONIOSIMPKIN
390,320,308 *27435D4354530952B15F8A3A8932883AA98B1F3F 5FB159FB
390,320,309 *2740E6AF14E0B70993AB4D58A93CE81D25F29BF7 5FORCIBLYSERIOUSNESSSERVESET
390,320,310 *2749BFBC4FF9085D9CCA246D7FA173FC9B2A5D57 a$od6
390,320,311 *274DA62AA307EEBAE14CC45D97E551F3792DC5DE apically
390,320,312 *27443CEB58652024669A31737F2912DE1F746BEA [email protected]
390,320,313 *2740E1D169E9B0CE1B5F695B20CACC453A0FD53D 5PBIVVRCNGTTMG
390,320,314 *2741233FC78C4393AD3D928CFB243D3EA0C77B5E ar81trag3$
390,320,315 *2746E4A2CDB6A6B5DAE8D8224EB49BE7D0D689C6 5SATUREI
390,320,316 *27442EC1C61D20D34310B6B071E55FF00BD84A9E 5SDRUZENEJSIHO
390,320,317 *2749021E2B0337FEF36DF00FB0FABDEC8F12A990 5 STEGBAUER
390,320,318 *274958A04B9665FF6689F1DB456FDE9695C8A0C7 5TAFFANEY
390,320,319 *2741C30A2F64F31521E41BC599661C45DA13C615 arfre9h7
390,320,320 *27443755609FC8BC4EB250E98DCE1A414CFBAE82 627019 kolluk-Onlemleri-ve-ICgUvenlik-175-.
390,320,321 *274D207AFDAFA715ECE8A75C7380D7F907F9C4CB 67DA66CBE27B301FB0CCB0AC17C0996A
390,320,322 *2745D4AE46CCE1EED5BD95181BC505A3CC27CC7A ARROGEONS1
390,320,323 *274DFE39DDD05073967D400013710D588C00C670 a,rsy
390,320,324 *274B238B1B66128866E36879209193962CB9AFA2 As,q
390,320,325 *274D210DE74644995BB7FF639828803A4A861F48 [email protected]
390,320,326 *27419952CE12045F03A6F15D42D16F85CCFE2686 ATCKED
390,320,327 *274092B9CC1D3B40221A1BEAEB581D702E66D930 6NEDARDKE
390,320,328 *2744D7EA197B54F84F5354B7B0E6213D55AD03B3 6provisoren
390,320,329 *2749D87A9EFBC7EB2EA740FFE1F438973887D216 6STARGATEVALENTIN
390,320,330 *2745CC0B8BC07381653558A59F96804F7F17300A 6TABTASTERS
390,320,331 *27420997616FE6537544B03A99B82342570BE1C0 6uebrigens
390,320,332 *274EEE9F68C580A30E10D31DB9B424394BFA6968 austeerbsw
390,320,333 *2742DADDA311479AC2571092639AB69C0E7D0BC8 AWI-P
390,320,334 *27498578E47FE847EB5433FCE0A1096A3A438C42 [email protected]
390,320,335 *274BACBBB9D4E9B1E04A60A863071CC4522E3221 AZDIBĪŠCĀ
390,320,336 *2747F6FB86BDF11AF07F6A43392280499A0ED82E AZRDIL
390,320,337 *274E974FDE78B60EE4D7B562218378AD9DB2156F B1BJ"
390,320,338 *2745ED0D6F8F710B9E8037832B6069AD9A02E402 b_2ee
390,320,339 *274AAB1B3AA25E75E05242B45622C9A18DCEEDAA 7DISILANI
390,320,340 *2740D01BC074BEE9968C5232842DF12404BBEA8C 7DRAFTPRO
390,320,341 *274D60769A70A95940D20942472D5046844DC2B7 b5&!l
390,320,342 *2748BE6A308A0324381168372883733997BC2A99 B6GC
390,320,343 *2746F75E92CFE2CAC264E245712776563FD48DA2 b9h%
390,320,344 *274C20BE9B14A09466804160DAC34320261CD857 B!A!C
390,320,345 *2741AB14ABB563AB32B9A983F9AB1F1200339D28 7MYPHIL7
390,320,346 *2742F8EF327949D4D9C4B9BA7CC7CCEBEE8DACD4 7PERFECTUATIONS
390,320,347 *274D3B9A6FFFDDE0BE340D0AFF2CF83B291B7F7A bangclockwise
390,320,348 *274B80DBF0D54BA4EB73327DD066D024A68444BB BARTON.VASQUEZ
390,320,349 *2741DA5250C909900B75300AB54FFA0B343A23B0 7refrenation
390,320,350 *2749096A39B6F9C132D26B6F3FA534F495937329 [email protected]
390,320,351 *274CF92B20D2E794C04EF797F1530B044D8C6E4A BATTO, QUI PIANSE ERGASTO
390,320,352 *274B5091791D849EAEE0F8179A59B56B89153AAF BB)_
390,320,353 *2744BB31791A296E5C86C0CB1483E5F8D0A732B4 BBBUE
390,320,354 *2748DFABAEF4BC60E6D17B55EE017BFDFCAD6B1B BCXe
390,320,355 *27452C1AEECF9FFDFD2726448ACD29938FE0D603 BEDILLERIGE7
390,320,356 *2742EF670EBD45904B601A2151A62050177A47A4 868202 NE KADAR GUZELDI BIR BILSENIZ .
390,320,357 *2748F4334C426E7D7DEC106EC778772A498EBB4C 881090 SOME-BURY-ACADEMIC-JOURNALS-UNDER-A-BLIZZARD-OF-PAPERS-.
390,320,358 *274E1231EE10ACDFD57D1ED778E91825D2699007 8AANLANDT
390,320,359 *27461D47DC09AE77613F6B319172E1D68FCE8738 benzoxate7
390,320,360 *2744E8BFED304021D94B10533FDD1C761C41B829 B?-FB
390,320,361 *274839EAAFC2C5B4F4894BC75CE21711A70E3123 bg/vh
390,320,362 *27462552B3105EBC00184007AED76374A02CC7CC 8ILUVCHICKEN9
390,320,363 *2748A01E19E9F379709CC58D7D67AE4431360C67 Bh_X
390,320,364 *2747E78EB4D0BD29159B30104A691A62825F7B5A 8MILLANTSES
390,320,365 *27447F961146E39CF8FE75186BDD19923D9E1246 BIRKEN-EICHENW
390,320,366 *2742B03F800CB23AD2280D31AEDA6C3818D68637 8PLUMAJES
390,320,367 *27483391D4C55CBEA3B315F3A2561F17FBFD247F 8SNOCEREG
390,320,368 *27448C7148582E600D3354E0AAEDEEC2FCB1A627 8SRIVISIBSW
390,320,369 *274DD6FB52D806817F527F018C0E69E2BB11E434 8TARGETMARS
390,320,370 *27405989BCB98BC9E3C914414C500FB172F26EB0 8VALERTA
390,320,371 *274B16DDAD7AC64E115F02856AD2237B0DEB3617 967746 bizgitmeyecegiz.
390,320,372 *27497C703099E0055A71EE3369C9F0375B4429A4 9 AUSSCHLIEF
390,320,373 *274BCFB9086DA1B4D0DC8D80A17B0CCBB7525311 9braiera
390,320,374 *27472081B69DB79908C3FDD2DC5CC59D09EE92D2 9DDD0CF45A4D61959D362C903053EB9E.PIPINGHOT
390,320,375 *27441CA7E4CA38522651CBD79B6498B33D372543 9EARESSET
390,320,376 *2742C1178CFCD8A935DB2ED0F12A53C841AAB44A 9IAMDUSTY8
390,320,377 *274011E1D6B8F03F4D5352EA983F8C44312BA555 bjleu
390,320,378 *274BCE9CAB92F2BFA26AB157C80EA2BF3533789F bleu-des-causses-queso
390,320,379 *274172C51C909DF195C1F4701DEFCECA3A6C7F48 a1b2c312
390,320,380 *27418931F71591A45E5B5578B0C94B1092090158 [email protected]
390,320,381 *274A8E1C0FD4C720D3CBAC595CF3D5A86F19E3BB a9u0
390,320,382 *27464D31E8333A74F7F6F7A4550B343B8055B850 BOOKERMOOREHOUSE
390,320,383 *274A6E1F8751C670410079C912ABC6749E639F19 AAA=M
390,320,384 *2744F6650FB8F400FA9B6E775E0070D9E8D43653 aabk8'
390,320,385 *274821EECF51B366B0141C451FD1DFCA9FD5EE33 abcii
390,320,386 *274ECADEF77D28E4B0C54C04819CE90B33D1A144 [email protected]
390,320,387 *2745598A13D8B39936B6CD760BDA475E2194B221 brandonbazner
390,320,388 *274097697C2971BBCD8DFABE8CDE72D67519764E BRANDYTHURSTON
390,320,389 *274A2D0A23D6F589E3702E423B4CC6C0732D8A74 absumeth4
390,320,390 *274D4850BDCD5D069F3FB299F20B0AE9E18E8089 BRIANPOTOCKI
390,320,391 *2743FD84BFF9CE129AF130F46FF1A901343336E1 ac7ah
390,320,392 *2741ADD7D5D890070CA43633DCE47601683CCF8F ACEA-1
390,320,393 *27421668C415CAC59A5E3E5696754B0BD713D574 acnsk
390,320,394 *2746D794A4C5563009E23066637C19E70F843C22 [email protected]`SPLAT
390,320,395 *274D298F6659A2716802F6F740CAF2DF3F625E49 BTR.=
390,320,396 *274701DA157FC76A10D20AAD7071C156E5015532 BUFH-
390,320,397 *274B73A44448FE07DEEA05233D832226BF233F14 aldoscordato
390,320,398 *2747D1EEA261D5E9F7FEA0565752E4EB1BA9B264 ALÉRGICAS
390,320,399 *2743721D28FB0048049C734348B07B64171A63F3 ALEXANDERBARO
390,320,400 *27444ECEB741C0699200708CA031C0F13625EC14 ALEXCORRIGAN
390,320,401 *274CDA6AC453C74ED547F955B124040A857F6A7B [email protected]
390,320,402 *274F06B468F53BCE70C159A2508E958F728B8D6C ALLENVILLESCAZ
390,320,403 *2741367E0F2DFB12D267FBC69771ECBA8246A71F ALLSTATE
390,320,404 *2744EFBF72861DB0F082372C8D07B0A4F4081ADF c0kti
390,320,405 *274AB437FF7E10A930DCAD87658904AF082E1F4F c4m,_
390,320,406 *274BD427A2ED27C52A1F38556A3D8FABC89CB8AD C5G2I
390,320,407 *274C1BAF8BBC0A2CF41312AC3B4567120C36227F c6291
390,320,408 *274D14FCB96A610EC95142DF6E88ECBF79720E2B c6mvt
390,320,409 *27447084344A36DBB2894742A45A320E11B289F2 anacamptis.condensata
390,320,410 *2744030DFC63AF988FA58DA2510195A538FC9ADF andré–carillon
390,320,411 *2746255A0648A60A389A401FF2EBA37E38F1ED44 CACHOEIRA-DOS-ANJOS-(ANGEL-FALLS)
390,320,412 *274B89ACE2455F7560CD89560327F9034DCDADED antoineredbird
390,320,413 *27474652261FCA34165EA238F16EAEC77F707B5C carrolzaya
390,320,414 *2743D6BF0A27240A0CA8FA923133471623155F63 carterbenage
390,320,415 *27447169751B4768408A9146B065C7046A5A700F a-p97
390,320,416 *274049995983FC2C96A31E6A1FFF305773C37B86 ARMAND.OSOWSKI
390,320,417 *274332E27F7B87101640158CB7F0A370B7C32412 c[dc
390,320,418 *274222F9636B0C0C00E96323ABCFDC9F55ADE155 ARYVETH3
390,320,419 *2748204528403133267066CF9DCCAFF011086C52 ascao.metro.de.madrid
390,320,420 *274554185D399BF538B6BF2FE819033475A73C63 ASCII/RFC
390,320,421 *274EDA174ABBE104220FF8D6F5AF82BFE0C794A3 ASPERGES/@/'SP/[@]/R/DZ//I/Z
390,320,422 *274CB241C90F0BA8AA3D91FEC685B680227D07F3 astroabteilung
390,320,423 *27466F3E7C99728BC709703DF16466C77A219B9A [email protected]
390,320,424 *274EB5F0EB79655F6FB1AD7969E4FD1D302A2146 auq/g
390,320,425 *27498ABE0F9D8ED31FE89B6DB6A79D7F9C894FDD av1o4
390,320,426 *27488A21F9A635000945F7855C092F11D57B0D21 a,z7z
390,320,427 *274CDD4F8F181B2A502D991C604FEF1C1F956F64 AZCD
390,320,428 *274EA0CE9BF28A27BB9B7C8CAD41DF0244BB55BF >-B0~~D=====Q
390,320,429 *274A66A29C05C9B5B8F056F5593EAE774423FCF1 b1d(8
390,320,430 *274F290EFE8F7E8C60368F6167499A6D3E69AAF4 CJ6GV
390,320,431 *2740678F7FE3028F04F9E86194AD5835632685F5 c&jp
390,320,432 *274BF5C3F772516A1ABF72AB266D1F886E0BFB0A CKGW9
390,320,433 *274368835CE58E8E4F42FB0E555F32C0A7CDD0BA bergamo--b-er0-g-aa1-m-ow0
390,320,434 *27412413CC1AC0985741AE398DC778F2B9D6F9D0 BERNARDVALVANO
390,320,435 *274986D137418E4A1DA912A7B5C2A80183D1E6DA BERNASCH9
390,320,436 *274424CF828E8E04A987E8965652EE67E6A6EFEC BERNICE-M-DAUDET
390,320,437 *27497E6934241AF1EC771EC2E5DB8845FBFC5850 BESCHOOTS4
390,320,438 *2746E099C6899AABCF1725D0E46A8D2B45DE0688 BEU!P
390,320,439 *2741A807738E2893FB213DCDBD2DC3E3C34D9286 clrbj
390,320,440 *2741985EC9A0B8F21BEFE26671A7C9B5CB782EE4 BHJMV
390,320,441 *27477E7516704C6839473F7B0EFADCF6897EE7EA BILOGIRSKI
390,320,442 *27491A0D114D50D1103AAA159AADC8F2DC25DE6C COMMONPULLOVER
390,320,443 *274C207F50E9AEA99E26CEAB361D2FB16BC76A6F Bkn:
390,320,444 *274CD04EE03CAFD041B77A587B0CF08D6C096DC3 BNASZTAS4
390,320,445 *274F8625A8DD3EFBEAA590FFA71C569EF274F2F9 BNJ
390,320,446 *274D12B184A6232D30E04478492B980807578122 bogq7
390,320,447 *274F9063C65C46EE4F92F18031F4AB496CCB0CE6 c-:ot
390,320,448 *274083C8917AE002B71D01B1CEFF882F53D935E1 b/qbb
390,320,449 *2740132E9C8283FF2EF03AC15A87994FB1462C34 BRANDENSTIEHM
390,320,450 *274973D397B49E585BE0F4174CB8E529472D96BD CQWV
390,320,451 *2745C319F59697DDCB9F7C6F256438272440B250 bricktown-ballpark
390,320,452 *27460588FB0283F9EE263BDF682FD3472167FDC4 BRIGHTNESS.OF.THE.MORNING.(KIRK.DEGIORGIO.REMIX)
390,320,453 *274D20E9B8965CD2ED4E311C0B6188359D58869A CSJC#
390,320,454 *274AE1748D505D14AD9C1A1B84F049F1D70FA769 BUJ3F
390,320,455 *2740494E340648C82C5B10D2417133DFDABBFD9D BUZINHA7
390,320,456 *2749AB10588612CBD195BED091E8B05B6F2042BE bwd/
390,320,457 *27412C39D8907333D4625E733C7B6AD1D9CCEA24 C.:.
390,320,458 *2748E3A366291DF4E057F15D68523A04AB2CD1D1 CYFY
390,320,459 *274EE018457E1DB67AAE7757279A3463DCED8715 d563
390,320,460 *274CC0E36DBC2D89F37E606927DAD44CC1069E62 D7%GK
390,320,461 *274844FB3281792544D5C6B9A78CDA583C84C374 d+8#/
390,320,462 *274E438E57AC0FC0A717AF08A7EA7B9E923D949D D,.8A
390,320,463 *274056FCB34C1B1419AE7B8215A3F344501A1DCD d=a6f
390,320,464 *2743F7C062279EF08366C0EA2E32541C9F8A8157 danelle-alexander
390,320,465 *2743074D524FC3A12C281455C3C0E86D38338F75 carrot-&-stick
390,320,466 *274A60031F1EA3DA67B06DC9C0C528DA48D579BD Car-with-nerves-of-steel
390,320,467 *274956A12BB99AC5E901BCA6BFE98602155F912F cathomycin3
390,320,468 *274A1E5121F0F6B237C4BC7F53E5D9A154CF9FE9 CC9U)
390,320,469 *2749EE9D1097C97AA81B13AFB4E7480E4379D88F CCD3O
390,320,470 *2749B2F524BB57A3DF54BF128B266D663F0C711F darrylaboshihata
390,320,471 *274BFC99B81A109FCF74F242075CEA0D2820C3C4 [email protected]
390,320,472 *2744633817CF35853C4327621D288FE7A8C8BB71 CENF+
390,320,473 *274C34E9C1ED4CBED868C2530F27CB382A0BDAFC DdR,
390,320,474 *274D03FEAA59B6B34FAEF615A6901307026128C6 DEBORAH.TURNEY
390,320,475 *2743586CD3DFD757E5820119EEF17C6678B70281 DECAY972018
390,320,476 *274B2867CA847B7FE5FB231BBE2C2061CBE79FAC CHARLES.DUERKOP
390,320,477 *274C0078B4F47498BBFB0B045FF93B1F4A7CB5D3 CHARLIE.FALTER
390,320,478 *274E0F2AC31DC6433A9C9A8214E548822C7CA193 deeann09
390,320,479 *2746B3B50252981FE5601C3B76A5F26222B2A435 chercheursbsw
390,320,480 *274B9CD010776F875B8AF8E4F29E4F055A1944E7 CHESTER.SUVADA
390,320,481 *274E854F684DA6C69C569ED4031579C382C58A42 CHEWYCHU5
390,320,482 *2749F21D2D8C73532185669FD4A8028A272F9B64 Chicago(ThatToddlingTown)(featBerylBryden)
390,320,483 *274F296348C9F08EE383A2FA1E6B5C8423AC9136 CHLOROX 1 0
390,320,484 *274E2968AAD20ED820EB59AAC284881E9DE8FA32 DEON.GANSEN
390,320,485 *274E0C0843238D48F558C8445A57E73A3BAB0008 [email protected]
390,320,486 *2740C97E3BF7688D1442088AF1AD03B82D10527B DEONOLLOM
390,320,487 *274325061BD3485511C87ED7A322A6E16FF39728 [email protected]
390,320,488 *274FCB511666887DF19E0F9906FDCE6B0B020911 CHRISTOPER.RIPPSTEIN
390,320,489 *2741AEE0315F930161B5CF0295B279D197D333AE CHRISTOPHER-MCAFEE
390,320,490 *274CA82B9F9D28796B778CF9FA7557C3510EC572 christophermegee
390,320,491 *274F8047494EB35130E757E5031768B4987AC384 [email protected]
390,320,492 *274369449187AC30F2048A58AEABA75EE7A57CB1 DESLEMBRO
390,320,493 *274680F49CAB06733F28F176EBCC9301B5871A7A DESMOND.MARSTON
390,320,494 *274A42B13EE9BA0BDDEC99CFCE0DC9B75F97FC46 c"_ij
390,320,495 *274BEB4DD0718A69B8CB0B8B3D3460411DDE973E cim(o
390,320,496 *274AD3092B278D0CC7D36112CC3BA483096DC7F4 CLAWKER
390,320,497 *2745FA6E9E203A3C8861A0A9F784B362639B8FE9 DIEGOCHESANEK
390,320,498 *274801BDECE8468DFB0EA4C770B8D52E3F0FCCDA [email protected]
390,320,499 *2747F59D48B03B7580358DCD8F5FF9C6B047DE98 CLOTEN
390,320,500 *27451B59892A2E54D5D0AA1D140FBF7E77EFE2B9 CL)V
390,320,501 *2748E23EEDB791D6D33902B7C9C7D1C7E92A43B8 Cn!N
390,320,502 *2746E5A102623205FE20841CB1C79069B327F32F d$&lk
390,320,503 *2744CCEE823C956A257CA47BFEEF382D26A45284 CNT)
390,320,504 *274BA2BFECD52E13BC5E10CF1442767D25A116B0 DOWN.BOY.(APHRODITE.MIX)
390,320,505 *274D311BA707C6CB2EB72BD19027266020CFCEE0 Dozijnen
390,320,506 *2746EAD90451B83932D0EEC03D1F98DCE4D86217 drd:;
390,320,507 *2748CAC57D33DF498D6D24405D2435419A1D9E23 coral.rogers
390,320,508 *27417417ED1063F5E6C2AF6F5A50E4BA41B74CCC CORELIUS8
390,320,509 *274B44F89A2170DC48813EAC43848CC049A06AFC CORPSD'LITE
390,320,510 *274D803F2B8EC46DDADDB52589C54A9802178F41 COUNTRYSTORE:29(A)
390,320,511 *2749FED03EC21D079A3EBB670C0EB01EB4AF7AEE C:\PROGRAMFILES\ADOBE\ADOBEBRIDGECS4\LEGAL\PT_BR\LICENSEHTML
390,320,512 *274D2E117C0E85C07146584D22EEF95C8C4C38C5 c:\programfiles\commonfiles\adobe\help\en_us\photoshop\110\wsc40f9571-23fe-4414-b3c6-ddf2a156a8ebahtml
390,320,513 *2749C5CC6B48506D49D6636444178C4100398359 DUSTYCASPARIAN
390,320,514 *274AA3096CF9EE63A93755344DF6883465DAF530 [email protected]
390,320,515 *274B94DFAA1656C5CE4EC2C45290FB524CCB6AD0 C:R?Q
390,320,516 *2746B1C9CCF65A12AFD6429A57BBB358BC6E83CE earq.
390,320,517 *2742B60E7BEAA92FF4DCDAE6C630EE4E689F2DC2 ebf2i
390,320,518 *27417561DED480D7A0947519347F58885E7B9B53 edisonbibles
390,320,519 *274DAC7F17B2206FA86A7F6642E151A7331D807D EDMOND.BERGDORF
390,320,520 *274730FC730CEBFB3C74BFD9BA12399652860D04 D2aZ
390,320,521 *2742F6EC744EEF66B88E9ACA31D06CF8DA193121 d_6fn
390,320,522 *2745FAE0905D9CC6BDA4FB75DEA794D062D1FDD7 DALLAS-HANSON
390,320,523 *274BBCA632E4BFD264F8419A0DC55FDADD4BFDAA damianmannarino
390,320,524 *2749058FF82AF2BED7CCB3B2864F0C95CE80E21B DAMIANPHILPOT
390,320,525 *274C49C7BD60415FEF3369E9FC5918CF20218C7C damienfoscue
390,320,526 *27438D78733D314AC9E94D0F5301B6AAA9AB23EB ELDONELCOCK
390,320,527 *2743E199038ED6120BC3D22CF3F06ACDC80BAA24 eldonwillmert
390,320,528 *274D77EFA170CE89D512ABC54A8912D0FFA08764 DANILOKOBAK
390,320,529 *274ABF11C0649F5485B9840D53743FC0C259AA6F DARELL.EVORA
390,320,530 *274998AB31BB04358ABD4D51536404407CA57A00 DAREOLONOH
390,320,531 *274272502DD8DE1DF4ADC4A0C001DC009D979EC7 ELÉTÍ
390,320,532 *27402D6072CE88F8E40BFB4C993584DE9AC88E05 darreckd
390,320,533 *2749B4DE13F99185868522DF80488193EE15B86F darrickgherman
390,320,534 *274B85EFEC896D01AB247E886E7965D93B10A6EE DARRIN.DAREY
390,320,535 *274B81D8733107C0C2C820FDBD1C55CE29C89C5F elizabeth.ann.steele
390,320,536 *27412BC53511F4FF84BA0D07F533525329D4A3B7 ELLERSES6
390,320,537 *27484A6A86BA22CD2C6D5B92050AC09E3B2A64D8 ELNED
390,320,538 *274A0D3375629B7E8F3F73C72B8BBB8371F65031 DAYBREAKING
390,320,539 *274649B6E999CE9EF2EC0A562433915883913689 DCKSP
390,320,540 *274A4B6087F9EEE0EFED92EB9BC04339D3E623B0 death-is-the-only-adventure-i-have-left
390,320,541 *2746D2D29F4E1EB11F528C72152339AC9E124839 ELX8
390,320,542 *2740D57F7F412850EF8AB280875DD81AC38EEF2D EMILY.HOMMEL
390,320,543 *2748270DD33C1FEBFB92C0CE06133913F41EECE5 DELMEROPHEIM
390,320,544 *2744833C6F701636771607F9CD2E59EDFD3371FB DEMARCUSLAVANT
390,320,545 *274C2333193C0ACCAC3E438D23FA55417EF1C306 demilancer1
390,320,546 *274347E43190A3AD724077A23A34055B67789B7B derdelaoposiciondeespana
390,320,547 *274AB43EA929F2506A7EDBA7FB1507F17D910739 DEREK.HEPP
390,320,548 *274C3E77665464EE66E72C4E414DD91FD9C1CD4F DFSA;
390,320,549 *2740319F350887E45A9A20BFCA21F6F5586ECEF6 DH:2O
390,320,550 *274A5E9EA1A639D78C129AE6A852F4A7555456B5 ERNIUXAS
390,320,551 *274750A420E5A46460C1A996790081E3BBF42528 erutabru2
390,320,552 *2746BD101E990CA8AE7742BFA6BBDB5952CF5E77 DIH/I
390,320,553 *274BA68C5A989927C8D5B5528970F2DC7320B3E3 dimitri.mbuyu
390,320,554 *27456686C5971DB52C7D7438BAD79D187BF36B62 es4m
390,320,555 *274BD9FC354614C75B88D0804284B7B31182193D DITK7
390,320,556 *274C8D4E98A23C407142C349287DFA7F6A0CD358 etisnesed
390,320,557 *274927B8F66140E01A778D5B2CC023FA6997813F dk33=
390,320,558 *2747BA29111F21595BF0548D1DB7C809F017499D ETTKNI
390,320,559 *274001BFC09F3240D969B5E25673A1EFE1FE9420 EUROPOCS
390,320,560 *27410B4A630FDBC57F02EC647C3F3F3694342072 FACTORS.4445
390,320,561 *274D7286A1C82B2279C62A5F65DFA3D32A781EA5 d-nhi
390,320,562 *274EB6EF98C241CC1EA444B0C805A7A79272D8D9 do.81
390,320,563 *274A14E5B6CFCD7A9D6C325031C87E63572C29DC domentiy
390,320,564 *2742EC159FCB6A4A96DF49F343DCA5586F20935D family.&.friends.(disc.4)
390,320,565 *2740138F61C1D3F5C629B330225EA026CFF2D985 famulantenaustausch
390,320,566 *274906F4C4D0104AFDCB88936F0CBA75D3F00BC0 [email protected]
390,320,567 *274B4B6C7258631444AC33B267734A2F88B29FEC fashion-that-rocks-(buffalo-exchange-compilation)
390,320,568 *2746053235867F9F97E4E48F4A176187E92B169D f*bq
390,320,569 *2742D5AA9CA8D65E1342AF17A83868E6EF33C40E felixbear6
390,320,570 *274D9F29BCC6B47AE6BE938DD408C4A4FC537F79 FICHA DE SERBIA EN LOS JUEGOS OL
390,320,571 *2745A315314EAEE3C0F7BCA791A254009F233276 dorianblacknall
390,320,572 *2746A44AA7440AD6CDC3C02255D0E6F6BD92F1C1 [email protected]
390,320,573 *274AA9676C29B1A4E78D3C7B6F7F9D0BF0EDF174 do.you.know.where.your.children.are?
390,320,574 *274E502FF2703E552B7CD7058A52DE16A09CBBE8 D(PM"
390,320,575 *27447BD7340ECBB3B0DE770A94572412AF7CB45A FOUR.CHILDRENS.SONGS.3.Die.haltbare.Graugans
390,320,576 *2745A5E65B6E2C093E6607719D2A03B32D374FE7 ds5gv
390,320,577 *274D889EF1652993309B9952CA5AD7FD0E26AC6F FRANKLINMETTERT
390,320,578 *274D9C5A693CC7B13346838DF4ED84CDB7ABBABD FRANKPAHULU
390,320,579 *274A0AB63049AE9BB367924CC09CEF12663D7EAA DT64
390,320,580 *2742A2296C973DBD7B3B00D4F30E22D95936F62F FREDRICK.DEVIER
390,320,581 *27412BE109CBFE18E29B3C607D6BD9AD2342BFC3 [email protected]
390,320,582 *2744004B59159B34AFB280C9D3A5AABDAE80B7FC [email protected]
390,320,583 *2743D20E9D002480765B65795F5DB7C071EDF4D2 FRELSERE
390,320,584 *274010CB7E5D267EAE12B40083D102133F6548CF fruest
390,320,585 *2744B498D116A1794033C9FC3EF7080070500E1D F}UB
390,320,586 *274551524C9CA1F440629FF1B2B22296FBE8B830 DVFJ
390,320,587 *274A00EFDF8F0A4EBD316321066DA3AE86DB0124 dw3,p
390,320,588 *27497D57018B5F176C51A2A34CCBD941BD7CE255 DWL:8
390,320,589 *2742DC721AC32D69C3324FAC5C509A51E5468EA1 GARY.CATLETT
390,320,590 *27493D1B93087981FAAFF5ED395C14B8D3090A2E e1480r47ed
390,320,591 *274CE02A1727E7761C745F3091AE3C7A9B49DF2A e%ay
390,320,592 *274CF440BBBB7622358D908CE828D960CAB7F2B0 GEOFFREYREITAN
390,320,593 *274A1205DAA8C2DC69FDBE9E2BC8A0A29C4DA50D GERALDBEANER
390,320,594 *274CC919E21F56DE9D58B9D695F32D773600BF6C EDGARDO.RHINEHARDT
390,320,595 *2741A48FCA38D83742C62055F96F7533338D2590 edgargallus
390,320,596 *2747F240C718BDBAF006FF0F66B2DDA67CA1337C EDGE.OF.THE.UNIVERSE
390,320,597 *274C2519CC03A253AA317BE91D28E3D579151DDD edocs
390,320,598 *274AE698792F9E51E59263C05447D8EB6DF79737 giovanniligon
390,320,599 *274E0F914DD9E25DCD016202BB92A6A84EB32B96 EHNERVEN5
390,320,600 *2743B0FEE6990E581F5CDFD32C0FD0490EBC9B3B ehxcm
390,320,601 *274995E726D04D15150B50A3F4BE26CE824EBF56 goldenpanflute,volume1
390,320,602 *2744EE7F5236309D2DE9E08DDCA371AE925A987A ELDON.WILLIMON
390,320,603 *2740A9261843A5DC1AA82606BC996EEA42CFF552 ELE1S
390,320,604 *274EC354C8413202CC166EF9369F22181574C359 g*q,
390,320,605 *274C95E308BC1581D1DA2796A8BFFE930E06E418 GRAPHIER
390,320,606 *2743447A1BA3892122A0E3957591EECDC5EDCC54 [email protected]
390,320,607 *27474F8FC33A563936C78A94FF8E4CF3BAF95285 GUNNAES
390,320,608 *274F6284F096552053FD1637C0FDBF94C27EE91E GURECKOVA
390,320,609 *274B74B50097153408BCA639749260F6B8875398 gustavoclewell
390,320,610 *274D0F7B0898A938E62781D0D62DDE3744C8F371 g\yc
390,320,611 *2740D40E2D5B75F7BBA1992EA10B46AA360AB976 eo?)c
390,320,612 *274AC07BE1067F35C48A98CFCA7C752018A55472 EOI8
390,320,613 *274187C3D67D9DCEF1D6BFD3DCC5C982B64F005A EPACTIS4
390,320,614 *274022E1627BB8B16F2DE61AF92DE9E3A4838D71 [email protected]
390,320,615 *2747072097852826EBF53AA9C268AC90081B6AAF erasmokosmala
390,320,616 *2740C450FA74351FCF680BA7C702E951D7E475FE HANS.WALKEN
390,320,617 *274F9720B902D93FBA6E065A6CDF29A4790A78B1 er-dachte-er-ist-gay
390,320,618 *27466A1B5F6C97E51F6D1622AC0C8D9F1C1DFF38 ERICBALWINSKI
390,320,619 *2746F4FC2E121B5E751B6B55BECE161858A0014B ERICSOSSAMON
390,320,620 *274EA907C963727F5D013E673CE8509E610E5A14 ERIN.HODSON
390,320,621 *2749499494C3DE6940597A5FCABBD63F5DAD3FFE ERNIE.NASERS
390,320,622 *2746100BAE681D73DBFC0259EDDAE492BD8DA4D0 [email protected]
390,320,623 *27408B778420C5B05F57FDF59823CB987671A64A hectorclouden
390,320,624 *27488768E2C7C647DF07C3E30F7C24F212B9ADDB HEDENBLAD
390,320,625 *2741CD9D124D8212E7372D5DCE535CF1D51559EC HETTENS9
390,320,626 *27455240EC2FFD7F0BF610BB473AFF8BFD431002 EVANFLETCHER
390,320,627 *274EA92E830CC1C36ED69802996BFC353D0CBA65 E:/X
390,320,628 *27429048162AFDD0FA33F78231AB63A4E6FCDD8C [email protected]
390,320,629 *274B4241C0A4E45305047C242F1F4997EB3F4C07 [email protected]
390,320,630 *27425148020B1601EAC975156616E0B8CE675464 hrenbrunnen
390,320,631 *27468A86DE54163772B664DCD0A8F5435DA3A01A HTDL
390,320,632 *2748ED5629E595E7F8FAC5A32C6A69806F90A128 f6vu97rsr9trm
390,320,633 *274986CF762E5580D698BFE7F62E99CAB354DE60 FALUREDE3
390,320,634 *274BBCE3E93458C12B408884B7C5B1DB0174755C [email protected]
390,320,635 *274B32999251F731F47EE123DFFC6494AC48B955 [email protected]
390,320,636 *2744CA8B892DB6953443ED4A6477D2E691353324 HUGH.GIOFFRE
390,320,637 *2740FD4642DC2E4F44828676416191570E0F57D9 HUGO.HELLNER
390,320,638 *27466B0575363274E9712666AC4196C3622FA587 [email protected]
390,320,639 *274990591F1731DC9B9AB192AC17F8FE04A7B282 faydalanmaniza
390,320,640 *2744D1EFF094A0B665F3C00277DB2C4967A85EF1 [email protected]
390,320,641 *2744811E64271D8078BF6E783A073CBACDBCAA30 federico.mayor
390,320,642 *2740E0051A1414672EF7C4979C403BD38A256D0D [email protected]
390,320,643 *274456DB8CCB551C6AE62F8DFA1A8CC243469E07 iamcalvin12007
390,320,644 *274AB5A1AB03E2A7096034A41A0AA2BCD0541FD8 FFOTSNNU1
390,320,645 *27469B98CB47524ABD768B8F05522EDE87390B02 FGH1944
390,320,646 *2743EA681A11DA145510C8EF2BED69DEEF27ADA1 FIZELYITE3
390,320,647 *2740D6187DA6DA17741B99252662ABA6C9F7320A fouilleer3
390,320,648 *27433EB1E7E90215430B2FDF809F400FFC414EAD FREDDIECOLLIN
390,320,649 *274A2208593AF8B20557C2E7207F94343DFAB5AC freddyzorra
390,320,650 *2740A3089E124658262A6D06A3B35A40AA3461A4 FRED.GLIDEWELL
390,320,651 *274D131A3355C51351419860C6A1A5779BB550AE FREONDRAH
390,320,652 *27412F8F44AA8860D57C7111C89FE1BB0140CA4E FRESHORGANICPRODUCE
390,320,653 *274161134E2A419E40D0DA1AE06FF503F0787112 [email protected]
390,320,654 *274D0CA108D512DDB0E357E980DFF73B4038C657 G140239
390,320,655 *2749E6808FFD1E464E930D7DAA3858281443223D GAERTET5
390,320,656 *274BAEAAA61423076E6C9D77E0FC1BC8DDF967C5 I+)G
390,320,657 *2746F54BAA3831EB14BFAFE49C138EFB29BAA69C [email protected]
390,320,658 *2742EF487C0D06819CD7B83DFDB66919FE39A66F ILOVECHERRY3
390,320,659 *27498F9F1CBA48082DD1C0A6BF74CAE230D88E31 GERARDO.FARESE
390,320,660 *2749A47A68F3523E9539AC49FDEA9E0C0DFA227F GERECHNET7
390,320,661 *2742E4289181092F137CE3DB95A30142595AF42B GORRINOSPOZUL
390,320,662 *274B58FBFE0A972FE8BB171BC2F23B7F97B00990 iraheadlon
390,320,663 *27443E50B6066E9A465B1E11913951F5307CC091 GRANVILLETUMBLESON
390,320,664 *2747E80D589BCB7970B759BB8AF767364B5F65B0 GRAUWOT5
390,320,665 *274FC2CFF297DDBADAF28EB66A36D05E8BBCD2CA [email protected]
390,320,666 *274CDFBEBF57B51C4869EB76220C4F8EC57A2C0D jacki-parker
390,320,667 *274C8C925154FA2B99A57D0EDBBF8AB5D84907F4 jackmrad
390,320,668 *27480C1AA89560B963ED760DDEA2B3DBD857ABBD hankgarramone
390,320,669 *274E70C1917C8B4D3FA705E834FAB7B2B0EF0BF4 HAOJING
390,320,670 *27436D8A003E17ACF0238A03B3F88A4A75989687 -JAPANICPIGMIX-
390,320,671 *274A34CB9492305046F636EE2A5E6C1C242392FF [email protected]
390,320,672 *274E8B04EE64CF284BB3A96D734E32FBC2B96BE4 HARPSICHORDCONCERTOINAMAJORRV780:IALLEGRO
390,320,673 *274DDABC66EA934006289694A2B86B67F1EEA5FA JBROWNPC5
390,320,674 *274ECF67C3391E0EEF0E8F3B40EC4846296FD6A7 JEFFEREY.SCHIED
390,320,675 *27426F321462FBB38A9154C6C09BCAFE15B28A20 jeff-lukaszewski
390,320,676 *274347112A3A40DBDB9A92E4FAB990EC70E4DEC2 HCRUPBUS
390,320,677 *2748259B630F72AFEFFC8EEEF04A89CA60F2EC67 JERALDGUNSTREAM
390,320,678 *274FEDCABCE6E3CFB10EF1D44A83B18D279D00B2 HECKELWERKS
390,320,679 *27423FDE955C09199D481CBC37362CF6873BC07B jeroldcanak
390,320,680 *2748674AA6F483F1ECCE17F7923B7C02C1BFC6BB JEROME.SEUBERT
390,320,681 *2749F16E07DC49E6791B647AD08E39571546C8BB JKHSK
390,320,682 *274E7314ACE3372C629FFBC27CBFFD60BB25F119 HERZOTÜMER
390,320,683 *274D10F29DA4E70A1A95CCAB5DEEEADF49F11938 joaquin836
390,320,684 *2748F00DC42A3AC81202F2B1FA673C2E61C88AB8 h|ld
390,320,685 *2740DE53741A4DF815471609ACC9F5E2E91E2B54 JOHTOLAN
390,320,686 *2742DB081CC6337BA91E0BFB72A0ADB63609B507 HOHEMESSEINH-MOLL,BWV232:IVA.CORO"SANCTUS"
390,320,687 *27411A6E9230386E5FDDB83CEBEB66F9577A14A5 JOSEPHDITORE
390,320,688 *2742FC7E22385FD39B00724A97F91A0DCF40EE0D [email protected]
390,320,689 *274CBE01306A1BA91092EF60B075BF548B36BE6D judalah
390,320,690 *27440F811412C4214D0F437FB3288FC5FF687319 JULIANA GRIFFITH
390,320,691 *2746C3A4CA88276374CA3F0ADCA9E8348A29A5AF justin649
390,320,692 *274FFDD7F83EFBBC65820B18B3D1357E21E1AC3D [email protected]+E$+
390,320,693 *274730FFD18A07663153D4B821D4CEA7402DA441 k[4b
390,320,694 *27440CA8A55E3C7810CF686654A8135DC946A2D1 HUSBANDEMBODIES
390,320,695 *2745E7775BF7D866974B7B3403F1107688B6872D [email protected]
390,320,696 *27453F1D332C5F84BA08340713DFA497A7753003 [email protected]
390,320,697 *274DC12138052E4FF174715E6CECDDAA7E9CA0A0 [email protected]+3$
390,320,698 *274480EB5E154464C755189931FF586AD135CA78 ibleiben3
390,320,699 *274F844FF745CD5191AB3DE2865DCAD768ED945D kelly-ann-hammond
390,320,700 *274EB08CF783D565127CE104ADEAFFD00277F7AB KELVINMAMMEN
390,320,701 *2746E5F6E5E4E118968B487DD9FB5E64FE239A3C IKEFERRELL
390,320,702 *274401A8540CAB7503472E03CB3903A8C5C87D90 inglimed2
390,320,703 *2746A128B88933FDF5E044ECCDB0155282C0F20B INSTRUMENTALPÄDAGOGISCHEN
390,320,704 *274654C08CBA4E19E82F896446084025CC0BAED5 KEN.GOODROW
390,320,705 *274D514FD8F06834E58A2BBEA1B6F3172EB7E83E kimgray6
390,320,706 *274A0682D4246DEB4F64912218252ACE0157A5F2 [email protected]
390,320,707 *274EF18DB8FFD5E6352F6C4E0A82306CBF403A16 [email protected]
390,320,708 *2742BF6B8F28C8E55EA4900E1B6A92AD0884E1A9 ITOIZAWA3
390,320,709 *274A9C7179EAABE3FE370ED4588C787D33E2FEE1 KKARSLIG
390,320,710 *274838FEEBB764A0EFCB74DA44AE8B8375CEC643 KLAGORE
390,320,711 *27414DCEBE70E5823A71C1763280381984213E68 IVAN-MITIC
390,320,712 *27436C8F294D75C90E0144F08A1E517B5D730B9F I'VEGOTBIGBULGINGEYESFORYOU
390,320,713 *274EF75DFEF0F51E411FAA4242EE304584E6B6A2 jason.choat
390,320,714 *274D5953778AAD60C8119C75C8DBB5150BBB473E [email protected]
390,320,715 *27494891631BD08E4FAD9CCC2F8893B9F437055F L9}>
390,320,716 *2745020C36A53396FA0F84AF731137FDFC8CE5D6 JEDZCIE9
390,320,717 *2743721C649BEA90FDB571726B90EA68C9401B43 jefaster
390,320,718 *274201B0F2B148C96EB9E088305AF91801E839C9 lahuarmillita(feat.eduardofalu)
390,320,719 *274A1E72CADD760B147F9839B5ACD869E88697FC lanelta1
390,320,720 *274E7BE3B765895B399E1C099387B5B2BE812C5C LASEINE(
390,320,721 *274382D26E0B6D98C32572DDB61A48DB1579F73A [email protected]
390,320,722 *2747C879BA2C665276C2BD1F8C6C0CA35BA12F78 [email protected]
390,320,723 *274A08F5F0314038C3F4B70402C6732283E6E8A9 lee.kian
390,320,724 *2749127C9A20FAC77A3AAB2F2B71CA29C9856D3B lefthanded 'l/e/ft'h/&/nd/i/d
390,320,725 *27472D49480F1FD69031EE6D85A652FB956DB220 JJAN231975
390,320,726 *27419D030206C679B363F08F00E8C7CE593260C0 JOHNSONBERTONE
390,320,727 *274738C7DFA245CDA066CBF2807D7B1E9A690E0C leopoldoburruss
390,320,728 *2747A70CF6D35128CF9529C2FAB813C02406CE4A leroydanielski
390,320,729 *2741B0357A5A1D0A4C34A8315ABE41DDA4C9CA74 LESLEYBONSER
390,320,730 *274528DA5E507E3649EAD0FD1F4C7FA7C7FE74D3 lesleyhammersmith
390,320,731 *2740B2266A8B7F05BEB91270A72CB049B2DA2077 lesleypentaris
390,320,732 *274A9D5BD6918799DE17264CAFDFF64CDC2F795D leyran20
390,320,733 *2742E53614B0A66D31C5BF86EECD529EA824DCA0 LICHENIC123
390,320,734 *2745AADFCDB933DA4FCE34EDC50554BCC8FE3097 [email protected]
390,320,735 *27486C6D7C978D6C636FBA52FD8D8420116C51D4 LINACAMPOS
390,320,736 *274F0F335B81091C09E3C66E6DF6CA822F1413F0 [email protected]
390,320,737 *27470E386346A3AB6025A1D138EDF7EC7CF0E8F4 [email protected]
390,320,738 *274C1F0A56DE83F6276D64D794C0F9CCC8DD6DE1 linwoodkunkler
390,320,739 *274D4830ADF394C2EF0526DBDB1BD5C2A7CF744B lipeng.sng
390,320,740 *2740E1D64C736F25C4EBCEE65824674E66CF95A8 [email protected]
390,320,741 *2740093BF0EAFCFE2FF3A0641CA49EDA6AB926BA LISBETHCHRISTENSEN
390,320,742 *274994F9CC054E3E573832F0583DBCFCB77CAB36 [email protected]
390,320,743 *2747706B449A353EAE22527F963DD02F0555FEE8 [email protected]
390,320,744 *27401F2F4FD587D36F39623E48BFE3E0C027F128 [email protected]
390,320,745 *2746EF0A4F0DB60B6C8FE96346FC06E76825BDFA JUNKKALA
390,320,746 *2748A3401B0B79337E1A846C4755A95A64D7DC9D [email protected]
390,320,747 *274251261653E32D1B1FA7796A381A858E541BE9 K2}.
390,320,748 *274A952B97144B25C2F4D28ACECE221670105345 KAPREKARJEVA
390,320,749 *2740D37E910F6C2D76CE13C2FCAE183BE38B5021 karamdaoud
390,320,750 *27457A1B1D5B2F101C9D83B89E95943FF16BBADE LORDEROND
390,320,751 *2741A4E4FB293AD400DFDD6B52FAB440675B5DF3 LOST.IN.SPICE
390,320,752 *274FF6F96991C9B7B778AE2E7651EE0C960E4765 lovebuzz/smokeonthewater
390,320,753 *274FCE4A8D7EF7E39BE7CCE9847271CC52ABE06F [email protected]
390,320,754 *274316DEEA6C111140CE4C473A57ABF03189D683 LUCIANO.SETTON
390,320,755 *274C9042D5ADFEFC8B75D612FB57A05088B73411 KEIN-ENTKOMMEN
390,320,756 *274252B944645E4CBA14FBB8BD11ABBC3B89F079 keithgoodspeed
390,320,757 *2744E334C097E2D3A1DACCA09B6D6CEA99D4923A KENNITHHANEMANN
390,320,758 *274665EF5BA9983909CE98FFFC48BE69B8D3C724 kerryboardwine
390,320,759 *274F592391D2179AA34D74EB325EF58D5EE561D2 kerryrobitaille
390,320,760 *2749FD982DF883A3FD5E249A6D7961F4D25AA3A3 LWANLU
390,320,761 *2742AA1C60D34BAFC875CBAFFCD1F848028AB4BF [email protected]
390,320,762 *2743DEFE5621EAF927A1C1B18350C4EE2CC1B350 kevin-solway
390,320,763 *2742B868331DDBD7E9AC96068FB8D6BE1A48A6C0 [email protected]
390,320,764 *274794871B98AF035D614C1CD9CAA3859F28B7AD K*EY
390,320,765 *274E99E30C33878E5C33F128DEFDF8CE953D02CE KIJKSPELING
390,320,766 *2746EFFADB0616234AC9726665BDB9985ADEE69B killer50!
390,320,767 *2744B2DE62BB17E2680EFD97D50558838F35D613 macbabki28
390,320,768 *274132062CF1F5452D456847595471115F8B7D1D [email protected]
390,320,769 *2744F0698451F16647C956DD30E934A54F3ACE4D KINGS.ACES
390,320,770 *274FC71FCC91E40179FBA7C4ABB82BBF6F0B2B06 maestranza.industrial.s.a..|.peru
390,320,771 *274176FCA6817E920AC0DF2A852D65574D122292 maggie.urquhart
390,320,772 *2744AD4145DB1DE6AC0AEED2753442245A9E438E MAJOR.FARKAS
390,320,773 *2742DC6012DF1634D2471588461D0B77B4523B37 kkhxj50813
390,320,774 *274EBBAADB6F7CB4788131EDB3482B9C959033AE mallabars
390,320,775 *274EBE3FE2B06166777D44ACFD361F8919BEF5A1 mantra89
390,320,776 *2741F7CEE3B3DBD35AA4DDDCDA50CF99424FCDB4 MARCEL.RIPPEE
390,320,777 *2741BD2587AE16940FA9189BA9BFCD9A0ED634CE marcos.sagasti
390,320,778 *2745C7EAD1B02358B3B5F904CC081EBC70559410 komball
390,320,779 *2748AF405E6C602529C5DE004B0A1747113D351E MARSHALLCHABAN
390,320,780 *274A23FD6F389418116198753104D15BFF84C62B marshalldonkle
390,320,781 *274C8A1A46E5DE357B1F30A4E9A764182F035C3A martin.cagle
390,320,782 *2742EB483A687F31CE55522199A8A51854D0640F MATEFAIM
390,320,783 *274AF0B64EC3E0D7863DE2F01A14705B97FF6178 MATHEW.NEIN
390,320,784 *274C33140DEFEC98A53B58B94F1964BC575402D3 MATTHEWOTTEMAN
390,320,785 *27440940AF80922295B07AF60ADE24E68E6FC73A KRISTOFER.PENDLETON
390,320,786 *274EA03D637A3CFE30B1176DA38DE7145684F050 kristoferwiddows
390,320,787 *274F816DCDFC257E1E3254EF9C52D53CD9CC420D KRIZZA11
390,320,788 *274844A88F57C19B59F5C858C20B011A11FA5D66 MAURICIOEMANUEL
390,320,789 *274F33CB8DEA698D9DC0B26A5D719334632866C6 KRUSING6
390,320,790 *27440FC66FE91BDD96335C87EA6EA8921FA4FFF9 MAYORELIZABETH
390,320,791 *274F0B1268B47A931AB819598C2CC1992F1BD555 mayorquine
390,320,792 *274D74578CB2B2308EFAD7A8D3A0E57EF5E1EA8E KWAITZE
390,320,793 *2748A8B753E5369BA7FC898070718C18FD7B091B KYLEDUROUSSEAU
390,320,794 *274852E06FF09B09413FDAA2E6E65A952D82F731 Me&MyChauffeur
390,320,795 *274B69D116B3A4039197C8378FE8819B8DA17D10 lampricides
390,320,796 *2743ACDF171B3C65E876E9DD6B331732EDEA1B74 [email protected]
390,320,797 *274A4BA6D5D560F014475763883E505069F489B8 LAND.TIL.S
390,320,798 *274CEFE1CB179B3363BF3A72B2569520F8847750 MICKEY-CROFFORD
390,320,799 *2749702EA24A15D75F5997CD46F31A4849CFFDBB [email protected]
390,320,800 *2748F494C3FB4AF2B1F79D202B6A9909ECE497A6 "MIDI-JUNKIES-DON'T-SMOKE-CARL-CRACK"
390,320,801 *2746C665D1BF7E2940BC152E5FD6F8D7C8FEBA5B MIDTERMS
390,320,802 *2742DCA321AC55ECC404FE1A6A9CD72AD9138318 LEHTEET
390,320,803 *274F7D92FB96CEDBB18ED586109597BB3B89F8E0 millston.
390,320,804 *274B69E4F87F7EC8D4492C0CB1958A42828A901B MINDY HAUGE
390,320,805 *27429047C7E88AC7D2AB4D631C60C1436849D780 LEMUELWAINKRANTZ
390,320,806 *27465CF380A70872743D07D1EF30A233ECA6F5EC LENNYLICHLITER
390,320,807 *274928369AD6B70877B21532CE15F68257BC9F28 [email protected]
390,320,808 *27475746B395A8E2B56AC19DBF1B2154118488C3 miniature.painting
390,320,809 *274E2F77758B33C0051EC1167B25AC9BA57E1AC0 MOHAMMADALSABAA
390,320,810 *27415676BC951396AF79A8D42F32398E17B9F618 [email protected]
390,320,811 *274CD6C3A916C7C5ADAF80CF724E52CB065E216C monastuber
390,320,812 *2743C5803CBB0D17E43CBC62A59447E56755DC2F moonl19ht5
390,320,813 *274460BFF53CA7CB0432A7BA46204756A0772D74 moyanor
390,320,814 *274460DAEFB2EF7C3227AA4525600AF301CEC399 mr-skin-minute
390,320,815 *274998BE573A5220F0244230BECF9DDC6875F2E7 [email protected]
390,320,816 *27444D97CE5EFAF5FB6CD377888502D21C30BC7D muistaakseni
390,320,817 *274D2BC213840E536194001BEF654B0AA13EB37F NACHOSALSA
390,320,818 *2740BF787AC089BF034AD1243A84D37BA731A86F NAHJBSWED
390,320,819 *274AE4FCFACA5CC7527D5AB5D551ADC13567ACE8 LOSARAS8
390,320,820 *274F542CC66B9D04B9276F005B9FD2FA56C6A63B nealseldon
390,320,821 *27437D9002035387B6B9B753936BE648C0A2CA94 LUCIADASILVA
390,320,822 *2749F23186319C142966970795BBBF7072B6F83A NEMEGTOZAURYDÓW
390,320,823 *274A96290D188730882A849A769109A14031F4CD NGWGFYUA25
390,320,824 *2741F97569A0DBC3211C5A4B8807E0C8734038EC LUISMORISEY
390,320,825 *2747DC21809E5D5D8C94C69470561A372BA7DBF4 LUKESTAGNITTA
390,320,826 *2748C0C9B138659F74CE97CA4A1A83A3CE275087 luminosity7
390,320,827 *274C4AFD0CA65CC300E6BA7A625482F94621F064 noodsprong1
390,320,828 *27499D31FC2937DD0C4BCD1D4DA1CC4C8B87C945 LYLEHANSOME
390,320,829 *274860BAA1CD4E4EF43676303D1226CA1EE9E875 NOTORI$K
390,320,830 *2747E5E727EB696A8B535A00A8F2D211B3DF95B8 lznzgbr1
390,320,831 *2740D9D8CF5DECA917840DCB70AF04655CF7BB84 n-y-ramas-secas-(versi
390,320,832 *274DF10477ABDD832FE1EBB53BC2EA5FC1DEBA2C Obliquons
390,320,833 *274C49DD689BC2FD17A80BA23DA117177DEEBA50 (O_) ~` d3
390,320,834 *274E1B8C67E2D202E166C43FCB44673DD904B536 OLYMPIASTADIONIA
390,320,835 *2740AE0015C06573C0101424BB5F3306B6EB51DE O]NK
390,320,836 *274E17293BCAAA2083F17493F8E30415E9275FFC oproerige
390,320,837 *274DE8F700249C3DAC2F27A9FA1E8CC45A526107 OSCARCOCCO
390,320,838 *274C9D7E15D31BA12CB179185286FF6EB717745E OSCARHARBERT
390,320,839 *2749BE0F84D965E7AE0EFC95EAEC1708F645589F OSVALDOKALCHIK
390,320,840 *274E56D18DCB0E780B510E91562E212622C2CC49 MARLINCOOTS
390,320,841 *2740D00CB3CB4ADEACFFE93B786F2176F698DBE7 ou71i3r$
390,320,842 *274F406ADEF6E0815F07F0EEF59A7A4C7C6DCACA P####>*-(>_<)
390,320,843 *2744138BA952D4DB3F66FB98108F4C989015AAFD MAYRA.VILLASENOR
390,320,844 *274BCAF3D7A77A45EB82614075F622B566EFBA2E m"ck
390,320,845 *2744BFDFFAF1D0D4970693D97A712519017E2842 meros-del-heptano
390,320,846 *2748DBE127D5D1F0178B9F2354ABF7B825BA690A mertayuda
390,320,847 *274FD539870287B2985E55AB5AA8EEA82DFE969E MICHALE.BENSCOTER
390,320,848 *274FDD1D17FE31E529FD4DC02E1982C38E8174B4 michelconover
390,320,849 *2749F02375F82D68D788C7A20EF1C72EE0321973 PALMERSOCHAN
390,320,850 *2747CDC52E761C12D39266B4A27C578B640D606C MIDTERMS
390,320,851 *274ADF70B092451798555AB282659815901EE9A3
390,320,852 *2744E11F767BA20F657E75072A2CCC7D449C7B6D `ƻu
390,320,853 *274346158616D8523195DF5428E354A29932A21C mindyreds
390,320,854 *2746E7F85495E6A36F47365585883873C7B9B8E7
390,320,855 *274E23EC9A747BF77AFF3B51CC214CBC0E156401 ꕵ
390,320,856 *27477BBD36F40B0A65DE391005CEE2BA81A1BBA6 x
390,320,857 *274417866B9CE502C28C61FC44B0F70BF9E3D8A4
390,320,858 *274C26B4A416A84513E83ECAE046623C821CE3C4 !$킢
390,320,859 *274614CDD4B285A9036D6AAEE10B2D18905806E3 
390,320,860 *2744F205C731CEC0BB7801938B8C1BA47F24786C
390,320,861 *27491FEB9AFFD273D15923E5EC6F5336A8856480 [email protected]
390,320,862 *274E8C403DFDAAB1F84AC9A5FC90E98B97F6CF5A w)ޱ
390,320,863 *27463A75E76D8DD24B51A7D6B6030F5F9716F87C MKJREDNEF
390,320,864 *274E7C2542DE6239FA562076990A01D354010234 _<C
390,320,865 *2741E44AB722251EA1E7DCFAC00BDB7B5F2106A1 ͓T
390,320,866 *274AB928FAA3C2FC0B65BFFB35580B1816C9C870 MODETHERAPIEN
390,320,867 *274A455EA809C3D02EA7586702601109BE842A6B
390,320,868 *2746197D784392416883FCC9C94A983D0CA08FE4 mohammedbecton
390,320,869 *274EF3853A37EB7A97F55F7D4E7188F1EBDDD072 Օ)
390,320,870 *2745EAFCBA42934F61D178E6AACA19497CD13524 '
390,320,871 *274047B56CD19038FCBB216EBD54880736D30625 MONEDAPATACON
390,320,872 *27407E454B0550EE1E85DF411548288B80B98C5F
390,320,873 *27407AE2C8172D19F43E970B533FDAA2D554CF97
390,320,874 *274559E0D0ABBAECB6DD2918CA3CEA845DED81E2 MONTE.TITO
390,320,875 *274EFDDD8883DA83E9A2D5CEDF2A1AB745018C4F g
390,320,876 *27414DCD417845244FEE22DB37C2BB39D31232D8 MONTYMCAUSLAND
390,320,877 *274240AD11A1799922DEC97BCA8BBDBF9FAE1069 
390,320,878 *274A2016E2DD28190A478EDA72AADC2426D7E560 $%8
390,320,879 *274CC7E610C1D2C14D5D225A69E2CEEEF3D8867F
390,320,880 *2740728DE8AD008B4B97AA3377614ECFE3BD1895
390,320,881 *27447BD6070E913EFCB4E087F288E386BF388F01 8
390,320,882 *274CD4A0B84EF61B0CD9B69761130D50C9F69C99 
390,320,883 *274211CE4D11DF19B1D6593AB2C7493762376AB4
390,320,884 *274490F6E41AAC5DFF0EAB56EA4EA94A0748C8DE 
390,320,885 *274A36F8BA7EC49EE99ED74075A9E1E2992F960E 3~
390,320,886 *2743E80CAD54275CB107E882BF92310412873397 n
390,320,887 *2749227C51F66500A1C23B05F219C94D7C5109D0 V
390,320,888 *27461A92404E3DA6E0DB22301867C93E2F15CFA7 B
390,320,889 *274274E70DBD30D95379309E535ECF85E462235A MORREYS5
390,320,890 *27455275259AEB6C0159196FBF90A2B9AFECB9EF MOSESREYNOSA
390,320,891 *274DD09EF2DEEEFE1B421F7F52E011DFC01532DA [email protected]
390,320,892 *274DF71C6FC2F6EB7A6C5E272752501B05046904 [email protected]
390,320,893 *274FD366C02E94C588571BEA77066C4541B381C0 (00)~`.~`<######b
390,320,894 *27449BB59C04AEC02544C165DB31A19F9B9FBFCE (0_<)0~-<==P
390,320,895 *274AF381FD65199826150085848E787EFBDFF30D mycatch2252
390,320,896 *27456594C8A1B0CC0EDA8E73F9ED2C2BB191847A MYLORD,I'LLSTEEPTHISLETTERINSACKANDMAKEHIMEATIT
390,320,897 *274B3BC2203CB4762F0A13FD963AEA13B8D2F5C3 myronhanisco
390,320,898 *274C549BFD246302595DC42A77974587BCBBE742 myyoung65
390,320,899 *2745977C010DE67E1BD43346349DF78942738F49 10autokraten
390,320,900 *27455D266D45B3E70B72FCFCD997BEEA2E614159 10-miles-from-nowhere
390,320,901 *274931F16D9A120484344140C9635DFC138FBEE1 NATCH BONE
390,320,902 *274F513ED32EFA631DA6266F49F91CD45D2FCA60 NATHANIAL.MCCURRY
390,320,903 *274345256ED2719265B3C3FF5DC63403D9FCC197 NEALSTANGANELLI
390,320,904 *274C50B92AD71C9E9DF26268B3E81B385739017C [email protected]
390,320,905 *2742639BA759170E535B5FE3ECD8215FC93CCB6D 125neil
390,320,906 *2745BFFFFFC885010ECA5C7F2B084FC2282BBD07 12scottishsongs,woo156no.9:"lochnagar"
390,320,907 *274BEA7AFBA683FC47272FEC0189BBFCD18F4308 1350659 t
390,320,908 *274E739DF5780EF7C7CC72EF135BB175425DF2DD 1361142 KUVIEN-AVULLA-K
390,320,909 *2743FC8BC50E279D44E127ABC1E7A690ADD780B0 142ZANIYAH
390,320,910 *274EB89B9E86EA602C411A9DD44E8BFA320B4552 15071679
390,320,911 *2747008294823D7D9FCDA8A9918D5EF41294C2A3 NEVILLE.NEID
390,320,912 *2747E7479A6F430D3D9E546D060F15FC7800BD2E NEWUOL
390,320,913 *274EA7F0C2AFCBCAF8602A02EC0842B075196E79 15BLITZSCHNELLE
390,320,914 *2746DD50292B865504A8FB45E4222726553A84EB 15 SUUHYGIENIA
390,320,915 *27472A3B779538A2EDD3E0BD13E4AA7188A011DC NICKIJAINE
390,320,916 *274434024C13D8F1F343825A728F8E13F9F612DF 1746293 luostarisen-kev
390,320,917 *27455233674D964EAD6FEFC53F142B10526EB13F [email protected]
390,320,918 *274AEE08175C504DBC15473B57A387117B88CD7F 188837 PUUHAKKEEN-ENERGIAK
390,320,919 *274CB40E8D6491DBE2AE0A0A9EB7191B23D98B7C 191828 sporortamInInolmadIGIyerdesporolamaz
390,320,920 *2744F838C8A7108538E374D617D31FA97E81D55A 19.UNDRAMATIC
390,320,921 *27413DDCB5F4CA49FDF15932FEEA79390310769C 1 ANTI-NIGHT-SCHOOL
390,320,922 *2746DF203B99980438CBDCFF753159E0E8BD88F5 1 BODENFUEHLER
390,320,923 *274DFE5903ADF350343A1BB5C0E95FACC480D74D 1CHIKINOS
390,320,924 *274DD752BB1774A2D53C8840362398E23F97E6F3 1 CHIPPERFIELDS'
390,320,925 *2747C28B6F01E94C9D80B175B08AEAD838BFAACC 1 coloradofluss
390,320,926 *274FAD4A5B183D9D600E636F678159BF37D82D8A nmrchrd
390,320,927 *2743CE6E4E4DFCD9A40C447ADFDCA96CD47885C8 NOHEULK
390,320,928 *274FB2A3ADB9D5D76CC19B1426B1F8CAE20CF145 noisewontstop
390,320,929 *274F5A37C0FB933CFF5DFA58028D1E756908EC84 [email protected]
390,320,930 *274C1B028BA73D00537456AF35D59A047DBBF57C noticias21
390,320,931 *2746C28BD7BB59EC50EC88DE362C7678FA0FD994 1-FUNKTIOA
390,320,932 *274396EF281D862AD1A9DED97857C44B545003F0 1-genomf
390,320,933 *274D1FF4110E12C27DDCE7CA8575C161B98E039A nscvngrd5
390,320,934 *274AD39282DC66910B0972F554D7A2EE57FFFE66 O1iv3.fam
390,320,935 *27431C20B61AC62F458FFCA511B0E678B418D1D4 O61245
390,320,936 *274925E02846055F173900C7411E49FEE17C31DF o$c11ome+er
390,320,937 *274A3691CF41C4B4488B2CA8B3D07110366DE2D8 ois-Jacques.Ossang
390,320,938 *2742E841D6B487A0335196AEA08324E1138C644C ojojtraeh
390,320,939 *2748E94C3B381B2AEE2EE74299A9E78A579671AD 1.PLASTICLIKE
390,320,940 *274FA7D40752B4D768B80944B6F07A2B02062FFD 1-pystytt
390,320,941 *2746C84FC3A85AB180F4F2DACEBEC543F9D3AD0E OPKALFATEREN
390,320,942 *27487329C6058FC3821D646967FA9F68BD851B03 Ornlm$r
390,320,943 *274AE1AFD2AF64D53E414DB95AF531050864AA48 othaniang
390,320,944 *27461481DDA985B7117C6E4623B9860DFF1AF815 OTIVOLTA0
390,320,945 *2749B4B7E6985CD4EA00E8D83BDFA41671B9D3A8 ourania.pavlou
390,320,946 *2742212B3B2832E4C36024D2E5650C9D96A4A5C9 Our.musty.superfluity..See,.our.best.elders.
390,320,947 *274D8D2770CAE046980D53FBAC7AD5D4AA255E6B overtureno2inbminor4
390,320,948 *2744A4EE433F127655C0D578D0AC798E0D5D3924 [email protected]
390,320,949 *2744CD7059D40247C6F4D4F57AA7301A97523C56 [email protected]~0~o{x}
390,320,950 *274B62055F9B58280E2D71C47AFD502CD7291D1E P19931990
390,320,951 *274EE2BC7E890C9484B53212D92C75B0EAB4E6C4 2090357 MY
390,320,952 *274FCB748401FB2382FFF3099144AEC4DB640463 20-KUEHLTRUHE
390,320,953 *274289BE0BF7502F1FBB4EA1CDB287D83760A0E2 21536
390,320,954 *2746EAE526908CA8AD04ECF938D572834EC217F4 PAPREAL8
390,320,955 *274D672BD1EE822E2977A0B9EF7CB5CA7CA3BFDC Partie0303:Cequiimportait...
390,320,956 *27428D6B6E2C67443801CECEF0453D0588879599 27RESPERS
390,320,957 *27427AB29477156296499E8203F9872F9CDB9DCA 285483 tehlikeli-ve-zararli-atigin-tanimi-.
390,320,958 *274A8D5E15F039ED2841F3988B7B50023B16544F PCVERSIOED
390,320,959 *274FD5F2EE2D1A06BC05D3D2730325BC7684A8AA penguinstuart
390,320,960 *274788D77F435FE58CFCA823652C9C308DB4A960 PERFORM A DUTY
390,320,961 *27484652D3397F3FD11AE6E537342F0DCF8F5D9D PERITR0P4L
390,320,962 *274A26F369D7740899979445CB874DA97E3A9BFA perovec
390,320,963 *274C2EB89B36E7F3D3ED22BBA30E89E55C9EE95C pgq
390,320,964 *274C3BCB4EDACD8FC8E9A6C1BF5CE3EFFE06E514 2DUDEDIRK
390,320,965 *274F02F494C914FC26ABDC3228D7B18E21F0CD2F 2KITEMSRA
390,320,966 *27439B3D61FA974F53B2FB5AD0237BFBDA169048 PJINKTIU3
390,320,967 *2743BC9E5C260BDA8917C676BC7F22D22D3347A2 [email protected]
390,320,968 *2748F0935BF1DD79BF0B6AA5CF608683E66D5A60 [email protected]
390,320,969 *274508C29C9AF02EEA0156C301BBD64BC44CD015 2.pintails
390,320,970 *274AFDA9041AC5ECBCCB1550E748D0FF79D6C02D 2 RANTZAUAPOTHEKE
390,320,971 *274EAC26A02223F7ACEA7E8D00E47A191D02B724 PLOWBOYS
390,320,972 *2749156F81CF45E606C7B397FDF5F801820B90F3 po14rize
390,320,973 *2748487D11A11D2A349B6D7CAE82DEBBA0AA8819 336EMERY
390,320,974 *2741263CBF8AB4E65DA9D2E30CD9B57D9808B57C POZMĚNIT
390,320,975 *274E914BE2A832A3197FC9F8853F127281479068 PPERIWINKLE
390,320,976 *27478B480AF3BD47A026B1D3015224BA963B6C89 PRACHI KUMAR
390,320,977 *27440969C4CEFAEF48C2467DE1C92841FBAD1944 3DMARK®05
390,320,978 *274222871D8C1687FF97F875BF6892C89E1B6A9A PRÄRAFFAELITISCHES
390,320,979 *274E9F113FCFFD7A8CBC58CD651495953C689A4C pre-civilized
390,320,980 *2743F01421440FD5E54C5DC05D578ECAEAFAC09D [email protected]
390,320,981 *2748BB2A02B969333C0B9460317C673313D8AA72 PREVENTION.CANCER.GOVPREVENTION
390,320,982 *2749B0797B290DB6D141459F5B72067CC0386D10 PRFFNRDN4
390,320,983 *2746FE8E8A19D576DBF808C167558F8FCEEDDF83 PRIVATEIDE
390,320,984 *274A5C65C44135AD86B7131E4323DA9CBD37FF13 3STRMBND
390,320,985 *274B4D2B9EE87242A99B05AD99C6EC04F48F849C 3THESEARE
390,320,986 *27468BC7A442BFFB604B022B547B91267919FE93 PSIWO1234
390,320,987 *27470FB3B321D7206E4A57BF4BCFCCDA9823214A [email protected]
390,320,988 *2749A441C90AE288B0E21F8AE0872A505E98585C PU/@
390,320,989 *274D3EA783CF78B642CDA9EEE9E3E0C78D1836E6 PUTTAVITEE
390,320,990 *274756192633ACF3CCA4009199F12050D58083A1 Q7VQ
390,320,991 *274EC9AFD02356450DF46095A872E9FEAB283E70 q-d~ ~ {x}
390,320,992 *274F29595D3780710DE1259DD5B58AD6345D8BA6 4LUMINANSER
390,320,993 *274C9F76FAD6DD2F90197850E60AE353748382E7 [email protected]
390,320,994 *2748DAB940C6D4E0F9AA9BA7429B394817E3A4E9 qlhr
390,320,995 *27450D1F211DAB5BB150D338D4FF67B8806E4E94 Q######P ~ O><
390,320,996 *2740BA3CE0F7D002675C43CDCB721D28F99C5093 quemehashechotu
390,320,997 *27494ACC0EA55B43DD6945C43FE07521F654EB38 4PIGOLIATES
390,320,998 *27414FDF948EA4F69D77A1DD284EFE134946A899 QW<-
390,320,999 *274F1527AAA8C3EF1992FF6A060D906C62E863F3 r31!gh7$
390,321,000 *2740C891B40B62AE41BAF65CE27A7F7102072797 4THATLESTAT2
390,321,001 *274B1B9BF780EC73BEF3C7F009B22C3CF8B696BD RALEIGH.LAIR
390,321,002 *274A50DAC5C906011BB99825EED80AF751E400CF RANDOLPH.FISLER
390,321,003 *27438BC7E3C3A891CD924750E01C7BE6B446F090 RAPHAEL.SCHICKEDANZ
390,321,004 *274F856E39234BD5B110CCCC5DDF52F47D9B60DB 5ANGELAONE
390,321,005 *274B8C958AA58BC0C50ABFD9043E5F54E4238072 5ARAVANOS
390,321,006 *27456220A50CE653B1970DA5563107405D6DB9FC RAULBUEMI
390,321,007 *27447C30E7B7F86EDC200233A888B06F129B007A RBENDERSKAYA
390,321,008 *27430C3232367901FB0A7C40A11EBEF44BF91808 5GOFORITCANCED
390,321,009 *274416BF3AC5628BD351DB73E4C19893DD71E636 5GROOVYCANCED
390,321,010 *2741984E5024AB59EE9F2625ED26000BC2D3A8EF RECONSIDERERAIS123
390,321,011 *274C2D0665C6894ACF22CAD1911697015C9213B9 RECORDGUY
390,321,012 *2742BF61E5ADE97EB4D77093FB5620177CF83657 5PERIMMAEISESSAE
390,321,013 *274A1CA30AA32C8EF0EF1642EA1790AF6915016C RE.LES.SOURIRES
390,321,014 *274AD91EE893EB9D01803C26FA47F8B07DD01E09 5SHAKERIM
390,321,015 *274111A01839AA3A5F3FF07A4693C447092C86D1 RENEGADE.COLOGNE
390,321,016 *274CACEC91D112E407011B737447BFDBAEF4A751 5SOFAREXBSW
390,321,017 *2747CFC6B7DE32D6203B807BAE375B2B2E92D824 5.SPIKEHAIRED
390,321,018 *274C4B96F9AFBA3AC156F1ACF42AB703E92627AF 5stoerst
390,321,019 *2744845D530C9FD9B1870919D7447530461AF326 5tigmatization
390,321,020 *274E1DD322B26A7018EA51E196A79D57E02E6311 5USAEMSID
390,321,021 *274CF41420681167A797A23BE654A86B9A3D6B56 RE.SURJOE.SAKIC
390,321,022 *274BECCE2A9E2BB12316B7BE5C8999F0E0F3005B 657RALPH
390,321,023 *274DCECB0793B5038FD0768ADCC671614037A932 RGOLDENSTAR
390,321,024 *2741F065DB19CB7833FCE7E40963FFF3793009D9 6CITENEGECSIM
390,321,025 *274C85A405E975A994DB9485FFAF5D30E354AB5E 6HERMESVIKINGS
390,321,026 *274F27F0B3DE8CA6D78E98185F247645E60DB5B1 ROBERT.MILLETT
390,321,027 *2743526537E5A8F3DED7EC22AAC2574B5DC3334E ROCKIT.STEADY
390,321,028 *274BCF4A269920DAD34B061C888703C4192D87CC rodolfospengler
390,321,029 *274D5ADE0878CA21925C01719A1C1293214B6B61 6TANYABABY
390,321,030 *2746C3DE07F980EF12D912D56EBD62C63D17C386 ROFARRET1
390,321,031 *27445B2CC198F668C466BD540090595E0EE56C67 6UNSEALER
390,321,032 *27492B163796FA4DB6AFFCA64C99FFD12B45D632 6WILDLIED
390,321,033 *27419F2A0279EFE974A1917D679C29793342D7BC 718971 " es sollte mich sehr wundern , wenn das hier klappt "
390,321,034 *274DDC35BB547D4E3619D07A2FAFE459B3CB9247 729MICHELLE
390,321,035 *274BA91623857120DA3B74498F402505B31D75F3 ronvassure
390,321,036 *2741F2FA072E9A512AAB55D7BE63B11FF5065368 rorybasilio
390,321,037 *274A2C39B2AD54BD483B4407ECD5D3D05D81B898 rorypinley
390,321,038 *27411184420A1ECB21AF42E7E880C7BFED06264F 7AMISSING
390,321,039 *274438BD96D3E7DD4CBE7283C476DA1991F02D28 RPL]
390,321,040 *2744E12B644FAE011FB51C1878E24E2B3A45C1E1 7DIVADELNM
390,321,041 *274BE64A1D2E267E20FBA43885E7719860C95BEA 7DOOMJIMBO
390,321,042 *2743A4C67053ACFBC680623E81474C5239F9C8FD rubbianino
390,321,043 *27419BB6E140090CB2F13CDA01EAB65A2FBA0701 7foreslaar
390,321,044 *274692363EF64492192A2F0281D76989AA1CC3D1 7ILUVDRAGON7
390,321,045 *274391530E9816360FC8A3D0E3BFFE0782BFDA1A ruptimed
390,321,046 *2740633122D8C097F624CD8815A0C1965F13FC91 RUSTY APPLEGATE
390,321,047 *274CB9CD4F21730CF6F9DD9DDFE3AD62BDD9FBD6 7MIKOSHI
390,321,048 *27443FA294A3910E37BBDED82841B32683D7AFCF rvoltes0
390,321,049 *274EE3331B7144442B2C668A71EB60B9DF2B6F6F RYSZARDSKWARSKI
390,321,050 *27421C30C19856C94878286134F3C86FD71F8132 s]=a
390,321,051 *274327BC39C12E618E57C45CA7C46B5A8AB675DB SABIEDROTAJĀM
390,321,052 *2746DDE2C81747AFAA50596F1908C4D082F2BD70 SADG
390,321,053 *2747A1EC657E822544A194BE1AC424A33032BB1C 7UNDEADFREDERIC
390,321,054 *274A3DF575CA7DC6FABFEBBB722C0CD3C59666D6 SAMFERDSELEN7
390,321,055 *27417BDF3B9E015BD1D1FE6FD9F17C6E98228D25 [email protected]#$%^&*()=812
390,321,056 *2740D888316245A8E7A5926B6D29D681A5447537 SAMPRAVESHITAAH3
390,321,057 *274CB13EFAF001345A280761B3CA370FF2A5E166 [email protected]
390,321,058 *274DE9A7A7B0A9B54BF467B466EDEFFB1687ED37 8BGEWINNE
390,321,059 *274A219438E64B12F2B23EE420364BD47477F10D “SAPPHIRE”—ITS
390,321,060 *27431C0868599C5FD8F25ACB8E9DA5820FB4B146 8BRONCOSMONICA
390,321,061 *2742B96FC110C9E5BE1F26AA06F2CFF0BE1E45E6 [email protected]
390,321,062 *274473D9F246AB33B796A0688D404F1499A62A21 8D79C36976A6323EB90E7C09D04F7186
390,321,063 *2741B02C7BF20A9F0E3DEA87A8EF3F345DA7F8B1 8EINAHMEN
390,321,064 *274183F0158DB5283867161121FDB77E1C91BA37 scilent79
390,321,065 *274A07D23836257967B04BFCA0A6669D86EB2A2D SEDNEDIEMREV
390,321,066 *274FB066A48A53FEA64BDF9497352F476BD0096D SEICRBSW9
390,321,067 *2749FD06B70D6EB845264BF8BD593304059EAEA7 SEJTELLEDOMS
390,321,068 *2745F78EF68842025B7EEDFE0E88F4AEED2DA246 SEKALEMG
390,321,069 *274B7CADCB04C861A9A71867DECF9032B9A909F7 SELPWILLIN5
390,321,070 *27489C3F27CCF1D1FE9A8AC3FF4C1D0FD2569E6C semisaint1
390,321,071 *274CBB761B6D3FF24027CFDF99627EA234C4ED68 SETHPINKOWSKI
390,321,072 *27478424787FC0C80D9D3B22533C8BC41DDAEDF6 SHAHRAMING
390,321,073 *27494B309CBA96B4FE6DF0A00835F392BD1D15A4 9MICHELLLIBRARY
390,321,074 *2749E2272F02D7A87FEBAB438378C05330380776 SHAWAIKI1
390,321,075 *2741ABA7B11F69015BBD7409BA370FCA078D8A1E shaynemoitoza
390,321,076 *2749B8B1AA76D259579AE1841BAC32CBB79B8FE2 9OVERROMPELENDE
390,321,077 *274D2BF35E3874A55C797C5164401C1B136023B9 SHERWOOD.FUGLE
390,321,078 *2741694331EB066A0536BE4EB59BF24C47EB9E0C SHIHABTP
390,321,079 *2743DBFF6FAB7DE517FC414875F2423664136ADC SHMITIKH5
390,321,080 *2745F879853ED9E6A88C55843AB75FB85FFD07CC [email protected]
390,321,081 *27479B7C03FFA2EFB949DEA1CB2D492C984695B3 9TEKSTINBSW
390,321,082 *274A6006BE55F2FA96A30B0B39B65903AB4B304A SHOCKED AND GROSSED
390,321,083 *274E881576DB7CDB0C59869DE30E2077AC11BB2A shsvox
390,321,084 *2740EE854274173EA76F0D7D6958D6696E260A71 a0eo)
390,321,085 *274E02480B9D7F12AC681685E854E5936822FE2C [email protected]
390,321,086 *274695F190582B2CA2D5EE39B0D5737879F98E5A A7VCM
390,321,087 *274F6CCE218CDEE875264AC107C14C82037FE0E5 SLGTSKABSFLELSES2
390,321,088 *2744A3DAB8AF7153344CC75F513052CA400A8E11 [email protected]AR.COM
390,321,089 *2744F78B6B2D7DC1D016009185401E526B562702 aaaurz
390,321,090 *27432512F464BE84E81FF20C63566AE022ED8004 SNEINIKIB
390,321,091 *274204BFC2FF77228EACD762D21D4E311D55AAD4 AAD&G
390,321,092 *2749F56A3F0FFFCB5360DDC4ED12A7B55DA0543E sorryand
390,321,093 *2742216609C447C44E1DF1FC3F8030A586B0B904 SOVAROTATOYSED
390,321,094 *274A075D089A5949CD816DD925A347F0EE6CE9D1 SOYLEDSING
390,321,095 *2749BD54DD2FD20C894F9C6A9609CE04090F3909 acaulescence
390,321,096 *274CB162A1F74D224C4F678767A4EF38915C4D3A SPIRIT WALKER
390,321,097 *2740EDA52AF6DEE5FAF701A5DF79A5FCCEAA0CF4 sportsfest
390,321,098 *27427CF4BB489DB2B4645F8512F59BCE80A7E00E .sselepoh.ylrettu.,nam.,sselepoh.er'uoY
390,321,099 *27468BF63194199B2D91780CC12AD6B7E69A04D6 SSOGEGNA2
390,321,100 *274AB029653F72C6AEF98DCFCC6EC517645002AA SSRITUNYARAT
390,321,101 *274E30F9ED24F6AD53B5F98EDEF738C8300F5951 advs3rs
390,321,102 *2749DE2B5AD7785EA1CBCC4B61BA530485987CC5 AIMIEWATTS
390,321,103 *274F9D9379DD42D540BAFE6BD32E2B84CE3EAAED ainohthcs
390,321,104 *274F4D9EB3E0B6F96C73DE791DC3615A70730631 AJTMD
390,321,105 *274972EE8743BD9A1DB192289F44FF542973EDC5 akvagroup
390,321,106 *274DC54562635B56E3879F517ABA1080A6AC3E31 ALBERT-CAMBA
390,321,107 *274264B2714343BE78CDEAFDE617ED7D6D4F804F alejaylenin1987
390,321,108 *27482DA19C8127E2BB993BC1D1DDB2F85E797EA0 algesthesis
390,321,109 *274F4CE34B8591F07E97F113479B604101372658 [email protected]
390,321,110 *274E211C4AE56F17CAA866E03E0FB4E70B7A1824 ALISATIMELIATI
390,321,111 *27413F213A748A8E1C6798814986D305976D0087 [email protected]
390,321,112 *2745D421CF2BD972C532C3270EE55FE2A26D2656 sunshinecoaststingrays
390,321,113 *2740D2AD323324B49FF49AE0DF6CB3FDD7E5EA92 ALLENSEVERYN
390,321,114 *274F1DDE8408C98678F68988F27E069BEC421AA2 almamay
390,321,115 *274159AF16DF25DBE882B98B7D8111EF6F193A43 SURSAUTERAI7
390,321,116 *27495B38BD24A12F2AD56BFFACF05186A9444D49 amanda.weast
390,321,117 *274996CA51973BDFD7F5642079DB26DB7DE9FE01 amaruni
390,321,118 *274867ED564C517FC1C2DAFFC18BB87C7859DCA7 [email protected]
390,321,119 *27431DBA4F683630B38AB2BE3174B9AAF18ACC0E amethapred
390,321,120 *2745C468537C37A86EAFACE89380BC67266F2357 amihud-6-0
390,321,121 *27455EBCEDB64251B1217DB7D7B33C4A08F1A464 am,?n
390,321,122 *2749D9D152082606F5117FFF2DBA9E294E283BE0 and-told-him-on't
390,321,123 *2744B8883916636D25EB9DE39FA87F6B75EA47E3 and yet detested life not shrink thereat!
390,321,124 *2740A918A21262EF5DA321E839737CC215387888 [email protected]!35
390,321,125 *2741A0944F60D2B393C62F189E11D0A9223E1F29 [email protected]
390,321,126 *2741C6E4250E8B609A09EF9E78AAC25074C1B327 ANITAMCQUEEN
390,321,127 *274C1D6BB61DD53EC0D77E8201427F804B64C888 ANNIEYSEBAS
390,321,128 *274C02C3947874E0487A73BB8982089250C461BE TALKTHESTIUS
390,321,129 *274697E7AFF55FC268834F9316344B2A1B875284 tamibrandl
390,321,130 *274308BB94599479E32A446780C1ED556EDFB917 TANDPOEI6
390,321,131 *274A3850D9917B43E884FB908C74CF754CE03037 AQaX
390,321,132 *2749492AE1F49745C3729FFBFA2AAF1D848EB9E0 [email protected]
390,321,133 *2741968F99554C244B44FD3B9DB99C525BF99B64 TELEVISIONESPA
390,321,134 *2743E47E2C0279D8A469EB15F4B30D0D97C25C38 ARDELLIS9
390,321,135 *274EDB6F97FF7AD834E6DDB37F9CEDD57C9D74F1 ari.ardiansyah
390,321,136 *274067936D9E63DDE36F584950802E684FDF771E templategurogu
390,321,137 *2740CC538346D12C39AEBE1A4CBD118781497A14 TENTHRED1NO1DE4
390,321,138 *27459CD353F5037DFAA6772738827EF317B73EFE terrarium-t/e/'r/(@)/r/i//@/m
390,321,139 *274156D898E034599993160192DD11DE88867C4C terryreifler
390,321,140 *274D21062413A720787383A24A3EFE08A0DA4ED5 TETSUD-RY
390,321,141 *274E69DBC5792878C67B1810521A3D57B5102E80 TEUQOBLIS
390,321,142 *274E82BEAEFB4B6229F840408EF13E60D77D73C4 ARLENSEIZ
390,321,143 *27416DAB0C272969F2B8D0857332771621D32D37 ARRIME0
390,321,144 *2743DE826263FF22AA88AA403B4E167C7565E29C [email protected]
390,321,145 *274AE02019C3B873D6A195AB2F15F0FBC5937FAF as$+,
390,321,146 *2745C7944A5420BADA946390E0315F83549C4B11 THATTACOBELL2001
390,321,147 *27462B08B49DF78C981FF766D85B9654D86C22FF THELINDSAY2002
390,321,148 *2744255E001D79C86184C045C1B2A79C6FC9F442 a+:tv
390,321,149 *274240BDD41DDD83E6C7FB801931817584A86618 TIWARIBUBELE
390,321,150 *274D1A8685BCCC8958E3738C3C922F8B66E6056D AUGUSTUS.KLEINKE
390,321,151 *274685D6C214D05B06C98DB94B048249D28E166F TLCSTRS1
390,321,152 *2744FEF40C8299C650F4B35DE1EEB312967D814F TNASSERPEDITNA7
390,321,153 *274134893436FB508927383DBC5155D563A26281 auv&o
390,321,154 *27473EE70D2FFC81E7F5AC00BD76DEE4E25EC8C4 A)VJF
390,321,155 *27476879A686D96C6AD6EB0968EA104E751DD8FD torre-de-vientos
390,321,156 *274C6FBF33B3AA0B7427E247EF4D2112F673667E TOUCBBSW2
390,321,157 *27411B82A496F7D50789EF2C69093CCA77AF8E42 TOUR-SCHEDULE
390,321,158 *27426317F58BC53475236F8DED8CC3E719DB7243 AYCW
390,321,159 *274A6B719214F8FC6D0E2D938D9407642E90FD3B az&)"
390,321,160 *274DA19B0C9E9D0064C592D3589058BFED8B154D trantesmith
390,321,161 *274A689985C382C2C516CC4AF1AD6D94AEB7A0AD trdansr
390,321,162 *274E84AA5017300695925B95889C9E4C6D85F83D b0ata
390,321,163 *274BAEA829AC493EF209B4F26550A69FBB499BDC B9TSO
390,321,164 *2748E2FB18B574461DE21D4CC338464F7826325F BADGERDILBERT
390,321,165 *27497FF01B5E95391A3E50C5E3306B6D571A5C7C twijfeling!
390,321,166 *2744E138C580C9FC25D680E4B958CC5E585A91E0 tysonmehlhoff
390,321,167 *2741C694E487616AE8DA1579DB5CC30314F06DF8 BASSIANUS Romans,.friends,.followers,.favorers.of.my.right,
390,321,168 *27473A8F70A0D10EDE9CAEFD9A2CAD2ED6E7CB2D u21987
390,321,169 *274679328EAAF8C344668C7B0147FE6352E45026 BAU!#
390,321,170 *274B36FEB53AAF10F0D989B1D8EFF114DD0BF0FB uieschillen8
390,321,171 *274C37D7D43F6F146920CEE76E848D2F05520738 BB4WG
390,321,172 *2746EB4DA47916ED1FE06112038C80327307FF45 umm.mani.muhammad
390,321,173 *274081E944785077E867D465AC584E52E32A5B24 bbp,e
390,321,174 *274F7C306E241C985C35C3B4BF98627AB4ADF6CB /USR/SHARE/MAN/MAN8/PIVOT_ROOT8GZ
390,321,175 *274FCBA9D3EB64E8C506EF04014BCB3EB0A7FC75 bck-d
390,321,176 *2740B4B17032F01AB18D73540512C97940737433 UZNEMIRAVANJU2
390,321,177 *27464F018D8A78BE8CCC591D16A9EAC9AC24E0AE bd***{x}
390,321,178 *2746A217B45105144F9607ECBE2EDBB879B78616 VALERIANOED
390,321,179 *2741933F2241E403F465BFF9996905005885E388 BEENINLOVE(FEAT.PHONTE)
390,321,180 *2742D258DC951A761C24D8A2800B9A6F2D749800 benedictterracina
390,321,181 *274ABE778926C3004CC740D1509D1503C2F6ADBC benedon0
390,321,182 *274A3652B8AADB09663E8A3232D53851C012A5E4 BERNARDESKEW
390,321,183 *2745557DDB53762664B40DFD3FE3562C1F48D843 BERNARDO.DIETZEL
390,321,184 *274663F4CE16DA124FEB1B0E055A5C2112266807 VELKEORVISTE
390,321,185 *2749A88AD146F2FCCE02DE9EE044AC78BDF6659B VERDROSSERS
390,321,186 *2747DF6CCAB044325583E8930D1A488DC0EA73EE b)i/&
390,321,187 *2744B1BF64910C8CFC1A090D74D367EC41B9347F bi7(6
390,321,188 *274480930276A0DAD448E65ACAE25AF2C8B127D7 VERWUSTEND7
390,321,189 *274BBA071FCFFFD151092ED38EDB650DD3E8CD26 VEZETO
390,321,190 *2744F81CD858BFFC7934997EB5DDCADFC8FCC6F9 biyyc
390,321,191 *2742E4DF316AC962EFA3F1D70290402A32FB9EF9 BK_E5
390,321,192 *274A864CB93BCE67529CBC8AF69B0C086547ED0F VINCENZOKAWULOK
390,321,193 *2748710CD63DD3951AB04254E617DEC7D61793B9 BNRKNNNGSLCHS
390,321,194 *274D8007D1F65E4E2F5C872900019E1FAF2CFBE5 bob=q
390,321,195 *2748FAADAA2D2853D4498228829AF3E217D79DDA VIOARAS3
390,321,196 *2743F4DBA1C91196534262A94EB8B65C9C8564E4 VIRA-WILCOX
390,321,197 *27429FF0BC57CF1DE33FB9D5947FFF1F72998E09 virgilmahley
390,321,198 *274916E6836E9C517EB9C39EAEFC9A3328F11D77 VIRGINIA-HOFFMAN-MASON
390,321,199 *274B013310BEBE7BB2C09C52BC238D8BE194E5E9 VISHALGAWAND
390,321,200 *27408AC3767B146018DD10FB06718D14B94AB8B1 VLADRUC
390,321,201 *2741B798790F131E68B08219056674CC5E73ABB8 VLLLAD1122
390,321,202 *274E0D815D1370A1D772FCF4ED8C8B977CBD879E BOOKERSEARLS
390,321,203 *2746683954B76C41AA62DB8543049AD86D111932 bozomarty1
390,321,204 *27428693B005F87ACF2AA50D00E39FCA74B42792 b)_p_
390,321,205 *274C23C2D87535D36D1F750D453A49ED83BA3477 BRADRYBOLT
390,321,206 *274641426E84BF13DD320D431068C113F01AC865 bradyprakash
390,321,207 *27407405C72CE78F88484614C67F2E10699E9DFA BRANDON.FALICK
390,321,208 *2742FBDDE82AC8D4B7CE067FBCE82A0664EF52A7 WACHTLERS
390,321,209 *274ABECBED49175BCAD41507DBC8F35CA6FB2E3B [email protected]
390,321,210 *274A96F3260AFB835E5ABFBEB8C2509CD19965B9 [email protected]
390,321,211 *2740ED7F0E908CFA295F457CAAD2ADFAC180D7D6 wareztequila
390,321,212 *274BC9399EBB20F89D7A5AFFE0277D5796F23356 buddhabar
390,321,213 *2743D8895A355E4E2A7315CB34E84904C92A7EEC [email protected]
390,321,214 *27445F810E9299A8790C92E449B35760F87FC9D4 BULL2007
390,321,215 *2747D4EE899B62F9B6AF4BF217D6F2B790155B23 BURTONMICHEALS
390,321,216 *274C58EF1841543C63F20946104243EB71F41EE8 BW?38
390,321,217 *2741DB5B9FBA2D8439A30E1FAAAE370B6C96B00E weschrusciel
390,321,218 *274EFF48EBC5DCE456C03039472AE923F3EA7F1D by/
390,321,219 *274DBCCBD28C1CC337FB41350E76E33FB2C2855A west.side.story:.prolog..allegro.moderato
390,321,220 *27401BA189011F900EE7EA234DDB5C9717288737 C2V/C
390,321,221 *2740DE1F63D0764E26FA13F759D759F2A97DDF55 c6fy+
390,321,222 *274D433DCF154EFD5D9377DDC068430F724D036A c7cl_
390,321,223 *2741C37CFB3AC5448B844399A2BEF0FC38AD5A70 WILTONLESURE
390,321,224 *2745DBBBE9919EEC97946A1CB5490BFFD70E761E CANARIOS FROM SUITE ESPA
390,321,225 *274183313AFAAFA512095BF7AC3880BD2FD44F99 CANDY-FLOSS-SWIRL
390,321,226 *274D642DB400D0D0704C92F5C667042B993DA9E7 CAPRARIOS
390,321,227 *2744B144EF516824DEA5A89E09AB8942CE3924CA carrie.gonzales
390,321,228 *274FE614B2CE0A8133EA6584DFFA45F2144E25F3 CARTENNA6
390,321,229 *2743655FA8B8E245C1B47F667C783D7FD42AF147 CESARMIRANDO
390,321,230 *27449D2B39D9C8D6812CDDF5CB5CA278012D0010 wwwspittlerecordsit
390,321,231 *274347694804F5763E0ABF0D7A632EF00B72F3C5 WWWSYDNEYCELEBRANTELAINESEARLECOMAU
390,321,232 *274C76D4F944AADD3F58D4B6034D60565C262253 x0j<
390,321,233 *274A4D7949447D97346CE5A5346EDD38E1F015F0 CHARLESDROZDENKO
390,321,234 *274DE243EB657E40C88F46B4E06FC6F89D153CDA charlierayome
390,321,235 *274C26615A7B59C01120BFA937CB4FD1488CAD37 chàtre
390,321,236 *27430DF1ADB2DA17D2F5760FE68786C35B7B18EE xneaaa
390,321,237 *274DF64B50A3496C7BC855F928CCC6D639B4F0E3 C:HIG
390,321,238 *274B480FB8197697F8FDEFEEC5A5E01D61ED8234 [email protected]
390,321,239 *274F09D401B422A21CA3523AD58184BF09CC132F chistes-de-uno-que-era-tan-pero-tan...
390,321,240 *274F017F798F125E9F5CFF2B0A3897EF32673E7B CHRISTIAN-LIBUNAO
390,321,241 *27474F93A419C6CD3D760CD68363CDF7BAA31E57 CHRISTOPERSCHILDGEN
390,321,242 *274C68F623D5DCB32BDE2A4BD968D1CA4DF1DEE9 CHRISTOPHERCICIONE
390,321,243 *274B657E6643F193E4F912995070C1D3F4CD8ADD c=hs$
390,321,244 *27412FFD75B82C7380395366EA34BA424354AA50 Ci==
390,321,245 *274D639D74021A91CA9D467364C6E774E31D87F8 CLAIRBLOTSKY
390,321,246 *274F262D28BF45EA660B21AE2F39F4420C875979 clarencehoran
390,321,247 *274C5C4EE8AD501A0B4EB04AE70730AB752B7ED1 CLEMENTE.GREISIGER
390,321,248 *274443D2258673E8CCF6564426ABE83F4D6C3B6C CLEMENT.WITT
390,321,249 *274A322D50FA6B6AC2D819CA51940A2935EFF345 CLEOLYDAY
390,321,250 *27467E217549925E9BC32216B20C074D993442A3 YEBTED
390,321,251 *274EAFCECD4B31BDCE2EE0EF51ED0C2A4D2C75EC YELLMI FARIAS
390,321,252 *274349721C31A39CEFA2A43D22CE5B9E3BA5EC4F [email protected]
390,321,253 *27416603D053EAEF042A6EAECAA7435F0F725B63 YOIÇIZAEMON
390,321,254 *274755C6C867F2C34454CC1DE4AD244987EDC3F8 CMGZ$
390,321,255 *27448BBD50E7B7A968AF9C615FE3130C27177650 COLOSTRALING
390,321,256 *2746C8D56CB7629F7EA338A975034291C5DAA023 COLTRANE*
390,321,257 *274CB90F5B6BE67895195C24B9354EFBADB3E50D zachariahmeecham
390,321,258 *274B92BBA3063D9ADA782BFB3AEF61DFB5E2E1EF ZACH-THURLOW
390,321,259 *2746CCAB4C5CC5DFDD4A7C08FDB0F0ADC56343C1 ZACKARYDICKEY
390,321,260 *27479348005BF30C1FF8A38F044F8718EEFBDC66 ZAIRE651
390,321,261 *2745BC26393AFA57690E300228192DC04A5A1C6B ZANZABELLA
390,321,262 *27446D689F2BCBAFF7561C1E14F9BEC082879DE4 conker2
390,321,263 *2742673D337CBC22C7450812F06807D99F427B7C [email protected]
390,321,264 *27453D6F9506787FE0D46C40A5F7888FCF1E2E13 CORD&
390,321,265 *274FE43B2A9B4CF4C7915CC73CD8B428B2A79723 zobacza1
390,321,266 *2743A3FE00D7A21EDC8FB94D8B79B66394CB3A18 c=q4k
390,321,267 *274944888E74C908C1FFAA2191EBC5EBA0E425E5 CRASH.10
390,321,268 *2746D6ADABE679F58749DC0F5025B616D3648B5B ἀναστραφησόμενοσ
390,321,269 *27418E3BC4C95D6A066D0F2DA809DEC10DF5BD70 τσουράκη
390,321,270 *2747BA07348384AC3FDA06C68AF0312BD2CD4D4E АБЕЛЬМАНОВСКУЮ
390,321,271 *274C6AFB7935E5C14808AC4C606EEADBC49C0390 [email protected]
390,321,272 *27422F92DB3D945121D63A81522C6A8325E5AA2A CS3UH
390,321,273 *27424040CA9F423EFDEF7ECB2B4B7B04ACAD91CF ДЖАНЕЛЛО
390,321,274 *274B0677DCCA34DE0E1D49795427F37904D8A72B CS.PN
390,321,275 *274560B5C5BCB719072851DE24AAAE013F741C1D [email protected]
390,321,276 *274A698BF6E33BB7DCF1EF8CF7167287A17B455D currd
390,321,277 *274E313703B508C2F9487D1AF03A03B7AC727E76 CUTKS
390,321,278 *2741241C6261699F080F71377AF7722B58A87F8F ПЛАВНІШИМ
390,321,279 *27458AE4DCAEE909AAB614845D497500D2534599 поесле
390,321,280 *274DBA1454BC7A2DEB8D484354321714816D25B2 d,5+l
390,321,281 *27413D4AED000E104E1A1BD0255CD2ED77E486E6 хронолоігя
390,321,282 *27489A0E597334927B89367FDF7B9F2474AD46A3 [email protected]
390,321,283 *274CFDCE1454EDD62217CCC8604A3B227338AE93 [email protected]
390,321,284 *274DC75843C4303C125BD277B24F16F26D4D98ED DA.L6
390,321,285 *2747093D174BC2B40B9D197AE453F0B7721ECDCE damian f
390,321,286 *27481A6217BB5BE1939C931A6BC1098ED41E2CD2 DANARASKIN
390,321,287 *274A0D33B6F17FF0CE0C85564621331609791FBC DANASKIN
390,321,288 *2742BF67E9E398AAC9939C71A6463B56AD198824 DANIELSONINFO
390,321,289 *274AB9F94A83FD43293424BDCD147107E40BE1EF DANNIESAMUL
390,321,290 *2748F77D462C2BB656FFCDC4BC16E7D89D7FE0B1 DARELL.TURBIDE
390,321,291 *2745DC46B61676663017C599B4937CF8748EE242 darrickbondanza
390,321,292 *274E9365A3259CECEE86BCD93F41A23FC7ACDDD7 d)atb
390,321,293 *274A2F5F5B99EF46A7DC237BE876B3522805DCB7 DAZ&S
390,321,294 *27473A05767519D0AF871F161FFD26F975C27673 宇宙企画 classic 山崎かおり (2002年8月17日、宇宙企画)…『私を地平線に誘って』『唇・未・遂』を完全収録。
390,321,295 *274BB53757952A0938D74E41FD796E4B4D9A70AD deliaver7
390,321,296 *27444802712BD10C569F2A31A43EAC4A95C516BB のメダル獲得について記述、銅メダルすらなかったというのはjpovであり不適切なので差し戻し
390,321,297 *2742AAC044CB57F07DA6A8CF23E10C87C29C104F deshawnvenetos
390,321,298 *2741EE622727712509B5AD2F6D2190C2302FAA6B designhornets
390,321,299 *274F1C9A8043BD309410B1FE793147B5AA113EE7 dilloncarlone
390,321,300 *274436CFEB28970DA04A3DA4F4AF225C384AA490 DILLONTRIPOLI
390,321,301 *274F34712D41EC12AA3B3047B2FC3E452D7CBF9F D%I$N
390,321,302 *27444DE6A835F52B72A4B3F6A06C9E1B32DAD812 [email protected]
390,321,303 *2743EF48A2D25A54B6BF702E43D739B311CD5539 dixie.land.band.from.santa.claus.land
390,321,304 *27427B2C099DBAC6C181262A0189945BC0D8EF0C Dk4f
390,321,305 *2747C07B6B24AA14233CBE4D194856724E28B226 DOMINICVOTER
390,321,306 *2745FD86F7D8C3D5AB3E172531A9DB036061A146 [email protected]
390,321,307 *27431C4F6EC53007774BCDF135C878E18B501EDB DONOVANNELLIS
390,321,308 *274AD0571F50CD17A2B2039FF2A98FD6606EA56D DONTE.SPYRAKOS
390,321,309 *27482E3C492B4C2A21003BA8DA8808F2BB7CCC25 Don't Lie Again
390,321,310 *274602AFC660B45B2741F99F3795532E72AC31B0 [email protected]
390,321,311 *2741E6462E806CDD6AA22C8C3A87D03DD05A2337 dorseynush
390,321,312 *27492AE5F0F25425C45009DBC0E72F5DA99205AC DOUGLASSMAHURIN
390,321,313 *2741CE91776FEB414A8974B970F191C84E455BD1 DOUG.STRACKE
390,321,314 *2740A87DB82320C214781490D621DC82D9224604 D$OW#
390,321,315 *274395BF0A66F23A9683BA3C79907E8BF1BA61EB DREW.CADIZ
390,321,316 *274EA5AA5985BF475705381619D8D52BCD857362 DREW.STRIDE
390,321,317 *2748B5B9344B61C20E8B9B0B06C30B130262E78A 1476276 LOPUT OHJELMAMAKSUSTA MAKSETAAN 34 ER
390,321,318 *2740D17A43F83ED1B67D129C97BB2669A5CCA77A 1500480 se-v
390,321,319 *274BDE8E5D1598EA2FDB7CE03C2C9BD5F5CA46AE dsly0
390,321,320 *274ECC31A9BCA1317C869AC3D46C06524420A817 181259 tuzlu.sularda.cokelme.hizlidir..
390,321,321 *27466E7C43BB8F548F6F9FC24A595E5C8CCAD0A1 1834522 SELVIYTYMISEN.KOKEMUSTEN.KAUTTA.PYRIT
390,321,322 *27436B9D978A1AE2873E6999009732231DB57171 DTD%"
390,321,323 *274CAC448B03E0CB143BC457DBCB3C40A142BF9C D!UDG
390,321,324 *274435F1C55795B9324F4DD0327DB2EFFDE6B972 1ARGITEK
390,321,325 *274B4DF4C4E594B28C4FFB2A25E4DC4C19B17C44 1birnen-senfsosse
390,321,326 *274524AEBAD657EC49D942CD4B069A5B057A973A E1ONGATON
390,321,327 *2742319B89B64D1FB33C51CD6E029CA2F562E6A3 EBURHOE
390,321,328 *274E67CED7D8D10FB134BFF0A77718B11629BE6A EDGARSOMVANG
390,321,329 *274B4995EDDA3E0B194D081A2114E350919CC463 edm18
390,321,330 *274AD06C751D90FE99EBC10E6C3545C2836A28F2 ed-robinson
390,321,331 *274DAB7C8D173A590E583AFC2E7B1CA46047B47E 1jatkotutkinnassa
390,321,332 *274C651987A2F6CC7AFB8F7D421DC93C42B516C4 1.JUGENSCHUTZLAGER
390,321,333 *27441D2D4C32C4E3D61AF169AB3E470D4FD405F0 1KIPEAET
390,321,334 *2742DBA0544B6115EF4F36B765640A6B63E340BF 1koenigsetappe
390,321,335 *2747609220DBFDEFD1799E7A8B96503351B096F5 1-kultasep
390,321,336 *274D90FD01C15017443C6AD89FBDFBA243E57FA2 1 MINDERHEITENIDENTITAET
390,321,337 *2746E9C1F1B0208BCF5D2242654AFA653FF3A484 1.NUMBER-BUT
390,321,338 *274D9C66D8B564761FCC1DFEA3EB3787DFF592D1 1opiskelupalvelutsivuilta
390,321,339 *274301C9853E845159AD8EDD14E0CB40C5E1EC38 EDWIN.VONA
390,321,340 *274159D7E9713135A082A85AFF48DB79D34AA676 1-PAINTING-MOST
390,321,341 *2744E85B48777E5430E1AD6E036A8EFF6DCF419C 1palvelupuhelumaksu
390,321,342 *27414B7CDE059DDB031F64006AFF162BFA7F7A2F 1SNOWY
390,321,343 *274B7772106DD0C66FC2D03ADBFFF5F21736D280 1.urschweizer
390,321,344 *2745B240A583472C743F0DA7B161D3FC3E20EAB5 1valkoviineiss
390,321,345 *2741F2B62F13026C4472F230AFD4DE497CC5D049 1 vilijelij
390,321,346 *274334882DD924F8CD9D72AE5EB8CE9CD1032592 EJTLEIRK5
390,321,347 *274EBBE3D5B3155FDDF29DAF060B07E79782B94E ELGUNI
390,321,348 *2744225B3F92BD984F29F137893B1B97D4AB9FC7 ELIAS.DEMONETT
390,321,349 *2747D28FCCADD099A2AC855D711F3C71A9F12FCC ELICHERNOFF
390,321,350 *2746DAF55DA4B9F2CCEDC690072F86EC6C069A84 ELILAKIA6
390,321,351 *274E0D80E9554BAB8753946D4B18A65E95F6DA07 ELIVRANTING
390,321,352 *2742312ED0593900F64268B4EC70E58307437241 ELLIOTT.DOUGHERTY
390,321,353 *2745F5BFBA30B44CEC672B22D86476A03A1B4C7A ELNV
390,321,354 *274D2DB0E9D70A2C16AAF80749FC4D226A15FD01 2878500 TOISAALTA-KUITENKIN-KEHOLLISEN-KOKEMUKSEN-J
390,321,355 *274C8CAB5B8BB1166B84749E53F84116C3C909FA em4lw
390,321,356 *274B2A13949D66C93B0CFAC5D0210B22C9A77F15 2chartshow
390,321,357 *27484949C4016343D6ECBE8F9BDD0A63C7A1714B 2cocacola2
390,321,358 *274280A4E0E23E991EFD76621F81F1C7FEEAAFE7 [email protected]@+E5
390,321,359 *2747D808E5936CD80F186142560AB60CDFDB4184 ENRIQUEMARKOWSKI
390,321,360 *2740122BE79F483B3504852E42D5507EA71E8DF6 2MURDNUNO
390,321,361 *274DA154C9884212E7F91E9F9E886388B35FC3ED 2NUTROFDG
390,321,362 *274341D8C4710BC71BDF4023D1DF02D36FE2EB07 2OSVETNIK
390,321,363 *274C4F9796B1A2EFBE7B0E6B3F03671C50E1D424 2 TAITEILIJAKUNNASTA
390,321,364 *274F1144127D20F73B1C8128CA8A95391921EE51 2.tarkastuksillaan
390,321,365 *274F2E3EDD8F1A3E73DDD6D6B3C2BDFC1B68791F ERICD.DERRICKSONG
390,321,366 *274F0F3437059DEB495F1A4767C24CA834199D4F ericmadueno
390,321,367 *274C3B07365A9ABB05E163A24BD6EE0FFA92FFCC erikadumont
390,321,368 *274CC78D7DF6EF8C5904DFA3AA5214E5AD72AEB2 3BEESETT
390,321,369 *27442C13FD6F294AA2E5EC7055096FDECFD28827 3b<--o~-0~(======8
390,321,370 *2744E1BBA874998368D76D14B7E08234AEE3101C 3-B*-SPLAT
390,321,371 *274FDD76CA282C6741DE6CB2021A29B8954C52C5 ESVKF
390,321,372 *274809D69A3EC4F54805194F7D06E8A7A3B02222 ETALEDNAMS
390,321,373 *274E37EEE2A12FA039A0C6DB9AC3295A4B0919FA ETANAGNA1
390,321,374 *274C77F69E30C291F6EDA6817CAC9CF538454347 3P.~0.~O.}O{
390,321,375 *274C9A7D7B346D270DF8DDCEDB704FF9E73175B6 3TIMES-WASHINGTON
390,321,376 *274C28521155280B867421D6378172D5C2DA3646 408BRENTON
390,321,377 *27485F4B59F2263E840D046CF574FBA3F810758D EVERETTEMAJESKE
390,321,378 *2743E79E1CDF3276C923BB2F5CAB3D5078DE54B3 EVERETTE.PENNIX
390,321,379 *2746FBB444B8FC61567B6A1A299B2D9DC06A750D 4 himalayagebirge
390,321,380 *2745A81AF8957A1E271CBF051AAC907013556A7E [email protected]\y
390,321,381 *2743DA1290048D26D2279979B229D6F97368C11C FABIAN.VITORINO
390,321,382 *2749BDA2B831CEC09117F9EA9556E7450F05ADA9 4OSTIGUYR
390,321,383 *274A37983454E32A8E6ED972495AAAEBC96DCC4C 4WANESLEET
390,321,384 *274C5B1A9B41F6BEDB624F7940C5EE0D08D9E1A6 4WHITERAPTOR
390,321,385 *274BB79696DFAF47630868F163DB3EC713573A3B FEDERICODAVIAU
390,321,386 *2747ADA91C9D10AF116A94DE7C63961D6805504F 502misael
390,321,387 *27456DF06D5DE2FD410D73876E8FE76DB47C7F98 582594 ASIAKAS TIET
390,321,388 *274EA7BE3770080387E36AC68ED9337A9B6DAEE3 [email protected]
390,321,389 *2742CB6F00C85A519643DB1A242D634BA1DC9133 FILIBERTOSLEPER
390,321,390 *2743B79E9686D88C13A650E40E20372333F3E0C1 fiq4
390,321,391 *274984225DCF9463F212A4D43660497CCD4161A7 FLIASARING
390,321,392 *2747D40EE408E62D332EA85B1A45C7FD3B374C20 5BSWLIBPTHBSW
390,321,393 *2743B79748E76AD325B770D4994C945C8FD721A9 5CORVEESES
390,321,394 *2747C4BEFB933A7F3A815DBAB06CD8B1A2146B67 FLORENTINO.KOZLAK
390,321,395 *274F0EE86B797A77F28FB0398D4DE9DE57348ACB FLORENTINO.RAMDAS
390,321,396 *274C24ADA0D9A78FA290A18B69975888A77DBE73 [email protected]
390,321,397 *274AB03265A2E008562955E252D5B2CC454672D8 FLOYD.FORNICOLA
390,321,398 *274032A9C9CF3FE6928FCF9A7A33537FD77021E4 fmgf
390,321,399 *274A3B627B41497C53552524FD6D09F9D68275B3 [email protected]
390,321,400 *274F859FEC8900A9876B2FC0A12981850C8F22B8 FOZZIERICKY
390,321,401 *274DBEEAC9461EBBA255991ACB786DF4DC6A9520 frånkischen
390,321,402 *2749A83E617B90652E19E9C1441AC9BB46A4B8B9 5LINCOLNVICTORIA
390,321,403 *274D7EE670F4C828068E234790CF1E8CDDA19C78 fredricwatrs
390,321,404 *2743D2C3A49AED74063CCB6893341E416D1ED918 freezeintime"foreverinyourheart"(englishversion)
390,321,405 *2748CD1B9A506EBACFF4C82D2E588AD8C0A127E2 [email protected]
390,321,406 *27448FB60253779116A13AFB09D566733386DDAC FUCKSUSAN
390,321,407 *274AA50336C8D0428E87370E8930F4B9E4AE0334 5THEBOSSBIRDIE
390,321,408 *27417A62AC50889FBA2ABD89B80671B6789A36D1 FULL MOON FAIR
390,321,409 *274E28B279AEDC2D2D84B273C4E001575BB6DFA7 604398 FESLEGEN KOKULARINI TASIR RUZGAR ICERIYE .
390,321,410 *274B467CBF81D897FB3B0499A0DCB418A3C5628D GARRY.BOLEJACK
390,321,411 *274B2EB540065E26E718F5B48C919DCB5B16F781 GARRYPRZYBYSZEWSKI
390,321,412 *2749834F2C21EB64B90D0D6AAD66F945FA5CE9FE GELLERSTEDT1234
390,321,413 *274F7CCF4A9E572DA7B7D7E588F9539A16044215 6BOLIBAR
390,321,414 *2744D86A881293FAE4A95DBBA365EBF8EAA0D0F3 GEORGANTASMILTIADES
390,321,415 *274B805E8E7759591A9DAF0DB2B09625865346EE GERALDO.ROSATI
390,321,416 *27476166834B59C35325C4C4245B11EDDC18FEF3 6e4c1a7a39a6389b90aa548bdee6b92a
390,321,417 *274104DFD30A43A1CFFB3F598EA0C0C345616E34 gfoy
390,321,418 *274023F1E89A3B90AEAD9F63926756DB5C17CC8D 6MYSALUT1
390,321,419 *274380F8615863DB1529CB9590041A00E0AA4914 GLEN.MCGRATH
390,321,420 *27476E9799AB160CF1D4D9ACFD929BA147B383EC GMORAGUES
390,321,421 *274E97A40ECECD0502E739294CAE49802F139979 6PURPLETENNIS
390,321,422 *2742AAC14CD791C45E80195AF798235CC602516C 6SAFECORP
390,321,423 *27487155D8A24C726E61F5E4F9CD786B855DF4D5 [email protected]
390,321,424 *2742760D1F142AAA6412EEFD49AD213DCBD89E2E 6SPECIALDUSTY
390,321,425 *274F196A9982B769FB05EB48B7E770B53C07282C 6THATRESEARCH
390,321,426 *274E11E546EFD52F500196816B22B6E0A062ADA1 GORDON.BASSOLINO
390,321,427 *2747D5B0B28B4B4C92F9BC0E6CDFB2BB1B845C65 [email protected]
390,321,428 *27412008CC6DAB439447783E5BBD82CAEC31129E gottiried
390,321,429 *274274150AE2C6F39D2541264B934CAC9A033D89 GRADYBAUMAN
390,321,430 *2749B46AF19D300696A908FC081478875804522F granduque
390,321,431 *274CA9B80DC94E5B040807E2294ECE3013B1BAFC groverizzard
390,321,432 *274D6E090D9ABDD1BAB9EA0C718ABA204C105090 7,baa
390,321,433 *2745C3CA37C5EEDEC9C49F9C9843B9D99CE2AC52 [email protected]
390,321,434 *274246C4529A2155B33C0FB76472F68D16E0389A 7CAPTAGES
390,321,435 *2749E7192B3C7A134B80DFF6F3FCBBE956DE0F3D [email protected]
390,321,436 *274930B1B0BD2F0C758240812B97F5309F6E5B6A 7EIGENSCHAFTSATTRIBUT
390,321,437 *274F77D319582FC17B4AE782C59144639B60F1EE 7FOZZIECOWBOY
390,321,438 *27454535519C810BC382FC859CCDEBD153F76673 GZ6V
390,321,439 *2749FB19A1BC309C30A977962ED7260AC0070CF7 7NEIETSAPREVEL
390,321,440 *274221D6D1EDFFF624DA00CEB6AF5BEB7B811941 [email protected]
390,321,441 *2745257A3B2A6E26B82CD15E20576CAE7094F5EF [email protected]
390,321,442 *274D9A82B04F416E7A8A265FE2798ADD4049E2AE HAPPY.JAMES
390,321,443 *27408FED5C0AA52A68CF6A6A6CA68410CA90B7E2 7WALRAVENS
390,321,444 *274C07A60A51479B206352D956580B88EC3780F5 HCAYIAHB9
390,321,445 *2743642A009ED563658DA2B85B7AA7491CC8371B HECOMESUPSMILING
390,321,446 *2742DB22DFCDBA275DBAC47D80CADEAEA0189BF7 8AXOTOMOUSES
390,321,447 *274747AE59DDB9E84E6CA490F805197CD4CBD55F 8===B**)O(
390,321,448 *2742CE2827572D0FDFEBEC83A3B6B786531BCB4E HIDDENQ
390,321,449 *274BB925C3ED510E92AA8D04B44FD2BFC64771C4 8GALILEOGRETZKY
390,321,450 *2742EEB7D3710E3DD304FEC2DB5820D08B11BC24 8ilovenation
390,321,451 *274AD3FB7E33E32168000D5F7F06F39D8EA59DF9 8WEIZENS
390,321,452 *27440D2DA27639A50011A6D906CBE5F395E8241B 8WIDGETDEFAULT
390,321,453 *2742088507D88F03D2F0584946B0676E306096D4 href="//KingEdward/ref=cap_kpm_pdp_0
390,321,454 *2746C98CDDA799DE6338B652EB07CE72A3CD6CA3 949167 kars.sivil.dhmi.40k-43d.1.795.6.1988.yaz-kis.degis..
390,321,455 *274C51FA90723580FDE6103657854FB9C800AC06 }9aa
390,321,456 *27413C4459479B9D173C340DCD7D7CEE36C6EEBF 9BSWDITTHAVONG
390,321,457 *274118719634A5CA9B08C88956594831F1234FC6 9COLORADOMARINA
390,321,458 *274035C12EFD71E476C021A79797A17A9DE78E56 [email protected]
390,321,459 *274C3D6D55E5570FE0B37C04AE1F04F9084E2480 hydrographi
390,321,460 *2744A7A5AEB0177CC2BF22B2D799114E86E69081 9JOHNNYKIM
390,321,461 *274F0982EC2DBE26B7F1571DFACAF2C4D60409F2 IBUTTHEAD
390,321,462 *2746869E7A802F9D07393F3E03ABD94ED9074A4A IGNACIO.AZOFRA.DE.LA.CUESTA
390,321,463 *2744058E11F4211D3DC14ED3F3250B6E0D96FB0D ikyokuin9
390,321,464 *274A4D17F61C2A04D0D4461DF4B87E675C55B3F6 ILUVBLUEEYES94
390,321,465 *274D20BA96F754E47D4150818117495D2E0EB77B 9ZABLATIH
390,321,466 *2748EDCC947AAAD2533D245999B3D6A434D04A8B A:[
390,321,467 *274B68D38A1F1AE4BE335E4817B6FDD16E1523AA IMPALA13579
390,321,468 *2743731167E070BEF5A9B634B88E7C851A8714BA a3%8:
390,321,469 *274377BD4DA93E477F4E413E6F0B3E9820BEF897 a-5gh
390,321,470 *2742D269AB68EDEA2AABFA87CEEDAE367C33C80D AAE"@U
390,321,471 *2747AF2A0071A6EDAD0E2FA4E8A09C9D97B0BE07 aaib_
390,321,472 *274CCB81EDE79D72D92B69D81099E7BEE197A35D ISAIASWEBLEY
390,321,473 *2749B79164EC67328E102FF4BDA75737F040C3A3 isbn100312960433.16
390,321,474 *27415C6F5303BC92002707C18C7079728BE5D23A aatg8
390,321,475 *27479F6A4540EC6F2C265EEE39C2CA3CFD160931 ABOUTWIDELY1
390,321,476 *2749EAA4938ADBDAA8A4ADD7E4BC9E76A508DF16 jack_block/dz//&/k_bl/a/k
390,321,477 *274BC9BA9F642EF8973859079AB62948DA30BF0D JACKFAMILIA
390,321,478 *27438224ED1462275A07FB4FF5097681692C2B61 JACKIE.COURTOIS
390,321,479 *2744CF2D1BBF90645B270845541F55E4ADD45CC0 JACKIELAURITZEN
390,321,480 *274DCFFD9CEC0BA8849567063165D3F304A16649 jaimemulchrone
390,321,481 *27457D62AD2DE17F357F473810D496C914920FCF JAIMEROGOFF
390,321,482 *274F09E517058A3A8F5E6994A20C7391B55A6695 JAKENO1
390,321,483 *2744D83CD916AD64FB54C091D9C1979B3DA2AA84 jamie.behring
390,321,484 *2744D099815F67BE89E635558EE9AB02ACBF02CE JANECAULEY
390,321,485 *274FEFFAF8EFD7FD641255FAEDC71A9C53FD8809 JASONVEGETABILE
390,321,486 *27455F51BFE31FC93138E7414209A7F1651ABB7F JÄTETÄ
390,321,487 *2743FDF2E956FCB7C458180CA9FA9B8203A143C7 jeanscai
390,321,488 *274C08E861BD84DB26C6E7FC2859B15889386D12 ad3ka
390,321,489 *274709CC3F9451DFB120FC21ECFB1FC5954A4F1A ADAN.MORPHIS
390,321,490 *274D46F81AE1FC7D387C15DE04CABAF481CBF4E3 ADJS
390,321,491 *2741B275264412E9A94421EC744A365DC134462E JKORRECK
390,321,492 *27463C6F0B1F8B7235093730552A94C59D9E71A6 AGUENTO0
390,321,493 *2744560F86ABB2F1CA63C3B134F573419FF1EFC6 joaquinginsel
390,321,494 *2748737E56FD57BEE2130F1FA367DFFDBC348981 ahey!
390,321,495 *2746DE2E8AB8B1FF9BF0F4A7B9D0B257DBC7B823 JOHN.LIDGARD
390,321,496 *27438D44DF21076860DCFE1C618D785FCAE96AF4 jonahbreit
390,321,497 *2741B09670137FE9C8339EC9327A145AD62ACD2A JONKEEFER
390,321,498 *27447F1240E3A6BE4C521CBDA0E7DE97F034ED9C AHTUH
390,321,499 *27498538D456FAFF35672C9D3CCB4EDDAB661E0B judesottile
390,321,500 *2742A30DF002DB38B67A7CE67400908115945FCC JUDE.VANSANT
390,321,501 *2746AADA1B61AC5644E71530749395BCC86FA9B8 judicious!
390,321,502 *27419152C62296D310D18A8233869D57DB6FE40F julieta.morales
390,321,503 *2743F45DBB54BE5A25F1EF7C93DCBAB0B291115E jungles.of.the.world
390,321,504 *2749D70F470B9D3B3A5EE161BA6654C709FCDD4C kânûnî
390,321,505 *274629524089EC0A8DEC8277B0EDC9C9C5D1D3CF KBLUTE88
390,321,506 *2748351E00A20862FDAA7A47F037B095199C7DE4 KCOQWJE48
390,321,507 *2745F097EC1BCFB4E191430241B97300E59D5BBA KELVIN.SCHMITZ
390,321,508 *2741EF5C69E1EB06DB23B57B398B5F8084AD646F KENDALL.FICKEN
390,321,509 *274220C9DF77767EE48630B22646860D5A5C616C ALECLUNA
390,321,510 *274BA958FA3C91C1A9A06DB51275C66906A8C842 KENNITHKOPPERMAN
390,321,511 *274784CEEA3B80695BD67C2B53C1A14A9815C026 ALEX CROSTHWAITE
390,321,512 *2742D830A78DC1FE1C790760B7C654D04884CB4C ALEXGISI
390,321,513 *274BAFAA76B6B64E5762A02EBCF23238F5FB4C40 ALEX.VANDAM
390,321,514 *2740FF819E094238E38DDD42A02374EFA8469310 KERIGIAVANNA
390,321,515 *274AF47FD8950F3D82534B3C8D51D8F7D7C06168 alfredquesnell
390,321,516 *27414669E222F34CC706662F07270A32150296B0 KESKUSTELUNBSW
390,321,517 *2749B7CEEE80218AA198EAAB082DCC91CEB06D72 KINCARDIE
390,321,518 *27447511F5316D698DA13274A04B6F7D208FCE2A ALLSTATE
390,321,519 *274F01F41031E0CE22D8320A26942645853A30AB [email protected]
390,321,520 *274D1682A8BFCFDB6156CF8FDD442666E00FAC38 alvbm
390,321,521 *274CE8588BD3B43E0104F67D42E85C15309C1281 KOMPOSITIONEN
390,321,522 *2740815F33725CB5E797890071EC61E35123644E KRISTOPHER.KEIS
390,321,523 *2741DB46AE7737BB5B065896F4043FE6950C99CC KS,E
390,321,524 *27479FC4AFD825DEDB625D8E020C79B6DD662ED3 [email protected]
390,321,525 *2746D268F72E70BE7EAC48A8E107884119F3D08B LAKOVITS8
390,321,526 *2742965F2925333B2AF8352F78D9C44BF7FA5B9D LARVATUSPRODEOWORDPRESSCOMLARVATUSPRODEO
390,321,527 *274F6A320B8D6AB6949ED326E2D97E430735DA46 LATEEYAH
390,321,528 *274716F7928C8235CAC11A51AEE56DA441C9A07C LATRANT
390,321,529 *2747E35F764C757B8F3B4D930C4BA03C9A5DD571 LDSTKKN6
390,321,530 *274D7FBBA7A41778B7BD8E7DEEEC7EBCEBAEED35 leifrandoll
390,321,531 *274B861E7F17F1AB0EC6004378CE3EC45DF4A3CE anhy
390,321,532 *274F84A45ACDBE150CB6019AA4353CB97AB2FC74 LEONARDO.FARRO
390,321,533 *27493CD730ECCAB859D56FC88B066EBA72422AF1 LERININGYRYZY("SONGOFTHECARAVANDRIVERS")
390,321,534 *2745EACC234B7C42E38DEDDE2B16C48671B4F796 LESLEY.GALDI
390,321,535 *27435CD85D5BC09BAE1529E801F0FB5BFCADEB39 ANTIPASHES
390,321,536 *274F4E856D99457A21C3C9DACB890DBF3B68F5ED ANTIVIRUSBY1234
390,321,537 *274092F77729BED2E575D07619184B7719DFEDDF [email protected]
390,321,538 *274F3E1DB76E850A72D4E4B941F9C6FF68591DD3 LIN4LOOL
390,321,539 *2741DCA2432155622F0F4A51D111E91E7686EE0F [email protected]
390,321,540 *274755116000F859CEF6CB975602B965A8635311 [email protected]
390,321,541 *274908845BEC7E2A2A82426E1E4854A0FDDF90A9 [email protected]
390,321,542 *2745296CD24AEBF1DA79D166B19806ECD2063823 [email protected]
390,321,543 *274A9B47F0C03E870106A5083A6A27F3D50D7040 ARIES8444
390,321,544 *274153952511A35DE5F1EDEF5FF3EEAFDFAAAA6F LOOSELOGO
390,321,545 *2746D41FF421C73F330FD30234EDC59AD0729FF9 Arn5
390,321,546 *274D0C43D68FD0A6982E4192CC71121A6A85B5A2 LOVE-3.1
390,321,547 *274434E46E6A1D9B35D0881E081A7D59BE2DED01 artwhitton
390,321,548 *274591D35D9966ED8D00CA469485947824A171DD LTANAKA1
390,321,549 *274D211DC6438A170EE182E26160E92C3EEF5E65 AS-CHIRICAHUA
390,321,550 *2745277FE7D0FC4CDFB65CA5A6923AB38B448B98 ludeca.de.mercia
390,321,551 *274F6CA920ADAAF41BEEE62C10B9D749F0366E47 ASK0R
390,321,552 *274D01178AA2490008AB8ADAF33763D5DE8296F9 assalsi2
390,321,553 *274443DFDDB00483EC517FCD0DE3DC24A14E7ADC LUZEERAKOA
390,321,554 *2745B0ACC41508EADB0B48522D37AC0649849FB2 [email protected]
390,321,555 *274E76BC1A78E69DD5B052855EB32C35CAB9A1F8 M0ral5+c
390,321,556 *274C58FFD29EE1D99859F5DABD6D5A8D4DACD768 M3M4H4TL4NG1TR4P1D
390,321,557 *27432E5A704AA9AD3B75932191601B7CED046F50 MACALIT
390,321,558 *2748F78997ADE8E90A1227F0C67BB7B09DC15DD4 [email protected]
390,321,559 *2743FC6D1D6626CFF7DE34B3C72CFA6FAF438046 Made-Upwards
390,321,560 *274D52E0BB926F12B4E2B98BE4F29995B9901BB4 [email protected]
390,321,561 *2745F033790ECE90F6F2E11FE88B8C74DE2581C0 autogestionado
390,321,562 *274FC32454468E11BA8D54A0999DA29018830FE8 marceloheinbach
390,321,563 *274B51C1E1F7548C793CC60755A1A6B8D9A15512 B0W8/
390,321,564 *274EF15CD1514A30E5C47BEF549FDA81E2370254 b"%7t
390,321,565 *2740617B885DC875C5279C07B067D83AB6813432 babbalottus
390,321,566 *274A47E760B1A3031F004237112619FEB1833140 marloncasamayor
390,321,567 *274F9A930796B5804071158F7669EF950205CEFD başlidir
390,321,568 *274C19A481ABCF7B47A5079102D611ADF4562C45 b-----b~o(o_-)
390,321,569 *274F8E47A5E9A89D2D38F881D9B4167687EA02ED b/!ce
390,321,570 *2743C1D639DBDC784D3030E5381A6CF1C96B8EE2 BELABBESSY
390,321,571 *27493FC93786D06269E4BA9779B4F89292BC57F8 BEREATHERED
390,321,572 *2749D23D848E255DE5ABC2C9D6BECA2763F0C1BE ber gl
390,321,573 *274393F704EA7715D2CBFE4431BEE3AA06B6DFCD BERT.CHROSTOWSKI
390,321,574 *274D513E3B4DA3CB994CFA1650D44B8A50C2068E BERT.FONTEBOA
390,321,575 *274778AC938B73E3203C045EF4D6BAB51B3DC629 BESTCARBUYSLTD
390,321,576 *27425CA244082D74E46989DE4F45B4F354C3AF39 BEST-PAID
390,321,577 *27460DDE93511FB440B0D37B278ABEACBF27CC68 beunnueb1
390,321,578 *27411E7F5434324F86E75854FA8C8946A20C4365 BG)%_
390,321,579 *27417178D712120A7C968495334DEE82BCA85C4F MICHEL.NEHMER
390,321,580 *274D22A413AE664273B123DF724A3BE6B401C98A mickeyklingshirn
390,321,581 *27456779CF90D6861AD5B620DDAFDF64BF5120B6 MIDTERMS
390,321,582 *274F6E3B348878EB38BCF0F1D6CD6A4573A7A271 BILDIRIS2
390,321,583 *27436F1C49D1F4C0610C8DDC385C1BF86794B6E2 BIPA"
390,321,584 *2741AAB32ED59EE872799F62151F1FD5992A7AD6 mitchnavaretta
390,321,585 *274D85EE7CB01A404EB199F213BE4CF34AE77E92 mitchoden
390,321,586 *274C82A3B9453D486D407C2857EA013F365DCAB3 BKVZF
390,321,587 *2746BD3936234D22F761E67EE8037DCF47878AE1 [email protected]$$
390,321,588 *27402899597A22B1A8D2E6A82798E906A654E957 Blanco(feat.Pharrell)(TheStrictlySpanishmix)
390,321,589 *274D0DCE30C5F3980D7BED085777BB03F7221862 moshepollins
390,321,590 *274788B14E5A086AE0789699B90B3C0A8B8263E8 Bo"B
390,321,591 *2748E3D7E870ADD58D3112C2F554BCD78400BFE5 mourning in my funeral
390,321,592 *2742DADF1B06A83F14F082E226BB6A717E4877D0 BOPATROS
390,321,593 *27497DAA247EAB264F54F671DCAA3B24C372CCCB [email protected]
390,321,594 *2740488E91E3FA5C3E852D58A7D158BFFA11A088 MTB32283
390,321,595 *2742FBD11D666D7850030AB13547B72CC7F2E7B6 MUNICIPIOS DE MAYABEQUE
390,321,596 *274226AFB2AE8ACDD825DBAD11D6E3AA0542A8C5 BPL&N
390,321,597 *274746A96CECE0659ADBE1BFE1E2A5E801D6DA58 N66189
390,321,598 *274E82882FB712513A6EC134AE6DF7791F10DCD8 N70912
390,321,599 *274C5FCB18CDBC2D143F885D103B701DC0852B2B N73RCHAN93S
390,321,600 *2741C3EF767B854768734DB3275E0B7AD3E7B010 BRENTKRAWCZYK
390,321,601 *274EC7EBD18B02D7D3D90A0CC84B81BBA10274B4 b#r#f
390,321,602 *27465CFDC77EEFA66F856FC611C6A79176CF2D63 NAPOLEONVANDERCOOK
390,321,603 *27460BA278055CC639ED20300C58E30529106A74 B&rO
390,321,604 *2742F0AE6FE069A0D5992EE9C9FBE1A4F16F665E brooksbearden
390,321,605 *27438C86BF14BA4465C3A5C9FB0C0FABC259FFB5 NATHANIALDELABARRE
390,321,606 *2749B1C0430B7A89C1426195C838A72A32CCD7FE nathanielcopelan
390,321,607 *2740B2CC4B652A3D36867F2BC2D543F269263E34 brunotacata
390,321,608 *2747AE5E6C29EE5A8F2EFEB79281343ED26B5039 B!SECT!ONS
390,321,609 *27444067F50AB7A514769CDE187271C3684DE866 NETHCIZEGSDIEHNEGELEG
390,321,610 *274470778FA68B6CA8B70C0ED1DB4B76FBEAC404 B&"UH
390,321,611 *274167F7185F86BF1DDEA2356C429598743554BA b!u"s
390,321,612 *274AA3BDA58C42D7BCC96F6B5881FDEDB977E009 BVjX
390,321,613 *2746DD0DFFED63BDB5B4F940DA4EE4311E78D011 byronroseboro
390,321,614 *274016277A8D12A1B25D97606F832EC4F3CF9590 C`
390,321,615 *274DFE2E4891F42E985DC94C161F572923377F19 NON-SMARK
390,321,616 *2749EB991AE617A6AEF66869CE7306E011D78813 [email protected]
390,321,617 *2745E12D5C28C4F961C4927D13F8011BE44F74B7 c-6x?
390,321,618 *2743C600A9D7234895D0FAB8056D4C08277BF182 c=!/7
390,321,619 *274177B9AECDA652AA4C3C8CE3AA092B6CA8136A NOTORI$K
390,321,620 *2749C0B2EBF51932BECABA990BEA82130393A7A8 [email protected]
390,321,621 *2743ED05DD391ADDDF6C7ACE3507D168A6B7116B nvrsmnts
390,321,622 *274BD3DBD2C8F4E68AD02B893F8D4A37D7725017 CANNABISGENERO
390,321,623 *2744B3C046057A3F6FCC0FEF04217CE9D18BCE46 n[\y
390,321,624 *27431BD9A6C0504404725030FFD1B81AED41730C CARMINE.ROBERGE
390,321,625 *2748E25369CDFE75B4B96D92939A13B3767029AF ODELL.WATKIN
390,321,626 *274172645E6A16272EB1631B8A7271046A56E098 carolinanapoles
390,321,627 *27413C3C1111EFFD8BF812809C3C0066C0547EDF ODLÉVANÁ
390,321,628 *274556938245B303551FF3007D50CDB6B8DFA1A7 OFTDREADED
390,321,629 *274F02FFC0D7C655E766BEEC68E9C9D2EFA0F3AA casiolena
390,321,630 *274083D65BAA52256A9B1C081C053218AEEECC8C OLENETLING
390,321,631 *274330C08BB470ECF886666BA3BB3F0023F2E203 ÖNƏMLILIK
390,321,632 *274CE2DE7F505BE48A5562F31A0559E50FC05A71 ON.LINE.2
390,321,633 *274266544A154B98BA3060D222F87C57715A9B1F ccqh/
390,321,634 *2744F89C4239910F1D3C974827ECA17E34DA2897 CDYSALES1
390,321,635 *274CE5EBA35A80B53DD50FA97B8D05AD79F09F07 oscar1530
390,321,636 *274607299E21AEAD84547E5B1C37373B98BA61A4 [email protected]
390,321,637 *2742F1C18E46D00B87AA0FE994EA653E852093E7 othematoma
390,321,638 *274409F558D260E79C26DB9006735E74ED9AB7C1 CHAMPIAN9
390,321,639 *274760F0E28838B2E31FCC83F4506394C030516D CHANCEOCANA
390,321,640 *27410C68B4E75F8849D048BFF8A21F758A5CF6C1 OXV
390,321,641 *2745F80452BCA59E194E19CE4BBD643E527898A6 P%"}
390,321,642 *2749386BC121DD0D105520106EF354628015EF5C charbelelamm
390,321,643 *274DB025F6533A8418E254E7D854055A15533049 p1ay$0m31
390,321,644 *2749A53556B3F77DE3EEA03228EE8677055DBCA5 CHESTERBAITNER
390,321,645 *2747EA00C41F1D5A6F2BFE5B74C9542459157B12 pascalvogel
390,321,646 *274EC7C7F1E65FD353D788764B6241F27488FB6C pasquale.monaco
390,321,647 *274074B6AD9FD56A2D6C75E0EB1FED213F759903 Pembe-Elbise
390,321,648 *274EEAFB794EA95AD1CE7FBBCB80699F19AD2FD1 cjs0
390,321,649 *27483EA78D1A8C3FECA6037238427DB35A618D0E peterlandini
390,321,650 *274A6AA645D2DA7A98C164074FEA3D6A00D2CEFA PHISHDASHA
390,321,651 *27428B0401F600065B3FFC9F45C1DC145144A340 PHOTO-MARSHALL
390,321,652 *2747DF3E9FB8830CDC9463370703BFB1EB412A2B pierretran
390,321,653 *2740996B11A040C52FD09F7EA4887A6C03F2492B PIMENT333
390,321,654 *274D3DBDC8638E3C7A8AFEE8ADEC9DA53B76C53A cmmmu
390,321,655 *274CC24B3F5DF240C02FE3ADA315AF9C01FBD947 POSTAUFTS
390,321,656 *2749B739B8D2EE8416381527B7CBB9C4A4F3B935 con9ratu1ates
390,321,657 *27466329244D6CADFD05F6C5EC00909F297457C8 preappo1n+
390,321,658 *2740385E2382ADF923282649A3B7B792DBF34178 PRELUDE(FROMPARTITAINEMAJOR)
390,321,659 *274CECF8856AD2897D7DC4E003210EA61F0214D7 /PROC/15/TASK/15/SESSIONID
390,321,660 *274A6EDB0A6A84917D5777F43BFBEF3122E9DA0D PROGRESSIVELY-LOUDER
390,321,661 *274A5C8C9BEF867C6F22B8715CAA7C4C4115CD84 CRISTYDOYCED
390,321,662 *27472D03A1E0377DAC7A4D28FD6B878CE2588084 [email protected]
390,321,663 *2744C55B4C57AD20CD59E1889D9EA968DBD9AB37 [email protected]
390,321,664 *274A1F46F437720F5C0C65DFE029920BFA3E1808 PUSCHELARSCH
390,321,665 *274C83BCB926E530E8C792FA26FD2786426EE909 CSB196.207.248.171
390,321,666 *2748ED646404621E977F4F7D17A16907487D2FBB QAWI ADIS
390,321,667 *274CE302D44F869D1363C44969A3CC204AE0B9E5 q=====b.*.(_0)
390,321,668 *2746F33F0D622A915C8DAE70D71CC70E5E1C348F csrk
390,321,669 *274587CE437DA9A6CC4DB6FC02815A2FBDBD5281 q=d-~0-splat!!
390,321,670 *27424C7CF8D29A1502BCF9A7F8A3E244D4365997 [email protected]
390,321,671 *274D4CEF3D6261DC2D3D269284964B70E02FC3A7 [email protected]
390,321,672 *27456F5F5E8824E86F4F0043A76F4CC9C8FBB37D CU!4L
390,321,673 *274B745A2FCFA36D90523A8E7688C3BA7DA2E586 c!xnb
390,321,674 *27464B3EE0A1F065E8FD3F017A2F9C7C24AAEC33 d,)#-
390,321,675 *274E27CC045CD503EEDAD3D40C78139B3C1DC6A5 d0bn1
390,321,676 *274470306468BB4C32BBDE4E443A17A2EEDFC7E2 D15RE5PEC+4BLE
390,321,677 *274E934B9BE571C953454BF3674C3B354E9E3935 d2yrw
390,321,678 *274A56A3B85542D609E53433F2B358FD26ABA25D d7%lr
390,321,679 *2749F6E2644F206A260B39B0940DB3269E137081 D8R)O
390,321,680 *274DA5995E61252949E4510005D6E9BC4C3E920B RE91S+RA8111+Y
390,321,681 *2744382BF61790C0FCC0EE9DB856C066AD833257 REALISTSCITATION
390,321,682 *274783F6E1C573DFB3DEE3757F488468FBD08BB3 dalp:
390,321,683 *274D288B3987AE1699B0F9F030D9021EA6A36553 DANA-TEW
390,321,684 *2741AE8587888A0F5ADCF8D6F8F824D4F8EBE1EF DANCE TOWN
390,321,685 *2746F825D27F83E83029E2B2DFD68EB4A8CB8546 [email protected]
390,321,686 *274F739922ABB14834FF7E94F8A3351EEEC60490 DANIEL.TWOMBLEY
390,321,687 *2742B69146434DCFD6484EE811B1F6D797AD0E16 RECURRENCEFORMULAED
390,321,688 *274D7D01B157A36A8439107BBD67BFEE07A5FD88 redelye1
390,321,689 *274229FBB8575A532A3A47041A0D6F4D10D5D518 REEBOKBRIGHT8
390,321,690 *27421D240CE7A280770105640D0B55E37352C6EB REGENERADAS7
390,321,691 *27481F4279719E7029DCCF4C33071634F53A0BE9 DARREL.KISNER
390,321,692 *2746AC40AEB7506BDEC9D67399285D1EF4AE8D4C DARWINLEVREAU
390,321,693 *274C34F4AC877CAD0DE31555DD0B99EACC649BF3 DARYLLOFTON
390,321,694 *274795F4A7D5F6589AFE9BCFBACEA154D6F48883 REMEMBERTESTTESTS
390,321,695 *274A0B95DA2B7B5594860161FC9361940B3B0021 DAYTONBALLETLOGO
390,321,696 *274E043BF54C12601006548359AE08380DE75B82 RENE.ORIZETTI
390,321,697 *274235185CF2205C3AB17A3157C84FE6C70C8201 DB850D89129938208ECE1ABE71699FFF
390,321,698 *274ED30AFA50A14E4C59D339B1F6353B6A97FD4D [email protected]
390,321,699 *274955BBF71F18A651674956C3FD637113E5CB2C DBNG_
390,321,700 *27448B4BABCC3E2D702414C291D0F663B02487ED ddsda
390,321,701 *27490EF252DAF252A6381120A047C28BAF4438B6 rhettskafec
390,321,702 *2747DE400089F64F7826DD4E708FC0B1D12B32D9 ria.ariani
390,321,703 *274212CC72980D86ADB6CE90CD2A3D9B6D7B1B89 DELMARWEITH
390,321,704 *274982E7EF52AA49FD693BD142F213B62208DF9A RICHARD-SOUTHARD
390,321,705 *274348811D7BF20F60F905319039658DFEF44EB7 DEO(A
390,321,706 *27421BEEE122A7B7717E83F72A186EC37A08461C derickstark
390,321,707 *274F3BA87DA24E94CA065797B1166F61C1B3836F RJAURIO3
390,321,708 *274EB4674CED93F68EABC38607213B110FF42EB7 DESHAWNSTIEHM
390,321,709 *2747E4DBC1F2D7DAD6291095442BB63A6139160C destinykinkade
390,321,710 *274068AA6CE3C610013B2F22074B506591068B11 deweyritchey
390,321,711 *27463A1E050A25F9E0178D058677DECDC4B98C54 DFFSR
390,321,712 *274D4B06317E37AA2AB85A9C803FF5871DB03F05 RODERICK.CASTRONOVA
390,321,713 *27468DCAE233EBABEF65CC4B957E6E3C1363F171 DICHLOROPHENYL
390,321,714 *274322827C83B9DDC2D1A819D7AA006ADBDFFDDA ROES-NORMALES
390,321,715 *2747AF240C42A3FCAF762A4CB7EFB63074965A74 dinulescuadrian
390,321,716 *27458BE23C277BC185DD8CBCDD3BF722476B0AD9 DISCOMMODITY ,D/I/SK/@/'M/A/D/I/T/I/
390,321,717 *2741F06FFA169885592594CD234FFE1C213B82DA ROMEODOUTHITT
390,321,718 *274119CF300EEBBDAA37757557F9602222E59D29 ROMEOTIMMONS
390,321,719 *2741AE8AA4D7408CF280BD2B2C05D07FDB64BEF8 D/_JF
390,321,720 *2747153B4F0EBCCE0ECB6BAA8630B1261366EF89 dk3$k
390,321,721 *274F359E74868F2A319FA8792CD05743FBC849DB D!NTN
390,321,722 *27482EFABCF933D081E6CE9F59748F8C637BF827 dominicfors
390,321,723 *274C621AC26BD0371C8A984532E971FADEB7F1B4 dominickjustiniano
390,321,724 *274F26748C21E49962BECB1B202F72B9F453B4F2 ROSSCHILEN
390,321,725 *2749856FC5817469E2342D68FF26E985393920B7 ROWENALO
390,321,726 *2747350BE020BB235E00D92A17E6BE09673D4912 ROYCE.VIBBERT
390,321,727 *274E32911C08A321BB156FD29655AD2D028256D7 ROYIRINEO
390,321,728 *27471C5C44E32E6099A788DB676D1BB41A4259C7 rozzie13
390,321,729 *2745305F1B58F72FAD084D2B9874A334D5745DE3 DON.WIRFS
390,321,730 *274FA42E117F26678F2F6143D836D1231EC066EE RUBINHEISKELL
390,321,731 *274F6DA10C7DC30BD5575828CA43A84C4B63673D rudeboyconfession
390,321,732 *2749D88D70D41C5FF44140C4C6F6A768DD3BC137 „DOWDINGGOV
390,321,733 *27408B1223D51C55C74176C450F41278D8A2FDC0 DRAOBYSAE
390,321,734 *274DD812BF8723EE192557F271C6587701D8632A dr=c9
390,321,735 *274830B1D331B90FC611681EF7502AC686285BBA RYANDATWYLER
390,321,736 *2747E08CA7472735B03013843FE0C81EE588E453 RYANISING
390,321,737 *27476A8DEC0F9EC20726104A97ADACF42DD2E320 ryan.jeavons
390,321,738 *274DE8907B96FBD49D2D204290E449834B92C24E DRHPHSRV
390,321,739 *274BBDDCA8DA503733DC7106DF1ADFC5AEF18764 S4L3S-F0R
390,321,740 *2749018B596645BE538F15362FC728D152C43FB1 SAEAEDOEKSIKSIED
390,321,741 *274D9E2D4BB749E7D91306D2A7951779251DA587 SAKURABABSW3
390,321,742 *2743EB529EE4BD2136B1738D83EB0FDAEB427BA7 salvatorearujo
390,321,743 *274D4B07411A422824579F6061E971ACA5357BAD SALVATOREBROUWERS
390,321,744 *27413893A9A58C0DB3806B681820248653413399 SAṂGŪḌHA
390,321,745 *2743E67E0C42DACCD81553CC7B71507BE5A4A7E5 du5/f
390,321,746 *2742688A44418F725B76C0F236CFC7CF4E72F9A9 SAM.SCHWADERER
390,321,747 *27450623EBA00746ED72510C0AED559CC9EFDD14 samuelbessette
390,321,748 *274313487DAD8FC8061FEB1E70C6604D7D11A1DD SAMUEL.HAIRR
390,321,749 *2745A68398A1EA90B2E87A3673C9020A1DDFCCB9 SANG.CAROVSKI
390,321,750 *274FE93B79EEF8D4637FC38DC4DDB3E3ED75A6A0 SAPL
390,321,751 *27402923CD7B6D663F5C22904F6C46A04250F214 sarvatrici
390,321,752 *2747EE8E4925356BE03FCB37DA64451D4BDB9800 SCOTTSDALEHEADQUARTERED8
390,321,753 *274A15FD82CAA4CACAC1DB1C3D02B73C2593229A SCOTTYJELKS
390,321,754 *274C113288772ACD306597F3C379289386F6EBAF scotwittig
390,321,755 *274384BE5B983E9B970619C692AA340EE784C8A4 duncanbarefoot
390,321,756 *2741729E03B70C42968BA74C0917214E18DB3AD1 SEANBRADDY
390,321,757 *274CB78481B4DA1A7CEF3D062F8E510F17D402DB duricefses
390,321,758 *274A42D7D294C57EDC63CBCC8F10B1DFB0ED5F01 DWQ&V
390,321,759 *274742BF93ED4A695C543048A60582DD098D456C dy+e7
390,321,760 *274257B7F0FCA1F70B316FB6C45BFF916FA3DAE1 SEXQUEEN5
390,321,761 *2745B89838CCA12C746A631DB61202CB4940A44D E7411917746
390,321,762 *274ACD6FBFD232D8EBB894FDE8D088C48A4CB4BC SHAWN680
390,321,763 *274F31A8F33CC37B4E9BCC248F7388EB627DFD85 SHELDONVANDERSLICE
390,321,764 *2741A3DD3250139398032D71AEE7E050B2DB514D [email protected]
390,321,765 *274D8E18C5DE0238A2BA0BE0697E52598B467BA6 ectromel
390,321,766 *2744FC23C8AD8729131AB915F41446D5DF695046 EDISON.DIAZ
390,321,767 *274C35F73D08186F9254D72AF11485E5A6E6235E [email protected]
390,321,768 *274BB74DACEF7CBDFE6DB9EB646C921A48679FF9 SIDNEYSHOULTZ
390,321,769 *274BD374EB22A869ED829282C4C6EEA913B153AD edneemeg7
390,321,770 *274D8ADAA8CA122E2D44F9946934ADBFDC7E1924 EEE0U
390,321,771 *274D8C57FCC1A1BB7574070C58CDC966BD7F5859 SILOPILLAC8
390,321,772 *2740AC72A2C08D3770ECBD82F2D8038D82A0A6BA egfw"
390,321,773 *2741F13B7EBCEBA61AADDD4182C49B3BA9003AFF EINATSHOHAM
390,321,774 *2747F4487B4C60061919DF15E45F5B91745EFDCA [email protected]
390,321,775 *27425796E90ED84D80AE681CF19283E8D7973E2D EJTLEZUEP
390,321,776 *274BA1E7D4B4875E8CC2850174E055EB860C42D7 SMAILAGIĆA
390,321,777 *274CE99BE1B4CDB05EDC9B2B6B32A569CDB3FC3F [email protected]
390,321,778 *274C7F1CF90BD41D7BF7C1F881B37BAB03395DB2 smoke! smoke! smoke! (that cigarette) / roundup polka
390,321,779 *27410CBCB3055BC2314B3103683A0EA7738C1377 elmobalock
390,321,780 *2743924CFA2C23F86B101B47D0A80AF77E7EF472 ELOYMCCLEOD
390,321,781 *274B43F7D4ED3735D5E9DE6C5BB1EDDABCE74C51 ELWOODWELBURN
390,321,782 *274AE979B58AB88A238BF8DE02F02E6C521FC03E EMANUEL.DUPERRE
390,321,783 *2745DF9291CDEC1D5B40F4B3E956FCF3A21BEB41 EMARVY
390,321,784 *27439CAC1301A0422A0662E3C49F5D5F99FD6045 SNURFATHIN
390,321,785 *2746873DA2099DB8DD1AC7E5AA59EF3696CA1744 EMMITT.LENNOX
390,321,786 *274D228D108FBA83F4BF61D7A73289DC24F4AFAB SONATA IN C, K 545
390,321,787 *2742B448F1DAC91D4ACD0A8BE8C795AB55D10B67 SONFORTH
390,321,788 *2746DB51F0791186891E683CB640D26C001C84D1 SONNYCANTLEY
390,321,789 *274463C0D6FF8C1701C30D723C4242E0BA6BA0C2 ENDOTERMA
390,321,790 *27404B5C420627F35D600838BB59882EFF14ED63 ENTRECOUPAT
390,321,791 *274082475D2A5F60F29744B6EC28CAE5CA272B2C EPPC0
390,321,792 *274F759FB1F532E2E1AE4F96DDF08401D344BCA8 SPARIAMOS
390,321,793 *274FE87DBE1AAAA685803D9A4AF074421A5DCA12 splat.o~0~.<---q
390,321,794 *2746B3D946D2300FA4B5D2ACBD6EBFF4CA54C7BE SRECALPER4
390,321,795 *274147F756CD8843D34426A615B5623F337AF3B6 SREDLOHK
390,321,796 *27403A04A16FFFCDDC014DCC1B1F21EEDC53DB39 etgasrez
390,321,797 *274727F28E0E3F6B6F9BFDB8B47915A4D347310E STAFFAREA3
390,321,798 *27440F66EB13DF407DD74E106877767306142EC6 STAMROFE
390,321,799 *2743FE445C68267FA853DF5524AA586483F8C473 [email protected]
390,321,800 *2748E2FDC265450D79A6595EE9B120B3EB5885D3 steinhofareal
390,321,801 *27405F8E97DEAA3BEB9ACD942E74A18ACE47B5C1 STEVENPHANTOMING
390,321,802 *274C33CA76A056337969D1B6944FA3482E53987C STICKBOYMEGADETH
390,321,803 *2747777DEFFE0DA85C44387DEB569E3F1906AFF4 FABIAN.FEBRE
390,321,804 *2740D4AAB751382720A2B28410E353C4672A8E3A @STR08!0L0G!ST
390,321,805 *2749936714A928F3B0C70997FCA0AD7E8B6125BB STUART.JARDIN
390,321,806 *27499274AF5A0D76A23455452626AD0CF1EA0AAC stuartmarjan
390,321,807 *274D61EBCD7C349006D4521A52A4B2504D5016C7 FARDTZ
390,321,808 *274FAA23508E8940A2FEC267B1F10006E276E0A9 fargood1
390,321,809 *274A22C1AECC1FCA6B73ACA1996217D289817ED1 SUBWAYR4
390,321,810 *274E960A55808554FF3A4AA7BB0009F1390DE2C3 [email protected]
390,321,811 *274B35C0A90E731E8E64DADEACF5A1C9B01736FE sungnewbold
390,321,812 *274EE3FF17B6912BACDA2314B1DC6938B49551F5 fellger
390,321,813 *274B08E5B0F14DE3C1B802A9BF47CF1D5527FC8E SUPERVILLAINESS
390,321,814 *27409580777C03CC339E41229A4F4A51ED159B61 final-fantasy-iv-the-after-sur-mobile
390,321,815 *27489709AFDFD54E12B7C809B71B50567B4ACEF2 sy'i
390,321,816 *2743CEC8A7F95B7A012652EBFF7116F12E83E55E TATANIIAE
390,321,817 *274B3E57C6E79F4CFEE4E5520D8594BD8A128941 TAYLORPASTORE
390,321,818 *2740C8BDC2D8C3201454FD846A2F1BEEE1288432 ;:TD$
390,321,819 *27473823F6FB2ECEC46BDBDB59260459212D946F TERESITA.SKYLES
390,321,820 *2745CA60A5F4D59661573AEA367E8E1859955A12 fredricdeval
390,321,821 *274FE45EDB5555914476B5B89FEADF7622B014FD TERMINIAMOS7
390,321,822 *274DC27C524FCF4030820834B54237C55201B387 TERRENCEHEWATT
390,321,823 *2749D4F9CA20AD3C89E2F142F9D5C9C26F3A76E2 TERRITORYGTIOT
390,321,824 *274DA171E7C0765CA59C71B2999C4DABC788BD68 TERRORIST565758
390,321,825 *27435FB756AA99BD6514AB0D57E46928C6CF940F frimerke
390,321,826 *27427D2212C31F6177027C21C0B8CB7F515159DE fxnaaa
390,321,827 *2740008CB35A4D2F61E1463DC6AE4D86C31CAD24 THEODOREHOWDESHELL
390,321,828 *2741C0BFBCD42E9E6C62E620F9972FAEF0236FEF THE.OLD.MAN.&.THE.SEA
390,321,829 *274AC07A67BBF25928D69DC533AFA2E9D2E3F380 THEPERANZYSISTERS
390,321,830 *274E2F98A889B83D034390FF1DD0B255E8BB4FB9 THEPERCY45
390,321,831 *274C6C94547A24678FCA6ED69C9D5CA300F70CC0 GANOTES7
390,321,832 *274D5343507BFF09103128F820B6AC1DCC1E2345 THE SOUND OF FUNK, VOLUME 1
390,321,833 *2742A1F8496C11AD67AFE38253D517948BD0EB74 TIFFANYMISHKA9
390,321,834 *274ADB336ED9FD467460AA1BA8374A91ED484F08 time'sawastin
390,321,835 *274583DF1C7C23C767384E429F514DD78C08583C Tinpail
390,321,836 *274D26ED74C9A63E92BDFB0A2C441765BF96BBD4 tobyruple
390,321,837 *27413239EF52EBC3C3BBA842E5FDC4C779367878 today'sbabyshowersrequireanarktohaulhometheloot1
390,321,838 *274287C73A3BB0EAAE47DBF1E8E80984140453FF TOM.ROSIAK
390,321,839 *274D8B92A888C891358A72D803CBF1E02B7E56B6 TONEYSOCHAN
390,321,840 *274BDF69C419394F541CAB0626D192910A271D15 TONYAWISECARVER
390,321,841 *2747C40A310F8193EB06DE72CD0AAB784D8F4104 TRACHTENBURGCHARLIE
390,321,842 *27432906C27EFF8DD147EBAF16E936F76F1EBFC5 GLISSANT139
390,321,843 *27495077197DF0924938E2A6B99EB3092B2FB4D3 TREEHEWING2
390,321,844 *274E19C2A70290BA17E06B041042004D5C217F71 TRENCHERMAN9
390,321,845 *274270F6ED805F708083DE24FBC4844491013B12 GOEDERENLOKOMOTIEVEN
390,321,846 *274D1C99E268E4F16D7FE8777E1C64FAFC95604F trolamina
390,321,847 *274A652252FACB35E5409A0D26CEA3A20E4D47F0 trumangapen
390,321,848 *2747390BB658238458F7E744CFDADE83A319AC42 GREAT-MEDITERRANEAN-MASTERS:-PERCUSSION
390,321,849 *2748047518B3915A29B0CBE91DFAAA7EB75DC251 GUADALUPE.SCHMOYER
390,321,850 *27421CFC40DAC2990F62B3F1EACD22DF84432F82 GUILLERMO.SALTE
390,321,851 *2749CF5A1118C5C5CB42AE6804504631D159EB0A TURN IT OVER TO JESUS
390,321,852 *274262391C1BF8E1FB113B5D446582889D0CD4FC TWRINERT
390,321,853 *274A6193C1F483CD3195D37DAC79EAD450E7C765 TX|=
390,321,854 *274FB9D55E6D5C676A774B4EDADB87BCAB13FCC0 TYRELLPERRIS
390,321,855 *27458FAB5C8454D5024273BA34A0BEEE6C8FE28D h3v)
390,321,856 *27478FDEE7A851639A9E6CBB64225EE066CA8F88 uma-shankar-prasad-singh
390,321,857 *274BA667EEE04E7D67AF99C3AD4D47280D8026CB [email protected]
390,321,858 *274E40E65D0674F2AD692E67ADB1CE46F01B4AA0 HAYWOOD.SOUR
390,321,859 *274E83AD22C8560C8511F90FF61530A345AD7A43 HERIBERTO.MALTEZ
390,321,860 *2743AE90285BC4960612EFEAAB2ED8F3BDDED0EC hermanmenefee
390,321,861 *27485CCABFB183B00AAB27D6C45A64541AAC3428 HERRINGBONEPATTERNCLOTH
390,321,862 *27405FE9B02C7408474918EEC42719BDD1A5A22D hien-trieu
390,321,863 *274BA32BBF743B80552E730506EE05DFFE9935CC HIFQXXLGLDHE
390,321,864 *27432D781CC3251F5D0CC4A589C6ECF98755A868 [email protected]
390,321,865 *27471ABD8F8AFFEAB0F59B9450B5EC31C034FCE6 HIPOLITO.REIER
390,321,866 *2749018816914D9B967EB6AE0CFF6B9CA0B93ABE U)P9
390,321,867 *2742A70E54310597A4C56CA9BA638A01FF226903 hold on to hurt
390,321,868 *2743157195901347C86B00110BF50EB8C333BC31 honkier1
390,321,869 *2740FEB1C8A8CD059393700995C8EDB52B956893 utsiuus
390,321,870 *274AF2BAB0CE9B19638D320A71D4D233AA86C9C0 UT UR MITT HUVUD
390,321,871 *27483C089939756450B3FF7582B77A07C6A2A9E6 HORRORF5
390,321,872 *274956147641F56AF46E6FFDBF3529E20226D8F7 UYRDMYC
390,321,873 *274D5AB1E2845B763E666720C1A31F9FC4B50329 HTTPWWW.TIS-GDV.DETI
390,321,874 *27475F12BA270121EF27E5D3A55CD4DC1BCC0C40 [email protected]
390,321,875 *2740705C48FC60ACCB9B808ECB1A9254ECEEDF43 HUEY.RASHID
390,321,876 *2749453A0642A85DE2055F18F5D41AA9E825CAFE hugdieterich
390,321,877 *2749565951EA5EA1E6A3FB226E8054DE30EFA447 VALESCA.SACHERSKI
390,321,878 *274BAD003FE744D9BEDFB9C67213D441EA065EA3 hukokbsw6
390,321,879 *27497998A37B490759C081EF7DEDDCDF3D37A0A6 HUNTERSAUGIS
390,321,880 *2748929D0C59B192E02C4DDEB12F66A7AC9EB2B8 vanessavandeputte
390,321,881 *274FFE45AEFAB588D45BC95734C8503B7905FBBC VARUN.KOMARAGIRI
390,321,882 *274FF9BF484E5225AD77C7F652FD526F4F72DAB2 I157076
390,321,883 *274FE2EC139AA979330CB3CC10E38651A6EFDC14 IBYL1
390,321,884 *2740DA98C317CE07A4542C00EEBF427C7BB3CF98 ihsuotin0
390,321,885 *274218E893AC4B25D9ABACE471F9E7F1925F7014 ILOVEEEYORE77
390,321,886 *2747CDC9BACC4C83A2510D63310C990CB6B8A659 VICKI.MADDEVER
390,321,887 *27495E7A9E05C25A85EDBDE051DDBB2DB22BE76B INCARNAIS0
390,321,888 *274CF1DE49E59D9B979D4797FEE17CA1D26C8842 victorramseyer
390,321,889 *2743F0FD18017B93E2586DDA1B0B9DE7DAD0EF83 VICTORZAISER
390,321,890 *274279876765F19B09A8F35895C6336C5956D67C vikasbuccha
390,321,891 *274B8D7BB503693B43DD80509C468EE4F3334010 VINAYAKGEJGE
390,321,892 *2741F4A54C64612E5DB821B4C39D5D21F9CC94DA IROBYLOP5
390,321,893 *274FAA691C19C234E8C26162A0E4AB36A3D21A08 I've-Been-Hearing-Things
390,321,894 *27443B4BE5A3275BE0A650BAA868CCA8711F045A iwwerwanterungsgebitt
390,321,895 *274EEFFB37B25EB4E4E0839D41D590DF5FCF6F41 VISUALIZEI9
390,321,896 *2748584D0C2AC66A49D1EBBAC92106ED8D028D22 vitimou8
390,321,897 *27403692E2DB8AC1FF58937C5FE54995305334B5 jacobantonellis
390,321,898 *274EAB527730960348BDA8CF24242007AD82341F JACQUES.HOWZELL
390,321,899 *274635960E0AF0B4458BE54B84E34E6BD8FE2CAC JAKE.THACKABERRY
390,321,900 *27494034100B26A8E84F859160A00F481A5C706C vndca7on
390,321,901 *274D5C569A929676507C3D76977B86AC83911E4D jameleichenberg
390,321,902 *2748E1A321B638316C3ED4C2D2F1AB7E09A243E6 [email protected]
390,321,903 *2743333C26126CBFD00B5C1FD0C273130E4145BB VRIJEME TECE
390,321,904 *2746D4BAA2A8D6C3E45EB04D81A9B4F7C1129522 JAN.SUMMONS
390,321,905 *274A5D6D2C36A3EDB4E8EBB84DEC90E0A1E5EB0B VS.THESNOW
390,321,906 *274A07570DC3A19ACD4FED26B6E1703354760375 VYMEDZENÝCH
390,321,907 *2742723FD3B2BA2A3BA8C3A87CFAABBA48343C35 jasunmartz
390,321,908 *274E4870D7E6B6F7A69987C80A89F7D2F1AA6736 WAEL.WALEED.YOUSIF
390,321,909 *274CB7808726F17C4FC2175B91C3C1F0CE93E89A waermeuebertragung2
390,321,910 *274FE2CC71D5074FD2B892BAE837087125080AAE JEFFREYKELLO
390,321,911 *274029DC1E0F06C350BA813F98A1C7CD2F0E69AB [email protected]
390,321,912 *2743E684C1A6BA6420985B41F2B7C46FAAE9D579 jeramychavoustie
390,321,913 *2747AECC01366B9F9EAD0059682A3BE0217897D0 JEROMY.WATHEN
390,321,914 *27445C1D1707A3799D6606FD50692C09039DCB14 WARD.SLEEMAN
390,321,915 *2748E5FD049443CC59552C900255BA7376B9D627 WARISHHSIRAW9
390,321,916 *2747F582CB0BF9BDBDB356269B24EB82B1596EC3 jewelgargiulo
390,321,917 *274644FDA08F3065721D0FF1591907C81BDB3173 JEWELL.PITTMAN
390,321,918 *274FC9E7CCC07B6E63302B78451F4D6F1A3B1765 JIM.LAGUER
390,321,919 *274A9B3F03002B35F31AE539028441BB3BE6871A JOAQUIN.MAEDER
390,321,920 *274349D9C54AF2063C0B70B66EC3BDFC273D5F79 joe.attard.sr
390,321,921 *2746E8223272A00B66E194B9F1637F6F762DE068 WD8BAA
390,321,922 *2749A2D7F6A01D745E0D0298013D05902E4EE638 weedily
390,321,923 *2741CA7332C4B791F3442461C429C6C4118DF2C0 JORGE.STAILEY
390,321,924 *274230BE6F737D6649711B0CF9675180176EA351 joshlunday
390,321,925 *27424C91FF3E717116AF5AEE46F8D1F49DD16F08 [email protected]
390,321,926 *2747C39F401F63189C052A8B0C297D6648F31569 JUDCELE
390,321,927 *274D0C36967B5CBEBCC92A24D0DAFB7B9964939E julie-mallen
390,321,928 *2749B086117507D86548121F48C50694520C5B35 JUNIORITIES
390,321,929 *27460B93D6FA376C7B02B5538C3832C8F38F899F KANISTHAC
390,321,930 *274B952A97CD2002789C5975695F10EB2DDB331D WHAT.LOVE,.THINK'ST.THOU,.I.SUE.SO.MUCH.TO.GET?
390,321,931 *274C38F76CCEC7673FDCB9672458E8AFB667F58E kasteelhoeven.
390,321,932 *274CF0FF651F7589ACF525D04D5877417F566146 kelek.kumaqayolu
390,321,933 *2740359EE4735CCBD74E20C1632960F7BC5716B8 willcobos
390,321,934 *27420F1E7D0EDABF74793B0710DFCEE9BD5902EA williamjhuff
390,321,935 *274CCB39AD51749D741BD3D3C7C018556AC21D7E KENNETHSARAFIAN
390,321,936 *274BBFBB9AC5EAAEA77C48AEB47AE6B7ACED279E willyrosenbush
390,321,937 *274A40E5C0EB8D26E96C0120099F596ACFABC1C0 willyseabrooks
390,321,938 *2747CC23BD544E853A121778E0173767314981A1 WILMERSTANCATO
390,321,939 *2744D949FEEDB236F8FBE7D7D4AF58707C5C6F7F [email protected]
390,321,940 *274FA1511C10400B5854258F2A34BC6496F65FD5 [email protected]
390,321,941 *274B7DE41C0C597B448E7C45A51CB7746AC61C24 KHARGAJEETY
390,321,942 *274DE9CAE25EDF1B4D369629040A551ECEDA76E9 WLAUTNGOEN
390,321,943 *274E093B9EEFA9139CF50A700F47A0509DAFD078 kirk.talking
390,321,944 *27413C3149AD9BE58B72017CCA618A315BAC7F79 KLIMHAAK
390,321,945 *274589B22098820F7825D1DB102A725793CDCA9A [email protected]
390,321,946 *2743B841170876040E2A1CD3D4AFF27C18C9824F KNIGHTSHADE124
390,321,947 *274FF9C31265A62174C231526E5E4D3EA7417EA1 [email protected]
390,321,948 *274569CCBF8A7D131E6C415D6E8A0EF764093337 KOONUSEKUJULINE
390,321,949 *274D1014E5A84FA3807CC45B7305E76B55609FE7 WULBED
390,321,950 *274F2978670DCB1D6C163D74AFF84ECB44FC0FB6 WWW1CLIKPICCOMWWW1
390,321,951 *2742471B7AFF327FA43FC7354F7B6F580E405999 KRISHNA.VENIGALLA
390,321,952 *274A67A11B8D92FC218747FA59108DCA37D3F26A wwwbaselinesellingcom
390,321,953 *274AADE9348BDDCB66F19F8FB09A461F14BDCBA4 kubrick6
390,321,954 *27465F0E047FA31CAE8B92C5BD201B5EAA3930B6 LAPINROSE5
390,321,955 *27473B7A2525BB93FCA3880D290679A7F3DBE34E LATASHIE9
390,321,956 *274266917D8E9AF5E998670A338AB03CB09BA5BA la.valenciana:.portar
390,321,957 *274C6B3385A172A594718E255B8FD3CA8A302401 lce\
390,321,958 *274510189E1FDE60A531933C86C2D016BDEA40FA [email protected]
390,321,959 *274832684EAEE7035164BA1FC8B600FD259F1EB5 [email protected]
390,321,960 *274D10AD0041D0CC6F513F63CB515D0AE5B6D13C LEIF.CHRISTOU
390,321,961 *2740D28F35AD0972522936EACF5C76833EE26340 leighton-hodges
390,321,962 *2740B057C6E04E5F281233C7FF94DC91EDEB0151 leitans
390,321,963 *27411A6B6D2A4F836CDB8C5E12F75D06EC408F40 (X)~~~Q===8
390,321,964 *274A00874608E82F6A33ACDF1E951D61A8FB823A LettheBeatGoOn(short)
390,321,965 *274F535F891438E915045C32552356EF7FE571E7 [email protected]
390,321,966 *274F939F8AB637FAA0DCEE8C1A3071D973F55589 LION'S SONG
390,321,967 *27443106624E9718C8E13747B65FE22FB2C45006 YANKEESBABIED
390,321,968 *2748F05F7F6108F56A7328D7607F335FBAAEA06A [email protected]
390,321,969 *2741206AF6FE46C47F774FCBD55D0AE365C0ABDB [email protected]
390,321,970 *2742C8DA1A3CBD8971D47286239EC9D4E61053DB ycmu
390,321,971 *27456838E7A5AE0E3966FF63AB179A852F08B12D [email protected]
390,321,972 *2740317B0EA25E851D00963B335943E4938CEC34 [email protected]
390,321,973 *274875AEBB6F92F3181BC56F2400CD2ABA1E3452 Y-L4
390,321,974 *2746167BB9E44B1B5563A9CA0C96DAE30A0B96E3 YNTYIST4
390,321,975 *27402C0A3EE1E05A5B5CA37FE765717A2DC35506 YOUNESS-AITDAOUD
390,321,976 *2744D27AF13947F0C85E9BC56D9641B48859FF65 YOUNG.MAMMANO
390,321,977 *274ABB71D00B62B4D55E77E02E9CE5C0D82A2A2C yuanpinchen
390,321,978 *274F5A05AF60A955E9A0BC9063F722124386B6E4 lu'nun-Biber-Gibi-Benleri
390,321,979 *274BF9F7D446170BB359F7FEC62D5453E37E8FF1 zachbritt
390,321,980 *2748A28B933E3446731760B265B5ADFD754AD3F8 lynlsens2
390,321,981 *274A902FEDAB6C6CCD2D1647E39A62F7A7BBDDC2 zara-glass
390,321,982 *274104A9E4028C4A1641764749BCF44244962599 ZEIREGNOL8
390,321,983 *274155956144F290B0BABCA7F45521177E9202F3 [email protected]
390,321,984 *27484D176CB51F657E6A8CAA605B6EC4777D2B1A [email protected]
390,321,985 *2741063F2E9ADF7D480795D32F404EE64BA6EB06 m4trcul4ton
390,321,986 *274B90368CCBB692824DD369A51BA8AF6ED12186 MALIK.JOECKS
390,321,987 *2747613B2171B09A8266675EBC2A6AE734A10AA1 ZOMA161
390,321,988 *2747692B68C7D41EB2B0B05F99CD7342DB9C27F5 manate7
390,321,989 *274D7C1C298A7EA5CA3BE99BE82D713B53E222FC MANDINOS6
390,321,990 *274ACB97E7AF55F25D8788D2ADEFC7D5E1BC1CAA [email protected]
390,321,991 *274E77C8A7734BEAC300057621DB3F481FE7494C zozobradomarlou
390,321,992 *274B1667344656643576920FC9C0C9AD530372CE manuelmccuistion
390,321,993 *274105D69FC2BB793FA9DADE91CC91C3D9EAD521 [email protected]
390,321,994 *27402F2FD5C5DBB471094E6044BFD76B15C817C3 [email protected]
390,321,995 *274E06A05D4F2CC3E47EA90582A0AC1594C0109A zumehci9
390,321,996 *27479BBAB1036D6E71C94395B9806D7E0F464510 MARCOKUANG
390,321,997 *2746D6D2459CF18F19ECAC47A11A08389C249DD9 marcomoscetticastellani
390,321,998 *274BE7871E33CDA002BB4C472DD867A82B6E74A7 MARGARETTF
390,321,999 *274198F5FCF3644004A231E2945DC99C8A9DC3DE ΟΥΡΆΛΗ
390,322,000 *27419CEAD2C7065F1025DDF2C17BF1639FE28706 ΣΜΥΡΙΔΕΡΓΆΤΕΣ
390,322,001 *2742B7111025CA918CB89574129D110C24CB62E8 виандот
390,322,002 *274CEF66C19130400AB9145913DE2841BECB18EE ЗЕВНУЛА
390,322,003 *2744AD67C3083A22039A775D1078873ECAB22DB8 ИЗИЛДООЧУСУ
390,322,004 *2740FB8CB847A1CD7365FB1CD015DDABF717A3BF masonsarmiento
390,322,005 *2744CB9E961F7E9B46D3036E5B0525C38AC2456C [email protected]
390,322,006 *274A3735FAB15D5ACCE261E1D33054716DEC71BA MATEK
390,322,007 *2748F3A8DB9DF9DB9E0C73454CAA654276E4B7AA mavericspider
390,322,008 *274E9AA054205AC48C5BD07BF399FE1EBCEEECEC maydayfreedom
390,322,009 *274E10EB8BF3B6647C423B2FE7C961178EAE9131 ЭНГЕЛЬБЕРТО
390,322,010 *274E66CE8013EFD47247F66CC7FA80BE0F264A2E ЯВАРА
390,322,011 *274D0A7CEAF7086D98F4A4429DEDAE3025223FE3 MITCHELL.KRAUSE
390,322,012 *27478CCBD99C6AE7180295E73462F1E5C1FB68DA MKWB
390,322,013 *274D1EB3AF342CFFE1474A2908EEB90DFE110D48 00008874SG200507031400
390,322,014 *274BD6FCA5FA675F7BE43234002D3A250A51001C 02271821
390,322,015 *2749A481E76CDC72877FF3711CCFB0A9398D8BD2 06.13.94
390,322,016 *27453939B78C7B5A2649055B663241A0C1D28A65 0BLI9473S
390,322,017 *274F9B32AA0F17B1D5CDC0DB9392227B3E70C1D7 109-budd
390,322,018 *274B70BB0F177F96C9CF5C808585BD431DA82049 muerto...esmejor
390,322,019 *274A882F416D088D099817E84189457C93C0E9E7 1299738 IT-RESPONDS-TO-TREATMENT-WITH-DRUGS-
390,322,020 *274A734427267BCA35EC621C29B7C59DBF5ED871 12-SARANAN
390,322,021 *274F59472C667CBEFC5172EA72CF001FBA397B6D [email protected]
390,322,022 *27486C91684B99175C988496560641851DA4F312 MYMAGNUMABC
390,322,023 *274975C143A31D7689BA820A0E4CBBB22E1DBEA6 1540762 GANZ LANGSAM PASSIERT DAS
390,322,024 *27445756671391D4F2681670DE92A9B5FE8644BF NAMGULP9
390,322,025 *274E0A2E0B81AA8A812094BDC27847BF4B18FE1E 16.fors
390,322,026 *2746DC65CA5D439A5D3290E12296110CF8474742 nedpadeken
390,322,027 *27412BD2133C670F1BCA0308B77B5D85C6400D80 1.BAF-VORSITZENDER
390,322,028 *27449DEB1F142F5FED0423782FBF57CC91F6F810 1.BAMAKOS
390,322,029 *2740D8576A246CC94221CEBCBA649F2F41A92019 nenyagandik
390,322,030 *27421D54F5D3B01A3340E6D388641BA4C8E781D1 n^)f
390,322,031 *2744F05BD5DC0C06A41EDB94D7DF7CB6144053AA nhu?
390,322,032 *27454201EF5180B1FFEF76290A9DFC8ECEC73FD2 NNUSANTORO
390,322,033 *274B1CAE28109475DDC75C3E6B8D28B7B4D20B50 1KOLONIAL-MACHT
390,322,034 *274649CEEEA29AFABFD4D36F313E7DD76EB77362 1-kosten-nutzen-bilanzen
390,322,035 *27445A1892C0BD292DEEEBF7D164C87E2E0E8838 noestarratt
390,322,036 *274EAFF5246755FB26AFE4DE38F451C372EE4651 noitallatsnirotide
390,322,037 *27412432AB0CA4A12B9452C67CEFBA6076E2361F [email protected]
390,322,038 *2748C2A39A5B39F38DBF806E1775C0BC42C0BC40 NORBERT.CARRAN
390,322,039 *274BA36C7D8B27ED5ED7D0FD302FC7340AAE19AC 1MYHONEY7
390,322,040 *2749BF4FE41DC05A9E9B63B42BBEC9890A0778B3 NQ2787
390,322,041 *27475D1D92E224C1D6BDC348E69F98498832C7C0 1-PRIVILEGIERENDEN
390,322,042 *27416DF7A173EA085CCB5264677E26BE8A73E8E9 NULLITIE9
390,322,043 *2743B978158D55BDDABC664669B5F43E68BF5386 1-REGULAR-SESSION
390,322,044 *2746EFAA5D8F77492AE0D6862D0AAE37DC37F10C [email protected]
390,322,045 *27485B11347459A0F9BBE2821139BCFF6707D425 n>=x
390,322,046 *274B991BEA6B0E8F25F696E9F95DFAF2AE929C0B 1SEXTRIEB
390,322,047 *274564CB8B24A072164AEBC12A9553330A4A9BEB 1 SFB-GEBURTAGSPARTY
390,322,048 *274EE2405E72B26262568D4F66D3FADCC3F4B9A0 O371RS
390,322,049 *274EEDCFD18C244C82E2528D6ADDA6ABDAF93D98 1.t-com-sparte
390,322,050 *274B3992E840353EA17AF75DF8332EBA69DB2A27 occersz
390,322,051 *274D19D3A29D9D6999597B78AD0A9F6238D0E0CD odbornci4
390,322,052 *27452F28F2F59AAB1C351D7D0B6A57FC8E8CC304 OFNASSAU8
390,322,053 *274E99DD99A7A42E9C0121601DE692121B687C23 1 VOLKS-STUECKES
390,322,054 *274E9244D896B1B581DC5F71ADF4084799E42A33 1WOROSCHJOW
390,322,055 *2740FCB7255DF30985D933933E3600AC690872B2 1yamaha2
390,322,056 *2747267AFF5A8962A101017F54F2F41F0A834EF4 ondrej.pala
390,322,057 *2741AA8901BFB67E548C4E27A80AB1F8F2B22700 21unfalltraechtigen
390,322,058 *274B9994865E249E2BBD67DC82E16FE2DD8283A6 onsducapitaineJacadiz
390,322,059 *274FBEF53D0F5AAF4315916E5997E7752A80C75C oogstappelen5
390,322,060 *2740814BFE311B8E39334A5E5A41F952557CC3C7 )O(O~O~Q====B
390,322,061 *274B0CE74E2221451F3313FE2ABE5333C2606476 2407522 seit 18 jahren sitzt er im nabukreisvorstand
390,322,062 *2745049ADD2606CA104C9A06A3D3CD3D29FF09A2 [email protected]
390,322,063 *274DF0C8BA116FFB2B6EFCA75472ADAB42BD45C6 2449193 they.usually.keep.them.open..
390,322,064 *2740DBBEDE31A21E5BF02952E08E21E729BEDEE2 2452814 AINOASTAAN PUTKI- JA S
390,322,065 *274D6E9A1FC67F8CFE8289FFA73AFE348AF59C7D ORIGANONGREEK
390,322,066 *274A1F64DAEC611A81CF978FE9E29CB6427C2587 2646358 WENIGERDEUTSCHKANNEINESCHULEKAUMSEIN
390,322,067 *2748286B18D2EF56EE2A86E9998789B4729FC26B 2681226 KUUSILEVISIVIIMEISEN
390,322,068 *274B60425E6821F924E51937525A13153D407D28 275560252x
390,322,069 *274EFF4B6738002CD738D8DEE7D01C7FE6FC6933 otospoon
390,322,070 *274E8FA26124320DE1171A54A621F4538DFF98EE 2BRSKLKKN
390,322,071 *274952A8BCC38C7E13B56A365AFA2A4253E56B1D Over-and-Over-(extended-dance-mix)
390,322,072 *274BAEDD2BBFA874439668905FED71DA0E116A6B 2DISUELTO
390,322,073 *2744F6EB9D9EAE6BC94B7CEDD93A4EDF9157C57B 2 EI
390,322,074 *274E8DF73867394D2EC3FC33FEF3903B7D507264 pack r0ad
390,322,075 *2743BF0CA1C98DA9A13431509F5261FF1E3B56C5 paloalto(version3)
390,322,076 *27445D0E97BFA8218FA9F4274EBC3994719670E8 3##@.~03b<-
390,322,077 *274183A5ABECEA17213C20A6A5E0EFE6DD4FB02C 340ANIYA
390,322,078 *274D93E877CDEB05F0A0D19A2BFBB350974BF09B PARTITA-FOR-WIND-QUINTET:-I-ALLEGRO
390,322,079 *27427579AE4D9859AB8C153FE13FA603356B3EA3 passingthroughlapaz
390,322,080 *274B4282C7E317B37E2E46C4A4D93DE2DB76762B 39429 energia-2025--seminaari-tampereella-lauantaina-89-
390,322,081 *274343128B8EF7784A728870C6DFE5B8E9707988 PAT.ROLLINS
390,322,082 *2749119F30D9BBB7141D963F4368351E2C2B801B P---B~.~.~.>-B0
390,322,083 *274E0DE93B785AF98CEA886A31533920AFDD96DE 3CASSETTIS
390,322,084 *274803564959AEEBF6DDA3FA4E2F6EFB986A05D2 3=D-~-`-3B<-
390,322,085 *274418D14DEEACABB13C5C2C33D2A603DEB58DC8 3DONGARNET
390,322,086 *27466A4FA00592D514EF34B1F893F10F77FECCE6 p=====d`~ `~ splat!!
390,322,087 *2741C8EA10849E8910181076340D67FE0398482C pellaeonclass
390,322,088 *274F4A6AD505830382C7DF48AE0F9A9780911F98 3P ~ ~ ~}8{
390,322,089 *27435EC016CA9872D67241EFF0DBAA9458218BB5 3THATBEATLES9
390,322,090 *274EA8A58E1A44EC3F3C8657202C0C4A62CC3E4B 490dayami
390,322,091 *274ACD6A34031A2314C39E47F8F67AD13C9FFC3D 4CONCEILE
390,322,092 *2746614F33341BB9E4181CF81C6F74DD9AFF2B9B 4CURTZIES
390,322,093 *274F563E9C7EFD8A8BECBC591FD003B735A2D39B 4-HECELERE
390,322,094 *274A033633D04FA35A9758208F60DBF24F2A3751 4HOMEALPHA
390,322,095 *2741B5010574059397A2D29781F71882134A9B0E 4ITTUDIK
390,322,096 *274D13A8969CE3F191021601DCFFBFED2753A225 4PARANTAJA
390,322,097 *27486FD9AEF870BFAB6F1CF21E698DD710E6BA3C PLINÍO
390,322,098 *27469BB517EE0097B68585F08235EA75AC48B4D3 [email protected]
390,322,099 *27460BD38DD57800F8DC0D415DB49415245205A0 p===p`~`~(>-<)
390,322,100 *274113ADEBC1F1EAEA520BB277988F29A7BE0E4C [email protected]
390,322,101 *2745EA764E358DB93F251344DED52E95B2AA68DC [email protected]@N$
390,322,102 *274569ED03F49B431406CB4073657A642D633EF8 5BETAALBARE
390,322,103 *2747E1AF7511E104CCA116901F5A5FF152048DA5 PRIMMMCCLUSKEY
390,322,104 *274308A8FE10F3819342371AA1A2CC07CB71F8C6 5COSSARDE
390,322,105 *2741E151F8624C1CA59214182B2D3E2F687F403E 5EATHIEST
390,322,106 *274C227BB95C0C39C60345513DD6932B07FF1D53 PROS1212
390,322,107 *274364770E66CB30FC1205B06822A9B325FE3CB6 [email protected]
390,322,108 *2740587B9EB54B7A2CEB114DFCBE1DD4CF24381F 5GIDNUMLLOV
390,322,109 *274E2D4353FB744B261DD3C1F99A4FEC3C171894 p*u
390,322,110 *2740DCED5DCCDDB831F9D09D7F5137219649086B 5IAMWHIT1
390,322,111 *27400427DFBC88C9E1D986F06F8A64539421DAAC puraskr4
390,322,112 *2749B9023F9183DE90DDCB4F90E4AB056AF643B1 5MISSYBONJOUR
390,322,113 *274CB4DD2F794B3E33C6E6E2E07B930C5D6AA480 [email protected]~.`
390,322,114 *274DFF00B1AA3997975FF3091EB46A3A0C82EDCC 5NANCYBOOSTER
390,322,115 *274183AF7CB7C7CF2D373A5A6E61EB021BE5DF19 5PHOTOEXPRESS
390,322,116 *27421D32C03F7DAF91FC284552CEDB98593247D9 5PLANERINGTH
390,322,117 *274A1C1BC48E9D411EED0F9046A88F219B7D4A79 Q#B~O~O-SPLAT
390,322,118 *274275B0D723F1FEB9F340073B6DAD24575D49CC QIANNONG9
390,322,119 *274D4568EBC6C19AEAF12B909EF4AFA7E48DA089 QP~SPLAT
390,322,120 *27427996951ABBEE964903D8E83FA095DB753209 QWERTYUIO406
390,322,121 *274E75120189EA1B9A66B710996EE281F6C114CA R3U7LZ3D
390,322,122 *2741240D3FABE4D977CAC98B637B76D2F3A5CF26 5UNTERGEBUTTER
390,322,123 *274F32087C165F881CC5B4FF7A825AD067B8998D 5V4RI4T4
390,322,124 *27422D9B3F61537FB41E1309EC52343C1BCE17E9 5YODADRIZZT
390,322,125 *2745B8BBB9CE9441EA9BBB023B45FDA95BCA9E43 ramirobison
390,322,126 *274A0C3A6F0FEDE86115CBBA7117A5B8B99EDC6B 676484 mindestenszwoelfgrossetrucksimstrassengraben.
390,322,127 *274A4EB5EE438A518A2B308A0E50C64B552C1B94 RANDALLVESPERMAN
390,322,128 *274110FFA192D5F8ABC70FBF80355BA042E2807A randolphcooley
390,322,129 *2744F7322B33729C8E108216DD9A98F41D270DAA randy.milby
390,322,130 *274FDC2B437C84C18803A08FD46BD4B6A38EACCD [email protected]#
390,322,131 *27490853FC3525A1D9A6792067C242C49AB41235 raymondgonzalezjr
390,322,132 *2747C8C0AD45C017602EC514E74BD76FE18A40BC 6COUNTERDEFENDER
390,322,133 *2744EDD611B146551B7A88ED03528B2B86BE026F readabout
390,322,134 *2747D7FD181A040D32CE2FA2A83CF827AD98A7C9 6EGERNEIT
390,322,135 *274309EF9222D08C58236ECE80B2FED2E0CBE4F8 6.einbrechers
390,322,136 *274FC90282AB1C75E2BD19547FBBB514949C072F reckymi2
390,322,137 *274AA10C8900C451CE8198CEECC398DDF2DC7D12 6lmbaa
390,322,138 *2747663D3F0469BF13F1E530D763F2B83A463EF2 6PALEESTA
390,322,139 *27481153658E2BA590C790D7703B39C5FCF95ADB REOVERBRINGELSE9
390,322,140 *27476182F5C1F768D71C9D51114189B98BB1AE0D REPAR'S
390,322,141 *2740E1AC1D62F9E271398547196DBAA3155F14CE 6PRISJETISTE
390,322,142 *2740D676044C135190F02EF19B82E382066EF06C 6RECERCHIER
390,322,143 *2745703EA6934C4B9EF507482E7296305F593F7B RESPONSIBLEKIDS
390,322,144 *27411E08496B9CA03837B102080577AC002E5A15 6SNOOPDOGLOVEME
390,322,145 *2746867E86E0EE03CDFE4F5072A61BBA8B9EB36B RETSKREWDGUEJ
390,322,146 *27426DE536AB77329E60719DD82F0DA542CC1E1A REUDPANTNINGSHAVERINGS2
390,322,147 *27459358FA310F90E3080561CE96979161BBC974 6themiki6
390,322,148 *27459C86EA0CA96798574779B856AB0606998092 6VALLANPITJT
390,322,149 *27489E9026E1C6DE2D81306FE8A58B9DBD739C18 RHYTHMS OF PEACE
390,322,150 *274F0A3E60B06227E55A4905B6BDBD39636925C2 RICH.ODELL
390,322,151 *27402ECA915CE4F69C015A944CBE3AA6CA187342 rickyporat
390,322,152 *274C156D497A54DD62A9DAEA36258BD2F16580C4 RIDEYOURMULE,PART1
390,322,153 *2741194A9FE5760BD9C35F4EA96988A0DAA14B0B robertovogel
390,322,154 *274F1635100E96668C19AB606E56FC8D174F8CB4 ROB.HATTA
390,322,155 *2749A175ED3268135C5EB5EE2672645D38703CAF ROBIN RANEY
390,322,156 *27469452016DCF335F818595A5330BFE009516C3 rodrigoii
390,322,157 *274CA5C94CE191A1605E0ECAC64B8E6A8E03C33E rogerburkert
390,322,158 *27486F7473FBC86AB18A5D4B4D1EBDF440345EFE ROGERMONSANTO
390,322,159 *2746BA0FA1D933B726B0ABC83110E7A3B1017840 ROMENEYE0
390,322,160 *2748374AC1DF79053EF2E5738F5BA865B277E1E4 7GAMODESMIC
390,322,161 *274ADB0B5AFB6BCC34B52655169D72B395F733CA rudolfmushett
390,322,162 *27498BD50DFF54BBD6A6E1AC7D96E2D726B4FE45 7PETUNIASERGEI
390,322,163 *27410A3523ECC9E377920BA2AB05685D2C829FF7 7PSDSPRMC
390,322,164 *274431BB2102D31C19A196E9D052E7D55A9A03FE ruperttrana
390,322,165 *274B100F4551912A5E2C362890F55E649C1E479B RYAN KOSTICK
390,322,166 *27451F3D86C99090EEE106A5713A08E19BF099D2 [email protected]
390,322,167 *274DCFDDBA0881BC3A808ECB5A6569544DEB2B2E 7RAUDEERT
390,322,168 *274781FA2F71BB30FACE04520C4E4CABDDA06222 SADDL3.CH
390,322,169 *274FA0136769BF53AB155F8BE9792D356BA685F0 saedesrepus
390,322,170 *274317D70712D516116950B78CDD9DB446048EA2 sallana.sallana.(versiyon)
390,322,171 *27421465494C6587DDFDCD493CE6150937534424 7THERESAMARIPOSA
390,322,172 *274D3B6D47303F71ED818B3100C503D81A679776 sambier6
390,322,173 *2743F5C139C0415E8C9EDFABA0B151ED7E6273B4 SANDYMCCADDON
390,322,174 *2748BFE4DC0A8E595D26D396489B19BFEC2FA687 813381 rahasto-maksaa-viimeisen-maksuer
390,322,175 *274B326F87F7DEF9C4118F84E9BDAD77C9BD9B74 SANFORD.CASPAR
390,322,176 *2746791DFAF97E15F909CF72A868F41A92415399 SANQUIRICO
390,322,177 *274F7AA58CBBC0B725341E84792CE42C6055E398 sborimomesboridusho
390,322,178 *2745E59DBB8B90DD341A63425D925A3461C6A046 SCHAPERS 6 0
390,322,179 *274C5DB0A4DB941EBF65B36C9341045BB06EE04B 8FULDSTNDIGGRELSEN
390,322,180 *274422095732298C50F0810D0EE7168BE18E89D0 scotlovelock
390,322,181 *27460D841C2AF1CF2939A0BE19C82C030C2CCE5F SCOTTFRIZZLECOMWWW
390,322,182 *27435DC66EBFDB9CB87954B829F04E0F4640556B 8HBDLTUWJZCKJW
390,322,183 *2749B6220E5478570B91D84BBCA2FCF514F3DA6D SDKOMGL1
390,322,184 *2742071ED48FC5CE1B688C1EFDD4BAB5C9CD102A )SDNUOR 23( HSIFWOLB *
390,322,185 *27425B2EF3F601109C8FF95788B7B38349D9C3FD s+ea
390,322,186 *2747ED66A85BD0E8D4718CD1F0055F7C9D7A316A sebastiannored
390,322,187 *2744DC3BB8FE36834B6A1F5EF3F9C876D6489CDA 8kakkestoelemeit
390,322,188 *2744485699289C2A1AFB3D1AD6141D3549CC94D5 [email protected]
390,322,189 *27435992BC37B60B82AE99533E1663C7E1ED1D79 serious-sam-till-xbox-live-arcade
390,322,190 *274AB0A04BB5B63A23D844B3E423A1A2F38F77CC sharon.mcsween
390,322,191 *274C45FF83CDFF2B773BCE7CE9CF175ACB6F0071 SHAWN.CUTRONE
390,322,192 *274956B785327251BC02BC7E44C3E9E407475F08 SHAYNE.CHALET
390,322,193 *2741E543C634553B63CC12154CDF674175359537 [email protected]
390,322,194 *27431A22BCA2331F35038551B83C2AF0F60062F5 8myrocky16
390,322,195 *2747B7B7D5B4B1A99D6B61445FD5833B31AF2484 }8{o~qP
390,322,196 *274B8D89E447007FCF9D0CDE0858AE43DD119584 8SNOHTELET
390,322,197 *2747BDB0F97909B8D0AAD703283796DEBFF208C2 SIFISLAFED
390,322,198 *27475F46F403498C957FBD91C9E65D3A7037F626 8STATENVNNAMESPACE
390,322,199 *274E47C3E7A36F5119E47BA77AE19A901F0112FB 8SYDILLE
390,322,200 *274CD4A6D7E7CA44B37B342190BE87E6989F695B SIKERSZÉRIÁT
390,322,201 *2746705B994786B4CC80601ACB7B7C14AFDB930B 8TNGSORTER
390,322,202 *2741E9D18FC0339954E45BFCFE25A7F83A1F2470 8TOMMYHOMER
390,322,203 *274B01D7A47B3D51D93BFB3FC45BE4607C9CF638 SIMILITUDINUM
390,322,204 *274ADF4AA5708218E33B2F21952857C293E177C6 995ADITYA
390,322,205 *27481FD077AB11A298C3F73DA223F601436430FC 9BSWWHIPPLEMANBSW
390,322,206 *2745E3F6F5FAA0C5A88895491D4A9C057740EAD1 9CESOTKMIS
390,322,207 *274A5ABCD9445BBA10B08F995690C3A7F01BCB7E 9DEFININGAPACKAGE
390,322,208 *274C5EA7C4BFFFF0ABD3A1C56DEB2AF6904DDB7A SNICKERSDADDY
390,322,209 *2743EF30A031F13147B3C245CE0E702609CED51E SNOWCOOPER
390,322,210 *274C27E7811B9DD86F31040C263246675F236FBA sonata-in-c-major,-k-330-iii-allegretto
390,322,211 *27423D6B9F7F0529DCED5868D74D34E08A86D911 9REHAWAIISKJORTE
390,322,212 *2746C6A7881A14ECD1EEB59C4B04ABC46A51B847 9SANTAL
390,322,213 *2747CBDAF28708ABB46FF528AD90A14A9FF9E674 SOURCESTEV17
390,322,214 *27417DAD0AAF3902173ED4F276DB9CFE60BA0C24 9SUCSAOXE
390,322,215 *2740FF0BD74D1942227C92CEEA5611DEC6A9D76F SPIRITOFMAN:HANDFULLOFNOTHING
390,322,216 *27444AFB61B8BDC5C6235E87A20B4E1F39ABBB99 a9aga
390,322,217 *274A1FCF92A94ED332B9942C7EDE2F96B2102C71 aaa9`'
390,322,218 *274019092A950AE19AE4893B9EC01CDA0C4F6A28 AAC"%M
390,322,219 *274EC511A3F1A29E6C1D1E8B6824C53654EC4EDC AAC^O8
390,322,220 *2742BE6A43C34AF362CCC2CECBF3BACA809FF9F1 AAD$`U
390,322,221 *2742D1D074016208CAC1DFAA5AF7C4F74DA26587 AAD:+Z
390,322,222 *274EFFA9F16543C5269FEDA3AC9CB7EC707BF316 aangenaam.klassiek.editie.2002
390,322,223 *2741F39E703D49779D0867AACCF2030CAB20F530 STAN.SHIBI
390,322,224 *2743D46097BF4ECF8D37A5F3E0E886DF093B69DD aanpaptes4
390,322,225 *2747DA319AA37242D3DAA1C3E3D36E51783A1E98 AAS;&
390,322,226 *2747F767CAE9438E836BA8D40AA783B856B7ED36 ABAKIENĖ
390,322,227 *274A56A8074A31E7973BA148FD7821FEFAFEDE03 [email protected]
390,322,228 *2746880F0E23710F60B5F49499C0C6B92BE7DFF6 STEKEBLINDS4
390,322,229 *274775B593831111628D4B1DC5080017F7884709 abdulgeorgiana
390,322,230 *2745D5DE9696FD0F09D909B7EE99B62BB0C3D9B3 abelwakeham
390,322,231 *274A95ACB0D840D4F60CC2A637A98462AF8EADCC abpbr
390,322,232 *2741D7EFAFA2722C6712FD2AF170F48F7BADCBA1 ABSOLUTVIKINGS8
390,322,233 *274A1ED7A82D0BBC9FFE64E73509DB6D9EFC5A1C abtm&
390,322,234 *274AD13104071A84E6DAA5D1F60AEEBAB1BE0232 STUPIDESES8
390,322,235 *274A634EC8DF0BF045A76AF6483704AA13C3151F acez^
390,322,236 *274A6171F5D875F44777750EE1F4EB40417D3812 SUNBIRDSMILES0
390,322,237 *2748B02383DB367B54270B7E98434BA641E99CF5 SUOTORCIDOPYH1
390,322,238 *274D5E2089325E13A5C63B99004B6199849CAC78 ADAM-KOWALCZYK
390,322,239 *274E5CC9E83178E76F1A247C3FC3D9A81D24929F ADERENZE9
390,322,240 *27417430439273093995C6F40CF67B7BDC210A41 adh/1
390,322,241 *27471B759F56D0220DF027E5B597D01E97609666 ADMONISHES5
390,322,242 *274245EF2D0BCBA34F81D8BAF698AAD88AEDF34B SYN0RCH1D1SM
390,322,243 *274221BF57D570F5038BC41A893B8BFE4CD97447 SYNDYASMENOYS0
390,322,244 *274AE25ADC7D50EFFBD90626C63D4AF97BF6CED9 TAKE CARE OF
390,322,245 *274319255D69AF71EAB1FCE9FD83D8C62C3E5D23 TALTOSC2
390,322,246 *2747717C732DC482CAAF6A0DF83F76E64B8E62E2 [email protected]
390,322,247 *2745289FC9A3636F5E45B5F18FAAD9B4F1BD443F TANGLED.UP
390,322,248 *27455A25C9F051C30CE7D8CF3A0C22754C097769 telakkap
390,322,249 *2746487F70D5D6581C28185414B44800FF00830A TERVISELIIKUMISE
390,322,250 *27428FC6D016613B9DB7FF1A34753BDE96D5BA15 tetricusa
390,322,251 *2743FEA456FD906270E53C6585076A196C2B9A3F thaddeustarallo
390,322,252 *27419B626D13AF5D1D027385235AB1F01ACD6BAE AJZHP
390,322,253 *274D442756FD673DE7782926554114F487632B29 ALJ&R
390,322,254 *2743BF93C41A51F91CEEBB35254314603F384E17 alkaptonuric4
390,322,255 *274CD21C83B85F2841A23D6375D348C810E66CCC allschwilerwald
390,322,256 *274EC3293001CB9FC37F1D2F8161CA29D667FF50 THEQWER29
390,322,257 *2744B2AE5C20F772ECED3C4E17F994E48F17AEF0 THE-WAYS-I-LOVE-YOU
390,322,258 *2741A021804C25D77F31CB7FA90F25CFEF032E30 THUNDERBFROGGY2
390,322,259 *274C5B04E27598EEF3C028486E0169967819ADCF THUNDERSHAWN0
390,322,260 *274E3AFAE5B10EE1F681889825BB60C1D5755ABE alyssapicture
390,322,261 *27442B3EECD9E4C053A7D13C3119FC318A694C82 a.me7
390,322,262 *27436735F96829EC242169FAE1393170784FF230 TIMTONEY
390,322,263 *274D39DEB6049CD99B8670B3B4E64308BD86B4E8 amorm
390,322,264 *274F568608171D7693E74246CCBA623445BF34A4 amoudshoff
390,322,265 *274763F96D0E736A7515ECEA16DF89AD8A5850D0 a/"na
390,322,266 *2744EEB90F483329C3B546B209954E41DF647C18 anbonsded
390,322,267 *274B24AE02EC76D41E6FF61FF7EC15BC8EAA3E95 TNEIATCEJBO9
390,322,268 *274F2718B3A867D8B0FB202A51EB29EBCAD63153 AND HE ISN'T INFERIOR HE'S THE SMARTEST
390,322,269 *27496740C27BE539381E5BE408BC0A54937A2C1F TOMEADISLERIVA
390,322,270 *274CB839793ED1FD88E03017EC0119A72152304F TONEYKANNEY
390,322,271 *274113B4B90750B7631BA6C91DE7ABFF57EBF15F anfow
390,322,272 *2749CCBB6DBBBB68B6B7B4724DF0A2B2522BF245 townhallrag
390,322,273 *274768C641A8FEBEAE7C224638F08BE2F67CBA1B TRAVISSPITERI
390,322,274 *27428A86FDB8070816D8F06440A1282E6005DD21 TRESLUPPING
390,322,275 *274D746F52A7CDD408993C2288ECB15D27C7B816 tridev.vadhera
390,322,276 *27447A5750F3CC3768F5934F937E7BA25765B879 antoniacalligaro
390,322,277 *27410739EE36A2D06B1B865DF511CF8CF54D4A21 TRISCA-RANDLE
390,322,278 *27415E78E8D58E023A7EA80647795087CB67E802 TRISHA.OFFENBACKER
390,322,279 *274A870560268FE5A59FC6FB9658BBAF399EF261 TRISTAN.HACHIGIAN
390,322,280 *274DF21BA8D51B95368C9B096F872E2656E3A98A TRISTAN.PLOENTZKE
390,322,281 *27487F41BAD1305155CE1AF0127E6E8C68A938EB ANUOKUODS
390,322,282 *274AE524071EB25616C5504660B9F0435E5C4B89 anwma
390,322,283 *274F27436D65D4E420CAE917058B83D3FD620A32 TROLLDOM(BONUS)
390,322,284 *274CFF89CD74BA2147461A3C2D5B9DB2247FCF92 TULUATSU4
390,322,285 *27491953E5C432BE5D279AD762CAB398F6D74BEF TURTLEAPPLES6
390,322,286 *274E014EAA3947673C292A9DD812842F02061CEF twattled
390,322,287 *274B3961DA7B7880CE5BB70D35C62B15FD53DB75 tyrondelehoy
390,322,288 *2744A033B6CDFBACCC864781D2188C538332CCB6 UCHEOMAIROHA
390,322,289 *274DA2A3BE75AAD9B7EAD1640EEF2957726A1DA7 UITDAMPTENS9
390,322,290 *2742C6E8621A3C6EEEA19D4E68D400A1CB986D62 UKOYKUB6
390,322,291 *2744E31BDE309F4D8F6D15552E50FD4146255365 UNABANDONINGS9
390,322,292 *2746C15C80DE4CED9225435443D935D419B408F2 [email protected]
390,322,293 *274693E70EDABA5BF6EBB9E8EE32F6F712D68417 ARRIPIO6
390,322,294 *274257D37884B91531142F5A7CD446A54FFE5F79 [email protected]
390,322,295 *2744AD12EB0CE24DE74D14D72D3829B977CE63B5 astrologyinalpha
390,322,296 *27457CE45771CD3D14C708A2EDCF6159ED00E79D UPPS.BBS
390,322,297 *2741025155A06B362E72D5A6C3B45F6123B71415 AS=YD
390,322,298 *2744E575D2AA4F226AD0BC8EC18BC560A431128E AUDUBON)。奧杜邦未有見過活生生的黑胸蟲森鶯,便為紀念巴克曼將之命名。
390,322,299 *274C93E65D9F25D749D0C75835AF9BECF5A8F153 aufgeweckteres
390,322,300 *274194DE218768864B925FB59893945D820CDFBA AUßSCHÜTTEN
390,322,301 *274E784503170B2629D60BFECDD99B49F3A95025 AUSTINVACI
390,322,302 *2745D77059F61C5130EFE50136775DACFED3DD2B ava;t
390,322,303 *2741C3991ACE231C2E75A8D372E854A126B03A19 AW9T
390,322,304 *274859062104461B061F20F76B6F5C06E4D99626 AXQV
390,322,305 *27493186A25FEFCADF45E2405DDFCCC67DC39C14 b1hu"
390,322,306 *27455CB5E81F9F9A6BFAE6ED758701C8516987B8 VASALLIDEST
390,322,307 *274B7CF3C24952710E3B34200977E0E1FF849DD5 VAUGHNSENSOR
390,322,308 *274788DEEA0DD2D1E097021C6A1B886227D6BACB B4TTL3-SH
390,322,309 *27406CA90A40CC091D343E34C1B4F68AB3561BF5 VƏLƏK
390,322,310 *274BAF3C64935BB352067D274A232BD4561CBFB0 VENAY.ABLETOON
390,322,311 *274D5595178AD94EFC011B39D2BD3FE62160872E b7hep
390,322,312 *2740C44CBAB02886AC6A3866BC1594AAC452E09A B$8BV
390,322,313 *274043AC03D2B5CAF4594CB38E646210D847FBE5 b=9fg
390,322,314 *274DF9231B73FA1708DDF737F56DD4A3B086E66E BAE93
390,322,315 *27414C71D01BC72E69BF36DE65A79D3F6DE5A545 VICTORIOUS-VIRTUE
390,322,316 *2740FD0DB02367258EA0A7CF62E6AF12255B11F6 viderait8
390,322,317 *27409AA85B078CCB65507626251E4339F48EDE21 BASILRUXED
390,322,318 *2741D74659B95E5B7B14D8B0BA4E4B07070B32A3 B=B.~0~O.3B<
390,322,319 *2740A5977CA1191D25591BEACF163B0EB8EC1509 VILMAPILA
390,322,320 *274C4B02A1E8D6BF2B711BC8AFF513B0AA99135B VINICIO.HERNANDEZ
390,322,321 *2744B04E3E5697E1C3D5BA624E5C5442B7D99739 Vinros
390,322,322 *274B8A1AC700B7376FFE5C64FFC95D0D408328B5 BCNCQ
390,322,323 *274538A8FA21198B57518A3284CE7DC598A99BA5 BERLINERMESSE:ALLELUIAVERSESI&II
390,322,324 *274E8738966A3473D0DABBFFD1D0759E596F4738 bfbtk
390,322,325 *2741D99CDCA4CEE84AFD0AED246813C438122F87 BHNQ
390,322,326 *274DAC60471D732DC652AE1BFBF9B222661E0F48 BLN/;
390,322,327 *2743FC931F867F7C0C6AEEE702769A1495CA2580 BLONDE4
390,322,328 *2740AC2F26EB91E41F4FCD66187E1DE141129797 BM31F
390,322,329 *274B8B21D35C19E6E4A98C365BD8F5DAE278EE61 BOB.THOMAS
390,322,330 *274CF2F1F7CC5BBAB893E9E302B8FB6F9D3EBF47 [email protected]
390,322,331 *274FF6EFA1634FF1041DA6FE44CCC05397C18B20 wilmerhulslander
390,322,332 *27461C8484A20265B6D614BBBD88E9ED2D394889 bookerlefurgy
390,322,333 *274F35197F5C13F92B73BCAA4F5648F56E2A2DC0 wine.of.aluqah
390,322,334 *274A3016C044E66519FE8F31BA060C84346E46FE BOYCEHOFFART
390,322,335 *27496B91FE712236BE05877C196D7C8AF9C32430 ...WITHAROSEINMYHAND
390,322,336 *27416440DFF9D48685DA50AC813C6C3092431AD5 wnonstopservicetpeewrwithdrawtpecdg
390,322,337 *274EC617C3205FEFD204A2E9A11F8A4E63C28239 bpm4w
390,322,338 *274995FEDFD835697EC80CAE82DD80B39800AFA1 B#P~O ~O)X(
390,322,339 *274551B019A5FB686D0D5C92DFC2459FE08BCF3D WOORDBREUK7
390,322,340 *27424D4D0891C14473CC94F83A750F80FF4F3825 bradrhodesstandalonedistributable
390,322,341 *2748557050F6BAA97CC0197FBCA9347CF658C6DB www.acnantes.fr8080
390,322,342 *274857184CC34B3E148DFB168F84DAB3E8265A4D WWWBRAINDUMPSCOM
390,322,343 *274B8A3043BD39897B43B56E456A3D5AF2476374 BRENDON.CHESTEEN
390,322,344 *2740A3F7EB3C5777F99E08160AD4B13DA419585F bristolnorthwest2007constituency
390,322,345 *2744DDD6A2363C6DC65CBF9F097FD0A127474BA3 BSWVOZAMARABSW
390,322,346 *274C9A8D6CBFF7C18E87B7AB162EBC8C3AE21BE5 BT6OK
390,322,347 *27450F9BE14665098B421117B1ED70E78346D05A [email protected]
390,322,348 *274EB71972B223B22426D57B66B881325FD92729 xshadows
390,322,349 *274C7CCB310616F0D87D27A5C2CB69AAAD441F55 Y270685
390,322,350 *274D404AEC9543427C6D4159C42B63C321DD72ED y7`k
390,322,351 *274C8E716714A2FE60946D184035A0837EE6B423 [email protected]
390,322,352 *2746519915554EE810C58AC1C54C2BD3A49A9D5A [email protected]
390,322,353 *2742A966C33DD2C7A62D7E61E9202D81AA1D389D by/
390,322,354 *274EE274EF554770E6B440BE3635802F95954CD7 b%zid
390,322,355 *274F3C4AA8540AA94E99887D6AD019950C856650 [email protected]
390,322,356 *274FEA0F091CE52BC81D9E46AE906A158F7FFF5D YKB
390,322,357 *2740BDF7CD53E689053F51EA136E84E09DB8C76A yoliswa-miya
390,322,358 *274FE6B7B084EFB3948D93EAF242025D3AB35E71 CABANE-EN-RONDINS-(FINAL)
390,322,359 *27493FEFEA10A72E626E28FFBF07D960E03A3332 YOU'RE.A.RUMOR,.RECOGNIZABLE.ONLY.AS.DEJA
390,322,360 *27479EBE5C299D6F93BD8B42649CE8FBD13D2078 [email protected]
390,322,361 *274864A945C3B4495710F2A000FBC560E6DA3CBF [email protected]
390,322,362 *274CF6D86B0EA0E21C5B1DE74E9576C5E2962AFE carevinom
390,322,363 *27439796A8A634D54497C0F0E68A6BA20C0BD9F9 yvonne.mcdonald.short
390,322,364 *27430F5B251B303E7A970C0D0AEE14FDEC3218A8 Y{W8
390,322,365 *274C0573E5B62716FF908DA416325BD0B739E1AD ZACHARIAH.CHESTAND
390,322,366 *274153CBF886AEBC22CA3BDA4517C7EBBFA58340 zachariahrudes
390,322,367 *2741F2CC7E5BA717F147752BF478927773C2A40A case_furniture.k/eI/s_'f/[@]/rn/@//tS//@/r
390,322,368 *2743B9EF801C008D428B703736E92E2B6C18A828 zacharyousdahl
390,322,369 *274EDF9F0007E75971F8F18E66AE5FAC1A7A92FA CAVESINTEZA
390,322,370 *274BC34DAF10FC5DBC3E5F572A37AA0552C40A27 C(B
390,322,371 *274653D2BA595F9B300974C71AF320D885DBDEA8 ZAHAČ
390,322,372 *274B7E4304C486D36E5B836DDCC3364A42C0DC49 zano
390,322,373 *274B147CFAE2BB52F3C712F371304D1A8308A823 ZCRTUUSLPNDGD
390,322,374 *274B2A8D5EAD26336B9E9FB296C64347F6ACA603 ZEPTOANGSTROMS
390,322,375 *2740481CD53422EA47A916F5F9D4B109229E6B9D ZHA4EW2
390,322,376 *27457C4AB03DF604C842096F8663D9F26C2BD168 [email protected]
390,322,377 *2743D65B3C0F93B4363EF17773BDAAC53658454A [email protected]
390,322,378 *274B4491FF45F8413CE783A9F4478C912D6A98B7 [email protected]
390,322,379 *2746C4CFA55E9C8DF59757DEA04FACBCD1D323EA ZIYAADGASSIEP
390,322,380 *2740A7FC72D3D7AB234F836E62EE4ECD78C4DC66 ch0h7
390,322,381 *27490FCB0429BD8DA47600E776E1020665FD75D8 CHADWICK.CATHERINE
390,322,382 *2746E7F3D5A7B72B9B468CD90CB5E77F8F15D3C0 ZOGWATER3
390,322,383 *2742C8946A6533F5270653B8BC8F31F3E775F292 ZOOLOOGII
390,322,384 *2747E3EE393CCBC410426751FF1826135F7503DA [email protected]
390,322,385 *274F0D624975E62141843CAFA72872103CBE7C25 changchaples
390,322,386 *274497A46029F294F31BEE1CD59A250FC84195FA ZUZUGESTEHENDERING
390,322,387 *2749334C15D9C01D284A98448BF57A7A4F4EBE9C ΒΊΒΛΊΟΥ
390,322,388 *2742DE5FAB10B65AB0021B6D4696DA29D1472FBF АВИЗАЦИЈА
390,322,389 *274079937F9789367D98432EAC10600B903EC155 c"kln
390,322,390 *274728CB160513C5ECC200EE36EC374DCB8B200F C&#MF
390,322,391 *274ED8C8639327F7CC5EC3CA310AE484EF15A33E  ВЯЗМИТИНОВА
390,322,392 *2745BF73D1DD369D30FF7EE74849439106B26C2C c-on
390,322,393 *2748222516333410B90526FC00CD3B0FDCC6355C contriver3
390,322,394 *274C63471C2B871A78C66B0683FCF7D377A1F51D CORNELIUS.MAYARD
390,322,395 *274FC46EE9111DE305E4C2C8FC3733448681AA55 CORNELLZAIDI
390,322,396 *2748DCD5B14A8E111D314CF6B1006AC189073457 cpdvh
390,322,397 *274628888194EE2B032D6F9D2405EC55EF8A5196 C:\PROGRAM FILES\MICROSOFT VISUAL STUDIO 90\VC\VCWIZARDS\APPWIZ\MFC\APPLICATION\TEMPLATES\3082\STDAFXH
390,322,398 *2741A0716C761BE6B024F444CAA9C83DDF233A43 [email protected]
390,322,399 *2744E2D4E091CCFB31379F6AEB3B42D1C718769D CUIDONRAIJEMESAMOURS
390,322,400 *274479EDC1AEC89D8AD2FAFD46FD318F15766DB8 [email protected]
390,322,401 *274ACF6F488945C6D156FD93D8F2E1BDFC16EF2C c+!,v
390,322,402 *2741C96C29D477EBF2D4B3E253A614AB481A8B5B cx8lr
390,322,403 *274C939C867E48E9A503814670EB5CE5668F4606 CYFY
390,322,404 *274002DD0DEB364FA85B4043E5D886E08EFB6D86 DAISY.SANDIG
390,322,405 *274203F8CB709BDBDB45AF6C005D328CA42724CA danielkisner
390,322,406 *274C5CD16B8C9F2B53CD643F9F5763628DB41E67 dariusnjoku
390,322,407 *2743F175FDD275AD9D04D9BC0220512390FBC0EC darnellreges
390,322,408 *274F4B504ECFB5EBD2B59DDC91FB6EBE1608E0D6 darnix
390,322,409 *274880882A5D59188BB0F4761612EE8B7901485F darrenjerkin
390,322,410 *274ABC10963E310C1B0373BAB54E1437279DABE2 (0-0)O~O~<======8
390,322,411 *2747BDBB0EB8B710D073B8E36DD052929E7FD0ED [email protected]
390,322,412 *27414E13426EB9E0B37303773E1163C612CB17F5 [email protected],[email protected]
390,322,413 *2749A6E8AA4B716B21FF12961EA2D0271E81C6F0 D_DQ_
390,322,414 *27406C99FA4F4CD69369AB76509DA67B9D517CC5 06121103
390,322,415 *274E444084CCA774B036AF76B13F55D1C93CC6B7 11-.-.-.-.-.-.-.-.-.-.-.-.--.--.--gnirahs
390,322,416 *274119BE6E2498BEE4BF342DD2F287AEBAFF8E06 120894J
390,322,417 *274435713A4BCF465FE1DC60D081A03D70C7F849 DESMOND.CUOCO
390,322,418 *2746CE4DD2F0F4F5CE33757097AC133D2C9AE46D de}v
390,322,419 *27402D75A66AD8FEE1CD6702AE11E15E63079F15 DEWISALIM
390,322,420 *2747CE64C79DF54CB70BE06500A2CAC216D89087 145882 materialistderhalbeerfolg.
390,322,421 *27441F1EE4313FADDD3B175E07B502F2DF93614E df/"l
390,322,422 *274A75D730370C9FF324A2E3F1E04FD94888D7D2 16MOHREN
390,322,423 *27486AD3812F817F8450BBB4BED9C31708C9718A DGT-J
390,322,424 *274DB2C2808FF0BDF2072F052F50DE41FE45652E DHANYAPRADEEP
390,322,425 *274DAC4ECE93AEF799E9932085BC345C1C0B3908 D)H.B
390,322,426 *274148D026FA0E2024BCD999888029CFD453F7DF DHV(9
390,322,427 *2744A597CAA7FAA23E8380002E793D6679F5A859 1 BASANI
390,322,428 *274704F4E090CD4038DA8DD09B881EBEAE328F82 1.baufilz-affaere
390,322,429 *274272581B8D8F2204061E6F3CB2151B42C71318 1BLINDMYTHOLOGISIERENDEN
390,322,430 *27457FFF5834ACAB03E3AE181E09579F1C5E1F02 DJ18(
390,322,431 *274E536B5CA536045C92180F6C2EF0A1EDBD51A5 1.crashindustrialization
390,322,432 *2743AB434985518332B64718B5F828D7AE92345A d,k;o
390,322,433 *274124EF4AAECECECAF81EB9B81840640FD65945 1 EHDITTI
390,322,434 *274F2CFBC5A9EDCF8EA7557AB38D43669D2A1AB1 DLTX7
390,322,435 *2748AF634BC304710694BB70FA311240392CC024 DNMDE
390,322,436 *27460D3661250D56DE14B845AB1E283CC26F3CC2 do-je
390,322,437 *27436E8BC171F40BB92E7376AF7425DFDB39DC84 1-KUNTAKUULEMISTEN
390,322,438 *274D46C0BD3E7BA71E01EFD3E770B9F5FA6CDAFF 1.landesbueros
390,322,439 *274AC4E9D2F8DF86CA5BD3D73B2FF3B9422A6EBA 1LENIN-HAHMON
390,322,440 *27408CC868CCC7D40DDF65859028BD49860551AB 1LIITTOTASAVALLANRAKENNUSTY
390,322,441 *2749A62C922AF77E854FC714190DB9B422E981D3 1.OLLENHAUER-HAUS
390,322,442 *2746D06CDBE214A73CCFB3708814EAE9C6028762 1online-hakemus
390,322,443 *274693DC28A04095F4741F3EFBE8813FFE5A0F32 1 PERHETUKIPROJEKTIN
390,322,444 *2749F86ACDDE262638EE214271E21D05D5EFA73D 1.RALLATA
390,322,445 *274098C5C98F2A6B9FA850A7D361794421BC7A7F D$RES
390,322,446 *274DF204018D4A33B38CB50859E010F5A41B2C67 1riittaan
390,322,447 *274F3B01AFD082D3564D9627D9F1D385F37B0452 1salibandytaktikko
390,322,448 *274EE665EB063B0BCD022F34AF5FD3B93439EB9B 1-SCHWIMMVEREINS-GEMEINSCHAFTEN
390,322,449 *2743700C03C0CAFF468C00DD244A0C00E3DCD3A9 D:#S#
390,322,450 *27480752E0B36D6D71ECB2473C3A50F9D7A0C034 1.TRENDIES
390,322,451 *2740E2FA651A0CC9FE6DAEE5F1A2EAB1283957B2 ds#_w
390,322,452 *274D504D8FDEFD562C16A295DF448045BD8E80C8 d_t1r
390,322,453 *27457D4907F64A0F172C476A326C3CC0807766F6 2093117 MOHRING-:-NEE-
390,322,454 *274C6FCBCCF98BAAE304351C6CF8B27494B260E7 DÜŞLERIMDE
390,322,455 *274DABB6F827112E561921A6856A7E018CB5CBB1 d(v%5
390,322,456 *27439AA426A2E26E035CEE9C308B016983925C2B 24038 SAGLIK-EKIPMANLARI-VE-TURIZM-SAN-.-TIC-.
390,322,457 *274DC2A1E83743EC3036BC508CAEBDC917B403F4 2587434 alle litauer kennen brazauskas
390,322,458 *2747CC6A6FDD2C95E82D3846E5D1109D40BB8A98 25november1280
390,322,459 *27436F84307C821FFA8E6E5FAF26F4D1403CD339 EARLCHADD
390,322,460 *274940EDEEC67633E5F040138160F3C4108783AF 26oct1185
390,322,461 *27437291B7BD889B7D1749C7A86AA129FA97D313 2818054 gardneralsowoundedabailiffbeforesurrendering.
390,322,462 *2743442C910E7C5300D57D6D2D0A22977E5752EA eb3mn
390,322,463 *27437E4FEFFB9A367051F10D4D737306023B91CE ed!m+
390,322,464 *274A1886707256AFF993C4975647C2895F98B3DC EDMUNDOKISTER
390,322,465 *274FCFFB273C6532C7008A6FDD45C344B87C7AF5 2iluvletter5
390,322,466 *27400DBCDF7719EB4399A8456C871616D5BAB0DF 2KUMIKETJURULLAT
390,322,467 *274864D317B527F71DD490F2D7BACD4CD185F486 2 kuvataidej
390,322,468 *27485D4DD7693C13842C2A07C91051C7ACEFDEC5 EFCO_
390,322,469 *2741F55D3383C57E68877F14314E34AA05BCC48A 2.menabouttown
390,322,470 *2749AC9F92BCAC66141E7505E313FBE977B81F01 2SATISFAITE
390,322,471 *2745D01B8D5216BF84B81EBC3C29447567B104B2 EHENRY
390,322,472 *2744E42EF9DA89C1BBF7367C4DD1DA1BCDF63D56 elewator4
390,322,473 *27413458D39241B00D31E2F6CC23ECF2A3E7E356 ELLSWORTH.HAMMERSMITH
390,322,474 *274AC206ADE863362AFC6AE5C0F20117B93949DD 398032 PREACTOR YAZILIMLARI BILGI VE DENEYIMI TERCIH NEDENIDIR
390,322,475 *27421045D5B6799EEB80FFE7FBCDADF44815692F 3ADFLAXES
390,322,476 *27477D89CCB713AC101E81E87F17CA3930FCD3B9 emaid
390,322,477 *274F4D1759817DDD0BD0AEB802DDB8D71F6D82E9 3NDUIR4
390,322,478 *274D85950560F2039DDF4471105A4FF9F4190B06 emshtr
390,322,479 *2745A155DBFF0092C5222F8558DACCC260D88ED8 3SCHORHEID
390,322,480 *274594CD0710C6A9D5CFC1DA7E49DDBBA62F660E 3seminaarilaisista
390,322,481 *2742F12C8D6952F0C8FC3CE0ADCC940FCD86A756 3----->`~Sploit
390,322,482 *2744612BDA412EF72EB0CE4ACA35989EFB7DB956 ENP9&
390,322,483 *274BBEF25AB8E3CE8721A84CEA960FF47ACA0524 EPISTE
390,322,484 *27429CF08946A94840D1F97D4CDA7DA1F52CE162 ERASMOJONASSEN
390,322,485 *274A16953901B505E67938A7B7663BC960236385 ERDOGAN555
390,322,486 *27403E24C57A467A35896CCC2058103216EA92E0 4GUESMAN
390,322,487 *2741B934517209AF89E89260386DD5C467660D0A 4HSPANIS
390,322,488 *27405DF496F6BEBB258F4B2CDCB224EAD4782CB6 4 LASTAAMINEN
390,322,489 *274FAB5CAC5F582FC432E4D7E17EF025A309EA62 4RACOONNIKI
390,322,490 *27460F05A0EAFC536265525919BF23FE3D02AB4F ERNREREN1
390,322,491 *274E456BCACF21E543D7603EC0E5929CF2A8A017 errolbartunek
390,322,492 *274B51B4265A814A392F88059331630B73EDEFBD ERVIN.KUBICA
390,322,493 *274F46E18BE3DE88EADF5572FAF4B7AFA8135872 4SSIGNEKU
390,322,494 *2749A38D0BF2255529A7D90DA461F68D8B75794A er+z/
390,322,495 *2749C8842DB0D224921474A79CACA0333DD3E97D 4.TURVALLISUUSYMP
390,322,496 *2743E819B6493C945404AC3E358F7E178DBD5536 4-VAALITILAISUUKSIIN
390,322,497 *27468D4FBED6E14FF49F9A9B0AD19CD0C752C8CA ESTIMPY
390,322,498 *2743858196D43D3422C38422E640B2D13C068192 5:--5---#---&---natural-resources
390,322,499 *274931830FCDFC667C57694C228D9B52DC44F44E 588PP
390,322,500 *2740867A637433BB4951DB70DCE61DAFA4313401 EUMENIDEANING
390,322,501 *274FD769B43162F247F44A53D633292BA328834C 5DANIELLO
390,322,502 *2741236CE185526E85D5A193A7C0E6C358DF5D2E 5EMBARALHOU
390,322,503 *2740CA82D37FCB20C348B21D0478BD3E173DF3B0 FACILI.
390,322,504 *2743AF7E4A8B42824E677129E4A92CFF82E90A8F FANFARE/I'MCOMIN'BACK
390,322,505 *2741D7F1170DD8245106F44B1B2EB04EB50757DD 5ODLARAF
390,322,506 *274B9A8B26BD7AC646E5A09258D603AFD9F666EE FELICIALAWRENCE
390,322,507 *274781EDCE073553B08E31BB2D8D9D3C622A969C FELTON.NOGUEDA
390,322,508 *2749A5275816F42217D9B073A247ABC0FB0C00C6 [email protected]
390,322,509 *2741B87E98A4EA71D1934BAB212D34236E34C965 5TESLEREAVSESLEDEARTFA
390,322,510 *274BBF6E4448161EF9F475203ADFC5F36F40E532 @FIDDLESTICK
390,322,511 *2740A46291EFE9029B905C6F991CF84CDE7671C2 fiespin
390,322,512 *274CEC3020A62A46A81509115C5FC51EDF5A62A8 FIREPUGSUN123
390,322,513 *27481B4F570DE4CB40AE19610807268F0B57FC14 613EEE0E-8E83-3AE1-A3A8-45E3FC52FD5A
390,322,514 *274A8EFB347C5CB1CB6CB392C4689464E57E3DA3 6BANANEPROF
390,322,515 *2740EE8C8A6C832AF61A8595045A5A550AAAEB3F 6F9F64D5CBF0368FA61C93C64B59B56E
390,322,516 *2749B62CF6D745D52D5797E295A85DC3101AA0F8 FOCO
390,322,517 *274CD84455FBCBA44FE1DB8500611AB9BD0FED5D FORMALIK8
390,322,518 *274DD7C42A02CC6843E736E7B11EF72FC5299E5D [email protected]
390,322,519 *274821703B946EFE5808411BFA07314426887C99 6JEANETTESCRUFFY
390,322,520 *274D431F417F9AE2331D00F690566DBE9768771E 6POHLEDEM
390,322,521 *2746329C1B6956715846C49B2BDFE94EB1EBF3F9 6POLITISERET
390,322,522 *2743C30A7D031A6DD0344FCF845DE492C41CBD9A FRAXINUSOREGONA
390,322,523 *274A96FB54B9D9A6061BD8BD5983809D255C94F9 FREDDIEZENTS
390,322,524 *274DCD9464B1C515BE2DDA2F68BE82D36CB3001B fred finn's
390,322,525 *274D17EDB2BCCF63EA9711180D8575393B20440C 6SERGIACOMI
390,322,526 *274699B2EA9273E1214D6C1CE25D7AE4E2B0A2AF friniere3
390,322,527 *274E676D302F283371E6A211EC6A354AAC8851CB 6TIROIRSES
390,322,528 *274763A0FC062D1777E3DA24E7804C142EE87F3D fromtheshadowofelvis
390,322,529 *2745AB11BEF69B2CAB75041C3B5224F4AB9C02F9 70797 ISMAIL-ONCUL-,-AS--DR-
390,322,530 *2740D48EDFB34BBB237A913524145BB59C07E641 71c84b
390,322,531 *274B471CE63F4D21CD8D159949010C57DEAC8E1A 7BSWJSHYUNBSW
390,322,532 *27471F392CF0E1B387188D479937E63B2AC63E91 FUU64RKS
390,322,533 *27499FD8026D4303761CDF415A6964DB15137FF2 GABRIELMULLENIX
390,322,534 *274D2436E14FE0CAB8D1F88DF2E8639E844582F3 7GEWALTVERHERRLICHENDEN
390,322,535 *2745D9A7ABDC23B421CFB3C518B35A44B274B883 7GILEDRLI
390,322,536 *27410B06CB07797BD185DF689F78B40B841D296C GAGENTS6
390,322,537 *27492C7D4C4AC03885B4F9EE0BF534DABB23E09D 7INVORBEIKOMMEN
390,322,538 *27473E1E573B2CFCE51BD57A7968E16282782D33 GARRETSWINT
390,322,539 *274BBC64AC15FEA6D79E3BDD4181A80E6D5800E5 GARRETTRANUM
390,322,540 *274BF06FB063739E686FF2F439EB5F0EBE753DC1 [email protected]
390,322,541 *27411CBCEB5F149465004E41A7A68A6D6C5B5C1D garyarenburg
390,322,542 *274FA0F20F19E022E4E3076C661009F55DE9C459 GEOGRAPHY_OF_SLOVAKI
390,322,543 *27415B3D37F60BDD17A5FC197B64B0E402F7E7F3 geogri
390,322,544 *274FF51337DC081D094D282036DA4B8B3F8D95F1 7TPOONKLEMEZ
390,322,545 *27435F41C1ACC628F5DADDF447CD3409FCA3E5E4 8085vm
390,322,546 *274DA6D10CDEEE0F6363773DC5857882631C5D00 GRENZHINDERNISSE
390,322,547 *2742E663466797669919154E412ADCA92E1075CF GROVERVASHON
390,322,548 *2745C81D19A216A6E53B4CAB2F293B859356D533 [email protected]
390,322,549 *2743F3CEBADF6F6E2F0F7C49405AFFD57C6E61B2 GUITARITCOMWWW
390,322,550 *274686B8E90327456E99F7F6E7E2CCAFFBC94827 8EHTIMISEEN
390,322,551 *274DFB4DD1ADDFA10005C69616E8312CFF69F952 HADARTAMIR
390,322,552 *2745570C6D7CA5440BA31408C5ABE52D2D0BC80A hale)和
390,322,553 *2742085710D77089EFE1F137B9EEA4FBADCD9832 hangetje4
390,322,554 *2743F3AD13DFB94FA931ECFD4FB7F50ACDFD50E6 harleywolkowiecki
390,322,555 *27416925BD3AF5821FC6094C1809F6A5B752CA11 haroldcapp
390,322,556 *274F5D107A20D66B8EB450D5AA2DF0EEBF8947E1 8NNAVEIV
390,322,557 *27429DB4A8D8D02A7B600619CE439BAE94A4CA9C 8====p ~0 (^_~)
390,322,558 *274B000A89224585E9570DB9CDAA73ACEC3FFFF0 HERONSFLESSEN
390,322,559 *27413B3AC853A32C01CC4CEB7B05464F59E11DC2 hey513hero628
390,322,560 *274459E87E62089AFB09EB7BEB84FF3AE600B8E1 8VPJEODR
390,322,561 *274116563684B73EF0B4C09B1C243AFD9E695957 hjahr.2000.(disc.1)
390,322,562 *274A637350DE336E30CDF32BF878B17020F0F40D HKENUI
390,322,563 *27440FE00D80984854AAC59479ADCC0EE66B9C02 hkubarak9
390,322,564 *274CE03E39C1E7288CC5B35D0A05B972E4A8FE83 9DEADLOCKER
390,322,565 *274F04D42AC83FFF281568FCDFD45DD01C2F3FA8 HONGVENTURINI
390,322,566 *274A2D794510F1BDE43BE887D684C55B25CAB51C 9GASMANMOOSE
390,322,567 *274F133E883A2F421F2753DDC31D6240C618B0A6 [email protected]#$%HOTROD
390,322,568 *274D2AC3D91CEC328F9820B989C79CDD3329AF8F 9LENTHEN
390,322,569 *274D892B174D6F009A479A32B628385535CE0477 9LOCUSTBERRIES
390,322,570 *274A6D42A55F6D59898DEBC3B4EF3E8797900A57 9METONYMSES
390,322,571 *2749BB5C4F8FBA14FCAF762F91EC8A6390EEBE6D 9POIGNASTRE
390,322,572 *27416D863CC49BF0732496EF456D705E04CEF2E5 9SKONCZONYM
390,322,573 *274B0ADE40C42DD945BA513113C9371803FD330B 9UNDERMLERENE
390,322,574 *2745CA78318BD1BB42101FBC5EEF97D670B3AEBB a3tf:
390,322,575 *274171CA3F9D1523B229B6A0BA70D1874022B80D iZvlR
390,322,576 *274F8D3A24E9E191D14C10A8BE38F2A2C72DEE1A 3
390,322,577 *274BE4C2C128731D12066452379EFA82810D1366
390,322,578 *274A0A762F7494F557DD2871931463FE10647C4E
390,322,579 *274D023A721DB77E3BA6A409D8AC6B53F3B757AB
390,322,580 *274D871F478A6656602ECD99EE2723B3DC81BE84 g[nn
390,322,581 *274AAB773A7FA6E6292C4B0F1A102689D914FCC4
390,322,582 *274208093B6E4964C0DD60FE90069677898B2A5E 
390,322,583 *2746F8B8FF34F624254F67446101D467D598482C f
390,322,584 *27407406531DDBF75E3276312F3D5870599951FB ?
390,322,585 *2742D73580EFE9397044214682BAA82177852E80 +(}
390,322,586 *274CF4E4F4C7C3F42F0EF1E01C347C27C94CFB4D IAMFUCKU7
390,322,587 *274462E6404F94C35ABE22722BBA600EFA578D7A
390,322,588 *274325C733CB5409C65908D8213069509E46D0FD
390,322,589 *27452FB370C72BBF396D598AF28287C12FDB86BF tn
390,322,590 *2742974EDE0C19D00682A137C45F09554D4A2840 ibq{
390,322,591 *2741B33CAA76398EB29656C5FBDC225507815032 X)1
390,322,592 *274CD78A7D29FE06BB0FB847F71D761F82BDEA52
390,322,593 *274F0AF80EB36FA8BDB4548199C47AB390766A81 ID338376889
390,322,594 *274987B5D98FFDF871F500E8A73D7DCFCEC3ACBA IESELOEL9
390,322,595 *2741339BC931360D8F29EE14882AE75174142CCF
390,322,596 *2744E83C24309507CC05D36E7C77D15DAB8A9B6C 8
390,322,597 *274D1C77906A1E48F3A32053A94AAAF3FF04F436 R
390,322,598 *2743B0DBBF5A47B4A8D5ABAF7E395383AF5718A2 ;
390,322,599 *274BEDF78645584C7C54AB672140514EEC62218F J2
390,322,600 *27413F666DBA88955948E0D7B2220A76F72D5A90
390,322,601 *2747E02BE60089AF2FBF37AFB9924DC0CD062C5D [U'
390,322,602 *27441C227A25D9F52FF2C117D60465765F0C2746 Z
390,322,603 *274A341EA9EC0FF4FE9E7FA3BEAFC9489FE71686 B
390,322,604 *27445A8971507E0B42F287D38C4963CCD6BD3B42 Y
390,322,605 *274EAE6A4A3288AF8B21E548BE13B331DD052B36 5$wc^0
390,322,606 *274E8C4B949DB19D28F02B9EA07D5C07AD3D25CE
390,322,607 *2744A000C3768AD3171963EED3CB5404E4A3729A
390,322,608 *2743A99FFCE7CB24BF717DD8EEE16290AAA42FFB E>
390,322,609 *2749099C305FF92CC82FCC0748F2E982CA1737D1
390,322,610 *274E06379304E79E0F1C3F110F6D4E1CBB2F2FB3 IK-WIL-MET-JE-LACHEN-(LIVE)
390,322,611 *27481ABF547E3AC5E4F1BDE7042031C58FAACC37 TBG
390,322,612 *2748DB1EB52344CF6DDE2E36DD854B0E28B3D210 ILUVHOME01
390,322,613 *274824396A06B7CFEC0EE001E74910F42306DD03 J
390,322,614 *2749A004EEEC905DCDFEA4422DC456D090CDA765
390,322,615 *2747CC088CDB2F2B69021F83E4B752871DE491C2 imigracije1
390,322,616 *2748BAD32DCC6D5B1E9B14C85B66BD1257D6534C 
390,322,617 *2743B2B680191E889182F7F0CA792D197E98CE3E IMPOPPATI5
390,322,618 *274318F481648DB93A4E493F326D8AABDCFA92D5 [email protected]
390,322,619 *274C0FFABC9EB2C10834D804EFAEBFB0D5188A1B indica
390,322,620 *2745B61193103545D2A444FFF14E629BD513C681
390,322,621 *274285F39A6DAA3407A1E350FC5F46B63E99658A 6
390,322,622 *2746F8BDDF2874E95C16D85449DCF3BBF2861F9F
390,322,623 *27420A61B7868FFABAC260756E03DA044301142C
390,322,624 *2747745388B94D06B104D594D926F6A684AD21CB J
390,322,625 *274051EC3D71516F7EA97AFDD248D8E6FFC8EF25
390,322,626 *2747DE08BB6C3E2A929671D8EAD01A0B2F65ACFC insaend1
390,322,627 *274C16A2D963E19BC8917C107F74CC89C55450D6 ,u[
390,322,628 *274BF41100E443C68759D83E160E134B58701C3E
390,322,629 *27419FBB41BA573C61BE36B57FA04DAC04806FF8
390,322,630 *27426129E16FDCAB1E6E2DA2FF9DDBAEA08D3FFF
390,322,631 *274DF3C27A1EB008564D3FD7E73FDF262F57EAA9
390,322,632 *2740BD3C253E27F93889E9CB54D7AA8856105E2D
390,322,633 *274AC8DE37600150787845E85782C92614F6AAC4
390,322,634 *274A4C1458A0A30E7FA9DF56BE2973AF4A655FC3 INUOHS
390,322,635 *274EB3EF647771BB159E0D91790E62757E6B4218
390,322,636 *274C8E1EA4207585419D1D00C5D6C9E04E02467F
390,322,637 *2740A2F68F4ED50AACEE8F04A211BCA45EF8F579 IREPUIRE0
390,322,638 *2742B03973876AE00BCE281C205A88AF315F498F IRVIN.ADER
390,322,639 *2741E49F404326944A1A27E128738D76C160ACED ISAACCOOL9
390,322,640 *274AE3F2F396D7A5F577178EA753E42919978AF6 ISABELLEARNULF
390,322,641 *2748590304ADC5625E15E6580D45186C24F81EE3 I SAW IT ALL
390,322,642 *274F4D293C008779449CD6D2172B524C9FA8223E
390,322,643 *274A667CCFDB0E37EC0401B90352BC4EA7FA10AC ʐ?
390,322,644 *2741423707519E41D98C75BB6DA94FD6B6E1AEDE
390,322,645 *2743EBC19EEDAEAAA238E8F339AC3E5760EF00E1 *Me
390,322,646 *27409B500B487A08D5BEC95CE88124802A665E21 2
390,322,647 *2743FAA54C163120540CF88D3F240C5147CB88B8 ʲ٠
390,322,648 *2749AA04C3FCAB4B7313ACB865E3F85C1DF6DBE6 s
390,322,649 *27412446ED1E88C9A50DCF0B042C078636A38D50 s
390,322,650 *274E3F2C11B32F44F91D9B00302C75102E28B542 [email protected]
390,322,651 *274113F02803DB4E930E613CE26D0D2E34EB0666 05281909
390,322,652 *27478D161996B1D6D8F65E7F9C291EB4CF28124D (~_^) 0~ @q
390,322,653 *274B3A8F9CB08F3A0AEA682EA2F985FD5031DBC9 1065916 taaborinvuoren n
390,322,654 *274E4FEFE585C25E30307A840E6744B2EAE1D3D3 108630 TOIMINTAMUOTOJAMMEYLL
390,322,655 *2743D0BF970A8D95CDCE1427086837B075CCC11C JAMESNIBLER
390,322,656 *2746B7EFF06B70045681E5E54A1BB3A4ABFB5D03 11 akiminda
390,322,657 *2740A25B941292E41B706791DFAAFBA85B3662B5 11CODDLES
390,322,658 *274A1B1793490C59C55EFBF504DB023077AC4990 [email protected]
390,322,659 *2748F1782F9D281E53BB4DE1A6C9ED0929C6083D jaybirdj21
390,322,660 *274ACF2B04C07CC47EE12D836E2FD19CDD2CCF46 1382575 undfrauenprofitierensogardoppelt
390,322,661 *274F561B96C233A6B2394BA440F015286CDEBB6E JEFFRYMICKELSON
390,322,662 *274AE1C16ECC2436E3844C25DB13BEE849F360DC JEFRICK8
390,322,663 *2749CAB7297F2A8A3EDA58ECDB3E7720232512FB [email protected]
390,322,664 *2745B40FCB2ED2BD315D5EE5C3414A37A87BE03B 150AZSXD
390,322,665 *274E67324763027A2C1662E7EAD5C8275CBB91C2 JEROME.GASCO
390,322,666 *27400040328761286416EFE6F5D696280FAFF000 JEROME.GORNEAULT
390,322,667 *274EECA15E2640073FEB244A279E08D2CFD800B2 16091499
390,322,668 *2745EC69A49D89EBBA7C920CF94C1BD392FD823E 1663544 SPORTS-MARKETING.SPECIALISTS.AREN'T.SO.SURE..
390,322,669 *27478F0784191B85F296470D5DBAE2EDA5338939 1688022 SIE-SOLLEN-BEI-UNS-GEACHTET-UND-GEWUERDIGT-WERDEN--"
390,322,670 *2741D6BFCD533B8AD8118E60B42A6C16BD440617 JESSE.ORZECHOWSKI
390,322,671 *274F93F8F749C0F66258D92129927A19BBE86910 JHENNY DE GUZMAN
390,322,672 *274F2AADF8F1C64613079FAD7E4A07C90603FEE2 jhillianne-rivera
390,322,673 *27421959FC0A87815CC60E3314DCE7AF24537934 JHOR
390,322,674 *2740CA79C9B7833B34C0EB2BF1660583B6C7602E 1848023 MAIJASINIKKAM
390,322,675 *274D2414FE9CEF97914002C29D3058C3D945D045 1868069 TIEDONHAUN SUHTEEN KIRJASTOJEN T
390,322,676 *27404CE189094821A5CA744277711F5C4D611834 JIXIE28
390,322,677 *274E7F62B319356C06E765E296C971DE77D2A95A [email protected]
390,322,678 *274E847E262FCE106D06405EAACDF3F7E6F3393E 1994-02-27:HALATIVOLI,LJUBLJANA,LJUBLJANA,SLOVENIA
390,322,679 *274AF5B9141A3ECD838337E2FA26618C8651D60C 1 FRANCHISE-VERBANDS
390,322,680 *274A08ECA5C8698812CB73303B5F98608AA1F7FB 1-FUNK-TYPE
390,322,681 *274B6ED8F46B9E5C9A5A49230E362E1650102E06 [email protected]
390,322,682 *274678AAE985AACC7058F925CEE2164A54B2DBBD JUDSON.GRACEY
390,322,683 *2749FDB1CF8B1311C6AF024D74A770D8BB46266A 1-KURUMICI
390,322,684 *27420BE825C836A869234F3806E686ED6D8393D2 1.MAENNERKLIENTEL
390,322,685 *274F3B84F50BD183CD0C4CE9DF018CD8B5142BB2 1.merkkivaatteita
390,322,686 *27411EE29624F8CC1CB41F730E1A4A55D5A81F35 1METALLITUETTU
390,322,687 *2748315F06B3A36806E045CB6ED620CC33A0471F 1MFBASES
390,322,688 *274ED8863688A69B3D80503359DC113DC48D14CD 1.paranoyalarI
390,322,689 *27495417EF414D98265DB7C0FD3587FD356A61CA 1RAUCHERPATIENTEN
390,322,690 *274053E7B76BA87F2DED99F8588F0F32E2738DC5 1SACHLICHFAIRER
390,322,691 *2741340A16847F7456BF82B62F1EBC13DC5037F5 1SEKOHAN
390,322,692 *27429FDC920128310D63605DE23835BF4E12BB39 1SOCCER-CUP-SPIELE
390,322,693 *274C41204D3581197700174790EF69CDA46B9933 1U2L3U
390,322,694 *2743E8F6E57A3FC77ADC0D235F39DD4EB84C8BD5 1u-landshj
390,322,695 *2741C2E06FB3C93176FFE85B5D661E804A18932A 1.US-WIRTSCHAFTSDEDEKTEI
390,322,696 *274946CF7014285EE71DD715A48FEB6B0CF85554 justinfujita
390,322,697 *274212606E987B1512921AAEE6BC92393D1BF966 KACQAA
390,322,698 *274BA559C59A2A57752EDB3F3E5366240B37BCB7 kashghargilgit
390,322,699 *2741D66066ED0F031601DCE927BD79F45F35B21B 2230552 voittarvittaessatehd
390,322,700 *27477C5E7B08EDC3508261D874CC85605ABFD7A1 KENNYCARRANO
390,322,701 *2744FD3535441E7CE1A090364CA572E03769C8DA KEVEN.KOLKHORST
390,322,702 *27497628B6CFC8A2EBEEE3AF492C1F541056CEB7 kiethheiser
390,322,703 *2743B230F185B7A46BB41D2A5E852F956C23E9E1 kiethshunk
390,322,704 *2742A4FB79ED948551DBFCB7930B13C0BACDF398 KKKKK
390,322,705 *2742C3AA68C07B672C151DC273B2DE1825BBD08B KNORHAN0
390,322,706 *2742DA9EFCC6FC9CAC2B8A2D25FFD1C9CE30CC9E 2GNIGIDNI
390,322,707 *274FF77C2BDE68AC8DBE21A780A011B71C1B9F61 KOOWEERUPRAIL4
390,322,708 *2749AB151901060861255504CF7752342F6B4F83 2 KRIISIKOKOUKSEN
390,322,709 *274463A15A4CE6D714D3EF413EC5F4ACA508DFD8 2-LEUCHTKONZEPTE
390,322,710 *274029499E4E6EDD3ABC25FF0A896C14A2402488 KRACHTIGSTE5
390,322,711 *274A994CA90AC2F27D9928CD7963AA2469ADAFAA 2-NEO-ANTIKAPITALISTISCHES
390,322,712 *2742A019838C7FD333D753F38AAAAB1E0AAF4720 KRLEKEN
390,322,713 *274E15A7C75DC679C71DF538098853D551B8278C 2thehotdog5
390,322,714 *274DA5B9C2FF6D9B478E712CBFE0653D3180E626 KURT.GASPERI
390,322,715 *274A4F4863976589AC42073E8EE8748CF383AA3F K*{Y
390,322,716 *27448044FE6E7BA7BDB795F72EBF7A88B8DCFE47 L021214
390,322,717 *2741E8072BB29C92EF1EF8DB93152DD4064DC86F 323CLARISSA
390,322,718 *274B9937CACAA5E339696B464C669F80775C500B lacidarolihp
390,322,719 *274943D805E73737F211E72E98C03EBE1683617B LAMARDELLAROCCO
390,322,720 *2746B18C8455CC5DD25179AE569FED40166C6123 lanaonversustime
390,322,721 *27463DAA33543D4A2FFEC13098E17FCA95B639D2 3CAMERACFJ
390,322,722 *274719BB03C0EDC1239E24D195C6C86185F76CDC 3CIDEAPON
390,322,723 *2740159F984DDE634AB49ED6B513F6F6C9278287 3DOMAVANO
390,322,724 *27409B3EA9CBB3DA81372FD30612E0B4BA4682FA LA-ROCHELLE-TENDRESSE
390,322,725 *274A27F5FA394A6424629D68409BB7875E105F9B la.voz.del.caribe
390,322,726 *2744C8BC222B0223C9EB9760544A0DE72A25373D 3thesnoopy5
390,322,727 *274AE73CACF553028B50063C3207C69705B379F8 41m$-b4$i
390,322,728 *2748193B80E91D52FF023E006E09A802B60748B6 444antoine
390,322,729 *274FC625AA31BCEDF911B5EB6E8FF024A3E024F2 LEONELBAUMLI
390,322,730 *2740242561AE80ECE7E04EC00A52E273FBCDF083 4DOCIC4MOS
390,322,731 *27461549D0E1067F439C26EF8B72061A355B1255 4iamboss1
390,322,732 *274CDE1089D982403C20A231B5C797D075AADC7E [email protected]
390,322,733 *27484633ECD867A0DBCD460ACA829FC3DEEFA449 liam541
390,322,734 *274664830E3F970EDA7D7E41E6E169B2FE4CB535 linuxtutorialvideos
390,322,735 *274C26B34D2E7CEB8C13E33532B7D81B8DF0B13F 56.L
390,322,736 *274FF42A55801F81D32782B43837065D028B9E42 ~C
390,322,737 *274A0CE35E28EF40AFC40D836E6B345B17409A39
390,322,738 *274B78BC55D7C11FB753DD0F04AA27D911EEEE94 Fm࿴
390,322,739 *274034DAC9B755345D76B7DCAD33EB6B78E97680 ?E
390,322,740 *2747B1BB073404A9C0BECADDB5C95452D29ADC29
390,322,741 *27416132F7971DC17F0F0F45D972A8B88C521F7D 5AROPSOHCNYHR
390,322,742 *274D7CF0A6802759F6A2F54934C0A423F8ABC433 5BSWBOTVINNIKBSW
390,322,743 *2743E095084877548B4DB1F8D146BCDF98CD8B1F z
390,322,744 *2746C19E1EF5105153D738BC5E309B63A173B065 5CHARGERHOUYHNHNMBROOD
390,322,745 *274BB32DAAC2766F18C0712BC543EB0CF8DDE345 5ERUCTAT
390,322,746 *27403206C9937F385B9B81FC531FC8938B1D04F6 6
390,322,747 *2742B6649E6BDF6EBDFC3A90C81AA22052C549F2
390,322,748 *2743BC9D11C1CBECE9FE3916FDEBEB2D3C9B54BF (X]AA~
390,322,749 *2742775DE1FA4294A28D3DD1C5DD6513167F95B2
390,322,750 *274400A7055F60B4A97412D83FD146A54BEC9CD8
390,322,751 *2740A216A604D38BC471A49EE603F00743B69905
390,322,752 *274DF25C161394D62F2A0D352058462C2EB5B6EE c
390,322,753 *274062F63B41A6D89B2C96E23CA3730DCB89756C
390,322,754 *2747F64D45BDC1DDED82D85F415244D05CDC565C )
390,322,755 *2746E10F424C161910D5E85AF50B32F7673BD98F 5NEWSTAZMAN
390,322,756 *274CF3AA0BC90868397133A6A40F45400D18C517 "
390,322,757 *2746FD86F2A4B96175DFD40C565FF034420D644A 5.otosansUr
390,322,758 *2746297811674BAC6915744F97258E993F84414C 5plombeersels
390,322,759 *274CE6C90298ED379C084D33BA5D76F9CFFFD3DF 5REAUMURTERMOMETRES
390,322,760 *27405410C9001C994C4433E01621E9E489006A86
390,322,761 *274527E0EC57563D3CF6D74EDC2E40629502C71D 5SCABULO
390,322,762 *2746EB944D4D43EF37D1AA1F0D0FEEC20AAB0BA5 o
390,322,763 *2748CF268E3DEBDEFE8A21E16F5FC36AD3828CC9 5skilken
390,322,764 *274221C06CB6AA16310BBF69C0702B9E5BD0639F d
390,322,765 *27417F9129FCF8CFD6E1DFDC65C60F9EFDBA438C 630868 saimme-halvemman-lennon-kuin-aiemmin-oli-suunniteltu-
390,322,766 *2742BEBE5DECFF787B712FC908E4351112D31942 648031 yhteisty
390,322,767 *274D88FD876EECC287BA7C67EAC5BAF610F0CE01 6BEMEYNE
390,322,768 *27479C7C3FE2FA466B9C9DBEF4D5F7FD63381C43 6BSWCSLEEPBSW
390,322,769 *2747D200D5C7C726DD948E6B5E775BF2CEEAD841 6BSWFMTDUMPBSW
390,322,770 *274A2DB06406D7B91F7C7272DE20F622697754B0 6e1851
390,322,771 *2743F859C7470929F1E66E9C5E2F6419D80DC2DB 067.SCHNEE.[1]
390,322,772 *274C1BE189A92260B456C02C3E2CF66AC554221D 6POELYYN
390,322,773 *274F967658BA0CA7B8F4D2603F5FBA29D14A254C 0iloveshaggy7
390,322,774 *274A0B6990B303744E45D96FE10484F0E153E139 10:-10---#---&---Mars
390,322,775 *274BC7E1F261BAC31088BCF4818277613DDE3CD7 6SOUATTA
390,322,776 *274FFEDB2E7F2D71EBFA5A3D00A7FB465F39CCAE 6STRIPMAP
390,322,777 *27438D16F79DA722F20E58C1FEA473903F5CDB24 6SUNRISE5
390,322,778 *27483331D17337D948F2A0A72999BE3018B4813E 6uturuncu
390,322,779 *2745766EFE301CAFFC6ACCCD392986A0DBF6E376 10jul1219
390,322,780 *274E30168AEE08FF2468A5C88CFB602EE67218BF 1241516 TAPAHTUMIEN K
390,322,781 *274E779BA74C1E078AAFC1421BA757D6AFBC9E54 7CARTLIDGEBSW
390,322,782 *274B3D6B5975B8654F8D139D4C74D4FF21DC9181 [email protected]
390,322,783 *2745D4FC6B958E2E8DA7DB7DEF7FC43A95D849D6 7GASMANCLEANER
390,322,784 *2747DC202CB00D7499F04173DED29519716AEEA9 7HERENIGINGENS
390,322,785 *2747AE53FCA52240F67ED8CD38A1A679A0DB5405 7IDEVERP
390,322,786 *274BA5A7B03E8C320F1161A9BB680EBCAC9789AA 14B3ED83FE903D698D23DA7BC21D4EEF
390,322,787 *274FA54BDADD4425E7EFEB96C3228DAACD1ECF79 1717110 in.panajachel.am.lago.de.atitl
390,322,788 *27472842280FD4F51F0E165383A648EE704F2133 1741350 und.darueber.sprechen..
390,322,789 *2745D5378C800FD2685A7C54B968C1CCA33C86C0 7RICOMPERATE
390,322,790 *2746B2D562AF5B9ED98F956E916A5487736598BA 1907148 mmviestiviimekes
390,322,791 *2743B62F942F54F694DADC57B203EC2C61F8C2CA 1.ASSADBRUDER
390,322,792 *274CE6CE124E1539AD073805AFC36276C4C618A6 1 avionrikkoja-
390,322,793 *27445460C45C87041BFC7654D54710A461A2CEA9 1BLASTIN
390,322,794 *274C3EA7955733386672B6E14E1F9717004B7B00 1CREPEIER
390,322,795 *2749CD3A4FC7A2A34011092E4A076AD48CA85717 1 FREIBURG-MITTE
390,322,796 *2749DE61FC475EC86A1C66001BC5C4996CEF1BFA 1INFARKTIA
390,322,797 *274A50A6578A8D87009EBC1882516E6F8B751B72 813746
390,322,798 *274AB43ADA7CB68CCF855B7B585E0E8F188604F1 898943 BODE-VE-NYQUIST-DIYAGRAMLARI-
390,322,799 *274EEA470F462A04489308839B54E9CEAA65036A 1MYROCKON5
390,322,800 *2746F07285FB6CAA201A0802EA94D8DDCA380009 8apr1352
390,322,801 *274FBFEF13C59EF88F1F4238F4B8100E61BCAD04 1 PARIPA
390,322,802 *2740C5407E100F810611EF251AD73436A680C857 1.restauro
390,322,803 *2741AC1106EE8A509EB4AE302E2882543366FB15 1.RINDERMEDAILLONS
390,322,804 *274EAED8AFB77577EAD76B985E2780273E7D9345 8.DIVERSIFIZIERTES
390,322,805 *2743B35BB371D69CED0D34062F1C7EA0602B7935 1-schiffsfarben
390,322,806 *2747B4A684BEFBA15354117D9A7EFAC19B8A69D7 8e1g14ns
390,322,807 *274F174D74CA5A5930B2C46C026D66FFE8134ED0 1.SILKORTILLA
390,322,808 *274ED5EA2BF784E1357BAC7DEE86E40E5C6A6998 8FIRESHELLFIRESHOOTOUTSHOOTINGTHE
390,322,809 *274B44135A5FB255CB411245D7E8C0FC10A19A21 8GEOMALIES
390,322,810 *2746102E7096BCA03F8D4EBAB9E4C8DAE0889434 1 VESIHIERONTA-ALLAS
390,322,811 *27452030C6F0D6385C506F1A6E6813F8016E1E1B 1WOLTERMANN
390,322,812 *2747893954968430770455032C4230D880B303F6 8NEDIOOTLOV
390,322,813 *2742CD9CB909DAF55614BB36DD5D0F2457B5BCC3 8NNSVRTS
390,322,814 *2748E9BFEBEFB5D3F30AFB2FD1C85CA6C0425AE7 8p ~0 ~o (00)
390,322,815 *274FB7C55DC7ECE723F2597A2F3868EA75865923 2104078 KAIKKI RUOPATTAVAT ALUEET TUTKITAAN TARKKAAN .
390,322,816 *27490B7F2C27207EA9AB7806482F6AEA8FED5F42 2132725 AUF.DIE.INSEL.
390,322,817 *2748B036A8D4D2CA606DC9575E148FA475A6B0E1 8SHEPPERDE
390,322,818 *2740A02B0FC875178C2E7B9BF5486664E3C5C2FE 8SLEPPADRAATEE
390,322,819 *2741C6DC0A16ECA7DAE35D3AAC06545ED2E5C7B5 8TARTESIOS
390,322,820 *274AF305223F7626D4EC94889F2BFAB3C1EECF70 905433 -xiv-,-142-,-285-s-.
390,322,821 *2749547944A9663B7B97DD202070480F16DFEACF 999768 IN DER ROLLE DES REPORTERS : RUDOLF DREYER
390,322,822 *274858598EA2E74BCE9A916F04D3D27BA9E83AEA 9alissa
390,322,823 *274EA24C151952AC555BCC3BCBD00DF09AADCB67 9CHERYLGATOR
390,322,824 *27441E6BB1DBEC03B4895CA2A0358EF192C022EC 9GRANDMOTHERISMS
390,322,825 *274AFFC3E415D20CFCB6C9195C2E7E8246C2B51E 2915157 STATUKSESTA VOI MY
390,322,826 *27422BA4E08F6AC88999E38BD66CAA2DBAB30C5F 2AENDEREN
390,322,827 *274242317664EE4F341C40670916CE3335E228DE 2APPROPIRE
390,322,828 *27425A708BC095862B0D39BF799C391112E26CE3 9JOAQUIMJ
390,322,829 *274570682FAA6C496D685668BD76D27B49A84021 9KIINANKAALIA
390,322,830 *2740317AE6FFCF5E2BFF2CABFE83D8F3E8356153 9MAJORDOMOSHORENET
390,322,831 *2746CB9F358E5FD2E9FCE9573CD55C081F01A0BB 9NTAOPPIA
390,322,832 *27436D1849F94A3DEB14A10518826D90127DDC8A 2herumzuschmieren
390,322,833 *2748458E71C6ABBC12751A6FA65E64F96C257088 9REALABASTFABRIKING
390,322,834 *274C8DF1AB374DDEED8CC2F5DD44A87429F6EEA5 2ilovephoenix12
390,322,835 *2744A6F63AEAB760A5FF35C7FFD882A007E5349F 2.MATERIALINTENSITAET
390,322,836 *2746DA99CAC11E42533BC01F77D706FB542836C2 [email protected]
390,322,837 *2743F18A9A9F24E5732415361791B0C8E8338B24 9SUOMENKIELISISTAE
390,322,838 *274BA9A6EE8A2EEC794B55387A3A441F377AFE3D 2PREDATER
390,322,839 *274D08A4F120B65E2626DE69580F5D575E5A401C 2RDNNRDN
390,322,840 *27445C2ED192D8FD96746639261415B70FAB50D7 2-tv-nachrichtensender
390,322,841 *2740B07AE6167DD3CDBBBCB5599310E181D3A7C6 A0dD
390,322,842 *274D3C25389C17F9CFE03120DCF878C69466381D a2kdn
390,322,843 *2743C424D61187C7F99C568524632DF9C6660C07 A:47
390,322,844 *27437569391D40B79727D3E1243C5AFF7ED43950 349636 KIRJAT.EIV
390,322,845 *274D36DA0C41310D6BF0B7E37CB2AF855C1DFE7C 372705 koulutuksen.ja.ty
390,322,846 *274DF4F1A4F02D9474E1940E89F4E834162FB121 A9:HT
390,322,847 *274D58A94E888D8072CE30143B3045DE5FE9AD83 aabnbl
390,322,848 *274BF33807C466EA946F3E84C30F78DE96CF94EF AAD$&E
390,322,849 *2749C861F8D89A1D893A04E53F2E8072AAF8E01B aadn/x
390,322,850 *274BD8B157A3EB68D6A798B33254DE7858A17D35 ab-5z
390,322,851 *274F1A39F074E12DDB5D0C0B52F801B1A92767E2 4524 vergi.iliSiGi.kesildiGine.dair.belge..
390,322,852 *2744B95628C7F0B8EE0E64F14A45F55A78CB73B0 468c47590e5aba204419f14925da8938ouiouinon
390,322,853 *2744645B6A1CADC67379340195F01FEE7793D486 AB?HD
390,322,854 *2747674E98FB524D83FB6F11A599D04B1286CDE9 4EBERBART
390,322,855 *274514A4E8F9EFBB47BDF9A1255D12FF8209D587 4.FABRICA
390,322,856 *2740F4F4F3893DFC3F0ADDBBBB4C801F1FFC67A1 ABSCHUSSSCHIENEN
390,322,857 *274CA14752C1F50AE6A8641C376CC6DD9F1EADEB ABUHASHIM4
390,322,858 *274C9866A073D6B0F63C0934FF26832B519BF2DB ACAICRAG1
390,322,859 *274BC3AA1B6868170F6867C3A2F5DA841A554158 [email protected]
390,322,860 *274E0DA75DBD49061C8E0A7E28172A517BCFEBD5 [email protected]
390,322,861 *27417D0750CEF91F55A1CEA189CA81FA51C6E0A9 4P4RVO4R3IS
390,322,862 *2748BBAB0023F551CB44498D4EC231FB9E494A9D 4PERSONALKOSTEN-ANTEIL
390,322,863 *274419F035E8CDDFA1A3B218C4DCF242E36A4D2E ADAN.KAVENY
390,322,864 *27498063AE30B81F90046122F27F5D6C342B1C19 ADANPALITTI
390,322,865 *274B41F1EDCED0AFD8A7F1B2F8C91656EA50FE1A 4SNDDRIVER
390,322,866 *274C9A57889DF8BC368C24DF7291D9E3578F0175 ADOPOLPID2
390,322,867 *274F7C6E52103AD2F024AA812FB542157E9201EF AE#,N
390,322,868 *274EABBF4F598E8406F8F4B0C5BE39550D5C3298 af&k8
390,322,869 *274C49A28F4DA74C059D684A2FF57E0821E6351B af_wy
390,322,870 *274C45E162D833593E3D8B781075E009CE10EB7C 550-MICKEYMOUSE...-USER-UNKNOWN
390,322,871 *2745A5F3F9660198447359B0D08C9785372199A7 580699 mukaan.mahtuu.noin.30.ensiksi.ilmoittautunutta..
390,322,872 *274F2F26F9E894892567EAB7B00D7AC8B815F2A6 5ABASHIAN
390,322,873 *274162ED8D1AFB421DC3BF6BCD8F39920F49755E A.$GP
390,322,874 *274700263D47271A0B7B4BE6262B7C999045ED01 AGUNSOYEO123
390,322,875 *27497E1E04DBB36F248958439CC5B644DF38ECD1 AHMAD.TRENARY
390,322,876 *274C2B78856DDE29395EECCEBB7658A5770CA661 AI2AD
390,322,877 *27400D6C1BE439CE2BE7ECF0B59DDB390AD06373 Airplane,JetA320:Ext:PassOverheadBeforeLanding
390,322,878 *27425C0AAA3E4F12D567F587F1DD4EF1C353EF33 AJ7
390,322,879 *274EC542B833131BF0FB9B2BAD33256ABCFB1FA2 alaro
390,322,880 *274DBBE778B107A3EDBB6478A63BA1964A37946A ALESIADIA1
390,322,881 *2743BDC105B1E739B0407436ACEE350645F77E56 5 MAJOR-GENERALS
390,322,882 *274A5F6B6A88DB9670587069D10E07F2148688EF ALEXANDERLECK
390,322,883 *2747FA45DB40BBA542F252C40B632644AB7C553A ALEXIS.PENNACCHIO
390,322,884 *274D919507ED583542E95722C2720AE3CF18539D 5-ROSEVILLESSA
390,322,885 *2744D260DA4A97EA593F887280E2B69BA2E31564 5THATCONCEPT5
390,322,886 *274B2D148EC6ADA1F56AC84173B7269CAE2055B5 al(sw
390,322,887 *274E5C05E728142AA2ACD98302B767A092EAAFD4 ALTYH
390,322,888 *274FC1B31930B98ADAC77324A5AC32DBB7AA5E8E ALVARO.CARLO
390,322,889 *27455E586C4F4DA1E08D79556F3A3EDD53B6D4A6 602724 ERKTIN(EROL).E,ONER,N.(1990).
390,322,890 *27457516FCAB19036526C0DCF1411C8A956ADC6D ALYSSAREBER
390,322,891 *274BB1B109C1BB5A583F4566942046C48F850600 AMAHCUR8
390,322,892 *274AE3ED07AFE2E1E73BD59047A4C43E3DF95214 AMBROSEMCGLOTHIAN
390,322,893 *274701B726856CDBFBA1CA9C27DB265E118872B5 [email protected]
390,322,894 *274FD6B4B7D0A46F60B9E8BDDAC7537365537EAB 6AABENAABEN
390,322,895 *274C8C3B75B08E3CBEEA77DF96394B481B3303B3 6AFFOLKEDE
390,322,896 *27406027545F4CDAD856177B2ED7D47A2B020F80 6ASPIRAD
390,322,897 *274F95D2F5E0D038AF3DC2BDD5193A34F42E84BB AN_A
390,322,898 *274A230E19BCBB6DC01AE8F7DC4CDAC590309179 ANAS.MARZOUK
390,322,899 *27461014A752A281D1FB66DF3792F69967953A20 andirey
390,322,900 *2742D6C655D9F527941DACFB74CF35DE523005B1 ANDY.CHEVALIER
390,322,901 *27496AE924E9F2FEF579BE0C0A65BA540AA78035 ANGELOPO4
390,322,902 *274B1D5878B6738D8EE61DC0A78E0F4F404D87B7 6LUCASTWINS
390,322,903 *2743B26AF4C3B625A2116916ADC3F35DBCFED004 [email protected]
390,322,904 *274ECDFBCD8F1F285B666260178F5BECDB0DEB7D 6PEDLIKIN
390,322,905 *274E78A4A88F0C0B830C237E0C717197C7A12B9A 6PERSONALSEKTOR
390,322,906 *274A54793912449E47C8EB9E75185310B8D73CFF [email protected]
390,322,907 *274D24BC8028FD29207DF13E61DE68EDA45A1AA0 6XAVIERHERMAN
390,322,908 *27459EFDA45A6D55652540F1F78C7BEE7D3BB989 772062 the house had approved it oct . 4 on a vote of 263156 .
390,322,909 *27465098031CE99F9C533B45EAA88F4CA398E1D3 aoo-,
390,322,910 *274DFDBFDAFA1E23428352DC2C7C2DC8883B4BEA APPOLLONIAD
390,322,911 *274186F951588458A0E2DF34330CBFEE1CF804D8 7ABRICIUS
390,322,912 *2745366C8250027FAC6EF1DF546D8760B88C81C5 7AOX
390,322,913 *274744593BDC4FD1149C7330363CD8462BA2FA0F 7CHARSADDA
390,322,914 *274ADB804D52521AB379081885801131EF27E538 aq!"d
390,322,915 *27452DFC7DD42AF92FDBB16354F2D28C96375F3F ARb8
390,322,916 *274B481756052FEBED6D726CD4B15E9927EB1B01 AR_FK
390,322,917 *2747BDEBA2223FBAD60F97C7BAD5810A24C845A4 7NETRERAI
390,322,918 *27475858B044DF607086CE838AAC1592774FE0F9 arh7n
390,322,919 *2740F1CE3ABB9619399947EC0F75363233A23F8E ARMANDOLAGANT
390,322,920 *2743C98BF47449F733A0A25249F710CBDF37742F 7RENATE
390,322,921 *27491BAAF00315ED0B83F2F3BB021C022A6F1B9D [email protected]
390,322,922 *274571E2B82D5A736C1C6C6B21C2E9387404F07A AROHG
390,322,923 *274CB4B061789A1D39C811339BB22ADA8FEFED6B 7SSENPSIRC
390,322,924 *2746EF4C9CDF0A1794C3970217845FB9D3ABD184 [email protected]
390,322,925 *27477A9DAF7048D4CECFEDB5D0341CD42061F7C7 846MELINA
390,322,926 *274127BC37FD8A608E2E8937AFB0D62089441ED1 8BSWINCONCEIBSW
390,322,927 *274B7647FE3BB641CE68A2C0907FCC4111438877 8CHERYLDOCTOR
390,322,928 *2747A710A9127892BF5E72E72EB50D0EB2EEDFC3 attillare1
390,322,929 *274DF80BA8E08B3B6F4A26BCF6D01BE198B96983 A$U`
390,322,930 *274A3ECD71DD4E444C3DBF7E0AE915F4DAF0AEBF AURELIO.MCFADDEN
390,322,931 *27470112FAD1634E56DD5BCF640ACCEC673913F4 AuTM
390,322,932 *274A21214DF6F3DC0ACFAD0128B3317288191137 8INSPIRIEREND
390,322,933 *274368059B16BCB4404B0170028DE807D00A4A9A 8MASILUM
390,322,934 *27488E904F5BFB61F67FF83E2A281E4FA37B3E94 AW;A=
390,322,935 *2744B7EECEC211694CA0F634ED0A61FF8CD6BF6B [email protected]
390,322,936 *27431C8C114755E6096E2C2DBF6501EC669E17ED 8RAZMRVLJENIM
390,322,937 *274FCE8C5C98DDCF110169F011BA5146227652F0 8reassured
390,322,938 *27417CFBCFAC38057C015EEBCC2F73116EE4C27D B4C7ER!0L0G!E5
390,322,939 *2746F4DDF1894E9911D7BB2A915137F2AD688E3F BABYGOTBAKK44
390,322,940 *274EEA8DC446363E8CA43DCFB8A280F9517BA5A5 9BSWCRIATIVABSW
390,322,941 *274C2B57E1E19084367CD35823979ACC1A1B80FA BARNEYENLOE
390,322,942 *274C6A20B125AFD210306A3386FEC36B5C2E275A BART.BUGAY
390,322,943 *2747E96C18CF749AF1AD86492D2C436B7B1139B0 9cricketten
390,322,944 *274DA85E90172D5BAB5D9E2063831F7BE1F08009 B,A,U
390,322,945 *2749CABCE4CB250D0AAABF58D009EA63FD22C8B9 bbadn
390,322,946 *274149063D39CB32A7665921C71DCD030E29EAB3 9IRRMISSIBLES
390,322,947 *2747E7489BEDF2792B9EA8548D7F6AB0C6CC1366 9KINACHOZIDI
390,322,948 *274689E406A587F30151F2AAC987F66A738E45A6 bbrashcyber
390,322,949 *27422E81E903564C14A59C8A2A4B0CBCC1D71565 bc.t3
390,322,950 *2741B34FDACCB0CECB56FDFAFF4145FCD5E19411 BCWJX
390,322,951 *2743C02527D8633782F050C1288A1E274CF188DB 9THEDELTA
390,322,952 *274168420657C38995AA3C3BE1EC9F40B1961ACA 9USURIOUSINFLECT
390,322,953 *2749AA668C75DF4C15DBCA58DA3D8BF0FB214C27 beaubembury
390,322,954 *274218CB59834A362B30733E1D417CCCE4170E1E a1:f:
390,322,955 *27420FE48D4983EA99E9562F84D14FB73CB1F64D [email protected]
390,322,956 *274F20B233F48EB996A13E7B34705D7BE5BAEE18 A71C
390,322,957 *274D203C625F73CF820B3632C681B9A12D2F3F53 BERAK.TAI
390,322,958 *274349D5FEC9E8C21E8B18F99FCC4E24550C1D1D bernardinostra
390,322,959 *274B797CC348A7EFA35D4E566CE1A39EC72C2BD3 BE/SA
390,322,960 *2748BABA69CE3C149A237EDB59B6823D28DFB0AF AABG>A
390,322,961 *27446397DB726962BD34AA3967BD1F3E177D5D0A A$=AE
390,322,962 *27415D81897F009EB1313E33EB9B2E711045F36F BINOMIALFORDELINGEN6
390,322,963 *274EBDE612457EF85A0A790C9B139F6FDD963FB8 ABERNの発音は「アバーン」より「アーバーン」の方が正しいので
390,322,964 *274CE7B60587FCE96C646D71B8A02FEA0DB7459A B$K4G
390,322,965 *27494FDE6E186EC9FF0CCB900AD94F43573B074C BLAIRCONELY
390,322,966 *2741402FAB775970CF4C46B7DA14EE04CD7E0B89 ABQON
390,322,967 *27423C4E4C5B6A97120263A9E3CAE03D836A1159 [email protected]
390,322,968 *274BE7A31484BD1AEE20E8FDF05D6D696587B107 [email protected]
390,322,969 *2742DCA62E554013AD7C242585FACB2B847E9773 BLO/B
390,322,970 *2744D597CA8846C0158251363E3992AE1F560F8D blueskyaeh
390,322,971 *274F8001D16BFF28889C67300173EF13D15B2B2D [email protected]
390,322,972 *27420E65C7E7E5B59EE7BA615C90C0285633050D [email protected]
390,322,973 *27489D25E8B16E59187083B587A705302D12329B BMFHA
390,322,974 *2744C6CC4AF57DC164D7BB63BF1F29468DC68958 bob=q
390,322,975 *274B79BCFD9BE37A5E596732226D3EB79B630F61 BORN WITH A BROKEN HEART
390,322,976 *27480C2FEDF5FC20002787B2F9E34A4D93C1395C BRATNICH2
390,322,977 *2744C15D2B55EF6DD7792C342C5943A0D3FAE4DA AHC-)
390,322,978 *274F4AC318AF32CE265C08249C887C241C57145D ahx/d
390,322,979 *274D9CD7384AB6DCDC851D6D26B80F1612759D76 aiksj
390,322,980 *2745B4F0AA1E1B66C9E886CD323EB55C45128DCF AK5UD
390,322,981 *274082EB5E9753F24C6FFB42C4AE7C877EE8C3A2 al0sm
390,322,982 *274A3D74EA5D0964B8CBDBAA6D5BB76305DA0D02 alcrfe
390,322,983 *2743CEC2B55F148E8AF0082B543618C04719957B bu.g,
390,322,984 *274702AE58587F35D0DA7160C14B7BB7BD6F6C80 alexmejia
390,322,985 *274BE83AA738087FC2DE3313B80C434149817D3B ALFONSO.PETRAK
390,322,986 *274D128E2487506DBAD15C5B7B30724F0F5130AE burnaman3
390,322,987 *274B931227A3DEBA1D3C154EB4E1008ABE0FF9CB ALI.PAREZ
390,322,988 *2747CB3AE8A63A1ECC91CAB594CD57729029CD4B bv"-
390,322,989 *2743FCB186A3971D56635FA7DA2C5997A4BD79C3 bv_3r
390,322,990 *274C89E446ED4F7BAE61FDF421DD0DE0E76007C5 bw?on
390,322,991 *2740CA8005BF34CACA199958A7D9A827ED7199E8 by/
390,322,992 *2743E1965BAFE65D0573B6E827BFCD9C5CEA0EF7 BYRON.NOKE
390,322,993 *2743DBF5DC2339C7F11A8669252D71B80539E103 BZ!OC
390,322,994 *27463A7A1BAFD4127F18207F655DE72685B28012 C0JI%
390,322,995 *2749BA60E5843751BAFC7A9E7F4FCF933BE04C99 am+m
390,322,996 *274817FF3E9B6C0C70C265D7237CE0C7DC5CA6A3 C29I&
390,322,997 *274A523428B024D56F4C94D02E3FEF72C4316964 C4FGW
390,322,998 *27483E74A48A49C2D6EE848A60C81613CDD3ED00 C_79L
390,322,999 *274BFF4CC218ADCD940368F15004D8C6525FFF66 C9HI4
390,323,000 *274570D8079C355C418499482F2511758BF84C11 ANGLEOFROLL
390,323,001 *2749F32A83B89FDC4C9D135EC6B1BE00B524AF1E [email protected]
390,323,002 *2741B8E5FA9847F3B073352D389EAFC9DCA3F9F5 ANTEBOSNJAK
390,323,003 *274F4846B49D5F62A44C3DB01AFECC838A5F2C5E ANTIPALAMISM
390,323,004 *274918B8C50C24B7183A3E51356C253F3D5FDE99 CARLOS MANANQUIL
390,323,005 *2749028F3A6E0BC24CF54FCB585F15172251E081 ANTWANWORBINGTON
390,323,006 *274468E0E835435C530C0DB1474F98CB539CBCFC carnival.(manha.de.carnaval)
390,323,007 *274482200A6C276EC5B17688C012B80F3161E874 armandes1
390,323,008 *2743CC31A961A2DFDA8260373C8745DD336590B6 ARNOLDAGULO
390,323,009 *274D61701155196B3CA8805659BFA291E076EC05 askh1
390,323,010 *274AC827C8E1C98C9D0CCE63F1C7DC011B3519AD chadwickcalvin
390,323,011 *27408B61C79C279C9C104919F3A2F7F75E087307 atov6
390,323,012 *2745FBE7B50B82983F55C48FE7806FC4E919B62F au#3w
390,323,013 *274BED1CABCD153C09BEC5509A173593320FAD22 charleshagopian
390,323,014 *27422A5922257F0F68C5CE716F162B1DC334B276 AUSTRALIA–SLOVAKIA
390,323,015 *2741BA398B6152A2D43733EB988C42C25C89F75A [email protected]
390,323,016 *27404FB3E93333C9CA44B9F5C5EB0EA0A66F8257 CHESAPEAKE_BAY_BRIDG
390,323,017 *2745FA49C589FBA2CA8D722B5CF66C3B72B3403C [email protected]
390,323,018 *274F3FADBCA8B648697A1CB7AC8E9C2BB24DC083 AVÉBRÉVICAUDÉS
390,323,019 *274158600AB8142F0033E8E2577828F2607AEAFE aylsworth6
390,323,020 *274164CB45ADCC3C9765BAC1D62E4FC43727E608 c??kf
390,323,021 *27414B3C198B02533651AD509909642E378D0DE2 banner.gdett
390,323,022 *27400A289EEDFE8540526952DE8A4291791DBF24 BARE.ITS.FANGS
390,323,023 *274AAC30A56E0A5FA9DE2615061E222E9344CCE9 bbd-4
390,323,024 *27462F794EE2A02863A0E25347E3E8EA0151068B belonid8
390,323,025 *274A76602771ED728F96650159604A8513489919 COCACOLAHAROLD
390,323,026 *274452E98C558904368EADBC8DC61FA9BF59F5FB BETHANY ELAM
390,323,027 *274C8F5DC873A9B95B85D7963FAB89CCD21497E0 BETTERSTAYAWAYFROMHIM
390,323,028 *274E62FE407F1DF5AC75A4F2020B399B70EB9202 B=FCB
390,323,029 *27431CC28CC98BA8324DC99F84E714C04D9CC9D0 COLTON539
390,323,030 *27441D7CACBE6C1A73DDAFB5E52AD552F7D66A78 coplanmak4
390,323,031 *274AB79A4618316F2EA5A94EA2FAFE708424436E [email protected]
390,323,032 *27479D53EF3403E9C973E0CED786CB465FF72C2B corneliusdowker
390,323,033 *274622E226BEEF6D830FBD68B2B6B88D768F8EFA [email protected]+E
390,323,034 *27450B332AC5E25FFC1D9B9C3803780358E05F11 [email protected]
390,323,035 *27481FA6F890920F2D355F82066395CA40B9914F courtneyangie
390,323,036 *274732D491C79570B81BE54EF9471A533BE1A8BE BLAIRAGRESTE
390,323,037 *274955B9E2E6C31AAF5B4F1AE2FB769CADAA8E4F BLARGHS5
390,323,038 *274CB8EA6D398270D7230DBFB7A6CFBE40D60C46 BLF$=
390,323,039 *274B322BC7CCB98E8BDAA8FF2099B0A6C29B37BE bloczynski123
390,323,040 *274261160D24753FB8D2FE9AF04386151A1CBC39 c;r+:
390,323,041 *274FD694D5C612F8285DBAB2C86729EF92D354DE CR0$
390,323,042 *274F3D455AE0D58A48D677221340BCE71C54FEF8 BMILLON
390,323,043 *274B4947AD6B2F122DB9409E396C2E6E34CB2BE7 crld!
390,323,044 *27487FCE864D50FAE00B0FCDC9C39655A8CA19D6 BNJ
390,323,045 *274A6AC99AB7E666646170BCF7FD3601DD59E8C7 CSACSIKA
390,323,046 *274AB2BCC8C1A1B02674D01EB9469509D08A37F0 bonhomously9
390,323,047 *27468F1F514CEA8304C857B52820BC8AF636231A botq
390,323,048 *274132F2AF364DC35FFB640C769E9CBFD5E636D8 B;PFA
390,323,049 *274EA7F184B07994130AB7B4F2F7DEAC40C0C3D9 [email protected]
390,323,050 *274E9F43A5D61D845170FEF9F99A7894562D6F91 brandohill
390,323,051 *274F5C576B80DC44603C8555BA1FDDF8DA2CF9CD d3:zm
390,323,052 *274A03A9841CE5FEAF359DC08CB85ECB9CB9044D D5CEA
390,323,053 *27488352DCD12550D3C657EFCADFC1C4C7855834 BRONDEN2
390,323,054 *274B33AAC01E5E215250DF7DBEC42C491E97E85D DAMION.CHANT
390,323,055 *274DA5A8C2E04D9E04564EF8F53A445DE417C28D BRUCEFORBS
390,323,056 *274B61458A65BEC925FD24B982E6C43779A005DF BRUCEWANNLUND
390,323,057 *2745C9F7F04AF8E7EB69A9B7B12802DA3A8E6427 brugerkatalogets
390,323,058 *27464AE9458FB612148EC7662E22FFC32D5D056E daniel.mckelvey
390,323,059 *274FAB75FC52C13D81F57E6E4CE20B5A84C89937 DAOQ/
390,323,060 *274E735A1F7F2C9B2AE661183617DDB382FA3FAA DARRELL.SPIELMAN
390,323,061 *2742BB960C1CB8471EED813C08E4CA2AED8C443A darrondanella
390,323,062 *27458B13D32D08B5637E2C30486C6ECABEB1F8DB BSWKIEFERNWEGBSW
390,323,063 *2742C4D76B9ED128B1B8CFD5120BAB5997AA029E DASHOTTA
390,323,064 *2743218DF83321D80675EDB24C614E3E0F2ED73B DAS-TAL-DES-TODES
390,323,065 *2743CCBE9A08D86B1EEB5125B4EE7DB9525B6DAC DEERBOY
390,323,066 *2744AA12C2A38210A024DAB3A3C9675A8675D80D BUNMIKUTI
390,323,067 *274E47D995F672EC9D95D22EC549374F3F0D29A6 bx0;4
390,323,068 *274FDD82C124723047C802938A86D38D934C680B BXIBM
390,323,069 *27408F4197B5E7BD670D5B2B755E2D8FAE6DBBEF DHANYAPRADEEP
390,323,070 *27489EF93FC5FE011E78E3C5A8069A27344A2A05 C"A-/
390,323,071 *274AD24E129E1A525ED74414A3E2E1BDE42218C8 DIRK.ALCIVAR
390,323,072 *274B71CBD5E0F8C673E98823FC1DDEBA03D1CB2D DIRKNEILSON
390,323,073 *274F2642D99567764A0570C6DBDDFCB4C7E93E8D distritodepaico
390,323,074 *2745BA5B4FA6520EEC99D9EF3B5F9C80B7259DC2 CAQU
390,323,075 *27496FD71751527D4AE7813D26139EB8F8B8D3AB CARELESSNESS 'K/(@)/RL/I/SN/E/S
390,323,076 *2741D30FD9A0BCD46F613533A035CAEDE5791F94 DJTUCKER
390,323,077 *2745B6EDF406A1FDBF9B63896C1BAF99A7B808CB catjames1
390,323,078 *2747BE44A2C12836712DC45B7A690222E6C9ECEB [email protected]
390,323,079 *274F979847B3954CA9C1082DFB7A56B5B2AD6430 cb%p
390,323,080 *2744664A023213BDEBE0D2A87CB8D00BD971365B cclrtng6
390,323,081 *274C283E8BEBD44CABEDAF6D38D2C9D4A73E10C9 CCWRK
390,323,082 *274A93AB141C2F4FB0D83F7AFCC4FDAC0842726D dongwolley
390,323,083 *274B725702E70E13FE85D8C5DEC0D44EE18DD0B7 CEDRICPEDONE
390,323,084 *274AD2AF04A27E92D974F7FEB6EC12B63E270CF5 CEINHELLIG
390,323,085 *2749C7457B891D820439822BB72D0D811F69DBEF CEl
390,323,086 *274C538BEFD5400F0097281D86318E27339F1792 DOORDRUIPT0
390,323,087 *274B906EF867331CC2D4EAE2B934FC71F351E08C douo4
390,323,088 *2740442E1E8BCF066A3B3BF0959F3A7D8DBB1645 DOWGBOE21
390,323,089 *27442380229B0B1B6F46E9E9AADBC59E04039E56 dqfvp
390,323,090 *2745B3124E41153BC86AAD2546AF9094E1960F6E d"rji
390,323,091 *27491541925E46C90DAC887DD9C545714B31DF59 duck.jam.e.nacao.hiphop
390,323,092 *274BA16DA112C7F2289C2080EFB37B4E9B66DDD5 CHILCOTINING
390,323,093 *274F1E84E9B42B740D7ECD0264C30C3975BACBAB D$UEE
390,323,094 *274783BB51D6BDBEB00E4330925694E20A864EB3 D!US
390,323,095 *274CD8533DAF64F56B3F02EDC9CDBB611A5C5FB0 DWAYNEVALDOVINOS
390,323,096 *2744A5D2A9B0432DD76E1FA90B2F1809620E7F1B CHUNGJUYUNG
390,323,097 *274DBF2C431E4306265F8036451AF32F042F6605 cill&
390,323,098 *274616A0DE60BE1812E1D82D5972EB9F445AE840 C#K"K
390,323,099 *274E0309CF2AA5C0E72C6D925FE911A07E257A44 ED/T
390,323,100 *274FCD42AE2684EDC1BB834BA6F4E5C8A5CDFF1F EEYOREAMERICA
390,323,101 *27431F0F72823C5868E8F2EBB98287CACC2F6048 CLINTON.KAMPF
390,323,102 *274F8B51F2FCC19B63D2E5B7642283C804A7FF72 [email protected]@[email protected]$
390,323,103 *2745F94508895C14DF3EB39F423C0734C7B82C41 eh62,
390,323,104 *274EC19A184CD93F57913397A8F5B40FAE0EEB18 c$m
390,323,105 *2748E1EF17649EA7FD0D57FF40BCE47EE900E96F cn56;
390,323,106 *274E156846D5FAA45CEC0C89C8B20097A96954FB ElementalPurificationII
390,323,107 *2745B9C01046DB74BA718695FA9ED948C7C4F711 COHUU
390,323,108 *274FE3269773E2712F81FC583D3B665581395B0B ella-francisco
390,323,109 *2748BA23F66B1496588E90B7C94E3E57970D372E COLTON.SOUVANNAKHILY
390,323,110 *2743E4B05CF90B55B64E1635DD40FEB6287FE94F elliscarreno
390,323,111 *2741E468AA995D91293461672B0F1FF511698461 COMPUTERVERZAMELING
390,323,112 *2746635731CC817907CB9F047EC66382ABB3D97A elwoodspead
390,323,113 *2747DAE8FCD826368A86117001C5BB900D1CDD93 EMBSP
390,323,114 *27485AAF89528CAFA519DC1BF12AE0ACC702EC05 CONRAD.DAWDY
390,323,115 *2744E307358C1DE5E1825CCA44C12C9A39650F2F EMILIOKLINNERT
390,323,116 *274D6462EC80CFC781BF2601215202EB07A554C7 conspuent5
390,323,117 *274929976C17C7E697B6EC2475546AFA1B523EC5 [email protected]
390,323,118 *27494E7C9D534CFF92CD1A5145A162712B616D44 Could.send.such.message.to.their.sovereign:
390,323,119 *274CFF14931913B49DC3A91F5B2EBAF01E68C567 ENFX
390,323,120 *2747D4BA78138CDBD869C82EFAF55C9056D95473 eoq?y
390,323,121 *274EA300DE820B9C68098C91BDFFB5D78F16F309 c:\programfiles\windowsmobile5.0sdkr2\samples\pocketpc\cpp\win32\pviewce\resource.h
390,323,122 *274AD9B5B4314EB6444DB3093379BEC6AE653BB9 cqi9v
390,323,123 *27455CCC9ED1E0563775A0D4F957E5B316167BEC ERWIN.LIAW
390,323,124 *274A8282E75F981101DB435D8BE149808126426E escalona,
390,323,125 *27411F4CB8A761B86D2C99A01E108EFE16D13E32 CRNNMNTING
390,323,126 *274A66DDD331157564DA344601D94D522CEBC51D ET1O14TES
390,323,127 *274EFF3FC4C3CCFCE9BB8FB2DDCFEAD91AE651E2 ev5cer4ton5
390,323,128 *27483090E0501F2AC6E0BC8A79A10682E4007500 EVENEMENTIALISASSIONS
390,323,129 *274FA0A85B09F4181D9068C14E2419B321120CF8 exbotao8
390,323,130 *2742AED385C50A41BD1047B55E991AFAB4B8DD11 CV/r
390,323,131 *27429B33EF22DD2E29D3AFA26E4271180E3BD5EB FALCEFOOD7
390,323,132 *2740A3CC6F8A72F9C9D7CBFBCCD778FE03EAD14B CXA%&
390,323,133 *274C2EC497114D9030EB01B32BB4CE3802CEBDE4 d0h6;
390,323,134 *274959A8A57E5D5D65446A7B78E64BD4FCF4C7B2 D1AV%
390,323,135 *27499744B734655706A2F03E5F088C0F5A9B41D8 [email protected]
390,323,136 *274B8C9BD97954B7DF57824B1E6C6B164023A57E FERROFORM
390,323,137 *274F1BDF2E906C7D78FC20523FBA828C3451C87A FINARFINOVU
390,323,138 *2743B6BFB4DE4F0DAA4AB656B92DAD5E11E17517 dallassurgoine
390,323,139 *2748752C978A88A8F39885084CA27EF1B4C88816 dalp:
390,323,140 *274CF5FA91F269B557AED5038DD8C81DE312C3E0 four walls (act 2 part 1)
390,323,141 *274593C594AA02F648AC64E9DC2A1FED99B6A1BF DARRELL.MANNCHEN
390,323,142 *2749A128C5A4EA7A932002940C033A07EF376E9E DARRELLMCCOTTER
390,323,143 *2746C803B9531C712D50A30C953BD1B1100D0833 francisamuzu
390,323,144 *27412108F9F6ADBD1C9D8B9A6EEED91A73101AF6 FRANK.CATONI
390,323,145 *2744E653A4BFB1054286F6AC501A7DE1CD9EABA3 DA;UD
390,323,146 *27401B1C71E5955AAEC2F7B9CF99431D1A1BC549 DAVID-CRANFIELD
390,323,147 *274E34BBE2C7CC6CB9646958929B5C325D4932AB frimerke
390,323,148 *274C70C017DAF93B6C8AF60C9088C8E9C5ABE6C1 deduktionsteoriens
390,323,149 *2744275A831864E81FECF028479E902D2D0107DA DE;HF
390,323,150 *274357EB25765FEF2C59FE20B01FD7710FBDCC6E DENNIS.BUDD
390,323,151 *274F4FB5AD700EF9069989A88D3B72170EEA3D17 desiderabilita
390,323,152 *274E8E9695B62AEA4A12A37E3F8F5C8CFAC5C673 de&su
390,323,153 *274E30D9A98D94F980E9A0106856C11475395F2F gedeihett
390,323,154 *27440404A677B2A5E956B5D70D4EA8F81A97EBCC GENTLEFOLKS8
390,323,155 *27416CEEE886A5B01E3E0EEEDE886825F5F86804 GEORGE.FREEDMAN
390,323,156 *27494AA76C02C2EA8E4AF66F5C30E2DD3510A84D [email protected]
390,323,157 *274EED741699D67C9C8918479C387EEEEDC31EDF DINO.MONTS
390,323,158 *27444068906EA255935C114811F67D92BDC8C125 gita-aurelia
390,323,159 *2744BF17BCADB8FE0B1662D37696400F206031CA gk-f
390,323,160 *274706929021B9C62D98F7FE9AFE214F9B645C2F D:;LT
390,323,161 *274C3B9A5961A24CD4F473AFE0C4BB927ABC731A dn&"2
390,323,162 *274DD3E8C30ED64DDC6F73A1BCED18F814191D17 dominickkramarczyk
390,323,163 *274FB7EB66B12EDB1965EA6AC1A17E287F7DA7A4 donnbarze
390,323,164 *274E2351FD03FC2D31EABA0C224F4B750CE14263 donnbodman
390,323,165 *274B68DC03BAEF78478ED81B6814B7BF047B536F donovanmateus
390,323,166 *274FC481D57B07DEE996416A545D30F94682624C DOORLICHT7
390,323,167 *274A4FD42834510DDC156BEBFE294E0B615F1390 grnllgsed
390,323,168 *274051C7E9D1804E115A9FF7AD63EEAB469A4F08 guadarramatunnel
390,323,169 *27417B7CCA100F6549E2EA8C267E96375EB92258 GUILLERMOHECKENBERG
390,323,170 *2749926AA05D4A3493BFA330377561227F748130 guiltless (feat marc almond)
390,323,171 *274EEE0D9973C7B57624EDCF185CB659EAD7BC6E gunxthexsunsetx
390,323,172 *2744A741C104062627DF9B4C870E3B1AC3573C47 GUSCZARNY
390,323,173 *274D95061B2E74DF1A593D00244941AA69D557EB gusmorgensen
390,323,174 *2742E0E2A2998ED6832B753184FB973998C59959 GUSTAVE-LUND
390,323,175 *274332FCB572216B0E1F07591B043AADA3024743 GUSTO 1
390,323,176 *274623DD6AF7514CCA3835AFBD1177B108C8C25D guy.ferri
390,323,177 *2745730652379D3FB2A6DF7F545A06B7E1F13BCE GZO*
390,323,178 *2741BB22B158CEB5A4967DE117995E4110C755C4 DUCJ
390,323,179 *27429CC8A5861FD42A19F5E7E9001953D4DC5E88 HAOJING
390,323,180 *2748F600B5B7050EF46E9A6CABFE04045C2B107C E7421243
390,323,181 *2748D55E60286210AF5EFA55DD585ECF2B844301 eaglemarcel
390,323,182 *2740F5104CA75AF5BF6B65BC847E9E8BC5CFF678 EBCN
390,323,183 *2741BD9E86975D4BC8558C94F2E7269A6239C583 edhht
390,323,184 *274234EEA1BBA449589013CBE7C10BF19CB0E4B1 hgqv
390,323,185 *274DB1519746A35DB17908460E2C31D80F8674D4 EDMUNDOHYATTE
390,323,186 *274A521205C330ACD7D100A4547D6F47E7E5181E Hltng
390,323,187 *2745BDC2A623E709F64BC5A57529D7EE498768D1 EIUN$
390,323,188 *274121A4F09A64FABE4E983F42507DA79613A3E2 ekakgnok7
390,323,189 *2740525605F5A24D999A1C00B897AC6728FDBB50 EKILHCTITS
390,323,190 *2744C470645FCD95CD57A2B514F7E94DBBF2DDF4 howardmillraney
390,323,191 *274611E836A97307BAC432420F8651985C0FC759 ELIMINERENTS
390,323,192 *274889B03307A9E4201AA4D40F2F9CF2256A7923 elliottfurbeck
390,323,193 *274AE35CF1BC8CA871E99F18E9D5EE4224716510 HUAMBOS2
390,323,194 *2746AAAF0B8216C6D1D78306C23E4AF6C3A5D711 HumphreyLyttelton':"Whileplayingahandofwhist...
390,323,195 *27474D3C8A1E08EB886613BD570CB00F84E16BE7 [email protected]
390,323,196 *2741EAB81EC1F7E4D7342FB8D6D3D77100BC2A62 EMIL.KARA
390,323,197 *2740C9025396B41E260BC9BE6D5F52149F6CBE41 EMMETT.DIMAS
390,323,198 *2744533F5980A014CB0D5416C3EED0C3E5842530 emoryneske
390,323,199 *274084B6E84D62590ECB23A9870CF3C42E4E1F3E EMORY.PRESNAL
390,323,200 *274733A3C6A7F2CA21E5C239ADA18B48032EDC75 HYPOFYS3N
390,323,201 *2748D41B26FBF317088717E3AC6D82C9F6DCD701 IEAXOECP3
390,323,202 *274F34E391F0E5052A53A80A3EC4896628DBEA1B IKSWEZSU1
390,323,203 *274134F381ED548052982ACF1036CAAAF33DE4E7 eqo$
390,323,204 *27446DA8E91E46131A2F780D6E8C678EA478F084 ILUVBOOTSIE24
390,323,205 *274D47462664796E3959CCC2B812783AD4629A60 iluvjosee32
390,323,206 *274E173F7ACE68299270C347477C5281FF0DFB04 ESPANOL.DEL.RIO.DE.LA.PLATA
390,323,207 *274CA9387A32C4C93BAB779377029D9A77EB7DDF (I'MSOGLAD)HEARTACHESDON'TLASTALWAYS
390,323,208 *2745DC50B7C91EEBE4404FF5B0BDD219F18CB66F INCARNAIS0
390,323,209 *2743371E915392224DE853B997A4546700176A0F ET~H
390,323,210 *2741E9DB0E8613049467CDDA3A0C024F9428A6F7 inthestudio,volume4
390,323,211 *274655DD53E0D33C5C908CFB3E9A538664E383C1 evolussemos
390,323,212 *274E3F1B219C2F9C0B32D97A2257C58071576A19 E%WL
390,323,213 *274FFD6226466F74E2AC0E4AABA1B5762BD82DF0 ISAUKAYKED
390,323,214 *274EB01660A4820F432BE00947C09A54EF9D6D06 ISIAH.DANKER
390,323,215 *2749838978B90229772652318A60D50D949ABCA8 EZEKIEL.SNELGROVE
390,323,216 *274E3465CA814E463F834B7B5CFA1AD42A2C45D4 ISLAM-HISTORY
390,323,217 *274A35F034940453AA5FF74FBD3B0F4556EA1A75 Fala-Du-Guita
390,323,218 *274A0BF13066E16CA7FC64540B254D88F0B65B31 [email protected]
390,323,219 *274256BB0CB341EAFDD942512AEA3B0B5A749F6C fantens4
390,323,220 *274E896A510770B74AE9D1D6E930814B39C37F94 JACKSONGEORGE
390,323,221 *2748F2716ED833AAA4E12BA4C59D847CAF702C7A federicogriffel
390,323,222 *274613D61D2FCBB25E4674B7888CDD6ECE42D397 jakovljane
390,323,223 *274AB2D1CE374599E552D30AEF57D5AD3D429A1B JAMEYLACRUE
390,323,224 *274EE7EC1A609A6B0598D87617F270F9B8A5310E [email protected]
390,323,225 *27454D3E9F306D094A1058C76D585476C5EAC49A [email protected]
390,323,226 *274620229F2C2D3039D5B37F751BDB41C4116391 jamiemcnichols
390,323,227 *274B0464FBF264EFC89094097D227CDFE4BCC1ED JARODSCHWALL
390,323,228 *2747ADF274B4E67D326F2374C440E5E62633CFAE F^IS
390,323,229 *2748073C8724254E140F4075AA5B55FD5FD53A12 JCN1215
390,323,230 *2746AF457EC07B80DCCC091A2D6D9F97FC75C4FC FKOREA
390,323,231 *274995F38B6DB323724DF5C1373DF8C0685A2B71 JENETTANG
390,323,232 *2746E16DF35BBDABE2C92CD63723BBD23AB8EC4B JENNEKEN
390,323,233 *2746CD1D67E8F9F17D2E5DA30C187DA8F8430E6F JEREMY.MCCUE
390,323,234 *2742D5051729F4498D239EB46F6805862CD92EE9 FOREST.TATEM
390,323,235 *274C8070FB82E862B6F4EA401A15BEE57D0271E7 jesolotourismcom
390,323,236 *274E7DF833EA25C32A253262368E0C4FA0CF6820 JESSICAMCLAINE
390,323,237 *2744C8B1ECB60C20BB26C969FA1019C09F1E0DF8 jitneyed4
390,323,238 *2741B09B4CF332C4969ADFF4DB713905A0966024 [email protected]+HIN9$
390,323,239 *274B8C31BC9A5576BBECF32AC2C74B489782E8CA joe.weston
390,323,240 *274835A1021287C6284E058577BAF13B8D16C537 john.r..burr
390,323,241 *27408066B7A15660F8F3ABD6CAAD3723E79A4C4E FXD314A
390,323,242 *274CAC8778820A8D77476E524C96609A9CB66B19 JORGE.OZAWA
390,323,243 *274B30A21E05ADFB6F9C136BAB9022CBB7506E57 G7MS
390,323,244 *2741A3CAE2F8BB3607FBF4D996A7C674AEA4419E JTEMNUO20ZHB
390,323,245 *274F84145B3171ED52C6CC9D9B85324391FCB8DB JUMPED-HEAD-FIRST
390,323,246 *2743584674EAEFECA1F3E6C8FA670FCE0229D69D [email protected]
390,323,247 *274CE26DF93A31EA26FEDFC7D51EB781CDD0FB26 [email protected]
390,323,248 *2748011CE987DA7A36E8A93905EBE3EA685E9909 [email protected]
390,323,249 *274F0C1ACBFB954998D905CEF6811E3CB48BC92A GARRETTTHIERRY
390,323,250 *27448432977A8480DA886637641B42DF436A0E6B GARYNEELY
390,323,251 *2746F1793ABEAE77C8B4F19389508043EFDFE8A7 K83944
390,323,252 *2742D4392BD22EA6B87A598D59236E7E9304763A KAETILOENAE
390,323,253 *274D72D8E7E1B60F2D83D43A2D79765759E04736 GENERERING4
390,323,254 *2747543BCDDD197245BA388D866B43F47BA7F14C kcufkcuf
390,323,255 *2742E3C45D570C4609DE1D2443027D76083F9947 GIDDAY1
390,323,256 *274B8D4C75D43CE66226980DD9A03F6C9C647C54 gjchjchtn3
390,323,257 *2742951A7D82823C28D2DD955AC081BAAD1B3A14 KICKERSSTADIUM
390,323,258 *274DFE60FFBB33B9189F33B44292361A6E4FA413 gordonisabella
390,323,259 *2744B87CF2F8D3177236043AB82D11E19E2E3D38 KINOBA
390,323,260 *274675931F3D9D7AE4FBC59E0B2118AE58B42C99 GRAIGPRIGMORE
390,323,261 *274A529AF138724294385700FA9D6B2A9FD0C7AC KI=Z
390,323,262 *274EA861D38B8A090C0E5A9AC9ACC12C0A928DB1 klarzell
390,323,263 *2747DFE9E342FCD9F2AE2D5F888055A346C5C9CA GRUNDGR
390,323,264 *2747D9EC54B1E91016D808D2A69FFE1EE83304DC gulaybayram
390,323,265 *274883991722032420355EA720C4A1E60BF0593F [email protected]
390,323,266 *2742B95CAAE29AF50539B9889D20C848B9D7526D [email protected]
390,323,267 *274BB2BE93738E1082B9393C4AB7B8707A0F5AEE [email protected]
390,323,268 *27433766FA03B6558D2585E29BA725337FE0FC23 kroost3
390,323,269 *27434A1A2809E8E49BCD83D59392626EAC479A54 halmccrae
390,323,270 *2746915F555365B6FB800B5FADC137DDFE4AE652 KVIPPERLA
390,323,271 *2747CA0DA040E724BC1D2E29DB2B86359A26383B [email protected]
390,323,272 *2747CCDE99D298F314B2C24EDACC2FF4F6AB8A71 KYLEEACHO
390,323,273 *274FD29A79CE42C8E2BA58CE8740AA2E89206DD8 L0a7hn9s
390,323,274 *2745F67B23CDA9ED746C8CB81348290EF239345E L2:Q
390,323,275 *27467008C6694A59C0C2F2FB2D8F56AA544B160E harthaning
390,323,276 *274B2592E442EDF7CA94FD4E0C658BCD35FD1105 hayetmyos
390,323,277 *27407CFC7042814F5B86D104DE3853F8F99E49D4 hcatakub3
390,323,278 *274582680225797C81649F6279F4454836F777B7 HCIERNOV9
390,323,279 *274116FBC3939F012FFA1E7B00D183F90E7984F3 [email protected]
390,323,280 *274853300E13B057EB347A447BAEE5772977E1B3 [email protected]
390,323,281 *274D541CDBD1A2C0742F6953D8147970D498AAF5 [email protected]
390,323,282 *27460128BFB7A5B40D400ABD891B2A2F976A9D5F LAUFSTEG1
390,323,283 *2749384CBFD9230AFC6FB3361B42ED29992D62D5 LCQK
390,323,284 *274E210DC6E9C23616443B5FBB02730BB777C887 LEOIED
390,323,285 *274A054327FF7FC812DB5467402965D53CB933E7 lesliecarnathan
390,323,286 *274F3F049490972152201E35AF6F62BF297F9466 HOLD-MEMBERSHIP
390,323,287 *274C3965FE060579E95664450CD780CFD5B2173B HORACEHOYLES
390,323,288 *2746564784327D6B4460E562D26929677941541E hoseamedious
390,323,289 *2747FD47B9302112600D80357CA9F36FD746DB59 [email protected]
390,323,290 *274CA45DCF45342107DEA26409A694FC95D410D8 HOVORCA
390,323,291 *2748B3E70D294FAA927EDF3016DE1E4E3C9ACBAB LINCOLN.SOLMONSON
390,323,292 *274F6908903B1B7272C91E3EB3890153787A0381 [email protected]
390,323,293 *274B32DBADC07B899DAE1890F7D620EA55749AA5 LINDSAYGIRLING
390,323,294 *2749B36ED7D8BE969A847D2F0979CC68852EE5D8 HSITOOS1
390,323,295 *274316E11D9DD56F2EB4F039940C0D21EAC37388 HTTPWWW.KMNP.GOV.TWE
390,323,296 *27497996C3A4CF9FD6C8060D8198E1D5255FE3C4 [email protected]
390,323,297 *2748D822AB37F5DF193CEF7E279B203D3D00A2D8 LITTLE WHIP
390,323,298 *2741FC676A68F11EC45AC04C979A40179C80E64D lizarentaneza
390,323,299 *274F098C5069C2A46C37E7A4D8FD2C3E1C09D811 hvordan.man.blir.massemorder
390,323,300 *27470ACF9F60F42DDFD70C4FA15358A9B7431736 HYMANEVERROAD
390,323,301 *274B2E60895DF3AECE6BC11550D9B395EAC4F146 LOGANBARTBERGER
390,323,302 *2748196F0E2FB100D068DB70E39D64DD4527A82C LOGANMESSMER
390,323,303 *2743FBE1BAF9BE202A73BA3A72305EA781E04642 I23
390,323,304 *2742A3C12193D8CA97765E6D6EAFD9AD612AD931 L, OP. 20
390,323,305 *274A64E85A8D14E8442AD213724A8A09C8A8302C ilovecassie
390,323,306 *274365356F0CB81D1D55C615137389D4C797BA2D ILOVEHILLARY666
390,323,307 *274EA8B826C716A5C1710E2D5485D7024D014EAC LSZCZECHOWICZ
390,323,308 *2740EE870602F4E23CFEB463F2157824F7FDD33A [email protected]
390,323,309 *2747E9FB52747CC9757D37BB3F0F9F554D03F27F LUCAS.ELTER
390,323,310 *274EFAA775ABDBDA7D2CD1EF7CFF5410AF368C29 indivisible?
390,323,311 *274AEE1A2D71C2FA77B52B70C8B531E9BB4B6DEA LYNWOOD.CELLI
390,323,312 *274B19E87D3B2A2F715D0FA5F7F3FD1FF7AFBCF1 M228X
390,323,313 *2749DB59AA1965218D660CC50A4639EEEC95A601 ISIDRO.COUTEE
390,323,314 *274DA7B9F3AD8AE045AAB08724AC02A66CECBB4E IS MATCHED BY THE <TT>.</TT> SPECIAL CHARACTER.
390,323,315 *274211B28FDF8F2C31A0AAAA200D62A0763F74BB [email protected]
390,323,316 *2742C432E23D4BBCD4AA812E308C82EC8952D074 ISSACZEGARRA
390,323,317 *2744648172E59C7C64B4E430405883316CD24141 MALAKI819
390,323,318 *274EC889B12427F66F6DAA752AD8EC50A8AB4B88 MANDO.DE.LA.TORRE
390,323,319 *27426869B0E8EC24FA06AD3EEB55440A10074B2B MANJUNATH KV
390,323,320 *274969BD3D1E9FF9ACB3B69484392AF66CB52847 JACKIE KRANZ
390,323,321 *274A571A3F1029F18B5B09749D1CF4937A7B0254 MANUEL.CAMBEROS
390,323,322 *274EE785220A34E9A83B671B1AE615934FEE0E4C jacktashiro
390,323,323 *2740A500EEC6269B1F9139BED16AAD6B3434C96F JACQUES.FLORANCE
390,323,324 *27427FC922D5C62E9EC993C980AA59E0B6088451 JĂDĂNENȚ
390,323,325 *27467A3067EB6001E14794DA18EDC6F9A11F0B3D JAFAHRIO
390,323,326 *274E63BE370ED315FC1A1571C317BAF4A2630480 MARIANO.AVERITTE
390,323,327 *274CD6CBD4D87ED80D0CEE1CEE1A81C7F157D1AF MARICELMONTEHERMOSO
390,323,328 *2743745F5C1EBC88C745C2EEBF38331A81687145 MARY-ROBERTSHAW
390,323,329 *274A03A8595DB595BA721C5F4A7080F371B322EB MASSEYS7
390,323,330 *274BC8333BBD3A1439DFB51884E81762454388AF [email protected]@[email protected]$
390,323,331 *274838E48CEA1A373886DF1B7CBEB3DDF24107C0 JARRADJENSEN
390,323,332 *27404264CE1564782246DF4D846A40EC8B40A511 MEIRISHPUNKTOMTALK
390,323,333 *27437D7D5E3D9598FF6F4871C0F4C1C0FC918C67 MELODIEENLABEMOLMAJEUR(LIVE)
390,323,334 *27428D2A2862B13FBB3A6354C4154F9C8F40A262 JEFFRYBRUDNICKI
390,323,335 *2741A848391FA395FEE4E1B98D9012995A900A91 MICHAEL-HURLEY
390,323,336 *274AB8F5681099A1101F8B1843AFD74B5449F7EC MICHAEL.JETT
390,323,337 *27480C995910085CCF815D011E4706AB20BC07E2 MICHALHAGEN
390,323,338 *274D8FBC9A063F561C3900E8E15AD4E2F9C250B6 MICHALWADDY
390,323,339 *2745CFD24FA80EDDCAFFBC39A89518E3EDAD7C2F MIDTERMS
390,323,340 *274A28E6FFFD945A65A67DA7826EBDB0792AF056 jerrodroggeman
390,323,341 *274A3A68C18ACCFFBB6C23F03AD8BC06483C8327 JERROLD.FRED
390,323,342 *27450CBB52733FC0766F4620B729552DEB6EED88 MILTONBERNS
390,323,343 *274049ED6BA2000E1B3267060F5D42C59DF2443D [email protected]#$%^&
390,323,344 *2741C7947243758E4AFC92C72BDE51CB9007238E [email protected]
390,323,345 *27453467648930FB249ACDC2670AF469B7C99035 MITCH.BLEW
390,323,346 *2740794974A95EDFB5879EB26FFF6DE914D27E1D MITCHBODWIN
390,323,347 *27474B7F8260A344A1ADF98B322B3CB7451BD6A9 jimmy.kehoe
390,323,348 *274A3E6F98A4276D02CADCCDF478B7AAB03B3FB9 ML053610
390,323,349 *2741B3705D59880725514A58A2C503D2DD6B0864 JOAN.PORELL
390,323,350 *2740FE0881F9AF5949823E538409CC88BB0F8D96 JOBBET-ÄR-FÖR-TUNGT-FÖR-EN-FLICKA.
390,323,351 *274D0DE99BF37FCD8CDC447E1D34C0844255825F JOELYONKOSKE
390,323,352 *274C8C6532D49D28184576E8856540BE784F0A1E joey-aten
390,323,353 *27440133983569FF0014B748639CE172E754B33C JOHNATHONSAIZ
390,323,354 *2746CDD5A808B72FCF3959EC6D300ECA133CAA40 moisesgoldthwaite
390,323,355 *27493BA5A53154C0CEF709DE9B175E9D3F2AB03C mollychiefs
390,323,356 *27430CFCABFF1F1E49F47116A7FD9272A465A6EF moonlike m uw1 n l ay2 k
390,323,357 *2740FE8F9AE2075E60D202FD2F0F91C990237509 jordanboye
390,323,358 *27414C8765317642A4BA35FF2DC5C5F3FAAC0344 [email protected]
390,323,359 *274AB24C22A2F1E6ED3586B06711679C0A8F6027 joseflapari
390,323,360 *274CD12EE9B65720D46F92F01DBED9224EC9C3AE MOSESWIER
390,323,361 *2745BD9E7325EB0557D8AD662FD66D91B9CB317D josieperrone
390,323,362 *274A84D9092F7EF0D29DCE78B4E873E20484B2D1 JUNIOR.JOICE
390,323,363 *2743D2CD11F6C4BF831A50FE099A7923186E657C jwri
390,323,364 *274FD1D42FA0B6BE38E70258A06FD57E82B9EC77 MYRELIANT4
390,323,365 *274885956A29C193278C5B8459B8FE9E97D6ADE0 K120771082
390,323,366 *274F9DCF448B56E50EDC5301EEBC2264DF348D1E [email protected]
390,323,367 *2741CD46ECA1ABFDBED9FA45EF5ED1A24BA6C14C NAITIK.DHAROD
390,323,368 *274C326970F8F0A3306BC080FE019473C64BA9E0 [email protected]
390,323,369 *274A58D749368C9A0C200643EDCC34529AF3CA8C NATIONALANTHEMOFBELGIUM
390,323,370 *274FD3A183BE26CA29874A1BDAAE29A8FEDC0FC3 ncs2k3t
390,323,371 *274F791F4CC2DACD2712A5A3D54D04B4AED5A170 keboo.lapar
390,323,372 *2749C1C49FF97E8F7052BB023BF8A2904359ADBD KEITHMICHAELWILLIAMS
390,323,373 *274552376C038F8BE449BD52271B59DD8EFBEBC9 neilpaulauskas
390,323,374 *274A1F2BE13B42D9CCE473A6B7B09C4BCC8CCC31 kendalllimoli
390,323,375 *274C2A786008B98409F5B4C1213D730A7359D739 netgitrefeg
390,323,376 *274F6B182DB79E7102D6FA9CC911276D9199DE83 NEVERGOWEST
390,323,377 *274651EDEDC37003FA5E07A955B4B68F48335F85 newperspectiveband
390,323,378 *274559379EB897EBD919E50BCCC6B356BA7A4D1B nidarizwan
390,323,379 *274ECE4B8D84E6DBDF9E49B00BEA79CEDA3C7520 KNIPBEUG4
390,323,380 *274D0F89901E2124F6F62EC697286E1C2F4E5754 kristinmitchell
390,323,381 *274FA809C6C0F5605564E28AEC968B082790952E NON5EPARAT1ON
390,323,382 *2747DE0C1061863C56FC8582C03E6DDCA83E8DFE [email protected]
390,323,383 *2744774FDDEBABFD96C92E380A652565D0717347 kt`^
390,323,384 *274E42B2D9F13F73F5CDE4E6954FE07851706206 [email protected]
390,323,385 *2748B584A35BBAD5BDD37EA4E19DA3CDC0C2C4D4 NORBERTSTEPHENSEN
390,323,386 *27495F7EEDBD5C902B08DE09B0FDEE6631FEEE78 [email protected]
390,323,387 *2745534FA2A70FCE6F06026C85021801DF961D8D NOSLEHCIR1
390,323,388 *2742E6B078FD1ADED740CB2E6427159DAC330A89 NS109876
390,323,389 *2746195C3022A653FCE170F13F14D64A773370E6 LACRIMA!
390,323,390 *2742287236C94400A545E98D777088475A1BB8F7 LANNYHUFTY
390,323,391 *27426482D80173BAF609170C63EC1FB40AD42099 o->-<.~.~.~(####B
390,323,392 *2747151180AD32C3BD4EF2BB3008D2EF8B99AF3D ODISSKEEM
390,323,393 *2748E3251B328A0D9798543D3498A02F273E23C4 lavendersplotched
390,323,394 *274D5EEE85C78F51527024A844F8AFF0DDE07D35 offshoreinternationalfzc
390,323,395 *274766E2291CB6BC8467F5D8110288155F36AEA0 Ohm(Suryakantamix)
390,323,396 *274B7B06780182CE8BE246EC958904DB7761E5B2 OLIVER.DUPLECHIN
390,323,397 *2743E295439D5FB60C0C874A102C75BEC5282F5F OLIVER.FORSMARK
390,323,398 *274DB0A5C6EB606F244C7C02E35C75BBEB0BC1DA LEIGH.PRIOLO
390,323,399 *2741C1BE2DE13A58944E0463D7E31E5791D7C144 omat
390,323,400 *2747B791C3083F92F198E7CD6002795991AFE715 LES.HILZER
390,323,401 *274ADFF02D04BF3CC2F68E4ADA438BA0AFDBD8E6 operniho3
390,323,402 *2741D64487A128701BED8F997E7C37A823850956 LEVIGAVISSETIS
390,323,403 *274053F83048D4A683DF61A4A7B9059E92E9C474 LGDINGSBUMS
390,323,404 *274C98DDFEFFC7FD793BA68C086129ACA98F476B [email protected]
390,323,405 *274CA4F245FC94D963A2327ED24BB4C8B2A46E1D lichtekooien
390,323,406 *2745BDE635D74CDCF1C94BBE5E1507A6E3A8C520 life-is-butter,-melon,-cauliflower.-~-anonymous
390,323,407 *274A7523B7F471D7D14BEAAA9A1CA6A466404232 LILY.PURNOMO
390,323,408 *274D5846F0BA1B63AA74F91E032090D058AA24C5 [email protected]
390,323,409 *274665B0DBC91CCAD32F38760C79890CB6B74B3F linwoodpederzani
390,323,410 *274FE517889B053A21782701E264552D5BEB7DBD [email protected]
390,323,411 *274C5334727FFEED48B06771F4B6533E52E2C495 OTHA.CANELA
390,323,412 *274969D64383544E6DD7A392D49100E0C38240C2 LIUZIYING
390,323,413 *27483FAC778C43685DBCCA72EBE5DE9D4B6E52EB L^[O
390,323,414 *274666342671C43B8BB3CBB839E9A29EF0F70AAF p#@`~-)0(
390,323,415 *2745120073658D560E7287C38D49E5513D218C4B PAIHUNG7
390,323,416 *27458E49A45C5B2C799CC62C594A23F424414273 love island (manumission mix)
390,323,417 *274053786F417326E5EFE4DED5ABD6E18179D14A PASKALIDESALAN
390,323,418 *27446F90BB2FCCE70183E180081392AAB7CFE2E8 patellas
390,323,419 *27433C70F38310DF61FBB7E3097BB710DCF253B5 maagdeke7
390,323,420 *27430000218E0AD60BA9456B0C4632FCF0EA9590 MANHEAD/DENNISYOUNG/NEMESI
390,323,421 *274276E44B691E914C1143BF2EA2EC6332965D48 MATCHBOX-(LIVE-HAMBURG)
390,323,422 *274D5C7753579E51FEC9DC0021A3BD062ECB6F45 maxholroyd
390,323,423 *274825457B87B41F60B35CFA935A287B534FC3BD MAXIMO.TSURUDA
390,323,424 *27480B418BAE3D27D09E2D5B87A30E09824284BE MAX.MIX.9.(MIX.VERSION)
390,323,425 *274A9954FC37C9A534018426497C970ED5B4DEE0 MCKINLEYGIERA
390,323,426 *274CF5EF73F54A61B1C941BE69558F475CB0CC61 MEEKANDTHEMILD
390,323,427 *274FE926441518BDE922A3BC12C57500341CAFFB philipdeluco
390,323,428 *274E37EEE72890ADCC0DC3FE439EA79D189CE7D3 PHIL.MUNKS
390,323,429 *2746E41CA8F773333BB55748D350346CF0B549F8 MEŞRE
390,323,430 *27467BAEFF7D3C265FBC309A6954D9070C0FB93D [email protected]
390,323,431 *274418BD8E8A33D709AFC9D7010B77AE646F65DA MI6=
390,323,432 *274AB2DD2C5FC38A897107C02E16A22D21EC2FC2 MICHIALAED
390,323,433 *274BE38DE4F52722E6B73D3961DC2424A1D7B116 mikkypumpy
390,323,434 *2749F22AC87A405911667265F4F8AE15CA6AF897 mmcgurty1
390,323,435 *274074480127F3C44E02288C47C14C9F36996057 mn7er$
390,323,436 *274459C693A382612F4DA47D3B5CBDA6F866BABA MOHAMMAD.LAZARD
390,323,437 *2747EDA93D71E6118FD9FC2EB6EECE759BA585CA MOHANLY2
390,323,438 *2748F4394B509D74510BF23F267D1F6F2A1B4B8F MONTEKUBICA
390,323,439 *2748D5EA99BCABB6577AF1B0E18C54A539B440A7 PRKSNNSES
390,323,440 *27450329B66674D6BE6575D00FCDB6ED409A4B79 MORCADESES
390,323,441 *274B2981D54B1A5AD6F254A4EFC6ECB9267B5467 proklet
390,323,442 *2742791B0556A49A1AB9DFD90B54A2E3D2E6FA9B MOSES.HEISEL
390,323,443 *274CD14FD83CF58111C0C12A3959BCE7E2CE3311 MOZI0323
390,323,444 *274E81189C5DC49FBF7E3281B84BB11462FD0E1B pteromalid5
390,323,445 *274AEA494403003F594C6134AD5849EF281DF766 mylestupa
390,323,446 *274024167213F61321DDCCEE806B74191F7F8C31 mypuddin43
390,323,447 *274D56B1E6B1FB4E4076BA2F31E69E41CA1FD9D0 MYSTEELE2009
390,323,448 *2746A05F9F2B59FDD24E30B881302918E1FB5813 N30N4+4LLY
390,323,449 *274F3ED3CB39C27468A1287404A243540091581B nagbanmb
390,323,450 *274DB5720E9CDD5B1DE23FDA18479E53C2223E9B ....QUESTION OF ACCURACY"
390,323,451 *27476A723F6C47E54A94822E854EB02206D9C1C3 natura1!zat!0n5
390,323,452 *27450E6FCF5917F817B56A2BFD65AAC38EC2DA25 QUNNIPIEUK
390,323,453 *2749CCBCAA4B9A44E584367AFB722B658B48B50B RAJIV-PAWAR
390,323,454 *274BF70D08DC139E0F003351E5CFED9DDD772576 nerotnaklegez
390,323,455 *274F86CDC0A4E0D3DD3D289FEACAF53056D0C8E6 NICHOLOUS3U
390,323,456 *274BD18D12A6EF511CD1CC49BCE92A741CEBC2A3 raymundochester
390,323,457 *2743A60CEA2DFE96DAAF94A19B59B8AB28E2D8D2 RAYMUNDOHOCKING
390,323,458 *274DF0017AA6044CE4E9E2A27FF1CFA7149E3E69 RECULONSABAFTAFTAFTERAGAINST
390,323,459 *274F90FE80E8F801809C65F240575302A7D18A0E REFINE-GROUP
390,323,460 *2740F815713D7E9EB55F0A4B92C51D225C7D374C NONCOMMENDABLING
390,323,461 *274ECF70BA7E094DFB6393BDD23D8EB02FAD81ED REMAZPLUHEB4
390,323,462 *2749395073BD54645EF99945189C8E1660FA7140 REMEMBERLIBRARIED
390,323,463 *2742CA41B87E6A11F8A9C495A8B188C6B6E3020E NORLYNEC
390,323,464 *274D2CC77D520B24E726DEEB5C562E435E98840F renatoswatman
390,323,465 *2746DA4CC68E0A85D5811155A89E40F6B544C6EE REVOIES1234
390,323,466 *2740D952E3C9977D57196071BD8632AC38FAF98A reypandiani
390,323,467 *274100624A3304D106BAA3D245B8A3EA2A9369D5 RGENWUNDERLICH
390,323,468 *2745261B8DFDEE48C71E57E1BEB352DBB67229F4 RICANALIZZO
390,323,469 *27473DB92958EAF33F35C19A3FF4B82B85390359 richelieuvalleymontrealthreerivers1777
390,323,470 *274A45E4224F69EDFCDD531D5A22F2ED7F07827F [email protected]
390,323,471 *2742F5724AE0F28A0E181137EF20665E4049344E NPYS
390,323,472 *274F0C3208A737AE685A1DDABC095290617429EE RIVIĆ
390,323,473 *274B5B28F67DFD38FC4EC3BB883CEADA3ED10904 >-<O~-0~-Q#P
390,323,474 *274A5F236751E081D933BAED9D0A9ABBF1E85A8D ROBERT FRANKL
390,323,475 *27403AC5A8C1811B1C33EA138B6B9BD6AA472815 RODGER.KALLHOFF
390,323,476 *2741A4FE7F98D2888D6C1D0113BFBE96C4F96847 RODNEYSCHWEERS
390,323,477 *274E7A305D3EA20DD75EC71428E8BA74AA204C4B rof-tsuj31
390,323,478 *274803BFE388B1F3121CF76CD373A5131C0662B5 ROKOSKI6
390,323,479 *2744953DEB9CB4C720145E40FF3F069CE5E17510 ROLLINB
390,323,480 *2740CD2542D9A62B9EC406FA179A13A3413424FE ROMAN.DEILY
390,323,481 *2743B9D69AD090EA3EADF9A259BBB0A78370E7B5 ROMANSCOUT9
390,323,482 *2740C0BB9ECC980D4D632F66763983A24369D0C0 OFFERTNIM
390,323,483 *274BBC678A5163C5C974424B22A1B8193D5EA0E3 ogle9
390,323,484 *274B963E4DEF42FC7BD9A7645A798A4DDBB9C045 RONAULABAUGH
390,323,485 *274153BE40CA948C793CC983BFBA03432DFCC8DD ron-c-mcqueen
390,323,486 *27458D8BF601DECA0F728D48301130876A1A2300 OL4BAA
390,323,487 *27458381776D425D34E97D754328FE50126E56E3 ROOSEVELT.BOWDICH
390,323,488 *274EA4600C2BCEB5DBEE4802F42D7A7723C3D5C9 ROYCANON0
390,323,489 *2743866D2612C0F0C488BC23126DE254A485B3A7 ROZADERA3
390,323,490 *274D2DF83BE88E067A2E26DEA2EFC6C4416A04BB ;)o~.O~.d==8
390,323,491 *274A95868B6E88AC89A0E8417A8AE7ECCC01B6DD oorlogsbehoeften3
390,323,492 *27425946F625D8E34AFBF1A4D91C7DBCC750EB00 OPK4XJSVKJJGN01
390,323,493 *274F300695C65F6C9D67588E358353F5F9E114E5 [email protected]
390,323,494 *2743CB8FC1092049046B0FF9D43682FE9457D86B ORMOSBÁNYAI
390,323,495 *2746CE613A2B73F6C45870B156902866CC6672DA RUTHIAN5
390,323,496 *274EEDA3DB27FC1A6396A968A76FC4EECA5648C5 RWRTHST9
390,323,497 *274BF07A20D09D8C4400C1B171B84814EADD55A6 OTTOZAMBRANA
390,323,498 *2740DCF63C1A8FD6F4B2CB7706ECD009C7CA0426 OUARÉ
390,323,499 *2748B4203CC600E278EB196CA1F00E6BCB93B88A [email protected]
390,323,500 *2742AC64FFDAA4B90EC3796550D095B94A21F798 SABRINAGATORING
390,323,501 *2743072D8682FB7C0888B22713AF0003E60EC837 OWEN.GEE
390,323,502 *27472BCBD1D8EE3B3655F172C1D0014C03F8676D salzgitterwolfenb
390,323,503 *274DCBC072A4D4731A41648C9928275D26148BFD samjulien
390,323,504 *27419CADC400D4953DC15E9C0BAF9285070F7DDB SANATANISTS
390,323,505 *274E887FF62EE226EEC9A25B957325AB0837F77B sanfrancisciana
390,323,506 *2742C29B29F448DE8F5704103B3652F591A74E9D PEDRIQUEZ
390,323,507 *2746D2B3CA704CC1314C5013AE1F52558525A08B PEDROOZMINKOWSKI
390,323,508 *2749310BABCA43276EA1B4CBD6D82A1A8175FB4E SCIPIONOVA
390,323,509 *2745AAF040D2BD1549DBABE0DC22743950BA4F55 scorpst
390,323,510 *27430FB87E2EA801820944A5E91D93AD222CE4E6 SDELEGATION
390,323,511 *2749455CC1F52A628F297059A46149543B212E31 [email protected]
390,323,512 *27411FB6A0F7EA0F5916E3F3DD350BB3B719DC69 SEAN.ELIAS
390,323,513 *274D0C70BD8F03C7FC33E16B35A1BB16E95E9306 SEIGNOURS3
390,323,514 *274F87859975E201E3645340232E1DD9C997525A seimerej
390,323,515 *27437683F5EDFC9FE6D2631AA13826F26170F851 pgq
390,323,516 *2747900645FD2E1526ADE7CB9F5288BE333F7478 PHIL ASHWORTH
390,323,517 *274B74326FB970BCBF1CA68930EA6E3B5E032B68 PHIL.GILBEAU
390,323,518 *274A5793340BA321F7587ADA036C0C0985FA2FA4 [email protected]
390,323,519 *2741D89BB820BD7A0C41A79F86CE0471D376527D PHTGLTN3
390,323,520 *274476B6AB4B184727920D61ABC32D81F8B9252D PIANO.SONATA.NO..10.CDUR,.KV.330:.III..ALLEGRETTO
390,323,521 *274CA15C72E502F41A67B860A2452FB0512501B1 SES-EN-LOS-XXI-JUEGOS-CENTROAMERICANOS-Y-DEL-CARIBE
390,323,522 *27454D08254D8117E6C59D43FBB6915A38E45E38 SETH.EPPERT
390,323,523 *274950C9102E88EE4E7118AC02850A10C60B8616 PLANKOVIC
390,323,524 *27422EEB0CE272B6A8FAE7552D334759E9F11816 PLEASE DON'T LET MY WEAKNESS SHOW
390,323,525 *2746ED5EF4A7E9C662D3A127A98BAE06848B85D3 PLOWBOYS
390,323,526 *274243B64AB89816C39D48DAB9FE12BCEE3080F6 PMID18788723
390,323,527 *27425A8456EF28C3056FC2199F168AF56D79F1BE PNEUMONICD
390,323,528 *274AE790BB96E4DA6BFC4BF5854E3E9C0E289B42 SHANNONKUCHARSKI
390,323,529 *274864ABAC3EFA2E89C022D02BE4A69C9A9A20AA Poliisimiehi
390,323,530 *274860F934ECEEACC62DC60471988A9304135F3C SHARONNEVES
390,323,531 *2746A318E073730A01CC36AFE5C69A17CB43E65F shazam (wave your hands in the air mix)
390,323,532 *2747BF7AFC406C523F08B85FFD8F024C1B84DF19 sherwin-marcial
390,323,533 *27423D9390236F14FE1D4AFFADA1E1409A2E5A47 P=====P`~ `~ (_0)
390,323,534 *2749D1222E827C6470FE23C81A2C9411CD00E6A9 SHPARGOIDAR8
390,323,535 *274E8988558AD3A53B1231BB94FDF0C0302E66DB PRE5E1EC7
390,323,536 *274D42CB59A08DE2D5E5876F124098A00073A197 [email protected]
390,323,537 *274BEAB3CDCB61583FA5588AC25D5E4FE206A5B2 SIDNEYBIRD
390,323,538 *27426D3923F08392A30AC1AA4BBF3CD0D966C3C7 SIMMETRIEVLAK1234
390,323,539 *274EB0CFEB4E4F6DA6FB2601A25C4F53339C35A9 PRIYANKAKANDHARI
390,323,540 *27456A2BAA14E40368F7F69E7FE91ED6A0CA69AA prometeo-liszt
390,323,541 *274A6024821D32CCE18270EC51673D50D834DF46 psychrometric
390,323,542 *274AF7701B68406A65D496F872A93B685D0FDA36 QAISRANI BALOCH
390,323,543 *274D57D7F8D943B0F98DE93E58042EFF5A5DBB88 [email protected]
390,323,544 *274C2421E61ED4B119B7945B36C9028BCEC2E80B QEZ
390,323,545 *27401C0C741615E489D1F6935A96C43FEF36C702 QLRENB
390,323,546 *274961DFF16D2F18764B0D644E118165937BE628 R44M
390,323,547 *2744511E8329966C941D9E044BD6E891874B1239 RAJUGUI7
390,323,548 *2742F55F80B252AB666E5C432EEEB27CD796FCEA randallshusta
390,323,549 *2749E02A515CA25FFEF7371AEED947950712BAB5 snowbal1939
390,323,550 *274A7D8E0C978198D111D6EE9272B07B75B259D0 RA$$ODA7A
390,323,551 *2741CA485F8E1B75F7C231AF09FC774F19D864F4 rasheed-freeman
390,323,552 *274D09E20E5F8DD9BC6B37254C7752D3CE417637 SOLMUNISE
390,323,553 *274B2FFD731D49B35000A1FC85A5AD12C1350724 RAWPOWER/FUCKAUTHORITY
390,323,554 *2747D5CB96EFC5FA0C8F7F6A4B6BD6BD1A7FC3CB SONNYALPHING
390,323,555 *2743EEA755005A86466593568384C54AC5FC50F3 sophia.odonnell
390,323,556 *274D6DCA1410367B50B8403C10031AED68C05DA0 rebelion.de.los.paises.bajos
390,323,557 *27440E7A37C247A7A3FC15E585C0F1B340C2EBFC SOREA
390,323,558 *274CDFB325D63DDA76C630896B219B68DE7CF81C RECENSERA5
390,323,559 *274BE71A3F1F6F6A7089200CAA0CE4B7EA2DD27A southlanded
390,323,560 *2746E1279026BF9EADAA14225E30C90E85539372 SPEEDIA0
390,323,561 *274261BA36D1B842DBEC3DD53BDF272B8387EEE7 spizocorys
390,323,562 *274E7064AF7E90EB491BEA75583901A464E0AEAC splato~o~d--b
390,323,563 *274467B2564A50EFA3B14231A9D5E807DE3A9212 sroirrawnoziroh
390,323,564 *274A490E42A31FF3837CD0A75CF2D9B94DA992C8 STACY KOLEE
390,323,565 *27466E947EE2C722F646F9144B682F2DC4FBD38E REYNALDOSPEH
390,323,566 *2748AFD737DEA2E2D8CAF978241B41F281881D32 RHINENCEPHALI1
390,323,567 *2748BA52BC19710F6B7A71FEA4804C008CF923FE [email protected]
390,323,568 *274880646664EEF82E971DDE5F116C1F18C16F00 STAVEBNM
390,323,569 *2741DAFEC4676868D3E498D12E52038F25A2F767 STEVIEKNUDSVIG
390,323,570 *274B066CD3EAA3E01A156FD79022C6916477F00F RICOSTRUIREI5
390,323,571 *274ABBE8A0B94F185E5333D57596297037B0C048 RIGOLETTO&GILDA--FIGLIAMIOPADRE
390,323,572 *274ABB89ACD6AAB9EC5591F605288AD53B383FAC RITNINGA9
390,323,573 *274FD80F1E66CC6812590391DDD1F11F2384A568 STYRESYSTEMTH5
390,323,574 *274D04C10CC2FD95CB2BFBA5EE423AE7B295299E [email protected]
390,323,575 *274D1DB1392D567C176A56D2CC94EB4CC7FC90BB suanthin8
390,323,576 *2743CDACB6DBFFECC2D444B7325DA8AB6BC839FE RODERICKFILS
390,323,577 *27460D2111CC2C0B08A99F089C4F4D54D79C4456 RODMCMASTER
390,323,578 *2740A3F72F0437400AF2FFD972CACE0C297A5B31 ROGINIAS
390,323,579 *2748061EA059007B5D6B7B774C36179E4291DDF3 [email protected]
390,323,580 *2741021900B5118F998D639C2E6825755EC58CBE rolandsettle
390,323,581 *2743696BFA9ADE0134FED7C00FAFA7AF49F7B58E ROLLAND.GAIN
390,323,582 *274D72A494D9F4E890A20576E397FA3E37AC8F92 SUPERPLASTICITY
390,323,583 *27426F46BA773C772ABA8B6A0F0B0465B0A39A87 SURHTRAR4
390,323,584 *274C3155E0707573F1208B1D2599F6AE16D569AE RONNIELEVEE
390,323,585 *274A26742F2017705CE1AB8CBC497918BD6CE5DA SUURYAAH
390,323,586 *274642D4DC5D79D2F1DC6268756DEB8F56CCF506 rosaflori
390,323,587 *2748C0164A976456AC00EF5262A50F54033A7E9A SWARTSSWARTS
390,323,588 *2742146C1AB3E2BA020B7B7581B86B9AD424E98E SYLUAWIA2
390,323,589 *27435EFCF3BB0494278F10A611CF0EE80577BAB7 rudypapandrea
390,323,590 *274FA16868FE99DFD2D42DF66F542486C0520115 RULETYPES
390,323,591 *274ACFE95D00F65ED15462E915CAEFB8391F3B0C RUSSELLBOSTROM
390,323,592 *27450C9226914C1A5E1AC651A58795C4440F042D RUSSGRINAGE
390,323,593 *2744155BE8E3F7BBAA81E5CDE25AD0250738F4BA RUSSHELZAMORA
390,323,594 *27490D48DB423D75E31DC8CC3C3819F0A7C8C64B szumko
390,323,595 *274DCA4E1D57B73002B8AAD2F06DE39BA1EAAF1C SABINADBSW5
390,323,596 *2740B294C51F0E5C401213DA51802E7362ACE147 SAEILYYKIN5
390,323,597 *27492925D9B7D46C90EADB9DA70F1EFB38BF33AC sagoblunten
390,323,598 *274F8AA069C0FF563584F62F11CB14EED4C5B29D TÄMLICH
390,323,599 *2741B5FD38A854BBD099DBA9AD10BBBCB4800031 täpläkauris
390,323,600 *274348B64143D9BC9C0EF9CC2144CFD0D2237912 SALVADORSTANGL
390,323,601 *274C5597F23DB83B06DD1EE3F4CFC6178ECED13E samankaltaiset
390,323,602 *274734DE7BA886200857426D1B33E25325E97D69 saraspa1
390,323,603 *2742C1A7E2B3CE9B26D24FA19E0B81810FDE8F82 SAVÈNA
390,323,604 *2741F43F46F81DFAABF3ABF623548E882BE853FC tekenhaken
390,323,605 *274AEE38C847245BCEC4A2CC879FC762630B9370 SBSLC
390,323,606 *27404C00B80D42912A093D447FD3AB686A3C5E8D TENIETDOEN
390,323,607 *27452AB4F5C5BE69E5A7E9E8A21A5A7C7B81AE51 TEXTYLBSW6
390,323,608 *274CF17F44FAB3030DC633B9BF2FCDF0C15A2AD3 [email protected]
390,323,609 *27407B06D2A4929C8DD2202C0428B767164F5FEE the.age.(fish)
390,323,610 *2742B5260AB4F607C819E3FF0E51DC112913C5BC the.eaves
390,323,611 *274C8AF58D95057F56F418871ECF0F516C185C8B SENSANO9
390,323,612 *2741B57ECB96162977F1A7EC07B34958A0FC0CD6 SEYMOUR.STUMB
390,323,613 *274F78E1B6C6FAF9431D871FDCCA25CE6DA772EA SGNIRTUO7
390,323,614 *2749304B317F15FDCE0138932AFF999F61F36ADB SHAWNANDREATTA
390,323,615 *274D2F65BFE0FAEC80847F3222D05460CF4DCAA4 shawnpoaipuni
390,323,616 *274945940AF6BCCFDA0C8847B0373C6C47E57558 shelbyservis
390,323,617 *274F41BA001E44B08F28B4D13C0F2802ED48F85F [email protected]
390,323,618 *274501B79E56E79968A2B5CA1FFD6EF07E7C61C5 T.I.&JAYZ
390,323,619 *274F78C629CD7BC39B896CCB712DA71AF8BD47A9 shermantoevs
390,323,620 *274A0BDF1F733B9DAF92234B0E024E202E65309B Tiny.Tim's.Christmas.Album
390,323,621 *2743A0FD428F5F3D32A2EAFF5F54961028EB21DB TIROTIRO4
390,323,622 *274374B5820F8C125C264FA9EC519454590665F4 [email protected]
390,323,623 *274FD01210F954CDECDBC3F56BF0A96A37C8733A tomtopher
390,323,624 *2744E3CBA999C81C9EFF6D427BBD3066ABEB69EA SITIDIOERYHT9
390,323,625 *274AC788E80880DE282BF7DBC8C61D5499052107 TORQUING
390,323,626 *27484B25CAC9FE4058385F3CA5FA6959753DCA27 tpnt
390,323,627 *274125898C2670656A9151882704267DB3616DD5 TREETELPMOC7
390,323,628 *2749093A5E37075D99CB0374D1DDED0FFBE21140 TRICIASCHURMAN
390,323,629 *274C744472FC62A6105223FD1C2B0C6A95A02C40 TROGGELARIJEN5
390,323,630 *274C79B8CE0BF81570E034326F460DB868967CC6 TRUTHLESS!
390,323,631 *274CB06A712E0D2C6D9CA2A8DB5F0855A0FD34E6 TTEOFTTBRING
390,323,632 *274D30EB3CDECCF3DE42BA925FE742AB92D2A16A SNEAKINGABOUT
390,323,633 *274CB8F3D500D6A7EE0CA09338CBFCFB9DE95C1E TURBOKUP0
390,323,634 *27424D1213CB07AFCDA5B3A1B5457279DB1625DE [email protected]
390,323,635 *274F6B8389916DEE2B98CBBDCBD3ADBC92782A69 SOLOMONMARDIS
390,323,636 *274F5949F196068753E4ED8B4C6BE91A49095690 tvaluesplit40haemo
390,323,637 *2743EFBF350864434F966D223DCCBBDCD52894F3 SOMARRAR1
390,323,638 *274C8E4600B5AD6CF907E2E745FDB733052B71F4 [email protected]
390,323,639 *274EFABA357AA0F180F924CF9BD7670CF1190C2C TYLERDESJARDINE
390,323,640 *2744E15419BEB53B960D05510F1B83F54F3927B6 SONSOFNORTH
390,323,641 *274EB5D849336C9D5FFDA75ED32892E5036DFF7F UBEHAGENES4
390,323,642 *274E89803FCA6B24B0393769C7CC8F37EB91C148 SPBPKT
390,323,643 *2743CE74DB7B57BB521DB4550103E9454F643ABF splat~`<3
390,323,644 *2741710EC96660134A5D1718D20A66E4E1A78E92 sportsfest
390,323,645 *274E932C9E353CA16D93534E60B7F0510062A30A „SPRITZPISTOLE
390,323,646 *274A0C28C6019E84D2D6DA3D3AD18E3EB3EA71DB SPUNKIES0
390,323,647 *27410C0B48BAC32EAB3BE39E1525035FC4D47EAD srnisten9
390,323,648 *274C0AAC3EBBFEEE98456379A7E33C42A2277AB1 SSHOUEB
390,323,649 *274636C5E48158AB86EBACCA46416ED6783E2758 staggarth!
390,323,650 *27414F5B9E069DEFB30B26426F3F291A5421CBC8 UNIPRIMA-CIPTA-INDUSTRI
390,323,651 *2742C88DE400C11A1AB9A719DFE94E6819B69BA8 STEPHBUBBLES
390,323,652 *274FCE2BB322834914832FD98FBDE845CDAE80F7 STEVIESTATTELMAN
390,323,653 *274AA76AE3ACFAA44D5990EAC7896E69A52765DB uranza’s
390,323,654 *2747005710CE46FD841E6BB3890A7B06DBB2FC32 USER_TALKCHRISKATE
390,323,655 *2746485632E9A80B9E422DFF291928854520BE6C USS_MELVIN_DD-680
390,323,656 *274EA9DA1F1C7C0145DAFF379CE454FFC35D18D8 suginin
390,323,657 *27421EADEE7ABF47D74431BF816ABC29F158E43C UYBATNIS
390,323,658 *2744558C528ADE2832852C506E78BE279FF3ADA2 UZPSOBEN1
390,323,659 *274448314CEE8E8D3A858C7EA30588CDA658DE52 VACEA ALIN
390,323,660 *2744FDE5AA8FC311764F2DD4537F860DD7F67D51 VACHUV
390,323,661 *274A70BF9866E66F351E25EDC26BF83F5F7C8B9C SUPERNASCAR7
390,323,662 *274B7FDBB7D5469ABBDE44F62E4FD4D552214FA2 SURALIMENTERIONS9
390,323,663 *274FCD2AAC9F2FF678949F9358BD71A40E76A5F7 SWIFTSDISEASE5
390,323,664 *2744954B3D26102E8C16355B1675BCC2052A2B37 SWISHYAS
390,323,665 *274F0EBC4DA7254655C60ACB7013BD10994A42F2 SZERETETTEM
390,323,666 *2740252632CDE9CCA2A916C8549A202D04C74DDF T109010
390,323,667 *274BE4BCB8F4947D6650FAA303F4B6E29510A69D TAJUNNANVIRRASSAANKIN0
390,323,668 *27441623AEFD2EAE5EC18AFC424020CE3F058B27 TAKETHAT-CAUGHTINTHEACT
390,323,669 *27407DB159095B3A08D886561010E258A299391B TALKHUYNGUYEN143
390,323,670 *2747EF742512B0EE673CB627A4C49FFB4CF11D74 TALKPUGNEXCESSUM909
390,323,671 *2743D69670B8135B085D0BCA00B696E0B79847C5 vbmvgoh79
390,323,672 *27458519049AE45FCC68EAE19097481832C59D1B VENEREUXES
390,323,673 *274CB66EF6B8AB9F71AFF48EE79DD0A851354460 VERIFIABLY?
390,323,674 *27452C308D56B36C276C64E595286F14FE692B45 TANGO SUITE, PART 3
390,323,675 *2741F2E11A10AF8EC9722260773FD9DE447DA0C2 tariq-quraishi
390,323,676 *27494C4E3D7567548C93E9BE1345CF18B5F0DFAB TAYLOR.BONNOT
390,323,677 *274CCB0FD423417F2077B95BC826EB402E38EFC7 vidya.kant.pandey
390,323,678 *27416EDCAC49DA273B7AC6C5837C6AD247DB6FAB VIENNA.HAHA
390,323,679 *274A9D33529A14D995F955082DCB63EBB2BA454C VIERUSHKAZEMANOVA
390,323,680 *274A7714181159D56D48833C124133D02D92F57D TEARAKR
390,323,681 *274AB075C15CA2DB19D9AA695385A7FD455B7EA3 TEKASLAN
390,323,682 *274817F0993E80124AFFB61F4E281FFB62D18CED tekramyenomehtotniog
390,323,683 *274D91C28F240EE0C134FDE98C2A9FA6B226CC1A teneille.robinson
390,323,684 *274EDFEF742820F161B0F89502BDDA9DBDE4106A TENNISSCHLAEG3
390,323,685 *2748327262EBC21EE822AFB940FA3BFEAE14A1F3 ten-second-infinity
390,323,686 *274E31F5EEDF933BD7377FA5B0106419AD50111C TERRY.GILLES
390,323,687 *274D140CCEADB1BCEAD58A8589C011934462E025 TESTTESTRYAN0
390,323,688 *274786C8A2E10A2E377538E58FD8A54403D84320 VLNTRNSS0
390,323,689 *274BA0790C5646E66C7D51ED786B351D41481A63 THERESTHERESED
390,323,690 *2741AE2680B04E11042400B3508D788EBBB6648E THOMASTECHNO0
390,323,691 *274940C29C9C1164C6665CF2063EA59FFA6F69DA TIDNIHC
390,323,692 *27406F96840E2A30BA590CF06E07C4D78193B5F9 TILSTEL2
390,323,693 *2742CF39AA93A4F8F425B15CF88C87B32B9CF8C2 tjondroutomo
390,323,694 *274AA0F160CAA9C887B094AD8DABFC7C102D905F ToDRaWaSTRaiGHTLiNeaGaiNSTTHeM.
390,323,695 *2743BD7429976D8C58DC7BADBDC7AEF25C2B4F04 W1NN3B4G0
390,323,696 *274EED8381E1B942F7D412C3DBB7B54A3435C42F toneydavine
390,323,697 *27458A62594989C29C89D885B147C1F5EFDF6EB6 WAELMARK.MARK
390,323,698 *274C0E6E7439E2FB2BFC3C5339A88E39A7B207AD TOPCATSNUFFY7
390,323,699 *274DD5F347C6AD23DA06ED6F015ED5D32408F546 TORENON5
390,323,700 *274911F74260AF671C3C006713F2DA72DBCE951F WARNER.ALMQUIST
390,323,701 *27462172DFB1F2AB2CD8C8C75466462E2A627248 [to-sabretooth]-i-fight-my-own-battles
390,323,702 *274FA811BF24C04594EBD69B1F9AFB43D8E098B9 WARRENLJUERS
390,323,703 *2744CF4127B6AF0FC6F03FAD7177E973BA143754 WARREN.WIRT
390,323,704 *27475C3DD643DBC9CB006D0726D1BA61D77BCDC1 TRAN THU THAM THAM
390,323,705 *274110025B4690298D24B1748CDE99F8EE913450 weigh7ed
390,323,706 *2744D9455211EFCA2F0CF2FE0C511610BCD02575 wendymarbethmontesflores
390,323,707 *274E54D62877AF266D78228695F24F54CE8930BA TREPANEERT8
390,323,708 *274923E92B5916AF8811260B227F2FACD0BA31B1 [email protected]
390,323,709 *274204B20F0E026390879EB03534C0DC81CCDA1A TRICKIEM0
390,323,710 *274C2A9908DF06E7E9BB18DA3A38934997B78B1C whereisequality
390,323,711 *274F0D0B52CD3409052A5534873FD4198BFD5EA6 wilburnassaf
390,323,712 *27463E8C06FB6DCB167F138AEB779B4EA751B1CD WILLESESING
390,323,713 *274DEB3E62CAF2CA8E435EC429A29FED44BEE3C5 willyamshanztobing
390,323,714 *2745FC57FC3D48E6CB00688CDFD77C7191AE9B25 WILMA-MENDOZA-LUCKENBACH
390,323,715 *274AAD44C2A783367F51647293BF574706BA71A6 wimmele
390,323,716 *27478FA6B12265F43613469899BE9B3F56710A49 wisdom.bansah
390,323,717 *274084012109AECDEC6981ABA4BB4E850D2CCDB8 TUTIHAKEEM
390,323,718 *274620E7FAD91E04CFC1FB13FCD1B084EE4084A1 wndlpdn7
390,323,719 *274B76BC5D8ADEC1E946A886BF13122CE699D8F7 tyeece-beautifulcolors-brown
390,323,720 *274A05005BBE7A16870DC118E6A0367A8E386F26 TYLA.WALDON
390,323,721 *27465AE7C798896AE019BE1634103EB445D99724 WPONG123
390,323,722 *274B500D2EB2B2C0ED074AC43FF6E1D84C42E591 [email protected]
390,323,723 *27410F30538A68CE468EC7EE6D35FE072906BE47 ÚDSZ
390,323,724 *274DB2C3274AA4010E2EB9EE41B3223B92CA0E0B www.charlesmanson.i
390,323,725 *27411BDFDA4D3085D6739D1DDF6549B36F33AF54 WWWCONVERGENCECOM
390,323,726 *27445AA54599BE0169B8633A71294A7FA74C086D WWWDOXIERESCUECOM
390,323,727 *274732D88CB226E5A5E025A180FEEBA50C0B7455 wwwmosquitomaxcom
390,323,728 *2743815FA060B103707ACD52DB7C5DB28391AD20 un-accepted
390,323,729 *274115EF10A8E2762DE4B20172129843D629DCEA untwine the sisters three come, atropos, i say
390,323,730 *2748200AFC431FF86EB4A38497349D14DE805C26 UPPID
390,323,731 *274421201DB594349B40B330137742D684C49A69 XPARSEBSW2
390,323,732 *2744DF31EBE005702B5EFEF100ED6C19EF7E3D36 userdprokuserdirek
390,323,733 *27491C38F7ABE7F5AE0E64E309CF05B9B3956574 [email protected]
390,323,734 *27428BE7283A77F0E68291EE2C8CD23BDAFAD430 [email protected]
390,323,735 *2746E55B194653BD6C74E4250573B46E88AC8C27 USUFRUIRA1
390,323,736 *2748BDCD8AEFAD106D9B1E96A90C55328D3286EB YASIR.MALLICK
390,323,737 *274144EB04A5B4B87BC42921C7630B842B04C2C4 UWE GUTSCHOW
390,323,738 *274527216F78B6D6C14C0913B4F698FB299895ED VACADOSES
390,323,739 *274F0B93066C7E50D7F867A783724E28B3DF27BD VALIUSSRUOGA
390,323,740 *274F43777F921BD0F56639D965B74B03EE91F09B VAUGHN.RIZZI
390,323,741 *274ECDADB13A3FBE6394C64755A85E29CAB480B2 VEERAIAH.BANDLAMUDI
390,323,742 *2747D6B7643C7ACEA9FE962BC2EB2D26B82609DC VEMIRPSE5
390,323,743 *2740E8F3455CC97F5EA5BB395BE7D53C489FE4A6 “VENERE
390,323,744 *274FF77CFFEF69828858BD9E1D5D6981D9B13A61 ysrial.clunies.ross
390,323,745 *274BE2E7C39D42260A75C532135404EDE3E6EFD6 VERED-LIDANI
390,323,746 *2749B0B2639A79113230AC16AE0BA8B3B3667BD2 vernbabick
390,323,747 *27453D10FA02EA48FDF4003E076B971DE3FF3ABA YVONNERCAPORAL
390,323,748 *2743890EA72FB8F23CBA2F486362CD0D1551004A ZACHARIAHPARKMAN
390,323,749 *2743D20DEA5CD813C25CE10E2BA5951DB3DED1EB [email protected]
390,323,750 *274E85A15F2DF58B316AB5F82FDE6C42226837C8 ZACHARY-BURKHART
390,323,751 *274F8D757EAD7213637156C4B453F0081DD09259 VICTORIA.HORES
390,323,752 *274D0BE9A1C2060A68567EFC74806774AF7AD8EC vifg
390,323,753 *2745495857368763F277A9BE242ECC0655838D2E ZANE.FLUMMER
390,323,754 *2747E5D1C75C51A8AAF2195F9C0F22A4A36A5BE4 VIOLETTACIKES
390,323,755 *27429FE9360575DBD52F34D4AE6ED79A7839CD47 ZDQVYZWLS
390,323,756 *2747D8A99B6228D5216026E1524B7D812D497E75 VIRGILROJERO
390,323,757 *2746E50A1F0BEC0A239A2C9B61A22A1ADBF343D9 ZEVIUQSE8
390,323,758 *2745D536744CFF31181448BE8EB57BAB2E7E5571 [email protected]
390,323,759 *2747C032580D438919C22BA1F385389209662617 VIVIANAGOZA1
390,323,760 *2748267A3332428BF31A9A1BC0A22C2AB09AAE30 vivi-purdy
390,323,761 *27466416408AC77C0E7073E65B8DC695903EE824 vk7p
390,323,762 *274D6D55CF9EFA5702E2A2D56AC4B40B33827416 [email protected]
390,323,763 *27430A6A7042BD529A27CD8E00F4773C68BB65A2 VOGELTRED
390,323,764 *274CF345B089CE9120AD0883213C39D8F6EB76EB W140209
390,323,765 *27402DE086D46B6033BD8BC13AB24218336C16B8 W24749030
390,323,766 *27419557961F17B31E928CF06BA3ABD08B576E09 ZUSANNED
390,323,767 *27406FB7C601994A00510B2B6BBDD289B552596C wan-lee-cone
390,323,768 *274CA28242E634A93BA61F629F626A7588B278FE WARCRAFTMATRIX1
390,323,769 *2748911EDD93DC137686B322136E83A44237FC4F ΑΡΙΗΛ
390,323,770 *2745A0FDD65EAD9116319805F16219EB011BF369 WAVERAISE0
390,323,771 *274D287F980B786F64BDDC2F76276E36AA1AF1FE WAYNE DAVID AULD
390,323,772 *2744D32DF2DCA7C7B960F7F91AFC717D182B4FFA АКСМАНН
390,323,773 *274044291CACB3E0AEB3FB4E4F7D80E55F3B76FF WDOWNES
390,323,774 *274057C8F2643B89101DB2BF0EB040CB99CE5EDF weedily
390,323,775 *2740C47273D305708AAF245D628F34491022266E weiberpferd
390,323,776 *274EECC07185A042BE7BC77A3ADDA3785C7F5A87 [email protected]
390,323,777 *274410BD978B5CB9F5BC8F210343B45EE7C6366C WGS>
390,323,778 *2749D0C8B27D2DA4386179CBF9A31D31341CD0F4 ПРИРОДAТА
390,323,779 *274D2FBF5C8DBB2BF8057EFE86C1463944833215 WIKIPEDIANS.WETMAN
390,323,780 *27469007EE6AFF79586AB2895DA5FA2A94184616 «СКУМБРИЯ
390,323,781 *274256EB26E71FDD528DBCF360D2671B8AED7610 WILMER.TATSAPAUGH
390,323,782 *274E2D225CE95437D8BC33A8845FF0FE2407042B чульжан
390,323,783 *2745D8E5CA0E77CB4D0A87FEDC17386EF020E8E5 WITWATEREN
390,323,784 *274C138838055DE1DA161688B3915FF4607176FC wolfganghecht
390,323,785 *27491B2EA0CE6EA90BDE048CC67A3AB3156073EE worren.itto.worawat
390,323,786 *274D975B663390D0E95253171A490A0A7933A50D [email protected]
390,323,787 *274915A6E92577DEE0B1DD6AC2A10E1F5E3B322A WWWCOOPSAREOPENCOM
390,323,788 *274632B97D53D786BD63F0048A37656338AB514F WWWSPEEDTORRENT-BOARDCOM
390,323,789 *274B0A6D2EADC146E067649E021D8030A34AE190 wwwtechcomindiacom
390,323,790 *27418774CC0556CB7038F3A13B5FA596B13F3D47 X<-+
390,323,791 *274C18A46E1802F297A0C30AC0C4B35C552B26CC (X).~`.~`@====3
390,323,792 *27479DD3DA202B25222FAFD05871A55034AD2E76 xanthanolide
390,323,793 *274BD213AD7D3A7AA2E7C1BE4283878F85B1D8A1 xems
390,323,794 *274B174F5C845A8B48386697387B7442D432A2E6 の廃止により出演を終了したことから、2006年度のNHKへの出演者は村山、
390,323,795 *2746EF1E02CD4CD2B8BE06499DC26F33B06DD6FF [email protected]
390,323,796 *27495E915093114B61BADD8C3DC550D9D192066B ydrr
390,323,797 *274A3D1DB43E7970D5A6F08FA736396095188B11 [email protected]
390,323,798 *27437A0A538D5D7AE16A73606A7884F8660CB683 YNIRTAMA0
390,323,799 *2745F3AC1B55226F2830D585B86EB4CDF4724AFA YOĞURT
390,323,800 *274F20861C43AFE09105EAC8B8A1F3ACBFBF6F25 you the widow
390,323,801 *274BB19F8DCDE6E67694CABF4F84CC7CB0057A5D YUZHIKO.MICHI
390,323,802 *2740268E921E4CED53EF37691502118F10EB4945 Z149182
390,323,803 *27443433FC15928449F42BEC73BD694E050905A8 záměry
390,323,804 *2741B8A300A7A9EEB4B695A711C31883B8860F57 (ベース)現LO
390,323,805 *2745F82EE53CBB3389ED4226AA5B4FA78B796605 [email protected]
390,323,806 *274E1AC99AD56EEA6E17084A7A23AA510571C006 02242005
390,323,807 *27453DB165C71D2C10E50ACFCF80E8311641C442 zoeclark
390,323,808 *2749958AF19E4160DF66A6D0D46F00596B7B8E76 ZWAMPPMAWZES
390,323,809 *274700721C7F17F413CBCD95764968D0D13DE023 ZWIJNDES9
390,323,810 *27446AD1458FCEA579532838FA8E17CE0C5DE9C5 100G(無水物、20℃)
390,323,811 *274A3D1A8A481DEEE00EFC0D01DF1F824175FD0B драјдсел
390,323,812 *274FEA3C8BBA41FC4100B4B42670768F724E0F91 1217613 KONSERVOINTITY
390,323,813 *274C138865466ECFE5607075D56BDDBD692D0881 ПІДГОТОВАНОЇ
390,323,814 *27477EC3465A84A054FE84F4058C62E3FAED8B3E 12-andreij
390,323,815 *2745CAFC8B696D480AB234848C632D30F076CF79 рассея
390,323,816 *274EF4820085C3AAA2197E21985186F1270F4FBB 13.tgvzug
390,323,817 *274E7D47B1B228BE5A4D1B29BEC357E0A4F08864 хавалімани
390,323,818 *27484929211498FA26D6DA110BEB7FA7E132DEB4 18 mutfaklari
390,323,819 *274B2655274967C9E34C2BA55E1374C4BC6E8787 191antony
390,323,820 *2746014F64A6006D2D82408A4DD6FA7E0DFB6668 1963846 aluksiruokkijatarkistaaohjeetty
390,323,821 *27458F3F7E3D6180EE13A13098B5F8EBDD03D11F 1990-02-15: live, volume 2: raji's, hollywood, ca, usa
390,323,822 *27446D78BDB97608BD32E4561006A312D40F0D6A 1-ANAMYN
390,323,823 *2747049C9B632B7EAF9D47D65052F458F2101C87 1-ARTPEC
390,323,824 *2743334516EE8ACD7EB67944F75F9A96B9DD4F9C 1 bruundinocasagrande
390,323,825 *274B8102365C22B66F85DFFEA0D2069FF092DF9D 1.evansi-br
390,323,826 *27458163455BA8B095085EA3FB58D1B34067816A 1hausschwester
390,323,827 *274C4C703DC44DB88B985B07530D2ABA366AB9B6 1 icmimarlari
390,323,828 *27406B28422C3A0E6C4E9797FE6C446F8E5B0737 1 INTELMAAILMAN
390,323,829 *2740383C4F1E1EDC908ADF7CC57BAB927EE15AD5 1 MOROVINO
390,323,830 *27473B48311A4C8075696B773774A80B7FB0D4D9 1.MUELLGERECHTIGKEIT
390,323,831 *274BB24D8E18196B434F8639B4215D174E3E0AC5 @[email protected]
390,323,832 *2741AD97AAC4C02ACEC25E4855F4B73CB8BB71F0 1schweine-demonstration
390,323,833 *274897EC6CFB0F7F30A69D7FDAF8921C9DF65D30 1-SOCIAL-RACIAL
390,323,834 *274A372E0478979CC0F03406F19CDD0F887A6EE4 1wahlunlust
390,323,835 *274AA3F2E2E373A61F9436220675532110206976 2054948 sein.alter.frontinstinkt.blieb.dem.exgeneral.erhalten..
390,323,836 *2748F14DA89DD609C1F68AE3D35EA5711D1CB5E9 2058691 se.osa.kehoa.,.joka.ei.ole.kiinte
390,323,837 *2743D86E3A69E65B0237E7A0A7F06577F478C36F 20-eson
390,323,838 *274071B88175BB61C82AC4C1099C8ED7CD2428F8 2232705 kaavoituksen-vireilletulovaiheessa-j
390,323,839 *27483DFDB40CBFEAB768F765BE43A0E25FC9F826 2317424 SE-PALJASTUI-VASTA-RUUMIINAVAUKSESSA-"-
390,323,840 *2746D32CD94616F26A59A52C82995B56F573250A 24071213
390,323,841 *274CEAEFBA46C835E93DD63DAE4D794461085115 2c1b9f
390,323,842 *2747BCD007B41F299D4F1DCDC3F5EF50F299ACAE 2DULZAINO
390,323,843 *274B32E2B3CFE8FE0D2B55FA885C75735350E76B 08.07.1589
390,323,844 *274F8F0D835DB2E3680C65947136FCAA2636E75D 1051617 MRWEGBREITDIDN'TRETURNPHONECALLS
390,323,845 *274CE01CACF6730777181314AD25F4613E80AD90 300トンのヘリコプター搭載大型護衛艦(dlh)として計画された。後に経済的、政治的理由から縮小が図られ、8
390,323,846 *274C06DBC8A7AC09EDA331222B778014B50BFC69 118-konmustur
390,323,847 *27453F2E5F75C0DD1378395EEAE30A0D4DDA4ECC 374905 hyv
390,323,848 *274188DDA92B32A6D74749E0F23B6CC4AB6686E6 3-ajatkaan
390,323,849 *274560562F603993C99CF0FD14B1055B75CAE6A7 1267456 pelimuistuttaahiemankoripalloa,muttas
390,323,850 *27450251A934BC06882D7EE0910C0BDB100B4624 3D ~0~O (^_~)
390,323,851 *274BB52CAEBBEB16D8D4A7ED183B193103DEF736 15APRIL1147
390,323,852 *2742C896D7B8197210A287E87743380FA9411D21 3P.~0.~O.}O{
390,323,853 *274DF01D2523C10E87F4E4CCA313EA62084DCF07 3 PROSESSIVESI
390,323,854 *274148CCDCA5263904341E43ED1D54E4B247CE04 3.sepp
390,323,855 *274D2CD689D980C87F13C05236A838A6227B542D 44duosfortwoviolins:no.33harvestsong
390,323,856 *274CAEB7BB80DAFAAA3A8710B9C81B39F29BEEEE 465449 LICHTKARZ-IN-MAICHINGEN-MIT-AUTORENLESUNGEN-.
390,323,857 *27458C074D24185398574C774A593C36415955B1 19051724
390,323,858 *274D68C28587ACC26703F05D56A0E02B912849AF 4IMBASTARDIVA
390,323,859 *274C33948421366440478CC87C7CAE972ECB3B93 1986939 joka.toinen.vko.!
390,323,860 *2747B42DCE9101D03BF5DEEB03269150B0136472 4mymatthew7
390,323,861 *274297FAC5E15FAB6CFC7168D10363D722919BCA 1 ANLAGENGROESSE
390,323,862 *274091ED86C0F926D3C68D4D07D660223852ECB7 4PN3U5T1C
390,323,863 *274F74923A9CD0C1A812CDA5208D3A6456B4123B 1bahnhofs-viertel
390,323,864 *274FE7F86F766708C95DE5459A03BA1A5891FD8B 1.BAMBERG-SEURAAN
390,323,865 *274F4B7A08B810A74943D91232A4B579CB5CA0B2 4RETAPERETAPE
390,323,866 *274BB1D85B25232D38B8E1DB9C0FCD36159224A1 4RUMORING
390,323,867 *274190F93349E14797C3975AB74E7F2F7634C53D 1CELEBRITYPREFERABLY
390,323,868 *2743B0FED17886C791CA2BB252CA8B347D4A00BE 4THESUPRA2
390,323,869 *274C989920A5BD848B83C7E7A8F4D09E25F2F62A 4YKSITYISKOTIEN
390,323,870 *2741702E1A3F253A533EC61D26471BB1A3C00F74 1 EU-GEPLAGTEN
390,323,871 *274F657B37A14A02BFC7D12A235DA7CD4433CDA4 1EXARARE
390,323,872 *2747FFD79C7E6423034F56CCEBA3D1D8B9A4CDD1 556213 HE-SUCCEEDS-REEVES-LEWENTHAL-,-WHO-DIED-IN-APRIL-
390,323,873 *2748AD01A2EB1FDF76F7436E9B4ECFE96A619F83 559661 kilpailuneuvoston p
390,323,874 *27432D82478E4A32FE87E25A0388D3210928CC9F 57001E
390,323,875 *2743A40A0B733C9AA7B9602DAF280211D28607D5 5ABIGAILNONE
390,323,876 *274039C43B6A8B406E008294D6E4A0C881143FBE 5ALLISONLETTER
390,323,877 *274B9798EAD8A6BFAE46D9A48ED0938E465179B2 1 HALLITUSENEMMIST
390,323,878 *274081DA6FED61B5F203AF0A7D498721EEC4E869 5BRANDIJOSH
390,323,879 *274FE49A88DF35A43694A171B415C56CCDC98A37 1 ILMOITTAMASTANI
390,323,880 *2743CD6A9439243AE3A1143E8929B093887F0F8C 5DENNISQUALITY
390,323,881 *2743584F541192DA0BA7C23DF0C1FAE01B263E93 5ETATTEPS
390,323,882 *274BC17D98580F0C9DED82524FE5E4F24A4E6243 5IHUPCUVYZMXL2
390,323,883 *274FAAB7507CE1A754C015BFCA8B36E9E872E484 5MACHIELA
390,323,884 *2748AF9E61D8B72C79F39E34BC97B685492CDB7C 1 MARECAK
390,323,885 *27428CE2A9E6468D28C09610A1F0B5CFCA113360 5P3F1CY
390,323,886 *2740CE92893F4DB0D7905A2148CEF825E00B1066 5PARISFLOWERS
390,323,887 *274F1A29E529095C2F2985D676F7A36BB7ECEEB1 1Q2W35808
390,323,888 *27464D7970202D4BF877179D64826CD9DB661DBB 1 RESERVEAUFGABENSATZ
390,323,889 *27412D09D5E61D6ABF0AB092B57F62B14FBB5150 5VEVINEVEVINE
390,323,890 *274BDDBBED12F66D1351B01CCF08DCD1289589F7 1 roemerbergkonzerts
390,323,891 *274E0607D09EC207EA7A20295AE7A5320F5C0BAA 1 SAKAKURA
390,323,892 *274C512028A2C4A56112BC99BE946F22B3220CBD 615344 subat2001bulteniicintiklayiniz
390,323,893 *2740DED0934233D91A7041E70C8F83983CE06309 1 STATUS-QUO-BEWAHRUNG
390,323,894 *274D4DAAF3438A8044F5783DC88691C96069C6E6 1TAALZUIVERAARS
390,323,895 *274477112402ED4E56852E7FB0608C55898317BF 1-TRAVELWELL
390,323,896 *274EA5B381490E7404670CEB43C423D02D20DABC 1.universitaetslektorin
390,323,897 *27433377B1300976B0E11D1175FB07DD79B45AAC 1-us-hobbybrauer
390,323,898 *274802A1D44EF6A8868FD3990D1E6135B457FDA4 1 VANHAFRANKFURTILAISEEN
390,323,899 *274F1C47D7E9DFD5EFCAB67265CFAE13DFD00AB9 1-VIRTUOSITYSS
390,323,900 *274E8E733FEB62C1DCB51F5C10AB8566EE775082 が1つ回っていることが知られている。COROT計画の中で
390,323,901 *274BDE02D22BE9C016B03D79337E0AD847C02BA0 20CEASER
390,323,902 *2745DE0FCDE16E8886B8EFE8BB8696A765FC5B1A 6.PANOSTUKSESTA
390,323,903 *27448070928FCA7FBFD5797647E9384D2CF3ACF0 6PAULAFIRE
390,323,904 *27401938352FAF593CCDD9D47C61621436618425 6SCHEIDEW
390,323,905 *2748DBFFA6E5B9CC77C5B11BE34A97FF43272786 2369ppc:16kw1v.9ahwzy
390,323,906 *274E0BF7B7E0493ABC922C84BCFD758BAED2A9CD 6SWEETYABBY
390,323,907 *2740E9933DFC1E20D08BF635FB1443C75D37891E 6TNEMENNOITNEVNOC
390,323,908 *2746EC780C7A5FF5882496A0635CA907A11386E8 2463289 parisuhde.toimii.hyvin.useimpien.mielest
390,323,909 *2745122CE0C9ACAB59C9DD528615C03776D5A6B7 6ZASTARIJEVANJA
390,323,910 *274FD51336798BFB23B5D623EFEC377A7E375C1B 707trenton
390,323,911 *274E1FB028C5EB7C025042DE1BB36E63D11B2ABA 745829 no:39/a5121388157serapacarernIlkayacancad
390,323,912 *27420A154F10DB8E3F3A9E279BDB983D9781F7CC 746000 UYE-OLUNUZ-SORF-YAPINIZ-
390,323,913 *274DB591A4EB279DF68BAADB430AD01FA0DA3FC4 2825998 HUNDREDSOFHOMESWEREDESTROYEDBYARSONISTS
390,323,914 *274E724A575E543D24A8D138C360D7220210D0E7 2.big-state
390,323,915 *27454B67EED09E52D58E1E52D3B3641F8CEC77ED 2f6309bad921
390,323,916 *274376DBFE5C389FDA4188FE012D1F32090F71E0 7MCGLADDERY
390,323,917 *274D44EBA36CAA3EF0CFAE6C7B3AFF1B04EDC3A4 7MILESAPOLLO
390,323,918 *2744A0E3184F490486C523E8604091A8EDFC1113 7ROSAROTER
390,323,919 *2747D6046FF16216928D62F17966B718958C7EA5 2Z2THNFW
390,323,920 *27409D45D8A882135C06FB42BB944D4B45145EFA 7TNEMLLAR
390,323,921 *27422F86F27B0AECA098A26AF81670A690FB42D5 31futro1
390,323,922 *274711EC2905F48A7E0929CD4AE8F8A8ECBF3153 3b ~ ~(o_)
390,323,923 *274424D7157D138589336FEFE474E68919C6865B 3B<.*.*.*.qB
390,323,924 *27417CE9D432D55F8B7A77665668EAD301FC2A91 83DF683C-C080-3CE6-AE40-23AD417408FD
390,323,925 *2745588FF6627CB1E95A8FCB77A2EC9B3369FD05 860753 KOULUTUS.DI.,.TKK.,.LVITEKNIIKKA.,.L
390,323,926 *274FE638E199A97446729AD32E1454E2FA85A592 878kaylah
390,323,927 *27468E87108744F0CF322CFA47DD3CF7FEABF783 8BSWBRABCHES
390,323,928 *2741CBED62BBFF952E20C90D5D11F6AB3ECEF4BE 3JURAVICH
390,323,929 *2740CEDBA12B74EE6D421B0A4B790EEE54B0D7D4 3MICROEXA
390,323,930 *2746F92199019D468B4A77D3330832F51694BE14 8DATOPARKERINGERNE
390,323,931 *274462D846BC34E3E01655D439FC78019AD98C68 8HAZELRUNNER
390,323,932 *274A4B0FACC71BDC9A757E4ED40CB8D305BB225B 3SWITCHCO
390,323,933 *274A138CB15B5078546CC9A278A003A7449D7FE7 3$TINGU3R$I
390,323,934 *274BCBDADA3BEAC9BF9A0F52D11B828E2B5580DF 8MENINGOMYELORRHAPHIES
390,323,935 *274E04D86D826E3210C385CADEE22F62164DE7C0 467014 OPISKELIJAN-TULEE-SEURATA-KURSSIKERTYM
390,323,936 *274ADE7FF0775C86760CE8F22D774EC4B3FC051D 47-flaccid
390,323,937 *274F2925F9D679B24606D5CB0D726F7DF8A37C57 8SAMMIEHOLLY
390,323,938 *274ABDC8212077C10E23418B3E39C3877DCAAE3B 8STEVERFUN
390,323,939 *274AFBA4F72FE67041F6BC0073B85750413D5D1B 8SUNBIRDJAPAN
390,323,940 *2748A590F8D4CA2952668368225CEFFA2A1AC901 4FREMFRE
390,323,941 *274F654FC8F7761AF2F636D40C7C6D8A39CE0B7F 8THATROGER8
390,323,942 *27456F1F552F04954A5DD8C1EC895C19508F3515 9DARYLEDARYLE
390,323,943 *274148447588CD40BD4144A7F81CF442B9EF6241 4SUBPARAMETERS
390,323,944 *274C7E04EC421BB74A05652B752E17B5AB21BDE4 9FILMFOTO
390,323,945 *274D95EDB141E77DD3D973D78B1BF6FA877AABE7 9FYRLAMINATS
390,323,946 *274F9A39E5D4217E83969E5FE4807E0200D7ADA4 4WHRMMUPKQRTTRT
390,323,947 *2743D3D13CA022E1F3955E3FBD5676A38BC5B65E 50417 ESITYS-PERUSTUU-TY
390,323,948 *274AFEEABBDF91CDCF02F483F7BBDE44525E2E66 9MYSTERIOSOPHY
390,323,949 *27483480F3E68DE92A3A3FAEEDD2C5E9ADD1A9F7 9ONLANDENS
390,323,950 *27484864217BF17FC77069AA284F495FE30F69AD 9PROSALITERATUUR
390,323,951 *2740FA0F09E60C76E7EC97D9FE7D4374D00EE13C 58ZORRO1
390,323,952 *274C98EABFE9CA46016CB41ED048DC535D7AE870 5ARCRIDE
390,323,953 *2743DCBDA85B5C9F7C3F63B5EEF2A4BD98150587 9YOUNGMINOU
390,323,954 *274B7683557E1A734A10605FD3DA5A4C496344A3 5EXONERIE
390,323,955 *2748B5CF74717E059FAC2E4AF3DBFD34241D0E8C 5iluvtexas5
390,323,956 *274B6B76B3D644D53AF8A9A79EA1A6EDD48F8575 A2Ee
390,323,957 *27410028BB13E408A02295400B8044AB7A430A84 5OPGEDWARRELD
390,323,958 *274F5B3AD670EED5795962566102B05FD2C9E700 A50?P
390,323,959 *274DB61B5795D4A50CFE3B6F7D0D189481118C06 5RICHARDREDRUM
390,323,960 *27495B5C0FA10647E0911539002C2BBD567E18C9 a&a;,
390,323,961 *27474B3C92F0B2428BEDCFC1BF933614A8125B87 a?ab;
390,323,962 *27410E4297A5694964AE574C025FF7371DE902A5 aaeb_c
390,323,963 *274DCFE82E329BF1EB228DC2FC3F345B251C0EEA ĸ­Å‡º
390,323,964 *27429C908276BCA3DDF239D6E99D595D6D052D0A 6847034B1E1F696200D6613EFB2D26F8-VW_GOLF
390,323,965 *2740F08777C9AE9438D35485273CF7B7C1207A15 AARON.KREAMER
390,323,966 *27441E671F2034DFF293AD06269D5DF391BD04B2 AARON SLIGH
390,323,967 *2743187FDB95AA814D6577160A4F528C72D62CEF AA+-W
390,323,968 *2741D8D29E3862A03FFFECF11014E766E8C93959 ABBYNEWCOURT
390,323,969 *2743E439A33A67296ABA35E4EB7B5D234090C556 6DESAFIA
390,323,970 *274EEC1791B6DF87238C7BD3CCD82B114F2FADA9 ABITURER6
390,323,971 *27490ED120707B981FDE47407270707CAB9000CE AC##S
390,323,972 *274A644A267170772AC0B6F3E76A79494025D478 ADAM.PORT
390,323,973 *274E85DB780399B8DA068C0052320CCA830020FC 771jaelynn
390,323,974 *274978376E06D93A8387F1F414BFF23E7B21FBC6 7AUFNAHMEANTR
390,323,975 *274AF6B3BDC053C4C15932CF369FB118D94389F4 7BAUMHOEHLEN
390,323,976 *2749898B3AE9AF6975CA58B87D6A3F0CE6D756CD 7BRAVESADAM
390,323,977 *274A8B492E4351E47E2162475BBF7A983D72DD56 adgjerry
390,323,978 *27485B8BDB9B5022B93AF284A5B38D41F306BFB3 7HELLOTORONTO
390,323,979 *274DA16588A6743DCA6B67DF9240A87E8719E7AE ADUL`
390,323,980 *274C80F16812471E5614CB389188663AD116294B 7OMIGNOLO
390,323,981 *274EE020E92CF94063652C0B429B00F77799D836 A.FINAL.PRAYER.2
390,323,982 *2749139B8FA78FCFCDDBB905E3F7D5CC09700D5F 7TARLEYMIKE
390,323,983 *27490A9737C4C7F91DDFCEC11A8C40F908F53E06 7THATH2OPOLO4
390,323,984 *27466CA06B6FD81A47FE3501F55A336415A06F7C 7VOITERAS
390,323,985 *2749A833A4DB88B71BFDB085AC9B15BBBEE0819D ahmed.qureshi
390,323,986 *27498D997C3576EBB4015813F255E1ACB8F0A7E0 airtemon7
390,323,987 *2745DDF1DD3CBB2FFDAF83A61BA9B7006B5FDEC3 aj(o-
390,323,988 *274E277CB08E86D9A9C9B113CA956EBF5D499964 8LRUUDROB
390,323,989 *274B28627150587B73B7E6819F07AA5206DA5206 alandeoliveira
390,323,990 *27464344C48618EDE073A12C9DCB5B7592F81642 8p ~0 ~o (00)
390,323,991 *274BC886621CB46F9811809605B587B1243295CD 8RECIPROCALORMUTUALRELATION
390,323,992 *2749D5C38C51B6F6F439E09F8E8E44DA0D942FB0 8SADHUISM
390,323,993 *2744C9EC4E26ED7D825AE6331295CAF507BFC0C9 8SALUBRIOUSLYV
390,323,994 *27425C5CC16D374391EFA072226891C975D5F2A1 ALEXIS071501
390,323,995 *27479E1FA2FBD92A1A0BB44BC42FDBBD7AA19467 [email protected]~.~.~UU
390,323,996 *2742F208586F655E763AE72A9527A0259B0D53CF 8YLLACITAMMARG
390,323,997 *2749E0FD0CF26036D0A4A573AD2AA77D7118395F ALIHAKEY
390,323,998 *274BC408926B7F8E2F48663A61F3CADB4973EE8D 93334x
390,323,999 *274FCBCA3DD26CD5CEBAE50D80C82A415AC4451C allenbarakat
390,324,000 *2745501EFCE9CDCE05EF79537DA8785FB50E9B2F ALLSTATE
390,324,001 *2740440F6AF2BED2FC6937E180CD06A9FB19073F alphonsevanwyhe
390,324,002 *274BC945EA6DC2EB5DEC9C308C6146FA0375F46A ALPHONSOARTHURS
390,324,003 *27454A65468C989E90DB5A83DD99D7B4211F8E96 9BLOEDINGS
390,324,004 *2744576F2DBC503BDAB40C21C7D4317CDD23AFD1 9BSWACTIVECOLORBS
390,324,005 *274BA0F03F26DABC274CE3AF0FD5324FDA96CC6C [email protected]
390,324,006 *27476A9F2A39B5FFB197F9B47F7B8D4634276A3A AMERULA6
390,324,007 *27462B7ED79CB7FAFBDE470C90393F398CEA4D62 amxf
390,324,008 *27420DB425E804F5B1E5E4BBD4D6F027842D7F2B ANGUAÑO
390,324,009 *274E531E54D356331BCCA5E9BC0ED33D25882240 [email protected]
390,324,010 *2744DF205BB16DEE3262CCD3CF4555EDF359FED9 [email protected]
390,324,011 *274E6ED8743AB5FA7721FD54ACD13690CAF515B8 9NIUKKOIN
390,324,012 *2742ACC9501F1FB6F7E80760257B2CDC9440094F 9RDENBAUTEN
390,324,013 *2740479797DACABFD0EF089CC674FE079FF63ACD 9SKIINGNEWS
390,324,014 *2746CAEC0F2C3411315DD7FA897CD5F0508B7B85 ANTONE.GRUDA
390,324,015 *2746B3A07E52BDC31423398600250261ECAA9EAD ANZAS.DE.DON.JUAN
390,324,016 *2746046152C95CEB53CDF1E194EA2388920FFDAD A#OD
390,324,017 *27415E633DBE1540183B9CB1B820CB4D632FF2DB APPAVAMOS
390,324,018 *274C9672FFD65E72F421D3C1E286ABB6ABD7AC93 A(Q(N
390,324,019 *27459A680FE5A69A1151A4269131E2F988788A7C ARNETTAWILSON
390,324,020 *274E0CD9C7B69AFFB5BBD1145E40662EF4FC5C75 ATBAK
390,324,021 *27434A8408314887E88DEB4CE310B5B04678834D a_v8m
390,324,022 *274B3A8B8787799BC7E15ACD19610A4CD9DDAD34 AWK63
390,324,023 *2747F06141F7D4D74E95CB5C263DD3C9EBB9521A A$CERTA1NED
390,324,024 *274A214BBC8D518D8E3FCB12E3151140D3A59285 adin$
390,324,025 *2740DD5E2720C1B09633679D9F172051C1DCFF7C >-B0 ~ D###B
390,324,026 *2741EE2A825E6AC57EE14D242ECB8D765CC29C91 b0mdi
390,324,027 *274208D5BB8DA9DDEB1DC8D595D0BA2958BF2742 a:gvf
390,324,028 *2741A3BBEE14835D44A0D4D7DD59BFAF132940E9 B-8LO
390,324,029 *27421865F336394EEB0DDEE0C97616D44925AA1A aincriez9
390,324,030 *274B81F5B3492DCE4AB5841A4277CCA0DCE0A700 AIRBANAS 3
390,324,031 *274ED536F11104CAB8E5312ADC133EA892F12C9F ak&+a
390,324,032 *2743C3A474AB490D9053910D677D021AC1DC81B4 bb~.~.~3b<
390,324,033 *27490DA4D4034D409E3579310D6D47FE57FA0A6B aleah897
390,324,034 *27457C31909042DF871B629D76AD0B8A1625BF14 ALFONSO.MORET
390,324,035 *27421BDD3ECC188B4C9F925F06F846C16E19A166 ALFONZO.CHALFIN
390,324,036 *274089B7F9C200BC78B6BD837E13E9DE6DF08A9D alfredolarmore
390,324,037 *2748D54C6D2BC3B6E35F0D7306A36DAD856C1F9E [email protected]
390,324,038 *27455437F5039B49C63A7EB8C98991960FBF6713 be2x
390,324,039 *274663C9758D6E2A924C35BE26F0CA6CF3C2FDCC benitosteinburg
390,324,040 *274787ECA3E6ED45B6ABD127CC9C5AD1C76201B8 alsul
390,324,041 *2748DED36B61201B8F77F48EF3B31C6EBA202402 Bh_X
390,324,042 *274F608EECC6233742982B57595C585FB7167560 A%_MG
390,324,043 *2740CA2F8B95D1C932D6939FEE120DA37C41F6A8 AN#:
390,324,044 *27467E522DAFEABCEF102ACCA949FED907E9595E b::(k
390,324,045 *27403DC7520D2ACB338B1105691EFFB26DCB5013 ANDRESBYRNE
390,324,046 *2742B3647AAE2FC15EDC49A4BD2527ED434E5ADA andrewmerritt1
390,324,047 *274D424686F5E6CF20E6F12AFF835A5CC84D7EE9 ANGELINEALCANTARA
390,324,048 *274E188674ABDA9F396F4356D42546F595133FCE BOBTINING
390,324,049 *274E0BB33E0229BBA98D02FBFBDAD6C6D8519A10 BOF;M
390,324,050 *274BB833FE705BFC05D389E606F7167078DFCF81 ANTONYCARIDEO
390,324,051 *274F5C0F51BFCCA75F09DF26BBBFEEC320279331 BOLTED-IN
390,324,052 *274875BD4E2142B48151E37741D1EDA40947CE96 aqhs-
390,324,053 *2747672A17DE6268FF90CCE71A4E65A5D23072C6 Arraignments
390,324,054 *274F3842DC8053BB58D09F327E74E3E5C7A3C3F7 [email protected]
390,324,055 *2749BB15C379B85DA42C53A5AD198E090300A164 brianmaline
390,324,056 *2741AE2DD81EC7E2D98C8ADF62EE60D073604141 bringmehome
390,324,057 *2747D67AFA24EC2A5A8A11E18621B513BF2206CB ASCI2BBS
390,324,058 *2744DE9C9A91F040A335730E68E15FB1760519A0 asela.sandaruwan
390,324,059 *27489D261F9FAE96D438D61BE56CB8271DC15816 BRNQ:
390,324,060 *27463C89678A2B00BA372DB2CC655AB74C43F654 ASK0R
390,324,061 *274BA348C1B3E8917F5E18AEC2F8DF4BC5B8E206 [email protected]
390,324,062 *274CED17572C6B4A110539C12EB33BE3F321BE7B bswnoitacov
390,324,063 *27438DA26356465751D6281ECCAC3BE765EEAE96 BT.P+
390,324,064 *2748D4B2CD0E9524770DB3A28A8E70AA70165E43 auo4d
390,324,065 *2742767702FB40C8089F45DD10BF7A4BA0022B8B av\
390,324,066 *274F03ADB8270189C18BE4E3E88663FEEE6C927A AWAF?
390,324,067 *274B18A7E869104279BDB2BD613833AAB4E49892 b=zy
390,324,068 *27429A376E7CBBBFD73F4EE4B856B933614534B2 B6FSZ
390,324,069 *2745C9644DBC15F49335B587BCD383C73B27F52F cameronnwagbara
390,324,070 *274E89363C89E4E47A38C82FD76DEDE4F99B6B7C cand1epn
390,324,071 *274316214E9F758729FD5ADFD0986012F4B9768D CARLSLOWN
390,324,072 *2741866EF433E953BB5F4C4A48EB8EE7EBED3345 CARLTON.HOWDYSHELL
390,324,073 *27470A47056AC36225314FFF5C791E34569AD576 barrettwarsaw
390,324,074 *274BD64CE44D26DB936B161D3CADF5DDAAB03FFE carminemieloszyk
390,324,075 *2742631F13131FBE2F2360F4D919AB6E074E6A69 BARRY.ESTY
390,324,076 *2747BE6062D56044CAC8CCF850C4C62C9B599DD9 baseball89
390,324,077 *27449787494E393CE6F00F1CF7E812F024BCF27B BENITOGODSHALL
390,324,078 *27438DCB4F56BDEAED8BA52C19A78FC417FB81A5 benmika
390,324,079 *2747AF78EBCCC7558C127DF90F1554F883D5D6B2 C?ESP
390,324,080 *2747F937D3236F3AF402C52E195ECC1166E09EFB "(CH
390,324,081 *27448B5B551062B8590232E69D4532A4FDE2B8E6 CHAMPSIA9
390,324,082 *27429129D7935B3AD47B6D22CB1697A38A0F32CE betacode
390,324,083 *274DC50DF0AC71F1018E8081A34078C238F06932 BETHLIGHTCAP1
390,324,084 *274A056CF76CD8CB8E24D60CC06228A9F1973DA1 charlotte-broome
390,324,085 *27475EC14E02BFA0C2A8257F6CA7CFDD024A74E7 CHASPINNEO
390,324,086 *274DDA1833B79E5C39C2D16E39839506F1223935 CHAUFFREY
390,324,087 *274201FDA17BEF92B7E543BD0FD2E723740380A8 che#s
390,324,088 *27419089C95B898D8BBE7F32795C0D3EA39078A1 BILLIVERS
390,324,089 *2740082E62E929EAC335EA7CE83D7CE03E1F56AD Ci==
390,324,090 *27426E8D0421F08673F35237C3AB4F8EB757EA28 C%J"I
390,324,091 *27482CA6E49A9B60CC1DB3F205E11F4903B48791 BLOO
390,324,092 *27405DA8A82F0A6B80B2B15A8CCB26DCA648CE17 BOBMEALS
390,324,093 *27448F086C5C34D106FF6C9726EBB12046A7419C BOBURST
390,324,094 *274D849CF149409B9C6E0483528B4073A8CC6553 CODYROBERTA
390,324,095 *27443AB38987293A25ACFD2BD701E3289D415EDD col0,
390,324,096 *274886B70EF46765A1DE0959CFC3D87D59FD79E3 BOYTOUCH
390,324,097 *2749CB692FDE1E5DE7EE71314BC53BA1E41E322C BP7+D
390,324,098 *274E4A9FC7849B2F197B527A03ABF7817F8E39EE brock378
390,324,099 *2748D660496B11A8068A37DD04B04F8A07DBE400 BSWWANDSCHNEIDER
390,324,100 *2746ECEA17A0556A901783FE5A845467FCF1003F b+t4
390,324,101 *2748F59D2A04FC0948A7364A587540A8EE46BA06 [email protected]
390,324,102 *27436AA7C7E9A93439218692F39970CEF3F9F8A3 buttonwoodbeachcombuttonwoodbeach
390,324,103 *2743DA9BE7B9115ED035E0D0600359A0D47FCE42 CRUZ.MCMURDIE
390,324,104 *27406AD1F161438308C42CC0AA09A540313AFF0C bv;+:
390,324,105 *2742B85C4F82DEF86DAE0B129CF9F5D246CA71ED bxmth
390,324,106 *274BAC48AD9644948BAE9E96A5B0ED3066007444 CU$ST
390,324,107 *2747E3054CFF151F793474FCE9F9350E152C4FBE BZNJ
390,324,108 *274E253E559C570FFE803EC51D696E025E7F36AF c3ah
390,324,109 *274A08087A6CF9A034DD6EAB13E34502F29C7492 c81.8
390,324,110 *274192F9D381377B3E538998DD7586B5D771AA37 c8p+w
390,324,111 *2747F43431195795F097E5F41F58B5BFEC9753B3 CALYCELLA5
390,324,112 *2748F5A2747CDE21EEED563DA58ECC4457362E44 CAMERONBANIK
390,324,113 *2746831662B90300162C86C5D299A9E33FD3FA6D cameronfabel
390,324,114 *274C064A8E51ACEAEAD749D186FABEE49278E06C canjilon.
390,324,115 *274DFBBA257BBED6ABE5D28D182452A912C9B791 CAREY.HAUSLER
390,324,116 *27497E73275665B57BF769C19C264814717D1D6F cariberne
390,324,117 *27472ED122384993A304EF8B4A500D48A6B4CFBC carlbushweller
390,324,118 *274005F8AA2E8D2AC47939B000B388DCD752F5FF d6a/
390,324,119 *2747A5D633BCA8371893FAC1CAD0CC7760E65226 d,8ml
390,324,120 *274A08326401C009A9078D4B41E18E6F1EAAEBF3 d9ee%
390,324,121 *274743D688CE4634F85E2F2EB48ABD2856AE74A8 damianzable
390,324,122 *274E6A55887B1F22401FA7F441BFFA333DD7D0D8 DancingwithmyDemons(BoonRMX)
390,324,123 *2744FC393572B55921963DB6D8AFF01BD6D11406 darnellchambless
390,324,124 *27475ED7213E294BD26789547BF88B0A2B3F5150 darnix
390,324,125 *274F150AD73BD71596B1127A18BA858821C73770 CECILIABENAVIDES
390,324,126 *2749C6C5233197488D9CE134EA92EB3A498AE00F DARRYLDENOFRIO
390,324,127 *2740ABD710EDC34840573A8DAFFAB86F739A5AC9 DARWIN.NOFFSINGER
390,324,128 *274EFC2F2ABD73342DD59054AFB5738B81EC0804 DAUGAVPILS.
390,324,129 *2745ACA9660F6F018859674AF1F0384F9B019BC3 c"(go
390,324,130 *274A69A19C3C3D00818D2886B52456D827A59996 charleyahlberg
390,324,131 *27434B92C693279E057656CFA02091D5ED4E857B [email protected]
390,324,132 *2744F7291D278A2B34FD5ABFC147EBD6919AA4A7 DEEP STRUCTURE
390,324,133 *2749E2AD9390269CEDF2E839FEEBE55814E8C444 dehenda0
390,324,134 *27497C42021DAEA96EBC51B4E3CF5AD826F83ABB [email protected]
390,324,135 *274856CEF720E2D30FDD8B50BABB1CF39E6E269A DEONZEMJANIS
390,324,136 *274AF8DF1032B0E40871D39BCF0F0165D5D18D11 DERRICKRENSINK
390,324,137 *2745ACD5BE1E3FF90A8873228EDA3163AC1532E1 CHRISTOPHEREILERS
390,324,138 *274043D34FF9C50FB04658EC3D797D3FC386ADE7 DESRUC1B1E
390,324,139 *2749B0466706A56E4394A977D25832B69E7C6F26 detalle.en.falso
390,324,140 *27416EF2914886F7DAB4C68D1E4924653B8AD68C CISLAND5
390,324,141 *27482B053AA34663459AAD952B5C5EF843A7F51B C\~K
390,324,142 *2742E7049794FD95BB3B18B875448C493C77A35F DHELSING%[email protected]
390,324,143 *274D2FFE6ACE2D2A6EB37C881310CDFB6AFD040E DHUINS
390,324,144 *27458FD3859F90FC51868EBEDE23597E82F56AB5 diastatic6
390,324,145 *274660DDDC95C8A9CEFBC01B69CF04B29E1F2145 [email protected]
390,324,146 *2747A3BFD37EA49B1605CED76A77EE905B0C7ABD COBCK
390,324,147 *274002A0706536A6B8031D4309B23429BD789089 colinalfred
390,324,148 *274274C3A4CE7127D1A168F1B49873AA84CB1625 COLINBURAS
390,324,149 *2745075C377073114359E00E342BA7875BE7D202 dl1/)
390,324,150 *2746F0FF6D24438CDE472F834F2E9B7566EFA823 DLH4=
390,324,151 *274E949D506F0AF5F7EF7A27A0F353E8BF08D254 copertinahp
390,324,152 *274EC34C53665366BE3E25998120E08A5FAA3B78 DONALDSAINDON
390,324,153 *274395355A404C2B2010A5C2D7BA8ED42CAA7169 CORTEZMCNEECE
390,324,154 *274EE843FDCF0BF47A363B79D7F97C0633744EEF cos?o
390,324,155 *2741611D0E9E8C6400AE002C98A5D6B5CA13ED75 CQDDC
390,324,156 *2744F20C539F306E262BAFCA8FD4FAB46E9AE64B dortx
390,324,157 *2746F82708D71CA7E71E09C2667A94B8B07958A9 crazyfish69
390,324,158 *2743F9E010B9D3BAE9B2A9F8A424A3970BAAD603 CRISTOPHERALLYNE
390,324,159 *274E724C7B8E7332FAA99E6B722AD483886191E7 CS+2
390,324,160 *274434BC002F0C227E4E5346E60C37AF21258E14 CTHU&
390,324,161 *274BE111483448E00B0E3CD3DA3F4137B4AF7C12 cz7a
390,324,162 *274E9B0E80585F2C76228452D6020C4A04A29BA1 D0A8
390,324,163 *274CEE7A9F6236903B25C7C181C061B2F24243F0 d2zy
390,324,164 *274AFD16D447828D61C1882023115DA118E9813F DAFAAW123
390,324,165 *274064EA9738D8885D0824A3DB88E6299F1D295A [email protected]
390,324,166 *274787F8363AAAF4D6C1C269ED45B44588E8BB1D damianmussenden
390,324,167 *2741F2A670B82B2A7F880FD63A7A0493CEA4587B DAMIENWALDVOGEL
390,324,168 *27458496DF33F2424CDE46FA6DEE0FB4F6CCA9C5 damnroot0
390,324,169 *27440CED22D16DF399049B724DB3DBDC1848EBED DWPU0
390,324,170 *27472DE311D67033AEEC460633DD645F7541C5B1 DYLANGWAT
390,324,171 *27452A50A5AF7561391F00E2C96AFAD4FE5AC128 dynalatitude
390,324,172 *2749DBC11B49981E9D75D826D7837D515C5AF20E darragh-kavanagh
390,324,173 *27495AB90CADC28B3435FA8D096147FAC4A0AE45 dz=h
390,324,174 *27492DFB95BE91442E3B8B8F6DF3CED31F5BB401 earlgerstenberger
390,324,175 *27475335F2137CAB773491D1185ACBA7E93D992E dawngelee4
390,324,176 *274D7A7D05379F41B2BF0545D9C85883A35AEBD5 DB,,
390,324,177 *27457DB6B4C7A5A697856C5F016227349506DE26 D,C4W
390,324,178 *27429984977D3BD358A21E93B4C12ED334B94766 ddxf+
390,324,179 *274358F406CE069C3CE195BA8A0BABF658E1DBA7 debby-wan
390,324,180 *274EDB72DC27766F141BAFE4AF4BC958E884D755 ee94x
390,324,181 *274DDA246A6BA481C201BE57F65BA11DADB27CEF eelerroc2
390,324,182 *2741DC857CD3365792F20603C7B32C52834B6901 e)fg
390,324,183 *27455DAB8EB3036E06983F5A7E4D2ABFF6B9BE40 deniseath6
390,324,184 *274A0F364152B39225322D76F2CC9C52BE008A56 egotrippin'(partthree)(egoristicinstrumental)
390,324,185 *2744F55D4EF8CB464C28099D3707E5F1218F5046 ehuck
390,324,186 *2746134F5A75D2589B5F2568CF1759AF21C75667 eiräubern
390,324,187 *274B34103D7AAF0ADF5DF477F1224C76044E7580 DEURSUUR4
390,324,188 *27407F78396A3EA7CF6C5B82910AD4C90FEE20CE df2yi
390,324,189 *27462BDDCE98FBD538BC14060EB02AE9B8C81C0F EL.CLUB
390,324,190 *27487106C08B3B9E573A3385407A4A4815689EB3 distribution-ammunition-indispensable-manual-diy-forces
390,324,191 *2749D2BA419FB2B1837E4E10D4FF1B125C24FF1D elnorea
390,324,192 *274B65A05CB313360165AB58ED1C5601F0401517 ELROY.ROWBACK
390,324,193 *2749B95BBD2CCC05BBFA27B952B17517B067CDAF eltemblor4
390,324,194 *274AA326ECD3E2D211B05FEA31252439CCBEBA27 elvernoning
390,324,195 *274B2EE31A8B38F836859207A2CD4A1CA742AD7C dl8%u
390,324,196 *2749489798508CC69B96F529250E7B006FFD2619 ENERINUS
390,324,197 *2745CC402E870A1B50B89CD5493A9800194CE316 DNGWB
390,324,198 *2745212B1A9055C081B9EA0C27BA61B8E791EC96 DONOVAN-WINS-ATT-GOAL-YEAR
390,324,199 *2746720CD23D23EE6CD4B25D59CF1C6CE4CBFE7D DOTCHEV8
390,324,200 *274083A67781EA2B3801BA82498A6BDF2AF3ACE7 DOUGHEPP
390,324,201 *274DC670A6CACE3BFA0B667BC3A6CD61C5404610 ernestolappa
390,324,202 *274B470122FFAADF54A3CCD81680DE2C4DB6FD26 dqky9
390,324,203 *27486620A751FB848AD80628D2799E05473CE7F1 ERUIONNYRON
390,324,204 *2743A2A17B1A8C5CDCCBB45171769DB4F0CB22DD D!R-C
390,324,205 *274263D110DD1758CC756D8AEBED412507195536 DSJL0502
390,324,206 *2740AC2FBFD75924CBE4F87133BF3AE20B593097 D!SLC
390,324,207 *274822F65F1A27885948586D57B85952E5D9097A dt&k;
390,324,208 *274862EED3ECAAA5C6144F823E657BD013234B98 d#"tr
390,324,209 *2747C375F7A3DA73924831BEFD78537EA6C63D57 EVOLUTIONDISCUSSION
390,324,210 *27429F35082066B790568E64A9736BA13F82AADE DUCY
390,324,211 *274440F4D6200E7C394B4BEA6499781D293A8104 ex-metropolitan
390,324,212 *274062F68CE3733BD5837626ABCB7CB74987E825 [email protected]
390,324,213 *274C7AB0E525A1D526221D426C9590F874AB73BD DVFJ
390,324,214 *274CE7B9CCF2621B850925D0C39B98F70F2681AD dwayneforcino
390,324,215 *27420624FDB905C39721317C0390A74930D7B061 fahrradprodukt
390,324,216 *27414BF36F19B4F6F829C1501B650851E0F7EEAB DYLANRODIN
390,324,217 *274C08CCEAD42F1467AF1B9C2CDF0C0CDE18E5C4 E^0B
390,324,218 *27437033934C85026EBD9760CA44800E117C3B0F femalinao
390,324,219 *2740BE4B72E6CA5F1A5CA7D8EF2363C7D8831506 ecdov
390,324,220 *274E0F6FEFD73E78CE6BA24DDC8316ABC27999CF FINE.VINDICTA
390,324,221 *274FF4A3EC84A4D97D477D2CBAE79AD46D76B208 edmarashi
390,324,222 *274D3BAD44E02DB9B04CBE61CA5B2444DC188CBD flame-capped
390,324,223 *2743633E70F4C2622D4BDD661BF2DD968CF89E19 FLUFIM
390,324,224 *2742C733C5F7826858F52DB40F2424371B76938E [email protected]
390,324,225 *274815600389F596B096E3B7DD8FEBBA4CB2CDE3 forcib1ene55
390,324,226 *274A003B826EB490207607082BE4CC6746BCD23F FORESTJANIKOWSKI
390,324,227 *274581EB942261A2A50CA060489299C46C934DE5 fortyfive$
390,324,228 *2744F01AE84F17EC5008EBF069DA4338F7D97EA9 FOZZIERICKY
390,324,229 *274F02FFFA4743E4895EC38C9F7F192C2C67629D FRANCESFARRUGIA
390,324,230 *2743F4477E0FA1D2B712D91B0180839E3B4F8FD6 EKAOLELOPONO
390,324,231 *274CE0BB822DBE74454425EB5289F7D4D6BD467D ekfvw
390,324,232 *274E7B2D51EC9CE372D20F0356FE0BAEA2175986 FRANZÖSISCHEKIRCHE
390,324,233 *274142DE385A09D719D1D25813AE6D8C14DC37D3 eliashamsik
390,324,234 *274C56CA3FBD0F710BA49910471F104274D935FD FRIONA6
390,324,235 *27408999AD5391B96F357EA45FB5F1AFAE58A5B2 [email protected]
390,324,236 *274617CCF99197138E8B9D2494540CD3288757D8 [email protected]
390,324,237 *2744A4FD5A3818ACA5E95420325D4BBF81FAC826 EN209.19.108.40
390,324,238 *2749FC445F7E036C5579BD8118CD7EBFD2CA9F62 GARAPSID9
390,324,239 *2746D0998D935724363888DF75F99357A96CCE45 [email protected]
390,324,240 *2743B4BA2C5F6BD36330512104EC97379CA5C1B5 gavin.mather
390,324,241 *274E910A8FDF1771568B321C9957276040A838F6 ep7q;
390,324,242 *274906250CFCCF4F5CC72A912C7437D41B36B87C GENTLYSLOPING
390,324,243 *274823D77586617967F84E2C7F5831D0672FBF56 gerald-nesbitt
390,324,244 *27434D343C06A4E46199F33647F86C035D80B352 GERARD.STOLTZFUS
390,324,245 *2740BB48060D1D1649A38741A044E91495870742 GERARD.VANWRIGHT
390,324,246 *27416E1D1D195C4BC30F0935C984988AE1B22538 ERGOHOTTWIRLOBENDICH'
390,324,247 *274DE40BD07CD46F9506ED013D42EBA153CFC6E9 Get.Da.Hell.Outta.Here.(feat..Lil'.John.&.Eastside.Boyz)
390,324,248 *274B8682E4D406FBE87637E711E6A4F7A50D6041 g!fy
390,324,249 *274AC0A4782DD194CAE0C954A814F715EE4CDA27 ervejzom
390,324,250 *274927C20B9B8423BF08700C4CE945DCD303D38F ERVIN.ANDRESEN
390,324,251 *274D0A8FB82A56B70BC6242E4718F7BA87B18BE7 ervinkvek
390,324,252 *274EF5B890AA86397C9DFFDF084CE62FEF6A6048 ES5,O
390,324,253 *274C3B0C0A114195BEAFDBDB40A320654AEC8F84 GL!$T3R!NG
390,324,254 *274FD6E614175D44228D51E84E42CC60688ACF39 eulychnia.clavata
390,324,255 *274F3D8AF5ED39C904BB74BEE1094CB98B6FB7B9 gomioka5
390,324,256 *2747F057801378B03F071E7CA7A9DE1522B43765 EVERY.LITTLE.STEP.(:WUMPSCUT:.REMIX)
390,324,257 *2748EF042812398F2F6881A671D61F4411FFB1C7 GRACEMAO
390,324,258 *274D0075321D48EDAED6BAF99632773A53278AD6 f4r533in9
390,324,259 *274F4F04A9563976BBAD8D4881362F83F8CB1781 GREGORIOTILLER
390,324,260 *2745EDBD1C35568B02D3225BB79228B992119FBE GREGORY.PUCCIA
390,324,261 *274BA5FFE583C31B022C4AB9A9B8B6C8BCADEBC6 grndznd6
390,324,262 *2747D05743A9932B1388FE552349D1EF8B0EA4B1 FANCAGA
390,324,263 *274DB631521C8BDFCE6739372FA2ABB01380DF34 GSETIATI
390,324,264 *274A8847A6EEA2E9BEBD52309154DEF1D3618331 [email protected]
390,324,265 *274A1E34BC7CB1F3C9D71A95B8966DC6F76FA369 [email protected]
390,324,266 *274464660298C307C2AA0BD0AAF7BCFD30FBDFC1 [email protected]
390,324,267 *274501F363A3E5BB00291205C0ED94FF1509F877 gulaguleu0
390,324,268 *2743311FF5BF3DA23C91FD7B7271C41B56B3C11A GUTTAR!
390,324,269 *2746E79CEA1F06BFD0DB8B2970A063441A90EBFE HACIREŞ
390,324,270 *2749BB4779D90403969BF8DC659644B3EE764CD2 FIGURATIVE-EXPRESSIONIST
390,324,271 *274D39223B56C87472D5FC7A58AEA078DAA59CD6 [email protected]
390,324,272 *2749C9585B11AE44C35D5225C57F4F045363B9C9 [email protected]
390,324,273 *27441A26EE2A2F6DD2BF16659F445EDEEF5383AD hannekem1
390,324,274 *274238AA0199A3C50541E20F0C49662C97D09EC5 HASENTREE.COM
390,324,275 *27409A5974FA2A987E2B4D90E7F4D1B3F94ECEA2 HASSAN.LANDY
390,324,276 *27498168CFB624E993B15B4CB23580ECC00ECB0C FOLKTON2
390,324,277 *274EBE0453C7D0CF5EB03108F97C8E9F9C94DFC2 FOREVER-GOLD-(DISC-1)
390,324,278 *274171576DD67D127C008A5D2E1C167E48950629 HERSCHELOHLAND
390,324,279 *2742110CF11345C8124144C9A209D87A4B216588 HERSHELNAVAL
390,324,280 *274264C95B4D847A96007D969C5F2460C8ADFEC7 HETEROATOM123
390,324,281 *27423A288F5F4BB3CDA43170255D47C3631657C2 FRONTEGGIO!
390,324,282 *2740F5FFFCD0DB4A891E1628555520FCEBED3486 holly.eden
390,324,283 *27426C69CD703414C5132D9D5FAFB92BE3F39F60 hook.&.the.twin
390,324,284 *274B53F99E5B49852F665EF303BF864E90B5B314 HORSEDOG0
390,324,285 *274166B9C7F56604063F585C5D7EEAB94C115132 houghdous
390,324,286 *27405B03370799C95F320F1292652BFB9356F3FA gavinrhead
390,324,287 *274AE4F88B6D06600BF0BD70ABF18EE417B152A1 [email protected]
390,324,288 *274CC685DA770675B347447D8198554C37DECEB4 GAZARIAN7
390,324,289 *274B284D52230B537FE408159EF15791EEE32C7F [email protected]
390,324,290 *274C00D7D6DC92AE0FDD7B5EA398E34A750FE893 hudson943
390,324,291 *274BE7DC3CF240FECDE479D97AC60FA5DDEDC1E0 GENAROHALLIDAY
390,324,292 *274678CEAEDD4A5BC6F8E90B712FE8DC4E7D023C generalgambit
390,324,293 *274C68312A4C259B26C364B799FDF4B7A15C545E HYPERODONTO-OXIDATION
390,324,294 *274BADE2D0C6E2FEBE855E4CF3AF40D668F32C24 IAMCARBON40
390,324,295 *274DD469C47BB7D26F1161E5FC6D84E160E4CC5D GOLOOLOG9
390,324,296 *274F94CE950C6173A394BFF2CECE5C06CFBC32CD gr0&
390,324,297 *2743F3C34B62553F4C40C316194287E4F916FEC1 GREG HABIB
390,324,298 *274D0F404B0D1DE035DA47E2405931EF6DF6FAED GRIDLOCK4X4
390,324,299 *27448F9E44189AC278AECF6EBA86BEAFF19C19A8 ILENU
390,324,300 *274704A1E8E516EC76B471D2FAD1011B106E6587 ILUVGOD08
390,324,301 *274E35336B63EFEE19EBE8CBF777F2680A973B3D HAMMERKOP-'H/&/M/@/R,K/A/P
390,324,302 *274F6A26DB257F74B034CE26E21ABDC47BE3AAD6 HAN-AL-EFRANJJPG
390,324,303 *274FAEC1A0DB0CA26ADA564BDB4DCA1C017572A1 [email protected]
390,324,304 *2742617ABE65FCCBFC4B9CEED0EBFBCEA015322C IMAGETANAR
390,324,305 *274EAA4C9E390465681279B93648B646D2ED8A27 HANNAHHONDA1
390,324,306 *274DF3C76C04C14C4BF97F99FCB22A7A00DB47D0 IMPATENCE
390,324,307 *274A65105A5E5D6D8646F23A21D2A5ED5C76B190 IMPONIER6
390,324,308 *274C97C94B637A202042234FD59582FCE0F56D0C hdrlike
390,324,309 *27456FD39CEC32E652FA0285228310C64F3E20D1 HEATHER EHINGER
390,324,310 *274E14A45646B485DD2B8D185642D275F2F3A656 INSELFAHRT»
390,324,311 *274F6B6DC17E567484A4FF0A9F4700EA0F991F80 INTERNLADYBUG
390,324,312 *274BA0E66FE2EB93EE9DD418B50CC423DA2B4E15 inventurliste8
390,324,313 *274BBFC002506458C35356FB8EC09F619E7B5D67 ISAIAS.TRUXON
390,324,314 *274228749639C2F57A651490AB8ED47B8A0B128C isiagiak7
390,324,315 *274D926094AF084E0B750AC5CFD6FA1F836D6410 HERE-WE-GO-(FEAT-VIRTUOSO)
390,324,316 *2744DBE0AD995CD4CD598AABF2E693BD6F55F7E8 highsiding
390,324,317 *274A4371C8910CCB8B62E8F86119CDAFFD6ADBE7 JAMAR.SHORTY
390,324,318 *274D3A6B82392970F248086AB8D499C03595B40C jameparry
390,324,319 *274E83D9DD0E1AEEC036578D6B333E223B7D3CF9 japansjanuaryindustrialoutputtumbles
390,324,320 *2744FEC9F5D19E78462F162A29EF9AEAAA2B5B41 jaredyahraus
390,324,321 *2741FBD7CECE4FA5941B5AEC5613F12621E3DD58 JASPERULSETH
390,324,322 *274786A046FB05FC16F13D01C2739B1E7D028DD8 javiercura
390,324,323 *2746A6532742B4AFF53CE0758EB3AD7CDF75CDFF HITUSHARMA
390,324,324 *274CEDE7D484B70830B392F9C23ED154B734E887 JEFFREY.ATWOOD
390,324,325 *2747099FFBF3CFDEBCC61BC4F24AB8D73A80D014 jenny-sutton
390,324,326 *27466F8F1D96D76F7AB044DB68DD3A62DA146AA2 JERE.HRDLICKA
390,324,327 *274DC5D8CACF5E4AAB1A561E704068BB70E1F49B jeremyconlogue
390,324,328 *2743D26F7686D407119E8D3D3EDC70B18350BBEF JERMAINEHANFORD
390,324,329 *274EA72260E2B785DAE3721EFBBB8DD2A9F95DD3 JERROD.REWERTS
390,324,330 *274F34EB22BF90A37A4A2E1F0D1F06B94B982577 JERRYKREIDER
390,324,331 *2749B6DFB21AA394513270FD869FF1BAA9ED1CAB hoseadingillo
390,324,332 *2742832F8593B8679923EF0439B602ABD369669A HOTCHICKS:JORDAN23
390,324,333 *2740880319DF0973A4D3E9449BEEB6851BC15422 [email protected]
390,324,334 *274CF8F0E3207F80E554190B9118001F54E54BAC [email protected]
390,324,335 *274D676B262615455E9E0F1D498D18712A51A92C JHASSKAMP
390,324,336 *274FF816A9B0BA9379F04B2F054A763F31DFEC6F [email protected]
390,324,337 *27470AFB63C66D84865325A0B6C5E366E46C75CE HOW-COME-I-DON'T-KNOW-YOU-YET
390,324,338 *27444A25B64320AEBB40398806C34D141D62FEAB j{n+
390,324,339 *274F2814EFDB418F1FCA215870D36421097297A8 htsednim0
390,324,340 *274F92797ED619FF1295A357244AEB7CD12C4066 Johannassyster
390,324,341 *27453532F68CDDA94010DD7CF139E519AC2FD2E1 joshhartmann
390,324,342 *274AAF8344591A15EF46A57C6D1551F0A15D030C JUDSONCABERTO
390,324,343 *274D18C8B442984051DDB48521445309251074B1 JULIENASCAR
390,324,344 *274534B97C578E4213F2368931146A23AB40DFA1 JUNKSHOP7
390,324,345 *274E867204D059C12B4592B431DE2804891C7A29 JUSTIN.BIEHL
390,324,346 *27466722AF7CE254F8DF26D6F58CF891671D7922 K68586
390,324,347 *274DAF75B1F488C5A69F2C08164E90CE3AC4A668 KATHAYISHHYATI
390,324,348 *274DB3EACC07E2C9B16686697DEECDAFE53D4B65 Iamsupposeddead:thearmybreaking,
390,324,349 *27440D90C4F6000B3691CE5622B2DC21320B115D IAMTEQUILA1995
390,324,350 *2742C2D76231498348087FB22F8E9D37D8ECE4D4 KETCHYN
390,324,351 *274296DB591169A82C49B377C6D57CA09A886695 kevin-kalivoda
390,324,352 *274BA40540A9CF1688B7AF7C21B8FB54C66F36CA KEVINRICKS
390,324,353 *274DD1B6BA7BA483FC8324D7DF433230220F9AB5 KIDDY
390,324,354 *274D5DC6E05D715E2EC979BB361A9E70E1B6106B ich.genie
390,324,355 *274661FB3510E92B349656CB9DC06C71592822D1 kohleneimer
390,324,356 *274F3B7942F30FB13378E36EFD08168B4D041A9A KRISTENLEIGH
390,324,357 *274A894192BDC45C7C4000FA374E1E8AB8B26B36 kushaeron
390,324,358 *274AF85AF6C438F77DC95291C5E18AE77887F376 IMNESNIS0
390,324,359 *2742BA3990ECC6E48C75C45ECECDABCF5BCACF60 INDUSTRYJOWO
390,324,360 *27493B48439477F571756329C1E066889D54200D LAND'S
390,324,361 *274BF7394114ACB8750047F736CC6D85F23154B6 INTERNBINKY
390,324,362 *2749BABBE148DE7CF647CD8F1C048E40BD2C7A40 LAXMI SUBEDI
390,324,363 *274EE3868281C663955AF09D61DD2402397EFC49 IRANIMUIED
390,324,364 *274EA064397DD686D7C2B741F1CA71E1DE475337 irvingdetweiler
390,324,365 *274296725F4D74F8ACAF22E78B808D9F7B4533E6 irvingmeinhart
390,324,366 *2748B9827257B93E98278556081142F868B02DCB LEE.BRIGNOLO
390,324,367 *2748819AE0109E05A76E1575DEEC850D99358AB4 leerraeume
390,324,368 *2747DA01B6BAB4C4550F03E1BD67E65DD8F265A4 istanbulspor
390,324,369 *27471C2688FFB7CA44E691CADE60548ACB2578A9 IWFENG
390,324,370 *2748ABA9E4F4EE22E958250D6E34C658792D3EE8 LEONELPERPALL
390,324,371 *274E5F2060D57E494BDE52F6DB1663C3D9227CE3 LEOPOLDO.CROUSORE
390,324,372 *27427A2419F2B4A3C27D200DAE9B3F33ABD2AE09 JACQU01MAI
390,324,373 *274DEE376FB944369F5672F3905CBD48D47BFC74 LESACTUALITES
390,324,374 *274737C84F2CB9831EBD41163F09371366778B2A jaime80andrea
390,324,375 *274D009FD98A7D611354D56BF149E3E471A145A2 JAMESMOSS13
390,324,376 *2749B1A3C5E64A4338D6D135FBCD15269B90C477 LEVAITHAN
390,324,377 *2742A03EA5F81E869523860ADAC3E13C8CCBEA15 jaratsri
390,324,378 *274417DF7AD4921A1ACEA05D1287781185D4E1EB JARRETT.ULERIO
390,324,379 *274B6AAE56A18A811F400F53DA4B95BDB196273E JASON.LAMPO
390,324,380 *274664983E2D57B658A02A09164B4229D048AE1B JAZZPOLO3
390,324,381 *274B23F01FBACF52A1EE1C124D53B78BF2C52CAC LEVERE?
390,324,382 *274C794742F63C2823C933CCD21C3FD3F8340619 JEFFERSONHEASLIP
390,324,383 *274B0884FACAD6DE054987B94CA176ECA4A79972 JEFFERYDERRISO
390,324,384 *27452852D9A179699868B4251C9B37B38D7B4F19 <Li><a-HReF=#Q26>26)-WHaT-aCCouNTS-aRe-uNNeCeSSaRY?
390,324,385 *274D8B2BE2043A8FB489E34A8D5252C2C9B64C90 JENNIFERSMITHCAGLE
390,324,386 *274B220C0FF6E611A2F7CA2791A02907DA1A1980 [email protected]
390,324,387 *2740B05732361ED582D908B82487ADAEDBD034FE JEROMEBINGHAM
390,324,388 *27437F84CB2E768FE3750C2EC315C114F0D918F8 jiijpjs24
390,324,389 *274F7F7D0F04161B468AA7FFC9F84A37A88351D4 LINDSAYWRIGLEY
390,324,390 *27447336844A5E39DE5C0D0890A8CD9B83222BAF LINDSEYHALLO
390,324,391 *274F08EF74C3F4DE57B25EBECAB9F59D795F9BF8 JKOTMZOWY
390,324,392 *27452E1D8929C41A32243A3B7C1BD330E9545979 JOAN.SCHUMM
390,324,393 *274FBF69751E52C52A0389EF914F352ED3E19A02 lionellashomb
390,324,394 *27425BE8F31AD71E429BEFFC21A59943F4F79E54 JOAQUINKRUMMEL
390,324,395 *274ABFD0F30D326B285D9F79C4851BC28B766FD3 JOEDONNA
390,324,396 *274DC1A8238F132294C3925ADD4E820C0E0760A1 johnathandugdale
390,324,397 *274A19254D67DD155482542EA8D725B1EA551EC9 JOHNSONHAVER
390,324,398 *2749AC4158D06B524D21352802662B24FC6E68C5 JONAHVALLEJO
390,324,399 *2746DB8137D3D5162400205CF96C0A5498F0C0A2 JONATHON.VERBIT
390,324,400 *2742687D9F64BBFF86DB5BE088B0B7CFCF5CAF12 jordanneisen
390,324,401 *274B71ABF65BE15C32FCEF6C089357ACD8E29141 [email protected]
390,324,402 *274622C508458A33D39BD0799CCFFF4AE1B725FE l|o[
390,324,403 *2746C65C9F481F61439336F36644953C6063DF18 logan47
390,324,404 *2746E9581D0BD0422FD52DD361DED0ECD1C2A876 JOSH.BERTINI
390,324,405 *2748E231E5A9FDD9EDB806D4C3C2D3A836E9B8E7 JOSIAHPLANE
390,324,406 *2749BAA6529F84984DB4C57ED43CA7683C3E60E7 LONGCOOLGLASS
390,324,407 *2747AB1E4249519C465E7105E7FD7FFA0D7B71C2 [email protected]
390,324,408 *274671E1A66A889EF20187FBBD22E1003B276ABA LOOKIN'.AT.THE.WORLD.THROUGH.A.WINDSHIELD
390,324,409 *27428FEB0F6CE41382A8B46F9A412852FE285FFD JUNI333
390,324,410 *274EC49B89CD2838B3109B73EA2FBDF3346A3AD1 loydkarsh
390,324,411 *274F92297F4D925753D7BFF3D65EEE3362908F0D j#_y
390,324,412 *27411F0415EEA11D397BC07B438C447C040FA70E kaishazing
390,324,413 *27464972ECEE484A844E7572FE7710C3E2FFA3BF LUISA
390,324,414 *274592EF27DFAE540F74BCC38B1536F24BD7669A luiscruces
390,324,415 *27430ED871DBCD2526A79850AF28152FB477D66F KAREEMRYZINSKI
390,324,416 *27414C0061BCA476D803AD2E49311D1A71397567 KARENDECKARD
390,324,417 *274F5AE445FCB545D2EF62FDB615210F7DF07544 katy-elders
390,324,418 *274D774A8F4483FE9D11BFA09CC79FD94B0E2FB6 KCEDERBLOM
390,324,419 *2746881353A5F03B096FDF22A3E0E846AEB49745 M3+3OROLOG!C4L
390,324,420 *27487611FDE7413184937436977ACBC84BB8B8A5 madaras3
390,324,421 *2742964B15D4479C6544DEE302827A117D737EF2 [email protected]
390,324,422 *274CA69DF5338F8A6B7290CF70CF63F80CED25EA MAIZIERES-ALTO-SAONA
390,324,423 *2746D4285B1497EAFF580415B9EA44118E9414D0 KETSZERESERE
390,324,424 *274179AE7EEB922668E436E52A9F74CDA7E4F5C7 MAṆDABHĀGADHEYYO
390,324,425 *2747C292A68369F69BE6FF75E6B1349201B853BA KIETH.ORILLION
390,324,426 *2740F6A5541BB7CF372F8AEDA21E06E5097F1A69 KINDZAHDZAH
390,324,427 *274E8B29F669CCE355F280FA00B92054CC25BDFF MARCOJALOMO
390,324,428 *274E2F446A553EE319D01425739AB788B5BD5D89 marcosaaby
390,324,429 *2749FE8D7096C895F9EE93D4149357DDD8CB97DE [email protected]
390,324,430 *274E417FACBBA8721A773A6715F2ECC08C4A9A24 KKKKK
390,324,431 *274E68F2F5FFE7CD7E9BA1BE0FAF1AB1076575C2 kleinindustrie3
390,324,432 *274FAABE46C4EAD55C628303BD8FA88B64A146BB mark-chester-dela-cruz
390,324,433 *274481A2BA364C41C4054A06E670E88B04B7F81A KOKEE2
390,324,434 *274276D705B09D1F5127FA99014810A13FB33A08 MARK-THOMAS-BROWN
390,324,435 *2746B5BE460A998CEA6B5A334CB0933D1E38938F marlinhesser
390,324,436 *27420C61CBAC9E98432089F065AC5A93AD48F719 MARLON.KLAREN
390,324,437 *2743F1BD84AF907CB826DBBECC90AC9F66A36B4D MARQUIS.CORNICK
390,324,438 *274C843F3B5504E577E96A856D7CC5967BD7500C MARTICHB
390,324,439 *27498ABE054B148CE4DE52FB1066F4A2DC32D5BC KOSOVO-MARSHALL
390,324,440 *274A22D9A3E9DC4E98D8C90E604B0F7E2028CBF1 KTÓREOŚ
390,324,441 *2744A822B7468E4020EE6207600FCFC085446D4A MAXWELL.BONGARTZ
390,324,442 *274DB4E16E4052D300A156A0EEAD36E4EFD4FC51 maydaybanana
390,324,443 *274B73182902D8373AEDDEB2F514EE399E9EAEB0 M>=B
390,324,444 *27441102E86EF0C26F228A46C5606805C7259BD6 LAADMIN
390,324,445 *2749D5639EB3236A7AD670BFB34529DD29D08A1C LAESKIGT5
390,324,446 *274C493389AA7FC646BA235E5C3505A2ADD800ED MEDICAGO-LUPULINA-VAR-WILLDENOWIANA
390,324,447 *27435DAC77D25E1D7082EE9B1AA1A84A369CBC07 LAMINATEFLOORINGCOCOMWWW
390,324,448 *2740ACF4F37FB6BA740D4AC561C76AC2F2641403 melissa.mckillip
390,324,449 *27408861B17620DC62D4F13270E34691CC1EEB23 LARGO..CONCERTO.FOR.GUITAR.&.VIOLA..VIVALDI
390,324,450 *274CEDB74E95F6A0F8C2EFF1E22988C06AB001F9 michael.dale
390,324,451 *2749EA23F0F64A99178484844BA27CC3FEE9D4AD mighty hard rocker
390,324,452 *274F1C8049E86E9D64215DC63833543A3A9DF0C7 LEEHEIDI2
390,324,453 *274A2A62ADD49E6DD61616EBDFB20DA5E0C9719A [email protected]
390,324,454 *274CCCA7451069048F0C131131DBC102327AA5DE MIKELTERRONE
390,324,455 *27442FA866DEC2198D9278995BD08E5C9C46F028 MILAN.DORSAINT
390,324,456 *274130A2EEFC5A4956140D5620BD216B5F4828CA leighnordick
390,324,457 *274F3B96D1D44ED142EDC2312D6B311DEA0EC979 lelandchott
390,324,458 *274A4B84E0ABCCA067221A61DB06005337842091 milfordaldaba
390,324,459 *2748D2445153C48DA5AEA122D1C3BD51BA192F49 LENNY.THOENY
390,324,460 *27400C2BD86E339325A8A73D5F0030241C675081 MINORBRITTLE
390,324,461 *274DEDE3A03B65767BC36D0380E5D0C8C7F18250 LEROY.EIFERT
390,324,462 *274C10150C2B09AB5C1425E2C5424F7891286974 MISLEDPRODUCTION
390,324,463 *2749CE2231DEB610BCEAC3451D912A4161BF6393 lesliemimaki
390,324,464 *2740B2326F459F8356E0FE0ED4217DDBAAA95C61 MISSASOLEMNISOP123:5AGNUSDEI
390,324,465 *27444F7BA9055B33DA23CEEEC396724BA649233B leswessman
390,324,466 *2746D0492E196D8F9F3D640633BA7BC5247138FC mitologia.fenicia
390,324,467 *2747C8E004DA4CDA1E711AB9C9BE19D210C78DC3 [email protected]
390,324,468 *274DB4946AAA56B627633A8BA7DDC2F697B52C6E lewinsky 7/30/98 int at 6
390,324,469 *274C771268BFF73D7B1B4DD3879EA7CCFF978C73 liebe-jugend
390,324,470 *2748F4CDE39A9366BD18B1D0A9BF342A34CFE16A mordv
390,324,471 *27454AA1D9C4E9D2B28EB253984789838E7551DB morrishutchens
390,324,472 *2749E279EBB7448CD2ED33E4F124FDAD1E35C7B2 LINOKLEMP
390,324,473 *274569A3F51C4D77BC8B93D2806A0C6926739589 LINSHAOJU
390,324,474 *274ECE164B70F0A8C519DE943659A354134A14F4 lionelchang
390,324,475 *27416A802B5F9AADEE1141270013E3E9A2CD07EB [email protected]
390,324,476 *2742C9662282E9F607AE319834E05015D988319C mrdarkandmrhalloway
390,324,477 *2749442318738A4E0340E67209FA9AFE27119EE3 LIZULIVENEGAS
390,324,478 *274E2B82292C6796946E97800AF3315E2C615F0D logan.holden
390,324,479 *274415ACE9E378CEF394348DE60CB1844551D92D louwilborn
390,324,480 *27419628C18BEB4490366BDC8F74335F43D3E57C nataliacavagnaro
390,324,481 *2748CCC90BF6841CA317F7DD2BD56C4221B436B6 lsthidden
390,324,482 *2743827D984C9EA2BCEC3C9481A292E6DDF93FA4 ncc1701mickey
390,324,483 *274F8B94CE925B8FDE26B705070A38ADDEA98E20 nealmcquesten
390,324,484 *274B8AF8A227807EDB24C39AF8E7B8F48AE38559 [email protected]
390,324,485 *274641C00957800F1197513ADDC810B85CA79E28 NECRONOMICON:IVINCUNABULA
390,324,486 *274C9DD19907F4209E1D72EF47F5684B475ACEB7 LYNN.BASKERVILLE
390,324,487 *2741F3741F11042175B2794E99A0C4FA1ED8BFA6 MADISON-ANNE
390,324,488 *2745C4562C6F6A6676306AC8D5BD483A9DC48EE8 NEWS部
390,324,489 *2742C150BECD62397B38951A023C8E74D08E1BDA NIKZURAINI
390,324,490 *274E72B1D552479422E02AB1A55775C16C011D1A NILEMORB2
390,324,491 *27443CC60ACEED152C47521BF8220B60E06D7933 NINATHOMSEN
390,324,492 *2747F3FA63C7454673A433DD90964A5A3F80C8B8 MAMAGUY2
390,324,493 *274F63562FCC8C73BC07F6F28D8F8CD5E8E1E9C7 !NKLE
390,324,494 *2748A924FC5DAAD789947FB99319066CB2476948 NMELETTD
390,324,495 *274F7E39256DD5C593B98BB29C890996373EA638 [email protected]
390,324,496 *274A15C4D3A2C6B306C0E34DF40543E2061C64E5 NOBLEKOWALCHUK
390,324,497 *274815FEA02BD88618C264041654943048AE256C mantiğinizin
390,324,498 *274DFBE29410933DB42F49D44DC72E15E863D007 NONDISSENT8
390,324,499 *27411CB0F05D18F36EA44C8B494560A5D90DE4FD MARION.PIZZO
390,324,500 *274134992AF5ABD8F077AE2977D402E9FDDA0B9B MARION.SAMIA
390,324,501 *274CF1F94B1D0F3D911E3763E664A7E16699A8F5 MARKDEROCHE
390,324,502 *274069FAF6C72372E0B2F75DF2F32571899487C1 NORTHERNSTYLIST
390,324,503 *2742D49FAA371F9B799EFB4190B3B74AB070FCFD [email protected]
390,324,504 *274CC663E20C0A24FBA26D1B31D1B64CF2CB9A2C NR.6822
390,324,505 *274ED9472DCA02EB1E95F4EBF43AD0C2F1161554 nsinteger
390,324,506 *2740D197EB54558C6F3487310D93848EC800B0B0 OAMK
390,324,507 *27430045F88DEABEEB856BFA6C080EB4A6FECE86 maximolueras
390,324,508 *27477502586B214C3F8F41FEB45F8565A1EB5CEC O->-<***D###3
390,324,509 *274E5A0E84B5A7F3DE2542A6F155EDA587F8FACF meavaaaayaaj
390,324,510 *274F5B786F5C9DC35859421DA953D4ED8FCEA2A0 Melt-Me-Like-Chocolate
390,324,511 *2745B2C45079E8E89AFD0BA3C47839BA922C7766 menageren5
390,324,512 *2741DA71A6576BCFE946B0CB169DA6DA6D527AE6 MERRY KISSMAS FROM PAUL STANLEY / INTERVIEW
390,324,513 *274255ACA861EEDF61F9749E495F644ABCB8EA01 michaelliguori
390,324,514 *274D4E59339894B449A898CFFD3C048792710E89 michealbellamy
390,324,515 *274AD4FD7C7BF8B246E8AC7FA2CB00F22E5E1A46 michigan_f97_roscom
390,324,516 *274F968C8C1EDCD274F364EA3A82E4C0D5CC94C5 MIDTERMS
390,324,517 *2747A8878CC30D1511AB80B310300D16FC0C2DAB MIKEEVILTON
390,324,518 *2746CF8064A9A14B060DCBC24CFA1A080EC400CB mikelragain
390,324,519 *2746FAA2DAE0735ACD228CB0E1FF7FB182A569C4 ostall
390,324,520 *27494DF504A07849C24E2151DEA50C0F070DB736 ox^
390,324,521 *274863701EF36BB001394D5630E481DC920CE6F3 p#####).*}8{
390,324,522 *274CB7A481D59BA07CC7FA48B14EE07F77A42204 MISMAZE9
390,324,523 *27457CF560C990DD577C8BB9D1EA40227CF78028 papageno!
390,324,524 *274BD7BE217D0825DAE8FFF45D152C29B4611D56 [email protected]
390,324,525 *27464FAD8F0F899F119EEB116629C2AA691A8782 MODERNBATHROOMVANITIES.COMWWW
390,324,526 *274A8D22ECA2D9DB7475C4D2ABA1E1421B571A45 MOHAN NIRAULA
390,324,527 *274F2AB4B66062E354C9F45538E73FC9921702BD mokaune1*
390,324,528 *274352B1AFD1CE519EB1C151BD0EC9CA691150E4 PASSPORT-TO-MAGONIA-1
390,324,529 *2749A6919EA819E30F41C9BD1D649476F8EABF41 MORGAN.KUNKLER
390,324,530 *274B5C3C92B3C52B57D214A58278F473C2EE4850 pb.*(00)
390,324,531 *274E887E701C489C5CE5B5F3BA336885E045FBA7 [email protected]
390,324,532 *2747B91D36574245E2AD5DAE05EDE8C46352C339 P====D`~.`~.}O{
390,324,533 *274A8DE1AF2DBC28D4BB0C7111B52852C721FAA5 perle博士在1979年所敘述。目前僅發現3個標本,包含:下頜、
390,324,534 *274536FE56FFC65CB13C2E4CCE40DF268172248A PETER.BLAZE
390,324,535 *274F35BE844AAE272B7D2CD907E47B54174C0B6B petergregori
390,324,536 *274D72A50F2FD0084BAC2EA04FB9837E39346B85 myspongebob02
390,324,537 *274732C306EFEB11745219A413F6B327A611316B PIPISIGALLO
390,324,538 *2749F2640B487B0D36DA0950590A1138E8910BDF NATASHABEAUBRUN
390,324,539 *2742210029D402C6409674371CC4524CD10704F6 planifii7
390,324,540 *274CB14ABBA07BCED860E4943D71E9EC98E9D9C4 NATIONALANTHEMOFBELGIUM
390,324,541 *2749C49F99AFB75E92BF8F16336ABC6824B0B3B8 N DE VIC SUR-AISNE
390,324,542 *274E31366D15F0234E5AD5E90C2C36A259452F07 nealalarie
390,324,543 *274F3A1CDACB6A94CEE680B61E7A8503724D478B nealmajica
390,324,544 *274CCBC99295E32C21B46FDD2BCFC7DF122F5C05 p==>.~O~o3B<
390,324,545 *274C2283651CF1649940E2A6A754F04783FB5DA1 ne-connissons
390,324,546 *274571E856BD71BFAE8429E617502D9CC56C5F47 NEMOWHCRING
390,324,547 *274CBBEE1B1CF28112660F7266C88BECA51D5D75 pp ~0
390,324,548 *274FC5C89BEDF91174384DE2AE49A22695EB8ADC predestine0
390,324,549 *2746EEAAD3A35292AA633B490A36FFAB4FD41585 [email protected]
390,324,550 *274F762221E81804939AC847FF4BB73C78FDD236 NICHOLASRAZO
390,324,551 *2746B0E8CE923442DB609EF47A6890013AD64F33 nihonzar0
390,324,552 *274E642454628545ECEBD6AE8A1F7849B554B948 punlets6
390,324,553 *274A8DE4262D1CF0FD5EDEE22A82CDE8661F64F8 noahbarnes
390,324,554 *274FC3E2ECD438803E6A19151ADC8A41586F5E64 q-----d~~)o(
390,324,555 *274BE9BA2E3153A5E183B986AE8B7A590F83DF82 NORMANHEISSE
390,324,556 *274F8E8004953F36A3798A63A44D9913897A6046 q=>-~O-~osplat!
390,324,557 *274F8197F72E1D2D47409A8D4399783E0ACF6839 NORTHCOUNTRYMAN'S
390,324,558 *274A7691E5B52AB7C5ED13BDD1537DD835A9A861 NORWICHRFC
390,324,559 *274DE696034BF14DB05425479E18C930DBFFF7BF NOSIMDE1
390,324,560 *2745B342F08CFB193D0F63F5519668A3187E8823 QP~SPLAT
390,324,561 *27478E3E39F662EAB1750FE43B1F0D98EF3028AA QUENTIN.STUDSTILL
390,324,562 *27427128A781F224F746C26A651B0E55491D52FD QVLKAAAAYAAJ
390,324,563 *274719ED6E1089F9B9AE9C026AE7A1377F4FF206 nutcontrol
390,324,564 *27409DB269CABE461A4FD6D2AE4A5BDB9A427D7E R3JUR4RV05
390,324,565 *2742E620FAB61D2C2D3749DD7C429555734A005D r4t!f!3s
390,324,566 *2748325641DAA5E05EE8EC78CDD469CAE88B4FDF ODIS.GOLDSTOCK
390,324,567 *274D904772D21DA382E145D9D6448430E6275F9A raulkindberg
390,324,568 *274CFC683769ABAA010987B280CBFA489424CE58 rave.reprisal
390,324,569 *274F558D290BAFE63EBE4B064AFD33808B428512 RCMBASKET
390,324,570 *27475D83C479970885E828CA882CAE47A4039C27 OMOLOGATI3
390,324,571 *274EDE54964C657EBBCB0C7D02A478E7F1224086 )O(O~.(8
390,324,572 *274BC5AEEB8209134C38744CBD369A6910F26E3A rebugul6
390,324,573 *274A93357C291216FA4611FAAB32CD47013753A5 OTROCOK
390,324,574 *2742CB6745A44C4687299FBD137FE62FCCF9DD71 REMODELACIONES9
390,324,575 *274EE646D9686C118F22415345E63B65A0724C13 OVERF17
390,324,576 *27495F78A3DE03A4636E507CC4E9ADD4D904D64A RENE.HOLLO
390,324,577 *274B3B59C15F6809FE323A89F38B6B91355C29B5 o&|x
390,324,578 *2749F093E1573C1DC3CEFD14A4169E1B68017116 PALMER.DEVITT
390,324,579 *2747AE0D38B5D19D5B84E75658E89D1522065163 REY.SCHACK
390,324,580 *2742E48E947DABC5DADFEECF452F4B24F52876F5 RICH.KRINGEL
390,324,581 *274851A884C47BE3151D17CE111C0D3AB0445710 pasqualetencer
390,324,582 *27481B2B5377BD818FE3C416034112B48CDBE78D patellas
390,324,583 *274FA4E756AEF90FD411F95A3749ABFA235921F3 patrickcannonier
390,324,584 *274FAC5B06E47B7FAB6A3923283645347BD29232 rijssjired
390,324,585 *2746B1A013F4F0B5B85C4CE1DBA96766D07CE822 rina-oktavianti
390,324,586 *2747C165D7C8C47CB4078757306ED495FBA65DD5 [email protected]
390,324,587 *274FD3308294ACA666859E0555C2217828D22558 ritterspielen
390,324,588 *2744867197884BA2EFB3176AC863A14FA351C4ED PERRY.FINAU
390,324,589 *274CFAAC66F1452E4987A4A3BDCA7F8EE8D42E1E ROGGENHORST
390,324,590 *274581F8EF4CB2470406232F72A6A6F06C4DE4AC ROSENDORALPHS
390,324,591 *27421B250761F13DA358B577126CECDE8BDB8436 RRCONFERENCEORGWWW
390,324,592 *2748B151E8AAB58E7D58801D28E1765FCA14AAEF RREPCO
390,324,593 *2744B7150957143DC2B9A23569DFED20FDC0FDE5 rtattoo
390,324,594 *2744DF017F6F699EC6C1C5AE7290469184AA4DE7 plinkatypes
390,324,595 *27484A2500FA680BCDF661F91446ACC19ABF6B49 rubinprovine
390,324,596 *27409C26FE6F16D7A4ED60AEA6927C077E7C3341 PLMNERVILLE
390,324,597 *2741985B9D2DF8479574640288ED7DDA998AD42E PLOMERIO
390,324,598 *2745A0584E500F75AE0F5043A5F3C641D287A83F PLOWBOYS
390,324,599 *274A5AC7DC114E4E89D630ABDC85662298039ACB RUDZINSK8
390,324,600 *2744AE1DCEE0DBCEF70E6BB0125782B16CC61735 [email protected]
390,324,601 *27431977B03C3A4D7AA277F65536E5E65D5512B9 ponderati.
390,324,602 *27459FD6D2E4427121EB6730CBE826109AFFA3BA [email protected]
390,324,603 *27487997A3DD3BDD3E210C74AFA8E1192E7BF821 rwsrbsw2
390,324,604 *2744E689487B1351F71894BB6373A4606C3DA2B0 profusions
390,324,605 *2740719728C429548E8FC5C29789A50D9BE46B39 rziahvm3
390,324,606 *274CD3BD2554D47EB051797C8AA69DE4E4618A9B @SAAA
390,324,607 *2749F9A4216B700A63214642F0C4B245333B062D SAMENSMELTEN7
390,324,608 *274A0AC1E708D0AC14F7BAC662D0B557E08ECD73 QCT|
390,324,609 *27480ECDA5BE3B8DF5693E3E8CF14067445E5AA8 SANMENRING
390,324,610 *274D0A753BEBC6A4A15FDEB6B568664A47823439 santosschiedler
390,324,611 *274D12215894E036D8D7BCBF40191E6568436C2A sapprovisionne?
390,324,612 *27405B3D5C473B62AAEA79AA89A3CC66924C4FC1 R4T1OC1N4TOR5
390,324,613 *27429E61E01CE43F653D316F6CFB064C10E92C8E RAILWAYTALKAPPLEY
390,324,614 *274A1FE52512774D22C4BA99E9C015A5212E9937 RAJENDRASINGHB
390,324,615 *274D80A4C20BDF61112BB19D092F4114F8FA9A63 rapage.
390,324,616 *274ED04B2917A0530CA7E09DF851D88717CB6324 SDRIOUA
390,324,617 *274796F2A2516A3FACBC873254AF7E0FFC3A2819 Red-Hook-Day-(feat.-Tara-Chase)-(remix)
390,324,618 *2743017D4A0EC07062A3FA5948326F1288457962 REINALDO.DELANA
390,324,619 *274300D9B309015692308318623C0D8969A64120 setivel2
390,324,620 *2748F383C4FF553377C5F20981545CC4143898BE SEVEN"
390,324,621 *2743585F947F112A6CED7A2F4E2842C492D0AC72 SEVERIAN:BIGDADDY
390,324,622 *274D9FAB65F838F7EBB71C6744BA7CA4B69A0DBC sevintage
390,324,623 *274E3368B4749B384621BD6872C7574656FE20F4 REUBENFULFORD
390,324,624 *274CFC82379E09EC3393C8F89F6EACB3CE652236 shamajikkoshtokathinno
390,324,625 *2749A73797BA55A0D18322179B526576041C880B [email protected]
390,324,626 *2741CF281E5F7F0DF559890555EEBCAEB5774751 shauntwine
390,324,627 *274563E9EBFDC452218326AA65EDD7E298E3DBB4 rhettamore
390,324,628 *274A06B51D24AC87F47212079E641B5F4D986FAC SHAWN.COBBLE
390,324,629 *27486593D231321239A364E2590DDAA20AD92DD7 SHELLEYHOBBIT9
390,324,630 *274C58CC28D0D21697C3D2CC46F1FEF4ADA5275F RILEYBRISTON
390,324,631 *274095EFB875C7BD52971660DF3A0360C83907F3 SHERWOODSANTOPIETRO
390,324,632 *274D5A3E2DDE941FB24A4453BC512F52CD547D58 [email protected]
390,324,633 *274FB5FCA053B3C35D608AAFE35313AD749B41D5 RJESTMME9
390,324,634 *274AEC8716E35AB116EF34BB905A11A00D2AE18C RKLEGGES
390,324,635 *27435D5A15ED6AF01B9F6D2A9527F5AD5EB5C4F5 SIKLINGENE
390,324,636 *2748D721C210BC3B4D8A39587893DDC0042E85E4 robbyrongo
390,324,637 *274C08E61A3DDA4D4146C7EBEAC204944C379B77 ROBOTS IN LOVE
390,324,638 *274CD36C0F67A58AA9949007771F0B815909058A similimum8
390,324,639 *2748985D70CA55385E76488BF5F8DE3379FA5AA8 ROJANEGEIA
390,324,640 *27410F5376CEFA067A93FF61DAC3DA92BA458B38 ROLANDO.WESLEY
390,324,641 *274F06AA3BD665D207641C2954E23C5EC5555DAB rollofcoins
390,324,642 *2748D942EF16B943E244CF5DFFDAF423D16D8BBA SKEETERSARAH2
390,324,643 *274D454FE0D6FD7AF0A0B9E3C375104B3E1359B3 ronniepoitevin
390,324,644 *27437B5BEFABBD6C778FE16FDB7B8218CD2A6014 SKILLEDTRADE
390,324,645 *2740FDEE9136FC8ABEF5722496987BA40671A73D ROOSEVELTGRUNBERG
390,324,646 *2746D3F21349FB0561D6700F3D3ACD049ACFA3EB SLAVEALS
390,324,647 *274568961EFC57184EF81EDB61F1F1BCC97845FF sllahdeivi
390,324,648 *274703D59E3388246D2EE2B87719103EDFF4F2AE smellthatgold
390,324,649 *27435F5AD911B663E90D98C4F77FA6191A3FEE31 Solid-Gold-Collection
390,324,650 *274B6DB206F9123863CCD6F1CECC991A04E57157 rubenbrandsrud
390,324,651 *274B24AF8A44BD2C5A108E85368F57EC403A912C RUEBENYAGLE
390,324,652 *27476046F60550AFB7E0621826AAF8CD63A88DF0 RUNNERDAN1
390,324,653 *2743868BE2D4A713E7514AC695236A97985B9E11 RUPAULHOHOHO
390,324,654 *2743DB4D2B8162795E9BFA8A05F15ED9DB67ED2B safka-schekeryk
390,324,655 *274F22762EB767E3EE353AF78040A4649D8B5322 [email protected]
390,324,656 *2749DFD5387345462B8360E1E9FBCCD92265EDEE SPEEDWROTE2
390,324,657 *274599BE5F21AC18B934EC0B0D0AF6543F8F2AB7 spine chiller (60 second version)
390,324,658 *27495E2C110BF61355170617AA432662DD5B98D0 SPLAT!!-*-*-*-(#####Q
390,324,659 *2747E12009AADC1E79B3FA4DECEBA152E69D7345 SAMENGEPERSTE1
390,324,660 *274A4CA37F7F72113359098461B890AC921115D6 SPPRTMLR
390,324,661 *274C232E2203DA9B951C0C6F6C18A906A7E25FF4 sproeikop
390,324,662 *27431AAB83A14B61B8C5EF67B5F08F21C2AFCFE6 SRRUBLIM
390,324,663 *274EC2F16E5397826E8687E17F07F647FF1F2AFF sawranded
390,324,664 *2744E057204B37D2E0845A001991794A5FC94677 SCHELIM.HANNAN
390,324,665 *2749E8D38F00A424BB0F9AFA37F1C112E91E194D SCOREKORTET
390,324,666 *2742138131FBC7C433D7112D812F47485C547B15 STEWART.GAFFEY
390,324,667 *274D637F91BCF67D756DBF62F28EED110BB59CF1 SCUTULUM
390,324,668 *274FC6B8806364456C067FE27F4DA852778687F4 SE---CINEMA-PARADISO-(FEAT-DAVID-GARRETT)
390,324,669 *274E00F009ED4AD9D638E94044CAE73D8A3DC34F seitepirep
390,324,670 *2742161B29C76E503FBE207FD45EA8FA61F91A93 SHANEGODBEY
390,324,671 *274C0C77B889612CC46FBF8801EFFBBB4CEA4276 SHANELURYE
390,324,672 *274FDF2B95564F3886A4BF6D77C55FD3AE030471 shanna-barnard
390,324,673 *274F8DEDBFE46444CB7DF1A0D455A6BE1177984A SUNSETLINDSEY
390,324,674 *274E486C7B501A4FBB199685CE034A5D8786F61A SWEETSOAP
390,324,675 *274276862F248787A088491E5DECCAFACB874708 SYMPHONY.IN.D.MAJOR,.HOB..I:101."THE.CLOCK":.I..ADAGIO.-.PRESTO
390,324,676 *274E788406B7960888264F6AE5351BAB86CF13EC sidatiaidara
390,324,677 *2740150ADB66F5EB08972F73DE3E8F86979A4E63 signada8
390,324,678 *274004D080FED3983C79E60CAE6105E14426483C singercentric
390,324,679 *2742223AB8FA46E55687B27D4169CB79F278DC29 SINIGUELAS
390,324,680 *2746D735E9E0B7C56620E357AA30BC5D9A49F124 SKIRMDEN2
390,324,681 *2746D99121CD24E186CBC3D4C63B54EE9610FFF5 [email protected]
390,324,682 *2748D7A7417CE11DB890AE4AB715625FEAE12AE9 SLABINSKAYA
390,324,683 *2742CFE213FB605FAE819C151C7A0444D13D4537 TAGESORDNUNGSPUNKTEM
390,324,684 *274967325CE80AC9DAF40ECCACC0F075A3AD03D1 TALKHISTORYMIKESECTI
390,324,685 *274961AB4A52BB9E3B529390103410547BC2E3F3 sluttdokumentet
390,324,686 *2745EFC87DFA86959B19518814B685645E92DB32 smdelene
390,324,687 *2747714D4050E15AFFE1C47AA79A2D659FCF7A69 tango-imaginario
390,324,688 *274BF02E03E0AE10DDC96D6AF990AF9C9B3AC233 terencebuckett
390,324,689 *27492F8962573C1C884BC8E976B6D648C40C8A36 TETRASPERMATOUS7
390,324,690 *274B29EF5E821D32A01B499B9F60FE17F768488C specificatien3
390,324,691 *274429E0FFE04CBEAF4BDBBC144D8F49BDDF6308 SPNCR123123
390,324,692 *274935416B2BF20F6A94C754D148305E74B6B379 THEFIRENZE91
390,324,693 *27430D7E1FB68B172D8B187A4587FDB2AF452A53 STANCHARLETON
390,324,694 *274A24EFBC21226558836C9A07E92ED1DA19964E thesystemisdead
390,324,695 *2740EC4B90AD2CC8EACD4912E40F01C18137AC0C [email protected]
390,324,696 *27478F8859C57EF459417C2EB20879FC2070ACC1 [email protected]
390,324,697 *2741D9FD0E98B12BB050DB3A50417C0CA458A05A STHCIREBNESSAK
390,324,698 *2745933B817B89400358BFEFC4FAEE4E1F091EC1 TIDROMED2
390,324,699 *274DF4E8651F92FE9EF93C0C083BCF770FEDF274 TIK1011
390,324,700 *274B2B360DC3E5BE19048CE1C374219F06C72019 timothyholste
390,324,701 *274CB863BCDF0B04355AE317E67D7137A6C4834C TINARODRIGUES
390,324,702 *2740D88D3E2D14B70A3ACD92FA8A67EB5B1471C4 TŁUSZCZOWNIKAMI
390,324,703 *274611C81963FC1698746AA1A53D427875FFCB2E [email protected]
390,324,704 *274496B70F418F93F5499AEF8E6A72FBFB69B7D2 TOBIASPONCE
390,324,705 *274CFC55B898BAD9557B621785D48B93199C3E87 TODDGALLEGAS
390,324,706 *274880DC5E49E8CD4872EE0A4E1B0E1C18DF5AD4 [email protected]
390,324,707 *274EC7D40CEF6F31E6BF837926DE162372F9D3CC to-outlive-the-war
390,324,708 *2742764332518CD5C7873ED6BB6EE2F6240E3633 TR0PH0PLAST
390,324,709 *274E1CC326DF3619897158FC2948D5A1EB57A02C suscitèt
390,324,710 *2746231455C8CF03273C9980E6B3460B4706B2FD suzukispanish
390,324,711 *27470AEDEEA1EB66E99C7F13B2F40947908AE877 [email protected]
390,324,712 *2748CF8A55303A61802DF85EE5E01A036EC27BA1 tabletted6
390,324,713 *274E0F6F6B1DDC24E27737074F308FC0E91D5D88 TRI.RIZKI.AKBARI
390,324,714 *274E4BF0DDB8D782107CD8E9376D6747FA3AC207 TRISHABUTTERMORE
390,324,715 *274815E418B838B1C44E8F0CF58CBC4F7362427C TAKINGTHESTAIRS
390,324,716 *27487CDDF88372B4D515EAFF9C589BCEF6AC9D7F TROCHOCOELOMATA
390,324,717 *27436F84F4E258C023B90CF57F8327C969421262 トロイカ:troika
390,324,718 *274790326E7175A8F912ED82BC4E299A3C65C51A TUANMCLOUTH
390,324,719 *2743191329689CA1646A4A2E1EDA8E7A7E8895D1 TÅRENES
390,324,720 *2744474F3F4A38BE285107C5C494C6FBEAB60570 TX|=
390,324,721 *274A99DF4F7B41B5F0D2099C0978AFF8D2A04CCB TYDSBESTEK
390,324,722 *274C2217611105F0AB4079DDB7C02C64224678DC UHNEPPILS
390,324,723 *27458904E41754C5FF59289743F47CE72E9A49E5 UITGEGEVENESED
390,324,724 *2746E2FC2BE75187105D03173723625D4ABEF00C UKKAL
390,324,725 *274764968EC0D7B9DAB4B9CBF54635CA53DD9083 THATBETSY39
390,324,726 *274489F56E8564A94FC38CBDA31AE2AA7E595C2F UNBELLIGERENT8
390,324,727 *274A56B1D441FA19ECC9E8C84BC96593791F965E THINGS FALL INTO PLACE
390,324,728 *2741635E51282A6BFA475F4015C606B4176CA1F8 uu-~-q######3
390,324,729 *274450613899B66039E11CBE9678F1F1598EC286 V2H
390,324,730 *2747F5199C27693DDC07CADE98EE56166C28AB71 valeriecoulter
390,324,731 *2749E707983389245B0E6C808BD25280C0A5BC8A thunderbastard
390,324,732 *274DCE5A70499FA6DE6E40B37C16BF3068A66FA7 Tight.lipped
390,324,733 *27411AF7A9396B5718AB7156B78390BF4121EFE6 var.onathemebyhaydn
390,324,734 *274A2212B76B49D04886CFA5854D93B016C71AD9 timi
390,324,735 *274A4F523860F66B7B90F281AB1A32B0E262AE5B tnangel16
390,324,736 *274DD16BFC8FD4DF5C81B744690FFF5A018E46EB vernonkesner
390,324,737 *2748696B3C569192ACEAB14B01E76AD2DB86FF08 vicenza-the
390,324,738 *2747B7BFFE5A8F3D168A7746C7CC44DA91045BD9 VIKINGHANSON3
390,324,739 *274820D61A316114F96FCEF92EDF3E7A5459E46A vincentprulello
390,324,740 *27440505C528329DA578F360F2218418F07BA293 VRXCLLNG1
390,324,741 *27429412B4BB70C946C9992658ECD852BA351804 wafa.abd.alla
390,324,742 *274D16647B436DD43DA93C17195853F3AD982EEF tri0leic
390,324,743 *2748981FCA3A4A025E7A7B2B74F11DE1F7AA4CF3 WALTERFLETCHER0
390,324,744 *274417239E1A320093BBEA6B5990D77FC76ECED1 warnerhokama
390,324,745 *274F74FC8ECE169F6BD90325CC57B788B4585B9F TRIPP276
390,324,746 *27433977B2C397F340F96E0779F595035692EEC7 [email protected]
390,324,747 *2743C7CA1042365185DDB641A0D36F9C98AEBD5A weedily
390,324,748 *274B43C9886D335E88F12268C408D8F92D138680 WELCOMETOTHEJINGLE
390,324,749 *274DF056806E4979F2C75E14DC480DA913983F8F WENDY-NUIS
390,324,750 *274003F995B412546217E5DEA93F89579F93E0C5 [email protected]
390,324,751 *27497EFDCE5DCBFDA6C8EA70F8C23D385A28FED2 [email protected]
390,324,752 *274795D2BFAFFEE312BAEDA7206F6052A9C04EC6 TSILANRUOJAERAUOYFI
390,324,753 *274AAB76E5612307E79A0295EF06601DAF093623 wetstalen?
390,324,754 *2745F90C7FBDA18C8F4E9B6EC6C2261F667F053E WILFREDO.ROSUL
390,324,755 *2749C44E7AA3E340CBA3605DAA3A285FDCE39379 WILLARDSETLAK
390,324,756 *274F1A5998145AE1B415216F13CCAE60EE717600 WILLIEM CATSBURG
390,324,757 *27491354CCC3DE62DC9251C1E66872F7D672000B WILLYMADINA
390,324,758 *27465EB70D544160B8AB9DB183A44E081057D092 WILSON-FERRAGUT
390,324,759 *27427DE8363DB95642A99E0B6A130E8648A51119 twopink.puffsmedia
390,324,760 *274DFD1B5077B7848D5DF7D679B8EDFDB8F586DD [email protected]
390,324,761 *27426F0EB9B168BDD03E08568E05081DD0AE3395 WNDBRNNG
390,324,762 *274E411A27A357776F606776F842648EF0C54BDA TYRONEBOHLANDER
390,324,763 *2748FE729C7D1090AFADBE74053984367D7816CE TY.WIATROWSKI
390,324,764 *274252FC9BB1EE8D5299B486C63003B551740F9B TYYDYTTMT
390,324,765 *274F9054301E6CB7563304E024A9647A0980830C TZ>:
390,324,766 *274B339894FBCB541DFFDDFE16323F967717C03C WWW.BURNINGSHED.COM
390,324,767 *2744D3514DECD858A082EF5FC7CB0D72AE7D57A0 xavier-jr-aguilera-samson
390,324,768 *274724433DAAB1347F2747CC848055C717DBCDCA XAVIERSWEETIE
390,324,769 *2746EBD4B7C17B39E8D081C2011451A02335A325 XESY40404
390,324,770 *27499C8629212E71764C6E8F95FFF1357FF7E726 újtesöld
390,324,771 *274BF8724EC7F718225204C473E5FB3258E58396 YACOUB.ALGARADI
390,324,772 *274307C3EA245026CDBF17B0138C28723562D2A8 [email protected]
390,324,773 *27414586C897F7E6D9419D50E93492606631B6F9 YE.HTOO.KYAW
390,324,774 *274A5149A77DB21C5DD86790540B80C3A29F8EB7 yengconstantinoovercomeswriter
390,324,775 *2744CC5EC93149288DE4EA603524EDCA0946FDD8 [email protected]
390,324,776 *2746F82FB5DFE4FF05DBE36197F9DFF1FF45C886 youngdalebsw
390,324,777 *2742F93F5A4B890E2606EDC2D039521D69784764 /USR/SRC/LINUX-HEADERS-2632-24/ARCH/ALPHA/INCLUDE/ASM/IRQH
390,324,778 *274C2D2D3BEDF3EBBAFF80E04F2274C201D9085D ytnuav
390,324,779 *274B66327B31E73247084354527DBB49D916BE1A ZAHRADNICENING
390,324,780 *274CF4C21BE7A77B6CE2638D603FF535C269124F [email protected]
390,324,781 *2749621350972712F31E5C908EA4EE8527CA99E4 VAELTTELIED
390,324,782 *27460723FED8EA28EB37605F98ACF68065D2E1C8 valencia.golf.naples
390,324,783 *27435B435F7DA7EF9C5AF975B4FC1F1078328184 ZESTY PETE
390,324,784 *274CE964390ADCD685CFFAA980984E2C26A38DEF vancewechsler
390,324,785 *2744FE6D1C5B9D1157DE40B1CC547535ED5A33BE [email protected]
390,324,786 *27465C1A3FE65B03E51EEC59A695DEEB19423AAB [email protected]
390,324,787 *274662F252458B2F5A4F3C6D70291FDC7C51FE33 v^c
390,324,788 *274F472D6CD2B46F377B32E0D32769CC73A35CBD ZIFFERBLATTER5
390,324,789 *2749165244923059887F164D95557D5EA08840B5 ZINMENTO2
390,324,790 *2749126B597B6C31D34726A266E7821330FA32E4 [email protected]
390,324,791 *2740250341D38FCD972E300F680E63C60B446235 veitbell
390,324,792 *2742C93DF3446A65BDD0BEA2BAF1870FBD0BB767 [email protected]
390,324,793 *27459F22C0530C3ED5BB0A17AA5EDF677185293B VENDANT4
390,324,794 *2742601098584ACAA956C07B116072318DE16BE0 VERTROET0
390,324,795 *27489F9B0CA6BDB6ADB4502B8002C13D9E2C2AAA victoria.elizabeth.st.onge
390,324,796 *27499E89F812AE23F72AD7D48FFE54C0CAC216A9 «желудок»
390,324,797 *274795239646AB6144CCDC9D4696006C0EA5EF43 vindate
390,324,798 *2747EBEA1A5AE0BE343237EB4C1686D6EACDC953 «НЕУМЕСТНОСТИ»
390,324,799 *274028B7F90B978997897AB55222AA1F2390BDE6 vjn-watson
390,324,800 *274EBEB01409D3F87BFF9AD74B6DBE38ABACD4E5 VLKSSCHLED
390,324,801 *27472368D4DA4B51850DB7E2F0EEDC39F88F6131 W3BKVE
390,324,802 *274AC6589BF70BE6BCB7E1559C91B1CBE58313B1 wallyrogacion
390,324,803 *2747AA6CE8D6E0800FAA14DA8AFE2F9C3B15B344 [email protected]
390,324,804 *274C2D354E19D0B2681C6E1B77952C427F7649F0 warren-myatt
390,324,805 *274262F9F3631C4D264A2971EB76E9AC05F67281 WATASHIWA.MIRA.DES
390,324,806 *274BC738676FBA4F03D2A10A70CB16839FC32707 WAYNEGROTH
390,324,807 *274C4CB4B29E8C8C4F835F448CC6B2CC3A10264A webdocpanhistory
390,324,808 *274967ACCE52E319DA4B3EE1687107AC32043EB6 [email protected]
390,324,809 *274862BADA402A280EEF51E0B22B31EC9283F206 стенгазету
390,324,810 *2745C7020CB6BBC55E4D6A101EE1F83245592864 WHISKYR0
390,324,811 *2741EEBBE5DDFD4C80A508284A3BB873AE2E1C61 WILLA GODFREY
390,324,812 *2744C975F8D4F7BF03863C448331662FDBCF5596 wilsongantvoort
390,324,813 *2744DD5C8200587890D3E6F6C719E0BB44B21700 WILSON.KOVALESKI
390,324,814 *274C1EA2E05DABD9FA1598B6EA52C1CBD56844A0 [email protected]
390,324,815 *27458EE8D46298655BB25CFE7D1EE6D17EDA712E WITHOUT.THE.ONE.YOU.LOVE.(LIFE'S.NOT.WORTHWHILE)
390,324,816 *27424711BC8080273535AFAF1FA422275C995907 [email protected]
390,324,817 *274D92118524F277FC7F2B9B30BE5B4AAAD4CCDA WWWINFOCESKOCZCZEC
390,324,818 *2742BD0FDEC6594430159307EB9565850624D9A0 (x) 0~ (8
390,324,819 *274918C30544910B846D7AE623593BFC89103835 YADIRA JONES
390,324,820 *27481E28E5FA84EA21338F43CDBCC18C75A78221 YANZKIE.SANCHEZ
390,324,821 *274E456E4A56A6E376E63A4A5F9CFEAE99CB7F16 [email protected]
390,324,822 *2749144CF4DAD617AE6FD22F65B6AFA8AF5D48F9 [email protected]
390,324,823 *274C0E9E4662859A48035403482425A2AA01A51F YEAH,-i'M-SORRY,-i-WAS-JUST-LOOKiNG-FOR-THE
390,324,824 *27461706981F5E5763644EE77C9DD7385DC70256 [email protected]
390,324,825 *27497D7E6D630115DE1F81D6A3013996D91FCB54 YENIT.PUCHANA
390,324,826 *274F8B75C442CCBF3DBABBB9129BC860EF23807B やローソン限定ホビーグッズを中心としたLOPPIグッズ取扱商品
390,324,827 *2740D5AD635FFAFB45D3EE6262B9F6336EFF2B86 ymfk
390,324,828 *274ED73F233D0AD6C923CF7B5BC1ECB7FB8DCAE5 youx
390,324,829 *2745CFB8F52B29CE6DE5941FF461388564EF5055 YROTIGABMING
390,324,830 *274D59E52633121D88DE23A3378F26A0820472A8 YUKIJOAN
390,324,831 *274E5194A6B02079A4ED7A12C8567866D519A0B6 ZATDAROP3
390,324,832 *2741627BCB0F278EBE3FA205EF39F6F296177FEB [email protected]
390,324,833 *2743BFE2A65BD2481711F197A10BE998E89B222A 10COMPUTERFACHLEUTE
390,324,834 *27422ADD11F125D6DB1E3F52EAAA74F2E1604F2B zidan.daghash
390,324,835 *274C1C71BBA245570F1406BA7155B4D6FE5F7689 ZIEYLA MOKHTAR
390,324,836 *274BC20E189C44F53469401389CEAED941906284 1251849 materiaalivalintoja-koskevat-tiedot-tulee-esitt
390,324,837 *274FDB693F115F20CC67C51666380983F98B5232 1257151 tutkimuksessammekin-k
390,324,838 *2746C6060144F607DDE3C850C039FBFDFAE9EA39 ZOHAASTS9
390,324,839 *274C61176E6691C547F145B76AEBAF2A83FDD59C 1658199 PALJONSATTUIJATAPAHTUIPUOLASSAOLONIAIKANA
390,324,840 *2743B577D9CCEBEB6DFF6EB8F2EEA284C828C092 16waltzes,op39,no13
390,324,841 *274D867DBFDAFD951C10C74A7BE91A2D322C0B3E 1727559 YHDISTYKSEN.ENSIMM
390,324,842 *274975254FFA264488F8191397F2A3F9D48EA94C zuly-tinoco
390,324,843 *27484E6FA48C3ACF02242C0960B63938606A3D98 1744639 DAS.ERGEBNIS.WURDE.VON.ANALYSTEN.POSITIV.BEURTEILT..
390,324,844 *274F7CCA91DA2F57303ACAB72DD2D518983AE66A βάρχιοσ
390,324,845 *27448CE83A1545842B945475475E218295D70FF3 1907933 in-seoul-blieb-die-boerse-geschlossen-.
390,324,846 *27487EDBE42D12165653F03B4842CC3C64E9A443 πολυ
390,324,847 *2742D7B17660FF4787CB97C9E061CF91804B2F1B КАНЦЕДИКЕНЕ
390,324,848 *274AB0958B48826B0B54D0959DE8EDE2F71393AF МУНБОКСАН
390,324,849 *2744880A5D81864C224F4B7FF1288C56A489098C 1eriytt
390,324,850 *2740916928E1A55CDD3B4FA76BD033060ED5B857 «связьинвесту»
390,324,851 *274A5AB94D3AB08488CBE8B1467567B755183A17 1.kolesteroliaineenvaihdunnassa
390,324,852 *274F0DDAE54C71DCA2573F1F127DC146C63166DB ТОРШЁ
390,324,853 *27401EDDCEFAF3E9E5B0398A4BFEDC7E03B3C864 (例:juki)
390,324,854 *274221E1AC069F5B3EEB1A876BCACC3CABFEC7D9 1.wayback
390,324,855 *274578DC2224A86B02CE5B89A720643ADEFD977B 1-ZUGRAEDER
390,324,856 *274F5AA10B1E54FDDC6BBCE341D71374E45B5F6B 1-zyskowiczill
390,324,857 *27403CDAABD73E417DD73198D0D9830E44C69391 211JOSE
390,324,858 *27439C0AB5C31C1FA5570E62AE8EBEBF9E31997B 2257276 WARRANTS.WILL.BE.ALLOTTED.ON.A.1FOR5.BASIS..
390,324,859 *274FFBEE5A62BEF258AE2181FF65BE66397876AB から山際を眺めた際、この峠の尾根がv字に凹んでおり、これを狭間と呼んだとの
390,324,860 *27443FD28A89F6F54712C74D899D200D463BF81C 28AUGUST1793
390,324,861 *274C8DAEFC444551745B0A0EAB105C103D0F00D4 2CHONGEN
390,324,862 *2746EA9D51A45C4F09ACF1E19F32548F0B85A48A 2EHSSBSW
390,324,863 *2744F745EB54E62CC2DB080244712D8216A991FD 2ki
390,324,864 *27412912A16961F057D3511D44BD23B342110DF8 ,303-RO-,203--,103--EB-YLEKIL-TSOM-LLIW-EULAV
390,324,865 *274450789DA3FABA7C2F73A0E5D2E7E2529E9780 發行;台版CD中譯名:眾樂樂
390,324,866 *274027CF84E9C957E4A474FE4AB1B4C043C53915 3.ANGLE'S
390,324,867 *274FF762D0DEEE90D442CED460BBEE63853442CC 3B<--o~-<###8
390,324,868 *274A4225027A66BD454586A2E173519E8FBA5C59 3.herauspraepariert
390,324,869 *274EB02352F94F5302533A1E429F2B4FC07CC3F2 3ilyana3
390,324,870 *2742A38B6FDEEECC39A3080CA0613890F16CD693 4151989LEE
390,324,871 *2743D2F85F847D12EEBB477C0E3D79AC5AAF8A80 475394 TURHAN-ACATAY-1982-1983-PROF--DR-
390,324,872 *27485073472065DBF28136390C9BFEAB20BF1886 486TLTAN
390,324,873 *27438E773C3945AAABB738DF3952791D072E93BE 4KODIFICIRANOJ
390,324,874 *274B7CD5EA05D0B3FAD5D8AFE2528C56CE77A268 4OVERLBSFILERS
390,324,875 *27477D68882E66DA9DCFBEB7DFAF93C83CA490E2 4PREBESTADES
390,324,876 *2744375D2C978933DB56D48B635E0FB139047B1D 4-vaarallisimmasta
390,324,877 *2741A4ECE4EE64A01460EDFBDE7EADB205D2C5C8 4VYKORISTOVAT
390,324,878 *274D688F797EE4F7716F2EB31EB7D6B5DB177CDA 584043 duwolltestohnediesehilfegewinnen.
390,324,879 *274E99A71A00F007DDCC751CF39BF5B6EFB7DA91 5BSWHOLBROOKBSW
390,324,880 *274A14577BC7601B4F7CAE94B5C9F3D1DCF52470 5GEREISTEM
390,324,881 *274DD3A3B2D4A7B38BDCD005A4D84B12AD2B0E7F 5IAMCLAUDE3
390,324,882 *274AC770F13BFF465DA0372F7D8AE84FDE549FBB 5SDLENOU
390,324,883 *2745FD39553C110E1D52FAFCF05F369920F8ACDF 608082c
390,324,884 *2742BDB75A1685A83952946B317073C09E0E6804 +011ER
390,324,885 *2743600A23A318686EE57A2B8F36B6BE9E63B1BB 6APLASIA
390,324,886 *274C411F620BEF1EC791106334072935558EDD40 6CRANNYSBSW
390,324,887 *27425E14D11A427C108FD49C9EDDBF2A134774FE 6DEIDEST
390,324,888 *27468144A2413C455C4D937F3A7938904E849831 6EQUINODERMO
390,324,889 *27417D8D7417DF54AC60711C62A23DCFBFF27864 6HANDGUNN
390,324,890 *274C0513BEFC0EAF33A172D5B0E418C047F54546 10.SUUREENA
390,324,891 *274E292E718DADCB802DD32FF19091A7E48B09D1 6RESPONDENTIA
390,324,892 *2749037C2E2FD0478783D543F890D361753C9B90 6UGESTEMPLINGE
390,324,893 *2743C2751684133FDA2565AAF56627B12B439F72 1362829 "-KIRJEOPISTOMME-HALUAA-,-SEN-TIEN-,-JOLLE-SE-PYRKIJ
390,324,894 *274C097C6D55134145831EC2E46FD65A8CABF63B 1363703 MY
390,324,895 *27461CE74AD41163C46614E210B0A2D22E514BA6 710724 motivayazilima.s.
390,324,896 *274785750B6DA51F6BE399D4E0DA469B62142382 1414094 SEIT 16 JAHREN IST SIE BEREITS WITWE
390,324,897 *274F4102288A2571ED0FB0D00B92916942F60AE2 1431209 " nyt on hankintasuunnittelu meneill
390,324,898 *27413D6411F4F4ECEF92F650EBBDE7E607948C74 7AUG1461
390,324,899 *274790C7220983EC551B3FF004E6849C9129FA54 1836417 BOBBY.DIGITAL.ON.J
390,324,900 *274AB88E0A56D51D1A11DD1E7314750A2AF631A8 1889457 palaa jonkun ajan kuluttua
390,324,901 *274D6796A42355811730DBCBB55B4B8D29462D0C 1951003 adoptoiminenonmahdollista25vuottat
390,324,902 *274F94A013FDAAB04BF9356A7D6A615587337DBE 1amelio
390,324,903 *274D763BCD4197D830642752DD7AECA9A4F07FBE 7iamtotal6
390,324,904 *27412E7E69A093547B646DC5FC8B99E146829A83 1 AUTOMAATTISORVAAMO
390,324,905 *274DB1D5763799CB345C99F8FA9289B2708D628E 7MU9DUPSLDHBXJJ
390,324,906 *274214162B3B27CF03ABFD47B1C5B9E04299210C 7PORAZMJESTISMO
390,324,907 *274AF47DFB13BCE3124A82AF6762BC69ADE19A96 1eriytt
390,324,908 *2742908B8D2F1B3F2AADFFF65C52C5CEA3A1F625 1gepappte
390,324,909 *2744049D7DA937BF89AD1AF7802FC4E635081E26 7THATIMPALA3
390,324,910 *2749BB7B5832EE9911A1F895F7B2A22636DD9F3C 1HGNHR3PB4WQM3G
390,324,911 *2746A94CA420DF68D59161D0610C0B58C422FEF8 1.HINAUSRIEF
390,324,912 *2744A8CB8C4D46983DF0A25D330E4B1962E7F6B9 1HUKHIUS
390,324,913 *2744C3C1F88E59F4353BD2593898B3D5E08FBF68 7YENLOKKET
390,324,914 *274D66247C59F3FAAB2DBDC23BA5EBC17E3566E3 1 KARABIINIVERSIOITA
390,324,915 *2748E724377B4F76FB01A3552EFB30C1AE8B3D71 1.KEVOON
390,324,916 *274425235C04000EBD83D8BF3A670DEE6D00D64A 1KOHERE
390,324,917 *2740407D94C4469DF0CA3F9014CDF8373EE7D7A3 82042 TOSIN-H
390,324,918 *274EDF56154953146AEB2D534C02DE42138EEE77 828276 TAKAISINSIS
390,324,919 *27478004E384603D3F48389C10E44615AADA2DC9 1 MACEIO'S
390,324,920 *274CDEE11C9E7AEC0B574A2878FE993BC3CC9599 1MARMAROSA'S
390,324,921 *274A2DC849D604B03476F1BEDC31E507A2AE6DA5 1NAADREV
390,324,922 *27418F2D877B517E7B63D8B51BC98DBD7683BF1D 1.NACHKRIEGSCHRISTDEMOKRATEN
390,324,923 *274B724391D2DB8B5F8CCE3B8FF130A839945D75 8BULLDOGDOMINO
390,324,924 *274CCCF32F90ADB43778951C756426E32CE80D3B 1OLVISTA
390,324,925 *27451EC2A1001B7FE27C7B47B380E596E5B98BF3 1-panella
390,324,926 *274209826A3BDCBCF6083C1B60773D72A67F1C07 8DJVLEKULTERNE
390,324,927 *2748FA2DD3AA8C0BB5E85693662173D3E5E88730 1SACHSEN-WEIMARIN
390,324,928 *274B79D48E51FE5A13A64742D468DDBBDD79B6B7 1-SEMIHYSTERIA
390,324,929 *274079C18F1E5EB3FA4756DC968ABC39B78218FF 8LAMAGRANDE
390,324,930 *2745EC65666583C72D9113B1718B37D519F360D6 1 SIEGWART-MUELLER
390,324,931 *2744E700C5A3C0402A9E37FCC4AD5447E834518B [email protected]
390,324,932 *27412A02A15486BEA9EB4B684A5C49FB6CE87DC9 8MY1Q2W3E0
390,324,933 *2746E6919B89BF5C3833645C33E6C23CE93B70E7 8PROSTIHVKY
390,324,934 *27437344F70FF1EA06F140D746DF5FA780466B0B 1-VENEKUUMEISIA
390,324,935 *274690B44843B1408AEFC5E479AF23BB6B89FCA2 8SCOTTYPORTER
390,324,936 *2743594275131851CA3BBC91362887F530EE8F03 8SYSTEMSHARK
390,324,937 *2748DD9AF70C39D7F9F31491B51152348775D0FC 8TEKKENKK
390,324,938 *2741647E3AF3F52323E320371E13B029A85394A0 8TRAENENDRUESEN
390,324,939 *2747D89F1070EB08F9229C4B62FF423C818E63DE 8WILLIEGRAPHIC
390,324,940 *274AAC8341D9C9EE652894BDF16BEC1D27AD1EF2 2034453 ESTEELLISYYDENAIHEUTTAAL
390,324,941 *2746A04A331FBDD55CA1F8BFE02785E0BECA5049 923334 NATUERLICHWARDASNUREINEHRENWORT
390,324,942 *2745EB5E6411C2C31A6605A182DA750616E9DC13 9A2003
390,324,943 *274641D055CD7004396F0579097F96B25824A3F7 9FORESTATING
390,324,944 *274FC49C85A6F56BC9BAED445598119399ECD796 2917709 ROOTTORINHY
390,324,945 *2749D6244336AEBE2E9253838326CA594504F143 9JNJORDAN
390,324,946 *27468F21E202B81C6AC3D667875B29ABF4EA1B15 9KIAOTSEK
390,324,947 *274EF3C5BC26C7F1E635C3B335FCA2FC2A7CB7FB 9LMPIMISI
390,324,948 *274A33BEB09B9906744EA86E70E849156A19F28C 9ONEHAVE
390,324,949 *274D36CAF7A24A8CBAB9DDAD30B931386A40786D 9REDRUMCAT
390,324,950 *2749681FE28E5E2CA9BE4E9CAB19EE1CB46CD92C 2DIPLANETIC
390,324,951 *274BE8DEF89DD35F15131C592D0963CC079222FE 2-DOBMAYERS
390,324,952 *274B226EFAA5F3DC0175641DC2E77B8CC20C8217 2.ELESTRISI
390,324,953 *274C69B884830421916FA5BC76D1CB42FB95CAC5 A$!&
390,324,954 *274DEFE8F07363D1E98B84985DEAB71CA3734AF7      2nd「sufficiently
390,324,955 *27463B620A2909F990FB3D9233162340F6D534FD A5UM;
390,324,956 *274433108CDA8915ABCC89391B6EC1E91CC3FECA 2-VIDEOINTIA
390,324,957 *274F36CB70C3FD28DDD583B7ED54769F881D5104 A8VI
390,324,958 *27468DF6A25C7117FA1600C2BFBA41AACC177ACE 32ANASTASIA
390,324,959 *274E7BCB235D2050C63652A1CD4A76C3CD614262 AA;4
390,324,960 *274299185D7F9E91B6A144BFC353EB67BABEC5F8 AARLING
390,324,961 *2741B2D608D5944926F6974E1B3A90353B39A309 [email protected]
390,324,962 *274722A071C91558D30C7D0D41D92B4B5C6D1415 3====>-~O-~o-:p
390,324,963 *274B82661093F29A8AD72AF6F754C0A9AFEFB016 ABCD1225
390,324,964 *2740BB03DFA95791ADA735AE853208B5F73BF725 ab*hj
390,324,965 *2748F062CA858AC1951A3B3DF437DE2FCBAC008B ac6mb
390,324,966 *2744D49759B97AAEB80E412538470A38BA0983B7 4FOTOSTATE
390,324,967 *274D0BBECB1D2078F8EFF0A02195CEF482389C78 ACZCA
390,324,968 *274DA3B32F690DBACAF4F2FB0F55547A113407C9 4POUPARES
390,324,969 *2748AC26C13B9C4E4EE1B143E9262FBF0F8BDDB1 4SRECIOJE
390,324,970 *274E889C280047B9A31B02ED0B40825E5AD84DB7 A=FA-
390,324,971 *27452C3A49B60906F16F48AE0F45C982AA34ED52 ag1_
390,324,972 *2747801825DCD51D2C9EB3F67CA3185754357F86 ah/ia
390,324,973 *2749B642FBC05252E8274B8678230237F5D1867B AIRU
390,324,974 *274A628E25380D549AAF09D72D46163850D2EC7E 5BOOGIEVERONICA
390,324,975 *2740045453FA3366DF4BD233A51CD993F44E2D56 A?J_
390,324,976 *274F93309B6F68E5FEE53C7BC9AB94A19B8C6457 5BSWYGOFBSW
390,324,977 *274F1931EE0FF7BF34CEE3FD5789473CF34DF669 5CHARCOTS
390,324,978 *274A4C6A2D638CEAF271DBC8DAC4B09E60641B7C 5DETROITPORTLAND
390,324,979 *274F729A9981179600D8D637949ECC02FEDFA01F 5EVITADAS
390,324,980 *274ED84C8A294C91DC3356947B398F61EB5EF62F alana.pohler
390,324,981 *27442C7E82379538283F0AB684658EE7A8895AF0 ALDOBARIMAH
390,324,982 *274A7DB9983C53CA4B2D95C321EC725F23214F8B 5HONDERDTALLEN
390,324,983 *274543C6FB3E0B4F0D025BAC3E5A2B4A89383A6A ALEXANDERMISIAK
390,324,984 *27464EB55046E99F6C490BE2E35BD891F8492644 5KEULENSC
390,324,985 *2749E76F98A1EB438F67AD4EA3BA80A2E27E124C 5MIHARBI
390,324,986 *27466ACFC392201D26BE6FBFB0C988A5244E123C 5PEACEBINGO
390,324,987 *274D0DCCF5AEA0E255DC32360724507BBA9B548E aliyilmaz
390,324,988 *274401C1CEF93C4974F817BE4BC04BD89A0164B0 5TSAMITROS
390,324,989 *27460B4D57680D4E035EA8E13991EDF5939AC63C [email protected]
390,324,990 *2745A73357C7FF28E0E91C8A5251C0DD5FFB2EA8 602AYDEN
390,324,991 *274BC06F4E85ED4F2CD8BB0139F5A1B8B41B4215 64A4A674312CBEFE6746
390,324,992 *274D24D545FE4DDB1E9BBC7A40875420369915D5 6BATMANBERTHA
390,324,993 *2747394885CE31910B96E8F2150259A7367ABC81 am&09
390,324,994 *274A3067A460084BFFD28BC1A408E407D679C16A am0uw
390,324,995 *274A40E818AB37831F7AE85A98BF323DD728E6B9 6CLOMEGESTONES
390,324,996 *274E6FBFE96F84306723DAF85D485625B46DA708 ammali9
390,324,997 *274BEBAE7C9E3CD01EB5BFB943FE8B95E9C31D54 AMRITBUT
390,324,998 *27437E45539BCC7044C1119D2D9BC16F46663D98 AMUBEBSW0
390,324,999 *27473936DCAB61D61AD46CE7CD176B923A35A412 amv#$
390,325,000 *274BA06A6BCDE10A65A37314393C31C4DA896AC7 6MAESTASQUE
390,325,001 *274DA9AD4F07E7C404FAD8FBB371DE9FDF5FE037 ANDREOZZO
390,325,002 *274993D9D695F9FBF1C670047A0F9F57BFF28374 6PEANUTSHITHEAD
390,325,003 *274DF172F55E8B50B532C7CE123A9EA1D7CEC5B3 6PREPLEXITY
390,325,004 *2741989D7E3835DC0EFA8E65C0858C2083E6C507 6PULPPET
390,325,005 *274476F8D45FB2B4005EB6A6EB440502591143DD 6schoenlapper
390,325,006 *274F280DA68C7B13161562CA3730FFED9C801E65 ?6VAAA
390,325,007 *2748E24B2C50D823CC3F1BA594A3B9A16DB2BA66 7AARSAVGI
390,325,008 *27403479042B031872EE7E57B4AF0186C5AF347E 7ANSKAFFENDE
390,325,009 *27405C018503300C4C94B1651BFDA01C9355C43F ao=s
390,325,010 *274D1FF325455EBACB0789D2FCE53E326F47F62D apynt
390,325,011 *2743615A2C5E132498F157734A148268FE58FE1E 7EXACERBANT
390,325,012 *2740ADD522E73FE023B2313BDEA7244D045DAA25 AR=CI
390,325,013 *27417881D04932D0D6C907C1F2FE2605AA04B808 A&RMG
390,325,014 *2747D1EBA1B6CF7C501F072696FC542BB0F25C65 ARNOLDZANGGER
390,325,015 *2749C71A8929C688E27E3EEFE92FDF987EF182C0 7MERLINEUROPE
390,325,016 *2745D207CCD6DA0032D85A5E08F232C214468213 7OLIVIARAYMOND
390,325,017 *2746CC74E936A765A4DD9E5D78CCF25517CFFBEC 7SDAKGPHWDYQAUYR
390,325,018 *274314485E1A5BAB283015FE5A1EF16AA2F47539 ARONLACHOWSKY
390,325,019 *274B98E92E5BEBC5F96D612A1AC50620D7E73682 ARONLECRONE
390,325,020 *274FF18E7FC06043BC77B44EB93EE337C0AA3CA7 arrangerais
390,325,021 *2744B3D864230D5869153DCFED60D0107574D776 ASNEPMOCED
390,325,022 *2741718950E7A0FC7681DE573305272136539366 at,a;
390,325,023 *274CD43BB87439D672BF5FF73C48038BDA31AB40 ATSIMUUB9
390,325,024 *2742134685A010B093D6F2207E43DE03A9F87BDD 8======d~0 ~o uu
390,325,025 *2746E62370529DA551174BC3D45033D07F9AC246 8DOSISENES
390,325,026 *27413F4CD61B53979BEA1AA16864F56C02CC80BF 8-EUMETSATIN
390,325,027 *274DFB00F0F52C7BAB1D76CF4F73085C753F8527 A=TV"
390,325,028 *274FCA43E78A1D0A2E37B16B5B8C666D08D6CCCD AURULENT7
390,325,029 *274F2D948501296422A0320453C1BEE16AE4610D A+U_V
390,325,030 *274F431B5AFA63CD722120A85AD1502912E424BB 8 OBLIEGENDEN
390,325,031 *274C2C0F6CDD990A79ACB6B717B5CCBE4B094D42 AVVILITOED
390,325,032 *274E10A5722320BC8BFF8CDB6F413A9CB0005BE0 8SUUNNITELMASTA
390,325,033 *274B3147E30B624E77ECB43B645B85954A7A960C 8TKNIRDEI
390,325,034 *274B706591F65607F0B90E5030D0B4BE46BB1D13 awg.z
390,325,035 *2741F4753449EF07D128AACCD0BB2D7FD35C71D6 AXQV
390,325,036 *2743532D425CCB0341721108DB815592F5050F18 978988 samoinsenmuokkaamisestayleistajuiseenmuotoon
390,325,037 *2745B510BBEE44E34CE64E083A83036D9BC736B9 AYJ#K
390,325,038 *274DE696D9384135D6CE05ED7EBE263068D8D81F 9AUFSETZTEN
390,325,039 *2744862600928577CE08664270AD1A4DD2A49BBB 9CIRCUITARYBSW
390,325,040 *274FD014AF6D9A4C1285B147842A05A43AE9383C >[email protected]
390,325,041 *274D4D246335AF83E45FFBF2908E70FA2039261D b58w)
390,325,042 *27469FC95A732FDE3179EE5180BCDADE2305EC9E b7s/
390,325,043 *274C9B37D4E9C0ACCEA74E59AC741DA9946E1515 b$aa6
390,325,044 *2742A7FF86ABC177BA093FF99413651E20CAF8B7 9WPACIFICO
390,325,045 *2749355937F97C9CA70E34736C9A15286BCF4F49 9ZAZENSES
390,325,046 *2747194DA0C0D0293870DED622CC73D8EE888D49 [email protected]
390,325,047 *2747CAAFF7B49D223AB11E6EE330E20FAA552D01 a0;w!
390,325,048 *27445DE6810B24495C03B35468A2B3E9256F1830 A7FWB
390,325,049 *274F1DEF0E0DD6E531D8CB026023678EC6175990 BAU!#
390,325,050 *274E6B837294B08DE53C9B1BC1A3D9BA02CE08AA AABEW|
390,325,051 *274C6AEA1B16F4C8B713A195F8B9A4A561538CCD BECHT
390,325,052 *274CA372C4F36539D050CA4ED93A90AB52833B5B BELEBEYEVSKIY
390,325,053 *27453EBC0C3173096394D92988D0214DB9A55D48 BENNIE.SCARBORO
390,325,054 *274A3322608F39DC3585D15D050A788B5A72CC3B bennydavila
390,325,055 *274F15B44076EC4405BFBC459581C3FA9A024B51 BERNARDOMITCHEN
390,325,056 *274A68252B89A41768ABFDDDC745940CA0736C90 BE?RV
390,325,057 *2743A542C6B98CDAC43CF8321522C45BEA281ABD Abreiben
390,325,058 *27414673E701C08102A5D815525BC223D478848C [email protected]
390,325,059 *274D5AA7631814E17030EC50DFBBA38CC94CC8F9 ACCONSENTIMMO3
390,325,060 *274F7A08779507E4C7165723ED67AAA1E7FF6C72 b"-ga
390,325,061 *274A9D9DE5C865FE56EE6DF4F375B802BF766DE0 bigi8
390,325,062 *2748928E8E8F266651E3BF27B6B30BF625EE5A05 b!jn"
390,325,063 *2748864C799521D1FC862D538E422CD1FF6D2BC6 ADRIANTUTONI
390,325,064 *274076F4BD990133DA62CC666DBAD9B1C7CC9E99 ADT]*
390,325,065 *27497035BDC30F337AADC97BC9EFA9293FE7630C afaqu
390,325,066 *2743FD71A8685345ECA30027B114B64DA1DE173A AGE.LHMIKE
390,325,067 *2743877774BF8DEB16FA2F4435B4935F291ED1BF bn4j%
390,325,068 *27451E0A247394BF9E06DF71596C4B1A13047090 [email protected]
390,325,069 *274EF703D153E188EC5CE00A12EA949E9CA9204E AHMED.ROGRIGUEZ
390,325,070 *274B7EA5B5BF928C11BBFED648A0BB77F19EFBA3 BOBBYCARDOSO
390,325,071 *27474FF8D1BD7FAA37B86E983E80F79F5103C12E BOP-YOUR-HEAD-(FEAT-CANIBUS)
390,325,072 *274A157FA3613F4836ECE9105DF4EBF4343B24C3 Ak5p
390,325,073 *27401CCE922EEB269DB810FAC24971A3FA80E463 b?p70
390,325,074 *274C6FCE66C6F11F2804A90013D2709766F3687D b_poi
390,325,075 *2745355E76BF6E23E464FE172CBA68312057874D BRANT.SIKAT
390,325,076 *2743DF3ADFC45A006C70C184B74FC4E0DC76EB1A ALFONSO.MILKEY
390,325,077 *2749ED282301FC778BD218B6769D6EA018C4702F BRENTCAGLE
390,325,078 *274CF77E224AFC3A39167656D188763AB3A73E4D ALLAN.MARO
390,325,079 *2741DF4C1ED9D4C54516906A083A86223522E3AD broscheited
390,325,080 *274E23434DFA7B77C5C752A7378306E428B182F9 BRUNODOBIAS
390,325,081 *27418A321B2065097620F27926B0E356418A7D80 ALLENZIELKE
390,325,082 *274DE00FD147B92B1A06E3A4CD75D539C1389F07 ALLH1
390,325,083 *274D040C56E31DC9B12703D1B46E4B8E85FF34B7 alt="ecumenism
390,325,084 *27415FF5248FC293D08E08A288728ADED3FDD855 ALUDIRA2
390,325,085 *2747ED2BEA4C2D14CA028E372E755EDDA76C77B2 ALVARODEGLOPPER
390,325,086 *274A2C7275F08A93087499FE84CE512E0250A00B Alyahs-1
390,325,087 *2748566E339ACC803E54BDC92ADD38E520DB57EF btk4u
390,325,088 *274CF35190A27A58C7C489F628797F5442EB8075 butifudon't
390,325,089 *274B0843FF18AD69C31B1475A8860967F466DD3F bxfn_
390,325,090 *274C0DEDECD2D79D60E3BB578C99E8D59D248B78 [email protected]
390,325,091 *274E04A0BD75297593B0EF9783DA4E1AFED41C6D by/
390,325,092 *274ABD599827FA6C1BA97CE5D502FC8CC230CC74 ANGELISACHSEN
390,325,093 *274971510CC1DE1E5F6F5CE3412F269CB292CCC0 angelotaraborelli
390,325,094 *274A3C2DCD47D5977DDDBA5CC8B72DD8FDC09D1D C5SSV
390,325,095 *27480957F28AF5BDCC9548930F4C695CE0BE4702 ANTONIOLEVITT
390,325,096 *274E39D0421D3A6A73F6F5770E983E4AA09C4D14 ao()b
390,325,097 *2749B2DA1C8161225F44111110B5818DBCEE344C CAMPANUSS
390,325,098 *2740EFF430A81D5089E174CBA93A2E9D2BDF4892 [email protected]
390,325,099 *2740DACAB2F5C652EEA00EF38A867430030E2BEB [email protected]
390,325,100 *274E39420D5CF6FCC96D732B6B0C6346359DBEA5 apically
390,325,101 *27438BF52A5057AB9B48981F6DB74B74BDF792F6 aprc
390,325,102 *274D931441F8977307B81EEBAF35A6E92A51BDF7 caw_
390,325,103 *274C7957E73FB16FF883ACC9361B43550A0678FB ؟8K
390,325,104 *27419D45D549A312FE984E71CC6975AA356B4C35 CBNDH
390,325,105 *2741C104D70502C8E8CF4CD634C11BE6F6B38E01 N*
390,325,106 *2742FCCA279570886DD1471CB9A994D37E499659
390,325,107 *27473A8582C65C069B95CB47611EE9238C6D07AB u
390,325,108 *27455DB2F5160397113A4EBAD125081FADB0645A 1
390,325,109 *2740075043415CBB66EFA174BD6DFE4101180C54 C&D,5
390,325,110 *27406C67BDE33B68E267C9F55E9FD9C0E29E7D36 
390,325,111 *27420EDAD9C754B7476E93B433BED17B4FE080B7 CEDRICK.OJITO
390,325,112 *274970A54147D0632247970918358C999040D1FB T
390,325,113 *274916D09D5FCF6800303C1891262AB092B7DD50 I
390,325,114 *274E5D3DE735048FFBD237CE9857BE556739A71F CENTRAINE
390,325,115 *274FA7B01A7B9A7E8FD99B6AC4CD26CE69B2B1C7
390,325,116 *274B528743FEAC2B9276C6714933B2E21201F132
390,325,117 *2746A65E2F9810C9ABA553B6A84B87C90245045D
390,325,118 *274745EE4D78431B15B45135D44AD1C2AF53A9D1
390,325,119 *2744465493548D4C2CC9D799A62603578E14421C cgip?
390,325,120 *274A8F1DFDBBC6E5E33B74219A19F23C57898BD3
390,325,121 *274201BA8DF95D464D22C82D90089BE4DEF3E294
390,325,122 *274A424A5936241F5AB55C2208D6C9EE0DD17A90 CHARLESLAZICH
390,325,123 *27411303A269E9BFCE1A79E2441459B924B6330B
390,325,124 *274540F03409F53417651D34838DEEE7A25013B3 $
390,325,125 *27468BD9A1BCEBE8D5D999667D28D7A32314A315 [email protected]
390,325,126 *27483A0489D1C409D999AFA0C8D3EA279E0551AA CHEATEU
390,325,127 *2745E33C0D6CFEF2FBA6F45B5A151EAA554B00AD CHLORSALICYLOV
390,325,128 *2745B7EE1B1ACAD74B61A4BF6D06E692FE5E327A
390,325,129 *274CC14B360CD64AE3B4A59A05C7188E0ADED315 [email protected]
390,325,130 *2743722AF4744E27D6C6CC3BE92B46010176A824 tv
390,325,131 *274E4F884D80357AC33FAE0C77210C20EAF26781 pn-
390,325,132 *2741F1922C607027CCE43ED80E9F7E7484071CEB
390,325,133 *2749E49767C141CEE7E1272A6597AD9D655384D6 ՛(:
390,325,134 *27447363A4A3464D2096D9D20D36855D2AF02A50 CIDAILI1
390,325,135 *2748860A0B6CEE105A277F72613B8E3384241F1D T&
390,325,136 *274790CC448CCF0E5C7485C72E1F060810A0334F +T#
390,325,137 *274F08150085566725A9B8EBEBF99FAC417C0578 cinquantacinquemila
390,325,138 *274856833A4BBC3971ABBD7CFFF2CC9CA0FF4B57 [email protected]
390,325,139 *274784DE6E5DF37C0128EC7D0A1266B9C53923E8
390,325,140 *274166E1923B6CA55F7C5D7522B6BF69089ED747
390,325,141 *27455E540EF24A84C0EBDADE50E2D5BFF5356EF7
390,325,142 *274B22378E2FA0A3E860BEA290804C2152B11D2A 
390,325,143 *274E289462872E889A6C9BB8C770F1C7F7B925E3 ckbpc
390,325,144 *2740FBB1D2ADA87B9B9C3C58FD8ECD1F06BEC7E7 %G
390,325,145 *274C88C92358D17BEA20ED4BFCB5A621E795949E CLAUDIO.BISSEGGER
390,325,146 *2742108909E0803A48CA80CD675DEFDDB5482982 CLAUDIO.DORSCHNER
390,325,147 *2749CCA10B76B52B9BA5391991B4365298A41E47 CLAYTONNORVIEL
390,325,148 *27400998BC3A43C12493D6DE01B78D20752085FF CLAY.WHEELAN
390,325,149 *274A3E8D201433842E52F65F4503D899BC06C6DF
390,325,150 *274B090DB79874609DC187128C797ADB83DF78DB
390,325,151 *2742770519EADD15E74E24E98A4771F9CFEBB99A baq
390,325,152 *274403FED27AC979CEA1FA0B972D570B415FAB56
390,325,153 *2742F8ECB9B23DD49246010314B9AF319CD1D39B i
390,325,154 *274E66640FD5B99FD89CF3ED6C135009600067B7
390,325,155 *274E86FF9D9B54D8695E76161B762826F79ACDEB
390,325,156 *27450E0F76E34BFFDE2322DA775F2F3CD3F3E664 r1
390,325,157 *2747236D7D8EFB5E63D859706F99C1B51956DE25
390,325,158 *2747E43EB39558DE1324617F9877BC19D22678B3
390,325,159 *274BF7D3E8CB232282908905C60578B60FDA7265
390,325,160 *274C9E64E1433C56234982DD04C796D7671C15D3 clrbj
390,325,161 *27428406581733DB5B291DE476362B6730F8D1BF
390,325,162 *2741E696DDB6BDAEC02DDB59A85ED2654F720C8B Yy
390,325,163 *27478F61B247DD357ECF6FDFDFD310378FB05063
390,325,164 *274CF9F6346293C2AA195CE9A5D41CE634337CAD
390,325,165 *2742E51F256ED9ADC05BE14450FF0C114874122D Wd]
390,325,166 *274932FEA3ED4537BAD9C646719DBB3FB93274AC W;;i}
390,325,167 *2745272C56BD188292217EF0E3B30024648AEEFA COC-4
390,325,168 *2745F0B43E1EF7D2CA139E62628933B5D4A93C45 C
390,325,169 *274F56CFB1F39E4487B3C405ED299D503E9272C0 CODOING8
390,325,170 *2740B8C4D63181AB119C98EC90595E6761618483 coincidedi
390,325,171 *274CD5DA978704B5A5B3F581C72D23DD722B4B76 c/ok)
390,325,172 *2749865DBD0C6A720E0D865531FBDACC494EE40C COLTON749
390,325,173 *27496FCA5C5A927FCC1DF352E3503AC0000669CD VMzS
390,325,174 *27455E113C7330BF51B6FC2DEECD5920B06186DD [email protected]
390,325,175 *274C8CB6DFB737FB61E6EFA117E1B83B87210766 (0-0)O~O~<======8
390,325,176 *27496B9E25B06747696A158B173D8259E9FAF013 c:\program files\windows mobile 50 sdk r2\samples\smartphone\cs\compactnav\compactnavsln
390,325,177 *27460D82800FA740EAAD540BCCB12277193E4635 CQ7N,
390,325,178 *274792A837E8412C6BBAD978A56224856CECDCC9 1789551 omassa-kirjastossani-t
390,325,179 *274C3AE035221BE565801DEA2845E6D85F870352 1914561 VALOKUVA.OLI.PER
390,325,180 *2741437CD0B1403BF56E30B3E575A8D8C51BECCD damienhearns
390,325,181 *274330B05E99F3A46D02C0B943DF1AD7116122AF DAMIONBALLINGER
390,325,182 *2746EF0FFB69EAA17609297E52A217D97142FE20 DAMIONLESCAVAGE
390,325,183 *2749D1082DB43FC895402F9B808A00CBFD268A0E 1 INCELENMEMISTIR
390,325,184 *274D26C72F1907C620E1C11AAD954A60E5982EBC 1MOSAIIKKITEOSTEN
390,325,185 *2749519DD52FE6285364A5B98BD926A6EA360BE2 1 MYYNTIPALVELUKOULUTUSTA
390,325,186 *274291F843DC6C1923EEE13F22C510BE19506FBD DANIELLE.UNGER
390,325,187 *2749250AEDF396E7C34220BF9F466AE2A09DA4C0 DANILO.LAMBORN
390,325,188 *2745CC2D876E82EB28A32BEF214349EDEE209DEA 1numeroaineistojen
390,325,189 *2746D1578E05D2FE14CE58DCED9F5E5B4F8689AD dariusrufi
390,325,190 *274D53E6BCF7DA0EC1FEED9120931B9491101347 1.redaktionsstandort
390,325,191 *2749AB11CB43938C5F981CFD9B56960F7C2554F1 1-tabyalarIn
390,325,192 *274C59537DF47A2140F08BDD0FB099081D621255 1-VC-FINANZIERTE
390,325,193 *27429673AC6A8D34F97C9CA432494EF63A35B603 2904552 ei-auta-muu-kuin-palata-radion-
390,325,194 *27440AFA61F31C74875E21F287C2B2DBE531FA5B 2-AUSGESPROCHENEM
390,325,195 *27447A810CECE90751CDF0C0A4D70007A51B9C50 DESMONDOIEN
390,325,196 *274C3180B7A6A4E0241E59EB1DE636ED79524CFC 2INABUTOK
390,325,197 *274A646F3894C7DAB2A056C6610B7F1CC9093029 df_g-
390,325,198 *274C7BA9DEAE501FE2FAB481705F031A698889BD DH:L5
390,325,199 *2744DAE96EAE1A11018E9DA2246A61BFCA864CE9 DIETITICIAN
390,325,200 *2748933C5CB2B075542FB63C5712C3BDDD92FC68 DIKTIEREN5
390,325,201 *2749D8A8BD1D5FD569E832CC23D43CB9F2EC7539 DIVYACHERIAN
390,325,202 *274FD313ADF9F65E88A5C781B419204C00F0844E d%jo2
390,325,203 *274307056EC1D802EB6AD6DBA34B3C993304E9F7 4NGELIN$
390,325,204 *2746F5BF6C564898120D76798FEA129DE41989BE 4SDLDNSL
390,325,205 *27417BCB12E18845E574562ED456F6615D829F5E 4TELECOMMUNICATORSBSW
390,325,206 *274AEC734363F6DD174BA72D9EDB6D4E429E7B43 583497 birsen-Ozakay-OGr--gOr-
390,325,207 *27439246407933FFF00697DEEC7A37FA59DF4148 5CIGLARSKE
390,325,208 *274B1E6BC87EE6816A14ABC4CE8C6ADF8FF9957E Drucie
390,325,209 *274D44637D96B65E904E98DFFC22EB0D0F346957 5.NiCHOLLS
390,325,210 *274E13B67CFA99699A4B2675E828040C4834DF53 dustinmugica
390,325,211 *27464F54D3626F2579FE5E2B504182DFE4112782 5PHENICAN
390,325,212 *27492F17937CFEAFB3C3CAEA8EFC553129DF5E26 5SOUTHERNIZATIONS
390,325,213 *274A0EC2C35C13DABEF816E4E8D1D196EBC57C9A 5SZOGEZI
390,325,214 *274957562A27A501D5479605B2768DD6553B2EE0 5unfailably
390,325,215 *274947629383AEAA4D072B837CA2A4CC325B2A3E dwwrlqc5
390,325,216 *27453D23E4467B32F8113D2060C60CCE648B8D09 dxc08
390,325,217 *274CAB37964F932AEBBBCD78F9E5C58E59FE94F1 dxlkp
390,325,218 *274DFD787E09BBA5C2AD7BF0E0E4B0E4074B6E27 EARNESTGRIFFITH
390,325,219 *274D05D98F96994AE5F2E0E06B2444A0975B7F8A EARTH-LINGER
390,325,220 *2745C0CC003588899D67FFEC1D96C0537D7DD7A9 6DESESPERAM
390,325,221 *27467F4ED6C943A81FD368585029B30E065C54C5 EDGARDOSAHLBERG
390,325,222 *2741B898F8F72BEF82CB5342F85A1CA940FFF22C EDICION.DIGITAL.DE.IMAGENES
390,325,223 *2747ED05E260570BC4B7F61E691CC2BC6772BD18 6GJENTAKINGAR
390,325,224 *2747F7738BE45E8E99B9BB04AFD24F1C84503C0D EHALPN
390,325,225 *2741DB755BFBEDD3E61B832593C8BDCDE88B50DF ehkisevsing
390,325,226 *27402120544D70295E0A1205DEB9C1A58DE08646 6SAREPAIS
390,325,227 *274EFF12AA7BA2BA104B05DBE0D2E7DF7C093B80 7BLOODTHIRSTINESS
390,325,228 *2748A141B8151BB7867FD58197EC83227709396C elspeciallinksearch
390,325,229 *2743C1EB747900A01E5267062B4DB6B5C63D851F emerald.dream
390,325,230 *2749F75B4B00C86A4D9EA830A1DD834EA5003689 emilemirabal
390,325,231 *274AF85BFA09A053E436D199953E69AD6B3A5577 7RACERXENTER
390,325,232 *274F411ED63C5290699972DB82B64A1F15F611A5 ENASTIHP4
390,325,233 *274BBE0427A87FAC3B4B401EC2C3FB63C8A1C334 enceldar6
390,325,234 *274CC3E413D397FBBE2F22EFAA24F5BC8CF084F8 8####b ~o ~o (-_0)
390,325,235 *274F94A20957FE10D992AC51ADA6CCE0DDE68A9A erinosuch
390,325,236 *274D7FEB9D399953E26B7923C86C86E90BD3E0ED ERNa
390,325,237 *2744CD01350089AADFD44D15DDE8EC6482FDF1D7 ETJ&_
390,325,238 *27400DFD8EB32F66B55DB47DB5E5759F3E7EA9E5 etsoced8
390,325,239 *2744C69ADF42CCBC59AC372C4E067A7F58C67EA8 9CALIFICAR
390,325,240 *274AE1B8DC37641B6CCBE0634C8D9E6E78B2AC57 fair-tongued
390,325,241 *274CA665B559145F2041D9BD3E9873C857023DDA FCFHHTN
390,325,242 *274F341B321940556BBC3159397C2EE4B4B66223 9PERMETTUTO
390,325,243 *2744EACCBECE63D2EBF6A656ACCC1EB4DAFC3B2D [email protected]
390,325,244 *2741B4C6ECD8E8C96315D480B9480D27F531B360 FERNANDO-GUAMAN
390,325,245 *2744645576D13461DDAEA909D15231CD3E01EC91 fetishdavidbramwellpetrajoy
390,325,246 *274CFA134E04576CF42E3F364257C1D72DC9E733 a4a/a
390,325,247 *274F76010D72351EF42FC64FE8AFDA25A5A0BF48 FORELSES9
390,325,248 *274AA30BA6845C3256A2B4963F52F1BF8C49BA5E aacodm
390,325,249 *274C608FD3E76D00537FAA7B9D90C72788B143E9 FRANKIE.RAGAS
390,325,250 *2744486019096124B3822A82874CE0D4414CF670 FREDDIE.HAGERTY
390,325,251 *2749BDA6B5BCB8BAA1A3FC4087E8E12364984AB9 FREDERIC.MCTAGGART
390,325,252 *274DCD05C66417F958B60A0E069E20AD10C85C88 ABRAMLERICHE
390,325,253 *274B2CA9ECD4B208EF8AEF1E4212602920F0F76C fteq2
390,325,254 *2740AAFF13CAA7DF88535B25502519159BB9649A gailsherry
390,325,255 *274D9F754554755E949E435F4BDD053A027AFA72 gandzhan6
390,325,256 *274951991383A18CE19AF01D60DAF752FED37F2D [email protected]
390,325,257 *2740B0B1FF75FE42F96B95DCCC5B4F045F591A67 GARLAND.SKEWIS
390,325,258 *274655B70D8A09D262F7703030415B4373A1A062 GARRET.RAYOW
390,325,259 *274A2B5FA0DE726419624CC79CFBA663694B88B6 GARTH.MARTINY
390,325,260 *2744B151D7235C5B2BCFA88468A0A354E1284DCA ADRIANSTEADHAM
390,325,261 *274B96C523F77836BE56AAC678443B4C73E82ECA g>d[
390,325,262 *2745151656608570C717F3B4156B5486E7431AEC GENARODALLIS
390,325,263 *27439F796DA4BDACFB8FFE5C9E9872B2B0880B32 geninfo:12pw47sstjne.
390,325,264 *274DD51523367CD50B5FE192B2255D9999362C79 GEOGINA4
390,325,265 *2747893D876E34F990A2AB08D9CEAF9125FFFE9A GERALDROVIRA
390,325,266 *2749D8A3B9C7EE6D7C9148C6380131B3124569AA GETPAID(FEATBADAZZ)
390,325,267 *274414CE1758C2ED5F40E52211BBC430DC724844 [email protected]
390,325,268 *2747A0C6E19D7C187E24E49810FE346994804C71 giailsole!
390,325,269 *27451FFDAB1F1FCED3C3DE48DDBD7CC44A324CFB gingerpaladin
390,325,270 *2741F9144F3F0ADDBBAEFF625C9430554A232345 GIVENUP9
390,325,271 *2746B887FAF18244C9256318E3761D9DFAF68555 ae;if
390,325,272 *27449A8FB5D8FCB173A5CC8CF89C21ECAB88CA1E goepfert9
390,325,273 *2747CEC037399CF83E148759CA9D9DFF8CE03B86 GÖKOĞUZLARA
390,325,274 *274CA6263F4CDB00E6089843D922B367BB36158E A$FQC
390,325,275 *274B7AD67E7C123DC438FECA0010EA7C0ECEDE73 gretchen+
390,325,276 *27494B502CB07667F07F74221C2D755D6E4341CC GRUNDADE2
390,325,277 *2749448220834560702E81C15904C269ED12D2B1 ahmadrogoff
390,325,278 *27495D8B5DA6305B335A0783652FC63D0B41EC0A AIRALPSDORNIER
390,325,279 *2740B37B843BA8483D4CA35CE59CE938B133358D AJ7
390,325,280 *274A67938B3F612D528742A817010806BE5B09BC H45076
390,325,281 *274B6C05441892A1253D369388E385E76D8F9576 HAI.NORTHCUTT
390,325,282 *274CA0151EC656DA5DC53349B17B1DBA6A99A167 AKRGG
390,325,283 *27447652CEB6ACAF20BEAC55216FAE7F03894927 HARLAND.HENNESSEE
390,325,284 *274ACD1752F94AA1AF770D7A93B37CDD94E84B42 HARRIS.CEPHUS
390,325,285 *2745F9F838B75B816E41E0CF5EAA23AF4B48CFEB ALLENHOCKER
390,325,286 *27424B6EB4C187EADAE646BEC9EC215B6C318BA7 haywoodhassell
390,325,287 *274BA62F6D170419D6D016D671FF935A4DDCDF4F ALVARO-CUESTA-MARTINEZ
390,325,288 *274088A8D1E84B20A3DD9D9BFB02B657547EB6A3 HEGARIS
390,325,289 *274566135BD4DA99470B71F949D89A1449831641 amuritvaleriulazarov
390,325,290 *2749F499FE0CE9BCA09F803C885B9C92BF3BCC7C ANASTASIAFARADINA
390,325,291 *2747F084A09145E42BAF47E0F6CE197A921F2600 anwma
390,325,292 *274D35BABBE3E1715F16AE685BFBD10A993D8F00 [email protected]
390,325,293 *274897DE6B7F5ADDE8C5DA8EBB9F8761B4D4B69F [email protected]
390,325,294 *274001590F68AB34DB3EA998F1346004305E45B6 ARELOMMI
390,325,295 *27472BBF7DBE3049E0F431C51962579C2D247D7F HUBINONS
390,325,296 *274060BDA1FA3A20BDB5881CFA7147FBFDF00A30 ARMANDO.BRANGAN
390,325,297 *274851E4C22E1240EC5246BB40F6D88A4F981084 artegarf
390,325,298 *2745A5AE7389C2FC0BE19C074A4DD6499C7B406F AR:WY
390,325,299 *2748256981DDF91D6D0B6BD713A5EDEBA3623AD8 ashleymacdonell
390,325,300 *274E665F274BD7F5D1DE579F3E975F26A09691B1 A:.TK
390,325,301 *2741D7DEB44B55F43928D7EB41E8936F577A77CA AV8R%
390,325,302 *2742843227A75C00CC389B840E0E60F3BFD4C7F4 informaticiennes
390,325,303 *274E0B270DFF8EB01C1E9F1574C023B381D27687 BARRY.SARRETT
390,325,304 *274A05754D2713456983B88D1A41614E8F0B2A79 i.v
390,325,305 *274930B4A79BB0F156E3C4FC2577003C1C87E992 bcg2f
390,325,306 *274D72CF193A043002D3D07B8D5D9E7A6E79A7BC BDBM(
390,325,307 *274FEE17F6B98E7B03EAD662EE4FD16E755989C5 JAMEANNABEL
390,325,308 *274E8C89FD19227BCD6A653DB358CCBE5C20CDB2 bek3x
390,325,309 *274C822B2433F50FA6B79AC5B4DC11E65450E70F JANDRAGON
390,325,310 *274BEEC3784DE670B0BA1C9FA0A32CFEEE526850 beufz
390,325,311 *274B01BAE60B462F198A86C3ADBD22B9EB1FE792 B?HI8
390,325,312 *2747B0386424E51CB64F80BEF76029F27133F42D jeffereywinebrenner
390,325,313 *274B9EF44F849ED91CB2E865F498022105A608C8 JEFFREY-BUTERA
390,325,314 *27414B89B54359DF53A1D557F7A1ECCBB0C51682 BIG-FERRO
390,325,315 *274B5965C38E0DD9B1DAA3123A461D40F09455C7 JEREMY00705
390,325,316 *2743945D2304FC25AFCC62A8DDDA4BE3A35E594E BISTRINO5
390,325,317 *274D93AD2D5B7BC5D0E38E21BB6FFFDE78B71D32 J#GO
390,325,318 *274FC9A8E14C0A0423572EF7FC840ECE8EE0424A jillcheer7
390,325,319 *274CC61B054C8F0812155837057D53CE4B6BA978 joelbaygents
390,325,320 *2743C167E083A67CB98DCE7C0D345E7D65B9A0D2 JOHANSVERN
390,325,321 *274C800B43C20EA50B68931892EE5B063D10E74D jonahtrecroci
390,325,322 *2743BCF890C2A2CABDF08BD18DD37E6328E30D28 jonascrager
390,325,323 *274957413DB047867963DFBDE7C83C0D3FD3385A JONLITTLEFIELD
390,325,324 *2744033DB791ADEBCFA1A509B23D219E87F5AB6A josiahmalachi
390,325,325 *27419412C64C652C69D00461D49CC82B62511F20 josuedancy
390,325,326 *274739B8C3F9B0C7E8F713F08EC479633101DE9E BOBBYMINE
390,325,327 *274EFEB645ED0743050C00C3F96DA48CACDE2A88 [email protected]
390,325,328 *274B2048A575C13A0386FF4BB5CB865F301A9831 BO+IN
390,325,329 *274669049677542A70EC035CA52AA86583522A44 JTUMANLAO
390,325,330 *27447B6BAE6191624CD584F8B5A002DF06D0365B JUANTOFFLEMIRE
390,325,331 *27467D62287E8BFD3EE7F708897250C2814E5A64 JUDEBURTON
390,325,332 *2749B52E3089AF390C489719E4D716145887B733 judefrans
390,325,333 *2744E09C5A66FAB00807A36CB9BCFCA5D951592A BONGO(L)
390,325,334 *274E03B767F04838C62D98DB331D68CBC78CD7CF boo+3r135
390,325,335 *27411D3D1D2B7874D0802C63A102B0CAC8C707E7 justinbarriault
390,325,336 *27479A6876F6823759A2AB45105701FBE7367F02 BOYCE.BOLYARD
390,325,337 *27454AFF408464E92BC775322AABBD57A252B517 bph:.
390,325,338 *274738C5AF1D6ED5A364B7B75B9019D743335BC6 karissasweeney
390,325,339 *27434959F825BE0E9D28F636CDF21D9FF59B1224 BRIAN.VERDUN
390,325,340 *2745ECD49C11401D5DA571A1E0B9A91F8F1B3BA6 bsh%#
390,325,341 *27455E945BA68F6113098714DD1C68D4ACE6137E KING.GARICA
390,325,342 *274E79006646E4261C115829FDC85366AA54A74C KIRJALLISUUSTIETEELLINEN
390,325,343 *2741A09E919B5F398F8B194D4C12754F8E013423 KISHIAJACKSON
390,325,344 *2742F339869D36EDBEF74C2C436BE7487F9BA277 b&ug=
390,325,345 *2746F2E67EFD82D4E4B130DED9DBB9BD408108EC koudosa7
390,325,346 *2749C73FBF34AE87ED999B261FED1393E18C5998 c0rnice5
390,325,347 *27467414EC2B1A7A246DC8FCE2F9EF72324F12D0 lambert-sa-|-france
390,325,348 *27415F2AF68D7AABCDC63C6CCC9EB317ABF5F348 LANDING.FEET.FIRST
390,325,349 *274BB0AE3F071B6E3B665238D55B871197774C83 c7(?
390,325,350 *27449481BA2C01787D79FBCB2CA55F5F3E908561 CALOPAAN
390,325,351 *2748CCB8BD7AB742FEE9229F9F0C08C8393260CA LE LANGAGE DES FLEURS: JOURNAL
390,325,352 *274BBB13EF6D7D7D4C802F1F2ADE63994EC9D788 leopoldocampione
390,325,353 *2743E6F6EFED098334C5D106F4FB70FC6C7B6F25 LESPANIER
390,325,354 *2749A0A81A8BC2E26DEE5ABDB4C9932C4F0D84F0 C(B
390,325,355 *2744C1B7CFBB215A6E57907C3A56F06E736F2F0D CCENSOPLANO
390,325,356 *274DFD51C16BC43BDA5081D8011D2847F57C5FDB CC.UA
390,325,357 *2741A2A86EB5143631D8C37457E18B81AC432CC5 LINOOHLE
390,325,358 *274F9D54C423DEB2417D2942EBFC1B89FB85E1F0 LISA BROCK
390,325,359 *274991C1B3E801052100AECC7CB74B2789411BB2 cdtmm
390,325,360 *274F51EBC999AB43C910D417A0046DB7113B5653 C:E$D
390,325,361 *274D0D60F85E833C63A72D4AA1338508CB213491 CEi;
390,325,362 *27427A8D98C06DC1419B075C45F7AA614E132D6D CFH3G
390,325,363 *2740C441D6DDCFDB8B4DD766221419D62BBB0BAC luizoctavio
390,325,364 *274803FCD2630759C0EB899DEA5654BC6404C741 [email protected]
390,325,365 *2744F14C7E2D2F648D92B77255A92FF8D65C3777 LURALEANING
390,325,366 *274EBB46A875621A25454D65A3A5BDB1B6EA2DF3 LYNDONDANCHETZ
390,325,367 *27429D78A14CD7841D89531CD11554E1887D040A CHET.HAESSLER
390,325,368 *274793776729C581D6BCB0AD5C56E0D2667A0271 CHTHNPHGY3
390,325,369 *274988E7C7D154D5C1A4FC63ADFA35DD3B6FCF98 c(k,
390,325,370 *274DC42C075722ED3E322D8B0549FB8CFF620763 MARRIKOC
390,325,371 *274B70E1925670FDB6F5C234B505888E54F8C41D CLAUDOUTWATER
390,325,372 *2749C0E2B3D4C9B118063B5716842CA23B0574DE CLAY.YANOFF
390,325,373 *274BE6A0F6497E49815A3676B5655947E4B56B75 matthewcordell
390,325,374 *274F11440BD43B4CCA334DF3823DD2B067E6DA96 mea$urng
390,325,375 *274A7EDF62364A5F625F97047B3CE6833F6C3FB1 cnk=b
390,325,376 *27478A1D9DDDFB2629F5424039A98002D56AEDC0 MEMII380
390,325,377 *274395AD9861F412C33DFB525191FF35FED5B75D [email protected]
390,325,378 *274FBD69050D4755ECC03846BEC898090F8AE723 combus7bl7es
390,325,379 *27415396DB65F5731C04A17A2DD1D50BEF8FD837 [email protected]
390,325,380 *2740368C575A3604AF9B46A87B65578527E5A942 mingxia's
390,325,381 *274B890C9475F9820221D818BD9044C99B3F4F57 MINHMOILANEN
390,325,382 *27459E0303D94886E11B2D6B8107FA6498E5FA70 CORVETE
390,325,383 *274399F9FE57EF8BB23F237E8960B09E92DD1621 mjcs
390,325,384 *27402D9BD22A5D3BE95DFE20B9F46D6C06DF4831 MOSEINCO
390,325,385 *274882563759B35F04EBD8C67B386F512FAC7B63 mppg
390,325,386 *27422C630AEEBD7695CE10FA7BF0F2E0794FD4D9 Ct"4
390,325,387 *274817C299FF6B9113BEB2CE254A4897DCCB2D53 myannie777
390,325,388 *274BCE335BF0D81D16BD50BDEF8991E6AD32F46B neha.janu
390,325,389 *274E20A2604DCB6BB3EC5660C04CAEB6C713CC4F D3GO"
390,325,390 *274B3173BE71854BEDD798A035CBF23B2293F947 NELSONBRYNER
390,325,391 *2742CA01D97528F88A9168646A60539F897EAEA5 D4CKI
390,325,392 *2741AD009EFE18F13730D662912C1234D47F48C5 NEUROSISCANROCK,NEUROSISCANROLL
390,325,393 *274C6DA41E8E33FB88C324FBCEE383F273A36580 DA$MA
390,325,394 *27447A8766A2B7B7DFF444FB657B2D492FDB6696 [email protected]
390,325,395 *2746473E80666EB065DB4D548605C7A1487BFDAB [email protected]
390,325,396 *274720E7CD0A27F531EB9FFBDEBE9BAB0F31137C DAN.CANTFIELD
390,325,397 *2747878C5A9506CB422770240743AB0C022BFA3B NOCOJASMIEDO
390,325,398 *2749CDE3CD03D8EB54999B474C123D4CC8D9C1A3 DARIUS.EIBEL
390,325,399 *27445333F4DA4DC459EA2CCFF45959F9CD0ED1C9 darwinsienkiewicz
390,325,400 *274B5793E876D5DB437CF0140CA4D08F0B6BE1EC NORMAN.JARRAR
390,325,401 *2745B5E2844A833B15BC90D9C8B5DE1CD3DE93FE d)atb
390,325,402 *274E06CE3345A12F42035E22FB1A9E4C4E41169E DAVEASSUM
390,325,403 *274E7FF66BEDFB87E096ACDCA92ABFF4888FBB02 ODIS.EASKER
390,325,404 *274C5CE27752862280190F595BE69A9E8E05DFD8 OFFICECOMPARISON
390,325,405 *2747A3DA1133D8F9F860AC273E4AA2F00E80C875 DEBOER.WSAWHV
390,325,406 *274D22101B58C5FCAFC9A4B00215804BA17AA216 olaniyiisaac
390,325,407 *2740F29D08986054B459812BABB9B898881C429D omaramor
390,325,408 *27464D7BAD6DDBE7026F081A09981355EE79B566 [email protected]
390,325,409 *274F26D39D10A746F1C85E39836DE65FFCE216C2 onavarapmi
390,325,410 *2748BA49AF216223F98FC49EC9747F08E53184F8 orvalsprengeler
390,325,411 *274A2AEF967F722D5864A5EA0D209268284D03C6 ORVILLEEIBELL
390,325,412 *274723C5657300F0EAB609B1C975D3FACD020F44 denissoldano
390,325,413 *274FE61D788361696441F068B7D17B66EDAF2922 OUHKAA
390,325,414 *274DB920B46B16161B89AC14FB7001C74D0A2EBF outdoorconcept
390,325,415 *27447E99980267F31319822F8A1A68070611653F P1023-1027
390,325,416 *274E29EE230580E2C32498F8C54F1DB054A0AE8A pancreatolithotomies
390,325,417 *274EABBF3A58459682D9DA34DD107AEEFA89965C [email protected]
390,325,418 *2743B18A01C36DF4CD776E3B79E52DD6222F23F9 patellas
390,325,419 *2743DAED9543B40C102BF8A349B579552653E701 djjp)
390,325,420 *274AC0A1BBF0C07EDEC8CBA0198672229411F656 D=K7G
390,325,421 *27476CDAEFBCF5990515B91073BEBD0054408FEB percylamorella
390,325,422 *274F11819AB32FA22E5EFEE14221CA4DEE80D677 DMn-
390,325,423 *274EB9368E9CFA6CBDFAD01F5AA96B60415245D0 dodownload
390,325,424 *2746A62D9B89404551FE86208FC9F228A04EF621 dominiqueible
390,325,425 *274EB2195B6F43ECA3C1BDDC9E7431D44FF82059 playasderosarito
390,325,426 *27457AC851AB58E8E4AFF82F19FD484C900CB37C QJEE
390,325,427 *2747ACADE3D47C6ADA4E76AEED74970F3EEE6D6E EGP1S
390,325,428 *2743E91C00624474F73305F53888F847C80D5959 RASHADBETACOURT
390,325,429 *274329B41B11F35D5AA7C0F0B16B5C41A9A0DB08 rashadlundeen
390,325,430 *274062C9BA82F68E12BB1BC1EA107DE074B55C98 RASSORTIE
390,325,431 *274B8EBE32C4F4474264B45F39DB4A0EF168495F EN75161150
390,325,432 *274204C43A8D843E741CF50175DC975E4715763D [email protected]
390,325,433 *274094ECEE4A71EAAB61F29891A9D345F4D8D7D9 reidmeckel
390,325,434 *27483707EA5A1024D24F5D0654C4F7CDEEA52DD3 EReB
390,325,435 *274569732F3C2BC55649C39B62561D9D98755C3B rememberthough
390,325,436 *2741B65E6ED4C2FFE643C188051676D005196A60 rerollses
390,325,437 *27429959CFFAA2709573EF1838DB06F9220E7AAE ESUERTSI
390,325,438 *2746DC0BA872383A5AF077244382DAE3CD8A89F2 reynaldoandruzzi
390,325,439 *2749DEB1F3DC24047C79493A502FDE0E1BB3E2F9 ETLUCIPA7
390,325,440 *2744F5731C2C957ABEACB6B3FAC19BB18724240B RITHIK333
390,325,441 *27421217DC00608DB52460479A31F0D27B88BC70 RITIKASETHI
390,325,442 *2745E0600318267206A245B60791C0259347B3A5 ROBERTWR
390,325,443 *2747C42420E216B31A1438C0E0208E6A456996C5 RÖDVIKEN
390,325,444 *27460C35A7899DCC642211B6FAE491BE2EF14EB7 RONNYGUNNELS
390,325,445 *274AA3D5C59E9BD616D684CD78CAFEE82D7ABF79 RONNY.HEBIG
390,325,446 *2749666DC627D284B20D86460AB2287BD6652B5F fasttrackfocusoncoalpowermaycostindonesiabillions
390,325,447 *274A620D8907EBBD3CE631CEF773820E9AE70D79 [email protected]
390,325,448 *2741E5E8FBC61AB4FF6ED9BCD91E72F7D0592F45 ROTIALA9
390,325,449 *2745D200A5F42F2A7B17338572F5217DF598F8E3 FELTON.AKSAMIT
390,325,450 *274ECD509C7C1F55F4504760C2CA28BC3014C001 [email protected]
390,325,451 *27443A91B1FB170342D83E9CB68AD3E89ECFDF30 rycei.u
390,325,452 *274AA5C8A79505543C92F09F57A0AA7C287AD39D »SALINGERJEVE
390,325,453 *2747A07DBF8BF750069F6A268817F79903B28542 FOSSILISATIONSBEDINGUNGEN
390,325,454 *2741576B3DF8AFA8E82E76E4ECF21790D67F655A SAMMELFLEIßETS
390,325,455 *274833A58F58CDF2310FD274A8E31E788F1629D1 FRANCES.FULLENKAMP
390,325,456 *274D9E02993B5D3BB9FE08AB7AAE5A5686C04715 santosglassman
390,325,457 *27432977C7C8299569E9D7BE19944D2DF48DB907 FRANNEL4
390,325,458 *274A57D8E56AEF29CBA3A8CF602E09B710243EC5 sat,
390,325,459 *27420AE09C79EA21B361DA2A9278A200338AE630 SCHSNHLB
390,325,460 *27481CB3F13ED34F3CD2C6EF9ABED047B5159E35 FREZELIERE3
390,325,461 *274115F5EFC9609856489FA7758AF3EC490A77DA FSHIKOKU1
390,325,462 *2745122ED888DA2646586DC3335CBA2595AB37B6 SESAMEBEACH
390,325,463 *274A55D86A34B8EC44F003721BC748C62856642F gambaianied
390,325,464 *274D50EF6313B176B4FCE8B14F32B71C01C9DD80 SFUESSENED
390,325,465 *274464695EE804B439708FD1869EB581BFE1A532 SHAYNEKREITLOW
390,325,466 *274A26699241F127C56B36C3B5E1606C7413719A shaynestoneback
390,325,467 *274ADF8B378FAB22740D74782F29DDB90884678C SHESTOPALOVAK
390,325,468 *27445BBC67A9FABFBB70788A21F96BCBEFB25B2E [email protected]
390,325,469 *2746B54B46E6F173478E391700279B71A305B5BE sidney.san.jose
390,325,470 *274BCD43EF1CC881BF95C1578E64746BBE0D0CBD GITLEUGSED
390,325,471 *274A7CB2DA8EDC4155926B286F71C929D5BA7866 gnillepu0
390,325,472 *2745D5BC18C3EAF40FF5FB405BA61E82F502CD53 graffitilyfe
390,325,473 *274359549F96C581AC66A3EEE803B9C695D77F4C [email protected]
390,325,474 *274BCC61BBE6678D47A9E92387FE14E11E2C3B10 [email protected]
390,325,475 *274947FC8B304F1AFD4AD14A2B505074DAF3176D [email protected]
390,325,476 *2746A11A1BFED643EEF0577BE10C891A1B84030E SOTAKORVAUS
390,325,477 *27433CE0A5B148AFEFCAE9B45D21992662203D7C srsnssses
390,325,478 *274660788F4C76012ED2582295897761F2696653 starueds
390,325,479 *27413E1FE2259B550BF49ED92D49FB0145265866 stephaknee789
390,325,480 *27415E52E0EE1C953939A9DFC4448BBB78C1967A stevensalvo
390,325,481 *2742443FFF2C44743DA0D5DB73E9B3BBD30CF958 STNEIAHCELLA
390,325,482 *274C6BC7AD96FCA7B32F7D5509D716B967AE0EC5 HETZENDESING
390,325,483 *27429DAA5FF3C65A1F578A99EE96C06DDD53E2A2 STOWEJACK
390,325,484 *27430447BE4385E41B099C2D1FDB07DE248291D3 [email protected]
390,325,485 *274A9320E6B17B8AC40E94015232F650E2DF9D4F SUBHENDU-CHATTERJEE
390,325,486 *27447BF5E4C4B75095E5D8A91DF66BE01AC27507 suddrey0
390,325,487 *2749380CAA504E205CDD127DDE091E96BB8C6FFF SUNBAIJUE
390,325,488 *274453CA8825D179796C9CF8725334FA392399FF HOYT.CUBINE
390,325,489 *274CFB6E3742CA069D12E8D03C51D971F8A32799 SUZETTECMA
390,325,490 *2749DEEA280D95143572060C75BB415E4C5E712D symphony no. 9 in d minor: choral "ode to joy"
390,325,491 *274FE6C67BA9A02D0A265CA28232652E08AFC4A5 I DID, I DID TAW A PUTTY TAT
390,325,492 *27413B0FFB2B1A1FCC0241B29C4BBD4DFC72852F ILOVETAB66
390,325,493 *274FDD5B8C1B972073C0C027856FB3F63FDA51F8 TANGERE-1-0
390,325,494 *274A7BAD0A3F83E370AEFF139A629D8C2443E948 [email protected]
390,325,495 *2747BCB903AB482E1709BEE1F19001902CF6DFB8 Tarde.de.cansancio
390,325,496 *27406E048D9A0A929AC3E44332DA5AC5124A8591 IM4MM4SRUKINDIN4MO
390,325,497 *274FDB56ABA2303782334EBA9762A8D944734DF5 TED-CULLEY
390,325,498 *2742E3E1A6AA30DDDF21D8C862DB1B2864AC970D in5urrec+ion4lly
390,325,499 *274BC54EDF53B9AFE272C78D027D35A83583CB63 terry.chua
390,325,500 *274F8A23FBDE66D8EF24739C21A62F6FF2C80442 TEURASTUSTA3
390,325,501 *274A8E86EC4D5C52A1CB456A00DFC49732B7DAF5 TEXTILESROMANOSLTDA|COLOMBIA
390,325,502 *274137856247AE3ED9D9DAF0CFD5E6B393BB85CB ISOELECTRIC?
390,325,503 *2748CE9C9EE303C310EEA3AB4BEECC477592F965 THERON.KOLIAS
390,325,504 *274D3865B06A2E479BCD41F4D76F61B3C29EC743 JAE.HOLLWAY
390,325,505 *274FC9C1A3FDD632D60CA5CF4FE5A2CAB65F8AE7 THULI.MAJOLA
390,325,506 *27414F3DBE378B43DDA6E307250F85845235D0D4 JARREDKUSTERER
390,325,507 *27405284C7D9C04895AF4CFD417D3495DB00C863 [email protected]
390,325,508 *274C5282CBD67F850C597CA54E7B0A1C53135905 TIRIKUTEENTII
390,325,509 *274756CE963A3AAEF1A2455D783986153DF98AE6 JAZMIN-FOY
390,325,510 *274C8149CE80AA6FEFC46EBFC25AD24E532BE75C JEAN.CAVAZOS
390,325,511 *274A8AB346774E16C0E3ABC1B2C4D623D174E7AA TONISHNESSES3
390,325,512 *27412BC992B2F78C87A26D37192C15B3F6FE7374 JEROMYPERKIN
390,325,513 *2740458ECA381F77132E26354AB15593C86197FC JKMEDCAL3
390,325,514 *27449BBCAB8AB2AFF6E49BBE2A24EF618004E903 JOHNNIE.YUNT
390,325,515 *2744084D937CBE82683D2E319AF18C60D126480A TRIEDTODOTHAT0
390,325,516 *274B4964EEF3033FA4F22D209DD98ECC8662EAFB trimaculate.
390,325,517 *274E91BF12BD97AD820AFBEACFA11B8D9BEC3BDB jordanmartha
390,325,518 *274B06772181FED8715B1B64918CCE359EA1E549 TROMBLIES
390,325,519 *274F109BA38E96F589C5A4A1C17840107307868F jospehbakley
390,325,520 *2745A1DD322B2A1B1CA0808D1783443A81DADC49 TUTUSUAL8
390,325,521 *274E200872DF0702655715E9322CB8829DBBD6B4 TUVI.COJOCARU
390,325,522 *27417BE8D229B0E2E15D5BB87CD29BF405368DF9 [email protected]
390,325,523 *274AA44D65E55F2862AB87D74FECD47F6833837C TYLERGMINDER
390,325,524 *27406664DCBA71117B9A843F6E329BDF2D4F7252 TZIPI GEVA
390,325,525 *2747311990B369F80821BD832DADFF1EF82DEFE0 K|9S
390,325,526 *274EDDF422C698131D90C6350DC331C7A1E03CF4 UKKKHHHHBSW0
390,325,527 *274951BB8A03D04C7E2E6C8F898DA0250DF80963 KAZVĪN
390,325,528 *2745A17D673B18BB81B971C0FAF027F8BC65E5E7 [email protected]
390,325,529 *274E2B524014C151FED810146A4EF8B749FBFCFB UP<MSG(MENTION
390,325,530 *27436B10A83854CC38BDF87D7560CD20D31828CF KENETH.HELVEY
390,325,531 *274B1E03861914D2238FBEDD4BB1CEAA38BDBC62 USELLERA1
390,325,532 *274146FC2E9C2BEDB187AB94C62303A60C22A399 KERMITLADER
390,325,533 *274A0D9D0A3694F6C23F81FEE7646FEF29950EEC KERMTKERMT
390,325,534 *27409D7B9F453CB5661973197A8CC174F21EE400 USX
390,325,535 *274BA0813182F2B877D2BD7547BA05F01DA5CCCB KORYKULAK
390,325,536 *27490D95F479361E23B58BAFFA48CD2ED85B8F35 VELKOLEPEJSIMU
390,325,537 *2743F518F553D7C6078BC5776713B8254744C3AF VEVLTBR
390,325,538 *2746126C8ACE35CFB15B312F1C38C8864C965DED [email protected]
390,325,539 *2747A702D7AABEBBB5DE9848DA68621332E1FBC1 landoncuffia
390,325,540 *2742646A954B1A82328F84CBB8661452D42648D2 [email protected]
390,325,541 *2740797EA1D2BA3CF4F2AC6AD2CD13F6467D998E lenny.dee.&.darrien.kelly
390,325,542 *274F683BA751AFA7CBDEDB61BB3C35735D7D4FC4 V*TH
390,325,543 *274A64239DD5477564CBDF43451123DDFA7DB3AA walkersymmes
390,325,544 *274CBAB4FFD4A28EE975EB6939FB6D7789AB7C75 [email protected]
390,325,545 *27423D5DBD7F6F53744F168691B58C146EFAB58B LLOYDBONN
390,325,546 *2749969370ED30B273BEB4FF2798B7ACD57C409B LONNIEPALLOTTO
390,325,547 *27487F98E010E21FD0AB61A3CF67F0A36C61FDC4 [email protected]
390,325,548 *2743FF5064FAFE55A87CE70BD5CBC5FB84467827 WENDY.FALCONES.GUZMAN
390,325,549 *27418923D3A9BFB20F776073289AC2F3DCCE800F WENGNY
390,325,550 *274A8BFC8A624F4B5B960BB29EB3A7CE439A522F WERENT
390,325,551 *274E079956D0BF250FCE379FCD63BA96B92ED2CA LUNDN-WELDEN
390,325,552 *2748A9188736E7F7A4369042BB8A67D856193818 WHITNEYWILLCUTT
390,325,553 *274CAC412FD0CAEC94DB500A0CC68A3AC630AF39 lynnmalfatti
390,325,554 *2742DEB2927A5F3EA5DCB78A03A02B8AC43344F1 MACINAVO6
390,325,555 *274B6CAC394127B161A69FBADAC61B13FAC129BA WILSON.BUHMANN
390,325,556 *2740CF998DCB5446592C32726BC68EDAFC166B76 wiltonstratman
390,325,557 *274008FFA6599694CEA188C72FE53620568FA066 malorgani
390,325,558 *2743EAEB707A9A84FA455429EAEA3EA0880B0817 winston2010
390,325,559 *274FDAA69C55F46D55C5AC5E2FF99EAA38F5522C MANGILY5
390,325,560 *2741D6C4AFA9648BA82C65350EF47E8E86294FA5 MARCELINOBRUMITT
390,325,561 *27409974566E29C54AF016449F09BB6C36A3DEFA marcelodutt
390,325,562 *27464F70323464AC55BF89CE6EE633A92EE40E6D marcelschrumpf
390,325,563 *274EBBFD8BB4EC2D5D18A4221CFDAD6702230B5C MARCISZOWI
390,325,564 *27489D5F005F6FF2B36BCACD8B80A681359E7E26 marcotombs
390,325,565 *27480FD3E215ACCD1ECD67569A9C0614B9BC8844 MARIANO.BASCOMB
390,325,566 *2748730CDCE844E41ABDC0A85D1CAF00DC575B57 [email protected]
390,325,567 *2748878F4A3AB96A18E5C51CF293802F17BEA78F MARK-RAYFIELD
390,325,568 *2742A175FB88051A789D9DD39F6A2B3332FFEEB6 WWWAECFORG
390,325,569 *2748B8340F59D36D733B14623187F90FEE4DAA75 MARVIN.NAKONECHNY
390,325,570 *2747E6F1003D6899CEAE23257AE130AC918091FC [email protected]
390,325,571 *274E03C24AAF1DEF588E06A64A242BBE5FDA489A MASYNRY0
390,325,572 *274B5C9750FC0E42160CF0492FDAAC6BCF3BBDEA WYNAND-WITTSTOCK
390,325,573 *2740A208CADA43482A4231B4586910D002AA4764 X1O'
390,325,574 *27465936B002203144BCEF9CFE64A4391A40D748 {X}.*.*(###3
390,325,575 *274B00C09871F1464C98F55EC9F6AD1FE5E06981 maurohetrick
390,325,576 *274CB52151486436B933CA8B09150744912B75A0 xclmtfs5
390,325,577 *274FD651B90A69E74DC7B074C28144B38E93D5D2 maynardbrethour
390,325,578 *274D8083B1410302CB75ACD201261309F924E1BA MBOMMALA
390,325,579 *27461E3486DA1D530E9C2A0BB52F54D2D9BE1502 MC%*
390,325,580 *27482A00CA8580B4C09AED6A05472F68FF8B89B8 MCORLAN)(*
390,325,581 *274F292B0796BB1E309A9F8BE3A0EC11A7CC8CA7 [email protected]
390,325,582 *274D82DA8231AD15A017593C822C329E8148CBE1 MD.SATRIA
390,325,583 *274895824D21E1CB27F94F9F617927EE457F9971 )x(o~o~q#p
390,325,584 *274F88F25ED0C9ED8D28F81BACC466F077E9A599 [email protected]
390,325,585 *274CD030523E0083DD7E1853BA052691FDA640BE melvertlyn
390,325,586 *274954DF49D7B199237F06F7A214F4D4E25E7E5D METHYLDIOXY
390,325,587 *274CEBB29A8E5BA4EE615323018AAE78538871AF [email protected]
390,325,588 *274C9CEAA676BA8CFE7E27F60737AD43BDFE14CD michealcrooked
390,325,589 *27487A4C1BC85080BEB7EE03E1F812083EE8FDB0 michelboggioni
390,325,590 *274B1C5CE11A4567CE2F7C3C04AC218E1B7DA1F9 MICKEY-CROFFORD
390,325,591 *274090E7095BC3A27123AF0233C89E39BF4E69C1 MICROBLAZECOMWWW
390,325,592 *27470C65D48D22922C9D0251D963124F43306F84 YANGJIETI
390,325,593 *274C686CE96D37835844B653D5E2231C966ACC43 MIGUELJAVERS
390,325,594 *2746803FC06F38684FB3D15DD25DFAD9140A727E MIKEEVILTON
390,325,595 *2740A8A6400309589D9A0C407E03791831F2AECE mirthanombre
390,325,596 *274629BC52F90B1413A07A72D5F86B55A5D8FF42 YKSVERODNOB
390,325,597 *274BF464BEF1B708E5EE8EE7D87D06F71BD124AC MISSY-REDD
390,325,598 *274A38E8FB23E92344A7EAFB17CBD7DB814482FA MKRAETZL7
390,325,599 *274E22793F4ABCFDA6BB1A5DE84E879655A7C490 MODESTO.WOLLSCHLAGER
390,325,600 *274DC96EA0C82180C362D61458BB6D0FF8396664 moer=more
390,325,601 *274BFF3F7AF43C034FDA54FA3A3A17038A625B0F yuyubeaute
390,325,602 *274F738B991AAAC45E732F8E9314EF6EC4DB8C41 yx[aaa
390,325,603 *2740AAEBD2B6F2B65868467AF4321EADF62BCF1E ZACHARIAHKIRBERGER
390,325,604 *2749C1AC8B1EE4F147EB9814FC7D2B2B4B760E99 ZACHARYIZAK
390,325,605 *274C85CE72AB9B1A9F5E303027DA3EDD10B45328 mordv
390,325,606 *27498C92D224B93B0668805A621E1F5BF6EE7586 morganwhitset
390,325,607 *274503D1542584359B819DA0F44062CCF4041D81 morohova
390,325,608 *27474C58AC679B3D1C58ACC4B235E9B0A368E12F ZEREPPAR7
390,325,609 *2742A4FB6342FB31627887884B009050947D0D1A zeuntjeses
390,325,610 *2748DF6F5D07CBB5D3AF0B4E8D89A409BD922B88 zhtoynta1
390,325,611 *274BE26E40D9A3BB87F39E6C5DCDF79CD3344483 ZIYANDANGQOVU
390,325,612 *274FAA02378FCF2A77A7E3566DAFD88C3F534F28 ZNAMENNY-KURSK
390,325,613 *274DCDB0439ABB853795FFD3F6949B60449842D1 multimetallism.
390,325,614 *2744469CABC470D200445AD16425474E012FD46C nakadatiさん :okです。
390,325,615 *2747ECC54012C38CD4A5AC644341F4FD553488F6 КАРИ́
390,325,616 *274F35CE082B51AC4F98067E2EEDFDA265AA39FE NATHANIEL.SKIVER
390,325,617 *2741AA9AEE304D90EBB4DE7150D1C2678477BEC3 NATHAN.PILKEY
390,325,618 *27441CF984B37808B61796F0CF4850269BED862D navarajraj
390,325,619 *27459E5A504EE4C089E01F715835DB1BC98A9071 NED.SARKS
390,325,620 *27444B311AE20E0C81223810F037EA4FCE42FFC0 сервиса
390,325,621 *27439404A4A88E6AB4C8BC956F19AB54DACB87BD nerita8
390,325,622 *2740FD5260523B996F4648D9AD92DBF4E22169D6 СУМБ
390,325,623 *274FC9618562E3B10671E336000356D0F8C84CEA NEVER-WANNA-SAY-(DELINQUENT-REMIX)
390,325,624 *274E6FF19BA9DD851CFB5E868A7CACA9CF4D19F6 new.year's.retribution
390,325,625 *274E76D6F3D84A1CE5CA7578B133DB92065C9BF2 NICKFOUCH
390,325,626 *274CA3C2953F3ED92B2D0E81E2094D2B29262824 nick.mallis
390,325,627 *2746AB42E459AF419E4A902D4D604B0A06BA3650 NORTHERNSTYLIST
390,325,628 *274626F833AAB42A18CB4019670983E95856DAB2 (O_)~.`(B
390,325,629 *2749EB71C07D4B9FE313334B25E0621FE16A8636 [email protected]<%_|^[!]
390,325,630 *2748D0E812CC42CD4865E21799AEF45D70C539C0 oscnode2
390,325,631 *274B185E1D46846E02D88BCCCF1EC262FCFBB7B9 otheiste
390,325,632 *27455C853E460E9988A2989B75469A4266DA07F4 [email protected]
390,325,633 *274AF75BB3FFF107A0B679208831DC9B66B14E90 [email protected]
390,325,634 *2742C4FADC52AADFD20E771038D729B37DB23FB8 ozzh
390,325,635 *27478D5F981057BEB60FC02599F50A7248868EBA PASTERNACK12
390,325,636 *274ECA66180051D46E9ECD9661316505BC3C13E2 paulostrem
390,325,637 *274FCA9ACA9310A061283C9C1E70A1DE9CCAF0A1 P------B~.`.SPLAT
390,325,638 *2746A9503F7821ED9C123A4357D63248BA39C1B4 p=====d~o~o(>_<)
390,325,639 *274D91EA9EBF99458EDC83D25F5D2DEC4B9C75D3 PEDRO.HARTZO
390,325,640 *274FB02CD908F9615BC81164BDFB822EA9884071 PEOPLE FEEL BETTER IN THE SUN
390,325,641 *27481631E0B837FFF4E0ABD0B4B00324CEFF77A6 06221112
390,325,642 *2743B4CA070BFAF64C3081D0AEA7FFC64F04192A 10191460
390,325,643 *274BBB18ACCE6B7471BF740E4A1AEAC7B20A99DE pimpofallpimps
390,325,644 *2742972060FABAFC6A73E98012434E4FA20254FD 11°DUCA
390,325,645 *274BAAA0B21913FFDA9CE6F129168DC427D02377 PLA$TER.$
390,325,646 *2742B0138155C8A4F4AC88A2A6142D34BD1EBC30 1217313 THE-ANSWER-IS-AS-EASY-AS-ABC-.-ANYBODY-BUT-CLARKE-.
390,325,647 *27466504D007241050C90A417E4E1603A6E273C8 12-20-1831
390,325,648 *2748D6C76DAC5098F68B441433C62B0CA2FC91EB PMID12449253
390,325,649 *2749260575359DB46D2F640A401BA71A9BF9786B [email protected]
390,325,650 *274117C44AAB7ADF1A9C09C140C6D836A386410E PORPOISEDREAMER
390,325,651 *274F5E5D7916F65D6AD2121F680E451016203BFF POWERHOUSE,VOLUME2
390,325,652 *2745333DEE02E2F52FEBD3020A6B0BDEE174BDB2 PRASHANT-BRAHMANE
390,325,653 *2744D28CCF7906A04B404289FA24454F2A1D3C46 prestonhamberry
390,325,654 *274C58EF6F9F290692BAEAEE0B708CCFEC028CC4 149は、やや青味のある赤色であるが他の有機顔料に比べて薄め色が黄味に寄る傾向がある。COLOUR
390,325,655 *274A84FDDC3FE4C2F584182E3B90BCB82107DAE1 17 HARRELL'S
390,325,656 *274ECEDA344F97C6A298177C0E2FD2609D7FC60D PUBLISHBIOSTUBCATP
390,325,657 *2748256D1857E89F0EE6CF18EF97F2AB45165634 PUR9A71VE1Y
390,325,658 *274D8B642ED7B34A7BF218C0699873DB7929ED56 (>_<)[email protected]
390,325,659 *27428FAF07591400E052C1E8FA8E94FBB28E436C 1bardaginin
390,325,660 *274C3FFE5975E94F8719DFC7253A85B706666863 1.BEZIEHUNGSGESTRUEPP
390,325,661 *274DE2C867913D5F221ED49822544947256866E0 qse224
390,325,662 *274F7A2D361A91D324CD1FB315CB2A17ED9DBBA4 1.DIGI-TV-KUVISSA
390,325,663 *2740CD83401D6E65F4AE48387EA4317DD8DCC77E 1EDNESROH
390,325,664 *274A5E3EF2EAC61C5FA78A128DBA990A3A998958 qyu;
390,325,665 *274773B97FFB87963D5F3343E8D5D13404ECCDF9 [email protected]$T
390,325,666 *274F3EA969283B39E1CCBB3CDDD5142A01DBDCCD 1 FIRECHOKING
390,325,667 *274E944BC1C0702C93F5B19C2C30579E4BF1BC91 1-GERAEUSCHPEGELMAESSIG
390,325,668 *274839C52717BBC434F5485B9014020C3179751B 1.GRENADE-BLINDED
390,325,669 *274E7E827A1EC3FF2B466E6809ADC82AE14C74C7 1.hermosolu-ulokkeiden
390,325,670 *274E1D3D79F4CAF6427F5D313D8785BE967D5EE2 RANDYALAIBILLA
390,325,671 *2741A06EB9385BE49B054BD921941041EB523E7C RANKINGDECREACIONESRASTROJO
390,325,672 *2741CB4698D6AC13C107E459F51E218F6DDCEF13 1JOSEPINA
390,325,673 *274304E9341E6517EFEFE33FAD83CF6CBD81844D 1 laserguidance
390,325,674 *274A980D1386D42ED3B9C5B098602757C2785B21 1-MAKSUVELVOLLISUUDELLE
390,325,675 *274FA99E6E39E73005AAACD0BA4A948238A92105 rbpaaa
390,325,676 *274D0B7DFBE33003979EF3E0C7B7015790BEC079 REAPPLIKERE6
390,325,677 *27481431802A9999FF8351C28B2587A989C237D3 RECOMPOSAED
390,325,678 *274F485F23858CD947B6F223577E48DDF8A7D073 1OPPIMISTYYLIK
390,325,679 *274B8237F5C5EEF21B147EE6E86AFD2255020857 1.PLAYERS-HAVE
390,325,680 *274A04F78D22A8666D4149773E9DD3C23EEA84E6 1.presidentinett
390,325,681 *274A5A0E1190C2C63A765E1A3856CEF790983772 1-pystytt
390,325,682 *2740142E2F091985AC5CD73A3F27A4AD87C73C40 1.schmetterfaustschwaermern
390,325,683 *2749D5E67D0979D4B36FF37CA56D0461F8F6AB6A 1 SCHNELLBAHNJUPARISWARSCHAU
390,325,684 *2746F3791CFEF7A39F54C6D3DF1FE261FBF99878 1 slcjoukkueen
390,325,685 *274B47BD9C502CEE414A204D36B6CE0312BEC4FE 1spsswindowssissa
390,325,686 *274A77859AC2C6B5F0BCB7A7E25AD3E1AE6A2B0E 1-steinbaenke
390,325,687 *2740B8833AB99949FFBF017507B622F8FD6FD0AB 1.strassenfussball
390,325,688 *27460817AB99F2A5C3CAFCEBD092952DE4CA01E7 1thewhoville7
390,325,689 *274C0F21FC9268A2D79E5C1016934B7DF307DE87 1-TRAUZEUGIN
390,325,690 *274C3FC447D9433C51ADC04C3DCE9C611DEE12AF reneheinly
390,325,691 *2740D0A81E8B83333EAA751B35DA421FB67819EF 1-TUTKIMUSJ
390,325,692 *274080F020F5FBC606FCE493B11E7C84ABB96B6B REPONETIS6
390,325,693 *274C750C5D48480C48BCB1A942C65F8B25E5D51E 1-VISAILUVETERAANI
390,325,694 *274920285689EB068617B53974906D1B1FC48945 Results.&.Remixed.Collection
390,325,695 *2743F007004ED5C8187A99D3E14C0EB291B23DF2 1 YAPISININDA
390,325,696 *2740CF4103F78FD0E70AE614FDBD0FB0643AD953 REUBENSOLLER
390,325,697 *274A87F573632CB85542F8BFCB658CCB12E785D4 20050908:patronaat,haarlem,thenetherlands
390,325,698 *274D24AFBBFEFBDE719B14237D8F39C80EB945C8 REVEN:
390,325,699 *2746E706925EE247B5ED9B3EAAF32A288E2F0811 REXWENTZELL
390,325,700 *2748B57F72120BC189DBF51BE065A4E2B5AAD5D0 reynaldohinahon
390,325,701 *274AE4A18BF294C88D9811CD3C677D2CF559BE4A rhapsodyforviolinandorchestrano.2,sz.90:i.lass
390,325,702 *274FD8C8917E047FFDCC38FA9C2338A2ADE4E65A [email protected]
390,325,703 *274CFC9230078B18A8AE785F90EEBA404AD4470C [email protected]
390,325,704 *274111FB13CD1CECE03ACAFB05E09B076E702359 21-10-1138
390,325,705 *27499EEF1D6AF066660001E82787D9D605C463C6 212601 ETWAS BESSERES KANN ES GAR NICHT GEBEN
390,325,706 *2747093511BA1DE0295F4F5BA0A162415002C750 RICHCHRISTO
390,325,707 *2740F67F60C27F9638477298539C3C08FCB9F18D RICKYALESSIO
390,325,708 *27408AFC9E6DD0F070AC5C1A73D8D73D881B3CD2 ritmo.domestico
390,325,709 *274C7818549E6E53466FAADBDCA3098697115C94 2325aug09
390,325,710 *274606B81E2BF442F5BB4F967F8D2D33E4656C10 2341477 VIRANOMAISILLA-OLISI-VELVOLLISUUS-ILMOITTAA-S
390,325,711 *27426A5D0A185491829D3AC3644059672F950ED4 robbygardner
390,325,712 *274C6D7FFD2F384C0D926B811575B95BC722D83A robert.korner
390,325,713 *27485AF634F01F88CA66D39AD464AB8CB1523D31 rockywhateve
390,325,714 *2746F0D109F4089EF3083AB2AADC7B82B4C3F4CD ROLANDSTEPHSON
390,325,715 *2744C534D3E3C53978572E0F5E1B766A1E5F7708 [email protected]
390,325,716 *274CD28FD6B50270EC1A107D098FBCB50A58644D 2909064 BILLCLINTON'SISONEOFTHEMOREDISINGENUOUS.
390,325,717 *2745FF4C34F70D6E35D8E16880D773B673CF601A 2-aivokirurgin
390,325,718 *274DDE78F0436B80E6EEADB8014B2AD3EA12ED0F 2.ASIANTUNTIJAORGANISAATIOON
390,325,719 *2745F283715B1EBE0FB462A02B0ED152843580EC [email protected]
390,325,720 *27466180962C98BCBB6B1393D5322B6AEE13FCE1 RUDOLF.LEWELLING
390,325,721 *2744D4D5CE8AE42CDD554884BD5BE1BD1A52D823 RUMASTE1234
390,325,722 *274F1D3A1FBD3A8979892D824747638309D84CBD RUSLAN-RAMLY
390,325,723 *2748D70939925B5A30236E36119954D6C710741C s2(g
390,325,724 *27452A11EB3D084CB1947A0AD0B01B84B3FDB2DA 2.pikkunilkit
390,325,725 *27443D7CA64C72C8DABA4D9B3A1416E6EC6D22FD 2SAVONNAIT
390,325,726 *274D7C86C86ABC60FE5684BF9FF334BFF09947BC SAIASSAULTRIFLES
390,325,727 *274A0D57E8F9200D08575253C3BC1C6DBEC09818 2UNFEBRILE
390,325,728 *2748ED08F57BE3730661498AD9AA311F4D64E171 2.viki
390,325,729 *274EC1A5D2EFE48F804DD06E35BECA4F6E0DBEA1 3:2promh
390,325,730 *2749A9F12860CAAFBEFE94DD2A9143F10A14C03C salliions1
390,325,731 *27484CABDC228C229E1D04E730393A605506FD26 3b< ~`@=====8
390,325,732 *2740FB4A1C9168A0082D40242163131FA023A9EE 3=====b`~{x}
390,325,733 *2748ED888CBF29B537B6C05D53A879A535AAF47A sand-(dub)
390,325,734 *2749DFB33960EB95EB2E4FF7389A63FA0C9680B1 3FB7038809E954667703EE868A58BCE1.CNUT
390,325,735 *27444BD1E5226F04DCB331F54230A5D0384BFD0A SANGPUREBLOODEDPUREBREDQUARTER8
390,325,736 *2747DA1824CACE4D977B6E614C406B36F53B2422 SANJEEV-SAGAR
390,325,737 *2740F5B19A33C4C6C85C484053C13E042004B983 [email protected]
390,325,738 *27406B6FA49858F0903633250F7B78B2A8957099 santossimpkins
390,325,739 *274F34879FE060803F29B7702FDE3EE2A3C460AB 3KULTIVIERTES
390,325,740 *274E74D239EE9DAE11621D1057EAE92FF49E7184 3-MAANPAINEEN
390,325,741 *2741AD9D2CBE9C5EAAB0D76605CB8F62A154DB11 SARDEŞT
390,325,742 *274CC426779E3CCFB5E1AC38AC4F0E5A3FAC3EDE 3-TEHT
390,325,743 *27406F826E059556C56D887948119A0394D465C4 schauspielku
390,325,744 *2740580A4E77471FC338B9FB6A3EDB4752C3CC25 4ERDREBEU
390,325,745 *2749D54ED55FE6070A01D80DF1BCE9DCFD9012D5 4ITTEDES
390,325,746 *274D97484536FE22C3EB89EE2A44290C7A79C1CF 4LYMYTITH
390,325,747 *2746280DA1F26F180ADB9B928608ABF6617B3A1D 4MITCH6
390,325,748 *274C5B7A023CDBD03B0185FC91A64FE3A2FDE71F 4NIRPSNIE
390,325,749 *2743B0993014D09CDC83A61EC1893B9FDA129A96 4SANCTIFIABLES
390,325,750 *274CB1A62772F9F839AC6033DA691F400ACD8803 4TREIKAM
390,325,751 *2748CE9972CCCF4C51621ED90FCD8E800E82E16E 4UNCTUOSES
390,325,752 *274F23A99080DEA44C0B10D1F974972FE0A31142 4-VESILIUOKSEEN
390,325,753 *27428C14D810AD96B5096E54AF5EA79EC5CBAAC2 4XYWLDNG
390,325,754 *274F9F5B21885123C64194809B0CC4EDC36EB99A 548LAURYN
390,325,755 *27455DD53BB4F3121A6C82CC6BFE64266DC8ABD3 5APIOJARENS
390,325,756 *27473E8F2151B36B1382B0B494DD3B82E6E04CD6 5CLOSEBACKGROUNDB
390,325,757 *274321045121DC5765E5EB6528ECB64C40499201 5DONALDPLAYER
390,325,758 *274E5A8530BCF36422160B5F54909D7E464370C3 SDRAYNROC
390,325,759 *274A7670C8F623CCEECC5DC449A5922638B4B9F5 SEACOBRA
390,325,760 *2746A4BA7EB17EE1A7519904D6654E82C793EF94 sections 2223
390,325,761 *2742DE31899E66BA0FDCFD238A5B26373CA246F2 5iluvwesley
390,325,762 *2742FF6CD641CC4C24859F48F4D6187F148BC3A0 5NAISASIA
390,325,763 *2746C54BE31F4D2C7AAD272F010AA0EBA26273BD shadriessen
390,325,764 *27406A8DB644B1482C3F400F15FF31645EB34093 5QUIRELY
390,325,765 *274DA07EC9C4E42F6810E1D53C8317A37E56E392 SHAYNEDONATELLO
390,325,766 *274C7D93BA9750CCAD6C91E3B60BA4369F32AF2F SHEA.SCHULMAN
390,325,767 *274C9D6C4FF28A25DFDDCC4664C5A08B04ADFA2E 5UPDATESUPGRADES
390,325,768 *274018CE59BB0D8B955740ED693689656CCD5AC6 SHERRIE.STANLEY
390,325,769 *274002343E70D9C53D94A20DDEDC4F3101AB6203 604465MEME
390,325,770 *274883A0979628574B210EAB472E22FA2A2FAE54 6BRUGERGRNSEFLADERNES
390,325,771 *2742CFCBC20CC15CF536AD725996C5E8BC819333 SIBLUMERING
390,325,772 *274E6565F72E44AB6F07A472542E6F7DE1C3C658 SIDNEY.TANOUE
390,325,773 *274FEADB91AF9D94B9D95021AB24DA561B8EB171 siggi.jonsson
390,325,774 *2741856747E6EF854B5897BB0798E9982FEE152F SIGTELINIE0
390,325,775 *2741EE3FFF874B7D20F5565D0089BE39BEE5F065 [email protected]
390,325,776 *2741DEEB06C9EB87A6EEC40272D6A9DE8A325307 sinohe
390,325,777 *274C4D6559CAA40E04C9D590292DD4ED8654824F 6RADIKAALIPORV
390,325,778 *274582979B46414D8152BACC92EF17A9A8398F1D [email protected]
390,325,779 *274B646ABF4BB1F28E11AED896641627A8590023 SKRUELGENES9
390,325,780 *274968AA00252F65CAB24EA2EEE0B211C1A45E23 6-saGlIyorum
390,325,781 *2743F46EB02D0C0D924F911D8F02E8E160B88EB1 SMERDOS
390,325,782 *274E5328ED4D4B04FE5DFA3861F5FCCEB8555994 776542 BUSAYFAYAPIMHALINDEDIR
390,325,783 *2740707C911B1580234E68CF9969D70345965DF4 SNOOPYRUX8
390,325,784 *2740D8D23632A4B25E9E3BC0A0041B2BD9CB30ED socialforvaltning6
390,325,785 *274667CAECD500293F206E001D1BBDFA92F02789 SOFFRISSE
390,325,786 *274F17A4F4790B68D1013072F7E52E2E27EC6F00 SOLUCIONOUNO
390,325,787 *27404BC7A447439DD88515E46AC3AB2A79B88D38 SOMETHINGGOIN'ON(LOOPDALOOPUPTOWNMIX)
390,325,788 *27422B0B1AB0B07E41E90EE3C8462AEA11CFFA97 7EXTRUDERE
390,325,789 *27463EECC1718844ABC38B9AB5CC28F437F2EB7D 7GENSAN
390,325,790 *274E77C7A445F2C18CECB15AFBD61EE4E7C9FFA7 7GNJECAV
390,325,791 *274239576EA98575615F569EEAAD893BD4EBA153 SOOLIYM
390,325,792 *2745F365572F9BF69F1FE2F4B54A6EE8BDE1EE16 SP0RTSMANL!KE
390,325,793 *2748CCFAC389E57A4529C832D096B5122D219572 SPCLTVLY6
390,325,794 *274AC3DE93617135FCE244A160F3CA784E2E66C3 SPECTROSCOPE
390,325,795 *27467C44B247B98F0982D559C714CBC7A925351F 7PGLDEVSVR
390,325,796 *274DD510F3446D51F9209DA2B8F77FCEA8246542 7PIKAVAUH
390,325,797 *274037BC94F03D0C744A83BF5A20BAD72A962C71 splat-~<=====q
390,325,798 *274E88AD06B46CFF8EDD769040EB9F65A4CB9F11 SPUUGSPUUG!
390,325,799 *274BE8A923C38C8267E2B38509DD2C04538742ED SREDLOHK
390,325,800 *27405694ACBB4662853100B7C957EB2AC6FA8C79 805868 bunlar-daGIldI-,-yIkIldI-.
390,325,801 *274AB731AA31ACC4210AA167AE1602F7451EE1AE staceytully
390,325,802 *274E9F94C8A2A45F2FAC90575842BFB3079F97CD STCKRNNN
390,325,803 *274303E6C72AD179C7BAB6DF17DCFEB17887D9CD STEFAN.METIA
390,325,804 *2749CB5BFD57278B1742E1630A1E60A13BEFA507 STEPHEN.KUPFERSCHMID
390,325,805 *274F7E5DF2D64B710B6E9D0171AA272DAE6BE875 [email protected]~0~o.o->-<
390,325,806 *2743A62954B9E26631E1F6E7B4F9345AE528BFD6 886MARQUISE
390,325,807 *274FCB2515BEF69881947816E712EA82C6B38A12 styrespak
390,325,808 *274A21C64B9A5AA32FAF5CB0DC591B8EB3DEB623 [email protected]
390,325,809 *274A4F7073A8F98993DBB84BBCD043DBC2662AA9 8EFFEKTENES
390,325,810 *274BA559CB9FAF76177574793A3330C0BB3B3C20 sweetsme
390,325,811 *274932B1FEFA1F65E7C9F377A7D0622F4F1BDB19 sydneyakoni
390,325,812 *2744F67A912A2638FF636AA0EE236B8F379F575E 8MUUTOSVYOEHYKKEESTAE
390,325,813 *274141B0C0206C3E17B475DB67E7877B42DE4DB7 8OTIKSEN
390,325,814 *2741BA0E64E5681EB8E41CEB90BFE6BC1F75749E 8p* )O(
390,325,815 *274D2D05A4FB20A73644DBAA38BD79DB2AA41338 TAFELBLECHFERTIGUNG
390,325,816 *2741C6BC31B86960764A313D6B9CA8C228AF0A3B 8SEXTENRY
390,325,817 *2748171E67F420CA9C63E0CB796FC764D43E6741 TALKDEXTRANSUCRASE
390,325,818 *2745D9921451B71D9E4532429FD543386403A4BC TALKFUKANIZER
390,325,819 *27445E96A1B3A21DFBEF049E54B9ECFE6D9222D4 TANYA-CARRIERE
390,325,820 *2741B8D48E50305066C6BD8A63D3866278C9AE18 TASTINA
390,325,821 *2747AADF6648ECDFB12ACDD136B3896148D0AA6B TATUMTATUMS
390,325,822 *274544CEDC99FD03F2356B874C24901F0AF8C25F TEDARKINS
390,325,823 *2741938F7EE0808D6796906EA84031495CCA7D90 tenshinhan
390,325,824 *2746C7E8432B3921D411F40FEF2DF5691F59C73D TERENCEDROWN
390,325,825 *2747063B58BE24B5372E3C213E1CD41858210A91 TERENCEHARBY
390,325,826 *27426F71A9F3BE969EB52450D2FC5F5C5794DD92 [email protected]~.~.~UU
390,325,827 *274D9AFF223A5F73ADA65F8A0051C5B50B8821BE THE.CONVENIENCE.OF.STORES
390,325,828 *27406D45E45DB2B8AE340080BB5DDBB8DB9BA6A6 THEODOREKOY
390,325,829 *274E6FE05F6AAC8AD133B89C15E1F0D324797597 THEODORESPATH
390,325,830 *27491B198FED2A9981A545A133D602A538501698 THERAPEANDREVENGEOFJENNIFERHILLS
390,325,831 *274A934EF3EBA9FD88183A400AD65ACB89D9E871 9AGBAYANI
390,325,832 *274393B1199BC8FC6209D338F432BC0DE23D3DA9 9BEAULIEV
390,325,833 *274860A033AD621C9DFD865D54059CFB6F563CEA 9CITATA
390,325,834 *27457514AC655A04A1E903154AABF892845DA9BE 9COPERTIMENTS
390,325,835 *2748E95E839C508AD14929645313A01E374B9EBE 9F4330
390,325,836 *27477592A3193FA30ED72DC427136167A6EBC0CF [email protected]
390,325,837 *274044C4F51968AFC39E3930B88650CC5129610B [email protected]
390,325,838 *27480CBD30F1BC7B6CFE019E83CF0F81EFEF9DB2 9HICKHICK
390,325,839 *2748BE2C0B3906F24C2616053D5F24EB5516A322 THREEFOURTHS0
390,325,840 *274268894EEAD25CCC38C9DB7D1BE444DFC26D21 THRFLDD2
390,325,841 *27414EB2569320432B6D5F327180D449913EC50A [email protected]
390,325,842 *27463B89BF1DF95B90272C5D31E862B758F84D9D TIARITNEPER
390,325,843 *274DFB92C046DC882927CA9672A29855EF72F157 todvanwagner
390,325,844 *274E7FF251FEEE0D7F4710472866AFF7F5BCDAA0 TOEN&NU(DISC3:LIVEENMEER)
390,325,845 *2743D196CB335B2F529C4EC088A9C9FC95E79E31 TOMAS.BURD
390,325,846 *274DAED4E4B41B8E0984B3459512E21FA44DD0F0 A),&
390,325,847 *2745EAABDB95453F583E387495017C91F87C99E4 TORYLOJEK
390,325,848 *2743EF3182EA82C8F0CC5F3B8A62C3C0383170AE a?0vw
390,325,849 *27453E5994F2D64C2A93C79F5A7016AA9EF53668 A,6:K
390,325,850 *274CCFE7D0DB1F758C2A2ADB2553AAB9B7190507 TRAPENCIELAWRENCIE
390,325,851 *2746E34F628605B683DA27B9209D15383F2277DB Aa~:
390,325,852 *27455657F4650F7693CD829E7F7339F016ABDBD0 TRGLTRL8
390,325,853 *27424DC8B36D57585B84D64963136B90C0E69B24 AAJJ
390,325,854 *274FD1196958423AEA54B52304749122BE72F0C5 AAPBF
390,325,855 *274AEA75463B54B63AAB6E4D972443C2C3F5CD20 tursday6
390,325,856 *2741EF29C407278BD0831603F3C0FA7A1B62CB5A ABE.LIEBSKIND
390,325,857 *274091702F395D12D8E9777B6923F236986B4A13 aberedfear
390,325,858 *2745E2CA1802FFD341B154B04C1EBE3D10F12B14 abgerackertemed
390,325,859 *274ECE15185A6EBFB3CD667582D0B208AE3DA10F TYLER.BELSITO
390,325,860 *274D1FDE2C17C8971F7A38E770199E1B79EF49DE tyler-donelson
390,325,861 *274D58468FB2B022ADC436E9243FF2840FB739DF ABONPORNADOS
390,325,862 *274735C079A4263C130F40D628572201BBE23BFF TYMPÄSEE
390,325,863 *274D6C8FD0BF404B5566556E95E5A67E8B586494 ABRADER!
390,325,864 *274344263202823125F5579F5F90B9B894753942 ÜBERRASCHUNGSAUFSCHLAG
390,325,865 *2746D7E8C97BB73F116DC6191B947B33F6FA65F3 act 4 - ecco, il velen di laura
390,325,866 *274A57A7FADE7B1C1B6B5FBFA7A0014FD5DD6D86 uncoffining5
390,325,867 *2745B823FC7D558863E77187451388B162F8FA86 UNECESSARYHAPPYVR
390,325,868 *2745F55CE4485223362B1B08B25A0BDDB145EBF0 un+emp+n9
390,325,869 *27437C5277DA6EB092A947D5E052485A8B817341 adolphlavezzo
390,325,870 *274DF297F4E67D270DF7D64C8E12281EB0DF68ED adpl)
390,325,871 *274A648529DFFC04F86AC13C98B22B353350988F AG7P:
390,325,872 *2744ACF5CEADB47F8530814888C2D81D1BEE556A VAEHAENAEKKIS
390,325,873 *2742C04375D761CB2920131312F71ED40AAD2BAB VAGARONO6
390,325,874 *2746FB14AD05C1CC1F44F2459D93746EBC12C19A AHD,B
390,325,875 *27422833B33D7B2D699191FFA4F90F75B1B6BFA5 VANDLISIM
390,325,876 *2745D5807222CC7B5BE32337FEF8BFB29F82FFB1 AIRA.JOYCE.PASCUAL
390,325,877 *274BC5B4A3A28B069BE301ABD87175E1D3C29BD1 AIRONAGSTRING(FROMSUITENO3INDMAJOR)
390,325,878 *2742A083A9F3A0362F7253535BE36CA059743FB5 aiv7o
390,325,879 *274FB3F93C7370B4505821450834A67D9FA258C7 VERNON-APOKALYPSE-STOWE
390,325,880 *274D2ECACDBD07FC279E5FFD1333EE30849AF2DD ALBERT.EANS
390,325,881 *274BC2DB6A1CACDF31D3F91A664674602E54B2E3 [email protected]
390,325,882 *274E3F192482B77F1554B15B7FE80DBCB058455F ALEXANDRA671
390,325,883 *2748DC3E6238A2FACDDEFF918D4DCA96B5F933FF vibratility4
390,325,884 *27411B06F2E9D005D3BDB80C5DB60FEAA095A2A2 ALIENSED8
390,325,885 *274A2078A692F2A3DCE7EBE1A1356B98605C856A alkliviz
390,325,886 *27427EC6B093AFF107BC61403862B3D4963E9481 alohz
390,325,887 *274359B71233F3CD7D80379B951A2D9E835A3565 VIRGINIARCONWAY
390,325,888 *27478924A0C6B22FC89CE917DF15F48FB59E69A8 VIVIANAGONZALEZCABRERA
390,325,889 *27415042A19C8856D4560077C8D686C4F43C96F6 VOEDINGSUNITS6
390,325,890 *274B474E14AB32897063A869FA22B25DBCEBB3AB vszaaa
390,325,891 *2748D545A8E7D1F23DB96CF0ED63324B96847827 a(nc-
390,325,892 *274EF0C8EA8EA976FCDFEE84139D4E25A4A8278F [email protected]
390,325,893 *274CFC51EAAC4037FABAB8CA54CF60C5F6536756 [email protected]
390,325,894 *27478E2615E18F46A92AE692FD3264EAE411944A wardgoade
390,325,895 *274B61EF343032CD5BF9C8DE478D049A42707306 WARNER.CANEER
390,325,896 *2742071AAAAE3D3C320114AD3C8ED1CC9AFBF4F5 ANGIEYNOSTROZA
390,325,897 *27474C38EA9A5CDCFE61ED2291E3DF5567B7100B WATCHDOGCEREAL1
390,325,898 *27490A797FEDA9AA36BC4F9D6C93092DE9ABEE55 ANIBALDO
390,325,899 *274C14B471F70299529051997B197A861245943B A;NKH
390,325,900 *2748D26F553A3D77185D0EA0D2313DF9358FDAE3 [email protected]
390,325,901 *274FE7E2E0A36AFACE0E59294B068FF7CFAB6C90 an-War
390,325,902 *2742158ADEC18770C1A13853D88FB084F268C90F we.show.up
390,325,903 *274C12347300EE939EDE07118876AD1F0187582C aof07
390,325,904 *274107BD6B3AF23C3985A152AE52F7D84B1822D2 [email protected]
390,325,905 *274A81C2329C7C513BAC81E77FD574756F4D30C5 aoswa
390,325,906 *2746432633B4B5BA1BE44160414FB618910BBDC6 [email protected]
390,325,907 *274917D8E9F354B31641FBDE5AF272658D1D3057 APUNTAVA
390,325,908 *274E553DA30D9D632BA8E60E32584E10C10CBAC4 wilburwiningear
390,325,909 *274167AD71BC8E6AD2C8451DB0F7ACA7B6025383 WILFORD.SGRO
390,325,910 *2742AEFFD8F3EF46B8E6379AA80F735D664F4FED ar7st
390,325,911 *27416FD492E2C70C2E18961BF5AF89BFCE98C953 Arbejdskraft
390,325,912 *27421B9802BD2BD4A6637BC58535436901B2DE52 WINDCREATE
390,325,913 *274C215975E1338A77D15242DB25C19E82465924 ARNOLD.LERMOND
390,325,914 *2741926F5DFA9AD834A20990511E6745BDD32BB2 WINTERMAL
390,325,915 *2747A3C1AA8B68D6917404475F2DC4706EF92939 ARONBUX
390,325,916 *27467DFA114C48B1C99BA4EF99097F931D3AA960 [email protected]
390,325,917 *274951BB142EB10F0C40D0188DEF5BFEA58E23F8 arthurfrench1
390,325,918 *274A9D626FA4C97498D9A1C8EC36AAB3897FD9C6 artrevolorio
390,325,919 *2745FD87B2330E15384EA879B6F69EED16A304C8 wpaeloe59
390,325,920 *27488AA952D40C2AB5DB5D117B0DC97598598B66 [email protected]
390,325,921 *274C30241DBB04BF39C87E5FA274AB59B3F5FC5F ASDIDACTS
390,325,922 *274E6687C8695C2B3C73491F3669959FA1137C1A ASIF ALI ABID
390,325,923 *27470F8B6758DA1169AF091292F05CCADC14D34F asnevren8
390,325,924 *274EACF070B2C1E7D5AAE372F8943105B64D58C6 wwwwaco-texascom
390,325,925 *2746E8258101135AFF063C3280FB74395568DF0E astartingpoint
390,325,926 *2747030407F1EF38E605BA7121DAD073BF24212A [astronut]isee...nooneknowsshitabouthooking...
390,325,927 *2748D05F8FE6E4A72A39D0B84E54B994B358BE06 at+5?
390,325,928 *2744984BE7A77F74EA214FBD7B8CE2B5F901FD7D AT5KF
390,325,929 *2740506ADD6A43F4DEF7D676B7D0153F5F6B1E88 ATALREMS
390,325,930 *274557CADEDFFC86A53F0A87544F4CDDF9FAE84E ATCCTTACTCTCTAGACTGGGCACGGTGGTTCACACCTGTAATCCCAGCACTTTGGGAGA
390,325,931 *27478F7319D4B79E9177161BE6C685AA6BD5EFBF atcsp
390,325,932 *274CE5295CDFC2F25B949AA483E7B52176702192 atl_1fc8b3b9a1e18e3b_xww_5f0bbcff
390,325,933 *2748A9C6570DAD2413E9E54F0C0C9B38B05504EF [email protected]
390,325,934 *27434675D041279C20F786DF9BA55589DA42AA95 XIRTAITINIS
390,325,935 *2749DB493F7FD1CEB0C8B5C8206677B73E6E852C xlibbsw6
390,325,936 *2743FAF0216ADF26A9D7D52203AA5D6CAD84FF5E AUFFHÖRETT
390,325,937 *2749BFDCDE17D36650F3C3ACECBA7948C2108E0E AUGUSTUS.SUL
390,325,938 *2749E1C877EA3979D6CD741675A44D2907916243 [email protected]
390,325,939 *2746C6A7C49F41DBB2B63063D1A4F07F51B5AA7C AUTHORMALLEUS
390,325,940 *274A20853447F5C20988FF23BA8855012932DCC9 ydrr
390,325,941 *274FEFE85C35AE76F017F4A967E7DF6C6A1B26EF yendzrendypillowz
390,325,942 *27431A16BD3F4FF196904DC603617F140633A4FA [email protected]
390,325,943 *27478D85EDE74DAEBEED8B24A285B0FC73407F7C YILMAZ-TURKOGLU
390,325,944 *274B38316E9FCD4828069EDE07DF698B2797801E YINGJIU9
390,325,945 *2742FFDAE9D8CE190FE190506BE7DD29BBAF5FFA yotasan-griff
390,325,946 *2740A3AB4165D1E4C30273AD3768CE1E4831D277 YOUR.BED.IS.KIND.OF.FRIGHTENING
390,325,947 *27436F7F2706F98F441EF110AA4C9EFC1DA7188E YOUTAKETHEBRIDGE
390,325,948 *27449DDBE4585D27CEB8726BD39A26A2A07618D9 AYCW
390,325,949 *2748677B737079D3CA84C34009A1691CCAF1DD59 AZF&E
390,325,950 *274B3313A86876E1AD87185BD240B01A7A70E1DB ZACKARYCOVONE
390,325,951 *274867F4AFC5C04C369DE4D362DAEC070E7FC454 B4D58
390,325,952 *2740A7E51A62236091AEF4F590313F61673BC451 zeireuqitarp
390,325,953 *274D0893E3FDC439A79495A7E99CD20B0C6EB078 b6sow
390,325,954 *274218761501566938EBC814F9B5B7ADDB69E1FC b8qi1
390,325,955 *2743D385FC47AD4322942EC64A260A9CB952425E zms6
390,325,956 *27458D7C2A63D93836F3E837FBDF0500B3CAFF31 [email protected]
390,325,957 *274A230A072A7529A4B5B0A08DCC3FB223496D62 [email protected]
390,325,958 *2745A74845627F7A56F8455B408858555F40D634 baritoneed
390,325,959 *274F4AF0A58B10F245CBA139A5F3DA5CE905F459 zxc104
390,325,960 *2744B35E72491F67E73E9957BA16229D2D32EBED BASEDIR4
390,325,961 *2745A197C3DAED2DABCA34B53638FB22E5C11B3C ΑΠΙΣΧΝΑΝΤΙΚΌΣ
390,325,962 *274A197801A5949853DA5F406D5DE1BA2B68DA43 BASISBESTANDEN
390,325,963 *2745B421D3EB159B570A718C076E10D729C97096 b_/c+
390,325,964 *274FFBDEDED94247B7BAA2E23A5BE82EC4757714 ПАНĂ
390,325,965 *2747AB9BD95E51F132F68DD09ADD0BE63ECE4A6D B"ED_
390,325,966 *2745E4BF3D3AA8221FA74AB78D06F6F4C45C9686 benniemahnke
390,325,967 *274F82DC77C7209E98A702AD168085B76F1C3FD5 bennycalta
390,325,968 *27435B6F6472ED99A9C92D8DA920CC50BD72137E ЧУКТАТАРСКАТА
390,325,969 *2746AA3769CE6AD330CCE7FBEE832633BE541364 ШАЛДЕХ
390,325,970 *274B33823846EA6A1C79048D2B437A2D39D5FB43 bern-jacksonville
390,325,971 *274289826E211B16A1D4F419D155747DE3D3BE31 BEU!P
390,325,972 *2747BC03C8ADA11CAB9C5122DD70349DC292D5A8 B?hL
390,325,973 *2742AC752816B882E5115F8041C72FC7DF89953D bigblue08
390,325,974 *274403E978BFCB70BAEB47C198CCCEE23EEF9FC1 BINOMIALFORDELINGEN6
390,325,975 *2748BDA5882FCF21F2D31FA6F14BCE7262B8A7F5 [email protected]
390,325,976 *27412972377249B783A2BCC17FA04C68B73706A6 英語の綴りの不規則性を揶揄するジョーク。FISHと同じ発音。
390,325,977 *274B306930DEE75A80707054BDEF162EFAC7B79F [email protected]
390,325,978 *2741F8BCEF7317939B31FC2A1E1B8A3E07D5AD96 BL=OL
390,325,979 *274452ABB8BE9534B5841261D06AF02E8CFA7C71 -,(
390,325,980 *274A151F8588F081E629E0C03BC353649AC14B60 BO+IN
390,325,981 *2745EFEE955C3018C145D18282DB6A788A5631A6 BOUSIEG
390,325,982 *274B56D7AF82BC47CC56F3BB79B70370260DF0A2 04.06.1703
390,325,983 *274A568B9CCDA1DF98595C1867E6F06432F22830 [email protected]
390,325,984 *27453A2DB0793FADE2C6B7D1B3C79AEB064D8C78 BRAYLON-EDWARDS
390,325,985 *274AD51DC4F829D0A5D035DC8D4AFC66684701B5 )0(*q8
390,325,986 *274371321DE2200B6F20BECC443473E45308306E brendonberndsen
390,325,987 *274EE8B2F06959119CCB17A212010FE4566A1C8C 1075249 POHJALAISEN YRITT
390,325,988 *274BDB199969D3FC3B9769E5D63266D08199BA97 10AWDR
390,325,989 *274072BAA43AB8DD114A53DA16F9E99F13E31F9C BRICE.PHILIPOSE
390,325,990 *27442B0C0A900D997DC48D2FED2E7D6D02A537C2 114WINTER2000
390,325,991 *2747F48E44D0BA840859A69FE1D79D736D27EECE 1206601 siin
390,325,992 *27459274B81179AFA41442C5FF433F65EFA1CACB BRNDRGR1
390,325,993 *274941D83731ED63F8B9DFC8DEFB6FFDB52A9909 12121439
390,325,994 *2741DBB9B6915DA7E2B2D667256115AB9D87FB5C BRTUE
390,325,995 *274AE9E2DC113BA51CAD1C74D5792123AF1260C6 13MAR1788
390,325,996 *274ED182E905E249B84D0C68FD985F75868E3F51 148802 ERI-TOIMIJOIDEN-KESKIN
390,325,997 *274598A772201386256B7A04D8E88F696E3AD1D4 1546566 suojelualueelle.on.mets
390,325,998 *274DC33360964CFA012F75E80E04570AE99B1081 BSRC?
390,325,999 *274641F8BB7E7AD6B335785341BD4EAD160DFA90 B&U5
390,326,000 *274679B5741B77E9190D11254C9C727BEBE8F593 BUFIIILO
390,326,001 *2745B9E41818BA0E20B7F4BE2D0C6A965F6F54EC buh yuh kah
390,326,002 *27422624C378839806C0F26B88AE0C80F746A14B büscherhöfchen
390,326,003 *27492B72C34BDD36ACDC74BEE75A239BE1CBFAA4 B"Z4
390,326,004 *274E38E9E5B236763CF70431EF128569A1F2C24E C+2NL
390,326,005 *274A46BFA0AD3F1B1669DE850CF7AF4C9B9F0276 C6!GA
390,326,006 *274A2FCAC812C321EBE0714AD8C264F02A1F72B5 CAiS
390,326,007 *27486C44027297F2B3B4ED78A85FAF93F0800B99 1.heritier's
390,326,008 *274E778FF415E53A173333D0FBCEED3A66D0446B CAMRALOGO
390,326,009 *27408A5527BFD8FCDD09D894D39163C646413EC0 1.JEDLICSEK
390,326,010 *274AC44BAF30400310C264BEC05B424498FA8151 1.JEYTE
390,326,011 *2741CB6436CDC8BFA84DCC46C8055019774D3703 1 KOULUVUOSIA
390,326,012 *274B00E3FF5FD2415CCF82A84187C0BD20CF371D CARLINHOS:
390,326,013 *274DFDCE9395FD391CE379C2C5438704AA26E733 1 LEIPOMOKONEIDEN
390,326,014 *2747487122547A3A0E400CE6E63ED88ECC19CEFA CaRMeN-GRaBS-HiM-BeTWeeN-HiS-LeGS.
390,326,015 *2740976B7EC1ECC52AADC5E4C78B9F606CAF0ED5 1.MESSUK
390,326,016 *274FC3940DD2B7DED3BAD2BEA2EEB8F3EC93A318 1 milleniumprojektin
390,326,017 *274BBABCBD3F6CD598B2472DB830C1C11B5BBC4E 1NOVEMBER1855
390,326,018 *2744DB48EFDEAEC9EF35FFD05508D09A499ACECD caw_
390,326,019 *2745EA713BF563A664639749650FA2734D28DA11 CBQMT
390,326,020 *2740FA55974F9C3BCDDC917939D92FC9E230C5C7 1suur-teuravuomalle
390,326,021 *274FA799967396CCEF096AE21DC934FA1EC2E7BF 1.talitinttej
390,326,022 *27419D5CEA7A959177D374CB60A06DC65DC7E4F4 1tergits
390,326,023 *274836D64FB9ECE5BD856FB6314CD833B7117176 CED$
390,326,024 *274B0166EE5015754AF5BB6BBEBE94254D20718A #1u
390,326,025 *274F6AB3F47004CC21F504D02E0E8662B8869153 CENSOREDGAYSEXSCENESHEREETERNITY
390,326,026 *2747A6D7F4A3DEA5002D780AA09F584615DCCA92 CESAR.GINGERICH
390,326,027 *274DBD6313FD90B00C4D82735FC7D0CF662E3EEF 1-YRITYSRAHOITUSJ
390,326,028 *2749303EBCA12CFA97A9C2E6F5B47407D90EAD9E CFN=R
390,326,029 *274F3FB8A73B08305481692EA197912E44016873 23dec1156
390,326,030 *274834D0E840BC2AF0C1C3C8B6CE353FB49F86D4 chanchalbisht
390,326,031 *27452EF2E39D946699DF156CBF4EDAD2B61D23C6 29024A
390,326,032 *27424B0A116619C111A982F5BF56F89D1EDA8257 292512 THE ISOLATIONIST IMPULSE SEEKS TO EVADE SUCH A FATE
390,326,033 *274D7A39539EFB183CE10729596FC1EFF179560C 2-Cyzgysel
390,326,034 *274D6BD3A1B971F30CCB7774E5B2EE8168B616C8 2DRSLWRDS
390,326,035 *2745E153E7E373C4965BEFCCF68FB5A3719FE68A 2-druwe
390,326,036 *274CDFB59717BBF7DC0B9B2A41B92384B0903539 2EPIKERDH
390,326,037 *2742797C477C97B47CA11B5CAB30C27396746299 2GELUKT
390,326,038 *2744909CB0BD2FA5FF06DDE3B02364999056E48B 2RIESCIS
390,326,039 *274ED7AD4CFDFB46949C835908EE1AB1CEB868AE 2-YDESSA
390,326,040 *27433E15EF44B55C925B3002C2EB0AE2339C4064 357jorden
390,326,041 *27452C779BCA6E0E64967DD1080A9C8A2F213DBA CHDMD
390,326,042 *2743E5657943D6C031C9B2A944B662F5C41DB8BD CHOHDPG0
390,326,043 *274E44A0E11371F067881B5F32C8DDFE9C5F2744 3FFERENTS
390,326,044 *2740FEEADC19F681565D273C793905D69BEC4F69 christianwehking
390,326,045 *274936D8441DFA76C2C76D48EE99F1B99CB9E0D0 chuckstrunk
390,326,046 *274A5A6DEF3145DB7DC16FF9732B42A357DA5574 3theharley7
390,326,047 *274F8347AD9FBB5DB7B69241076B4EFB69E8384B 41-T4IS
390,326,048 *274D9DCE97C69447831B91DF29C13AA4FF8F9955 429alessandra
390,326,049 *274A5B52BEE35F89828D1CC61946E9416D27AEB8 [email protected]
390,326,050 *27400E294B7396F7641B30BDE65EDA7F31A9CF7F 4E3895545F3645CDBEB0694411EADEEB
390,326,051 *274B892990501B5DA4EB1CA68B0C229846569C6B 4ESPANOLAS
390,326,052 *274053831D05799C5842DAFACE1A16AD06FE33CC c-jtu
390,326,053 *2749CB1D07705E4F343F37E26216EE3AF812B1B2 CKVINLAUG
390,326,054 *274FCBAAC6EA7162A9716D1440D7F816961830EE clementekarth
390,326,055 *274A496D3B273D726F15C70168152AA9D3A03AD3 4ODINKEMERE
390,326,056 *2747E3029F0C3DCA1A905896284BF6971DF070A4 clementmilnik
390,326,057 *274DB9826EF147BCD8D719875266A418A0803ED8 cliffordtromba
390,326,058 *27455B9E7A94986043E0DBBDFD5ED5CC06880D9B CLIFF.WEBSTER
390,326,059 *27434A0C820FFE6086635E5E6BE7EDDE33AC7EF1 4SNOIREROC
390,326,060 *2742A733E4B8794520FB7917E0004461336556E9 closedgraphtheorem
390,326,061 *274FF3CB272F5112D9D17C2028EB3CEA209FCF77 4TWAALFVLAKS
390,326,062 *274D073C75A0E0CF06BDB24BC11EBC379E1B40CF C=M4I
390,326,063 *274B69785F20AF6CA51D54161899F49BE0D11B6C 5AIRHEADINSIDE
390,326,064 *27499A40B24B3C1EBB075F1C970CE8DD4133B101 Co6Y
390,326,065 *27469A44723B842DC6EC3B4D9ACD138A31929078 5BRUBUUBURB
390,326,066 *274394075DBFC8764B193E8A45113D999BA02E7C comdn
390,326,067 *274F3B141EA6915F1E665176AE244BBBBA8A2C94 Concerto-No2-in-Gm:Summer--Allegro-non-molto
390,326,068 *274E41EEFE9E6D2C29F91930713EFD29230729DF 5CIOCCOLATOBSW
390,326,069 *274005AE850C25ADDFB72ED4B7FE24F179BC1A3C 5DENISEPACERS
390,326,070 *27434D32C40A33C0D1F32D5256081722680917A2 5ELECTEU
390,326,071 *274D6D3B77D5DF2A5DF842DD0596BF00A7EF5033 5ERVEN+E
390,326,072 *274F2E3B8FB716C13DFA59066B05DBA59D5753E7 5GALANTERIETJES
390,326,073 *274D46B8CC6312CD99AD34D992DC328DDC90C595 CONTIRRNED
390,326,074 *2744825AA6932630E9123426C7091281F48994B6 CONTRAPOSITIVE7
390,326,075 *27448E7E0CA1FB599B9EC6B9A106E24DEFFA616B CORTEZRIZZARDO
390,326,076 *274756B9A3D57261E989F3E2084F7659279BFE64 5TIMETECHNO
390,326,077 *274069F551D4C1ABEB5995C2BCD21807CE8EE489 cottonization9
390,326,078 *274F5C9FF941B98B8AB364BB4BF573C1674571B5 coyote81
390,326,079 *274E4E73E36CEDC99747E3B9E3B9AA49BD68CD13 C:\PROGRAM FILES\MICROSOFT VISUAL STUDIO 90\SMARTDEVICES\SDK\POCKETPC2003\INCLUDE\NDISPWRH
390,326,080 *2748D2E487F1680B2EA475941E7291238944C863 c%qfd
390,326,081 *27496699C95ACC5B214FC1FCD3A8EEEBE6035E7A 6IMAGERIALS
390,326,082 *2744F839CE68056A950D1E849F351657ECF26AED 6kuivurit
390,326,083 *2747B98991E3BE3539CD40D5799C3B6517F9D2F6 6LINDACHURCH
390,326,084 *274DB3EAE00EBAB1A4002D1AEB4435A845EC86AE cristophersmiddy
390,326,085 *274E568797D6587480C9125E8BCDEBB5899E9953 [email protected]
390,326,086 *274C421870774DF954E4C1634886770699FF85DA CRTLA
390,326,087 *274294E42D5D3821D3EC73F235C6B041E4A33574 6TANYAABCDEF
390,326,088 *274A3575B65E35781AB9365E51891417E9C6D6E3 CtP+
390,326,089 *274528724929EC43C596C2082C37756C88AC0361 cuwue
390,326,090 *2740505017E0E8ED963D10A01B9A12533591FEC5 cw459
390,326,091 *27462E073D6AEF8CCA48661E969339D2E6606606 6YCAIDEMM
390,326,092 *274E77AFA8E8D7DA035302B8DE45CD842D1DAC62 73-vaulted
390,326,093 *27467B87E7BFAAA3BD259691F7F7D1B8F4454B4F cwsv%
390,326,094 *274AC1785A5E34F0D70F46882A4FD083E541E409 CYNAMOME0
390,326,095 *2741D1B13CE9C2BA4A203B33A0BF836FBF181E9E c/y.y
390,326,096 *274BD6A02B8E424306519B01808AF86E2067EA49 czg)c
390,326,097 *27495372C668877E698A5CF5EE6279FD77303477 7AUTOMATONTONSES
390,326,098 *27477E1DE2A6821954FCC79B96B54160232BC3B6 d0ppe
390,326,099 *27427239EBF7E14B75FAC49131DA752DDCF24BEC 7CMKNVDQEQ
390,326,100 *2748AB148C79A3285A94BBF9E5992E676E219D72 d4a1742ca8e23cadab7289ada2b9f8c2
390,326,101 *27436F1FB739690690A100C7DD21E6B3FDCF3E80 D4WDU
390,326,102 *274F356086211CD5503EE9742B3EE1287F4C2593 d79w9
390,326,103 *274B3F6185F23C23850CBA5C0376756B8A51F580 7MIKEYBETTY
390,326,104 *274EA189F64EFA2E87B9B456308B655BDB68C4F3 7NEIRTSUD
390,326,105 *2749CC437F0FE66FE437982F293D658380544EE8 7NEOELLA
390,326,106 *2744F67B6A4CC71EB263A6F2DA435A81DCA956B1 7REPUBLICYELLOW
390,326,107 *2746507710E0F0207C5CEECAACAC4B0B6952AC28 7RUCKAUSSERUNG
390,326,108 *2743192CBCB424FFF34F30D6A8AEB3E19413BE64 DARRELFLEISCHHACKER
390,326,109 *274C14EC1D555E67C14404ABB461A091BCF8213E 7VRJIVLOP
390,326,110 *2747B61193C617D785470DD4641C6D31EF69BAC3 804238 OIREIDENT
390,326,111 *274D32A22216D6F70826D3B065A7F245CA68E133 8096t3d2
390,326,112 *274C49AE4A0FAEBE70889E45240E6370C1A802D0 814QWERTYU
390,326,113 *274D6EDE13C3EC167C43DE2517A1B87C98C55604 [email protected]
390,326,114 *274FD8A11204B302A4614944654456C1BCBEB69A 8IATUDENO
390,326,115 *274F99F0B6341A7B880F9893E2765E0C73C04150 DEEKRAEGER
390,326,116 *274FF89BB0A40D97555D17C0F74C9AA4BE091FC0 8majolicas
390,326,117 *2743187B2D199B88221A118723B08DC851C1A2D5 DELBRAMED
390,326,118 *27440419CF1AB6FA4C34617AA0E319B7AA8E5A18 8 NITELENDIRDIGIMIZ
390,326,119 *274FB5D9CA9986D01825C0E7D11FB8D3FC07E9BA demarcusgiusto
390,326,120 *27498D181CF7E0FCEB1527E43DAE217C56524AF4 DEM=S
390,326,121 *27490E6D4DAAE13C57C31A95B969B38F11E64757 8SCHARLACHROTER
390,326,122 *27426239A501C260C3B11DB78B9B86470E02E30E DEO(A
390,326,123 *27414A69978E143FB0CBB171E4F8C05F47419E72 DESMONDCOVITZ
390,326,124 *2747FD981C5C67374C263AA82E1C941B3C6F3875 8ZEPPELINDAWN
390,326,125 *2749BCD6714326543CC57AB6CF95D5155304243D 900816 siksi.torvalds.p
390,326,126 *274C98D4FD76386DEBA1AE5CD924879ACB072B0A 928macie
390,326,127 *2749BAA8926A6BE8C14E66EB816F41B989002C96 DftN
390,326,128 *274F90F1590BE75359A22D1BACA490CAC5E6FD31 dg1u(
390,326,129 *27489094C4EDE931487A303B08AE15A97FBCC656 DGTRH
390,326,130 *27445F1C06F50783D4106FE9DC6D6CD5155C1F1E DHWHU
390,326,131 *274788AC20BB200C1E6F6967EE2578B73A16ED89 DIL!W
390,326,132 *2748817ED858472780276B9E42D88461ECDB0FA9 9PUNKINCLOCLO
390,326,133 *274D5FDB36060DBC125F1928D44FD3C0898F6138 DKB5Q
390,326,134 *2744F5620D6BEBC1353C505352A05354F580C5B3 DM0AW
390,326,135 *274BF4E6625570ECE373B3B07E4EDC75D52043F8 dokpv
390,326,136 *274AEB9BB96BAFF34ACB9B96B5BB74C31869476E 9WINNIERICKY
390,326,137 *274D6B9CDDE316D2AAB459795EA7626B3623365D domti
390,326,138 *27462D8144FE5F36909C81895A314C6D6581BAFD DONNELLBONUS
390,326,139 *274A93E429967DCDB34A7D71F4F8DCFA1FFB0036 a1oir
390,326,140 *27434B855D609C12BB417C7ACF963013E5D36F7C DOUGLASS.BUKOWIECKI
390,326,141 *274927EE60864F850F6D92187E7FA39A2CD1F3C3 a5dds
390,326,142 *27484BFBAB98DC162024432A581D7E7D99F6117E AA"];
390,326,143 *27443C146BEA8E41BBC5029D694100DA37871127 [email protected]
390,326,144 *274A3A0B1DCC00CC6AF51271863F245E039977DF D%%SH
390,326,145 *2741020899F073C30277AB990207407CFE949D97 [email protected]
390,326,146 *2742EA2FA7CB1E6A7DF2677F3EE64FE955320AB6 ACCIAIOLI
390,326,147 *274369FF70E69DDFDC5DDEEBF80677923BBF642D DVKPP
390,326,148 *274533C9DA17C137033E58B118CC98BC3D4050C2 ADJS
390,326,149 *27482BC52F8E1ADE7D04D9224BD4C592B2FAD924 ADQTRVHB75
390,326,150 *274125C6BB29410ACFE7F01E7AC21ABC68EE5199 [email protected]
390,326,151 *274A4EC82C060E205E30AB06B8A4C76249F4BD71 eddiemckissick
390,326,152 *2748BB0F850C5321C6CE506000BBB6FFA8747718 eddierodebush
390,326,153 *274B6ABC733761F3B15E4914F12B471CF8CD3AC4 ahmadcohagan
390,326,154 *2740B304E3DFADAE5610A1C9D8F9D86424626516 AIKIKAI HOMBU DOJO
390,326,155 *27428D195D4DF7CA565089A9677359BF28B3A140 AIRU
390,326,156 *2742C09B6A21CE274C3D5E91858EA68286ED34AC AJTBB
390,326,157 *27468373B78FCF4537162A8278DA3B788F39944A EDKVE
390,326,158 *274012D25C6C38E869FD74B6F3438E6824B98A40 EF$L?
390,326,159 *274A66606762AD0072CA3AB03B97042697D67408 EGJ/&
390,326,160 *2746A738928A0A1C89B8B117D3203724C9E3C12A egp3
390,326,161 *274B7C672BFC760522B67DE53B9E410F265BCE4E ALLIEJAL8
390,326,162 *2747AFC9C947039D7EF5097C97C1DA3EB69B5203 EK.+A
390,326,163 *2742ED1F99C39258B9D549B12D8818C7FCB69A89 ElDiabloEnElOjo
390,326,164 *274B3FC3F45B7B64FCB64AD58B1546A3B5A338A8 ellisthansamai
390,326,165 *2743A53ACC0462F8E0801601E1F572B9F1D9FDE4 AMBERLY-TORRES
390,326,166 *274E5E89884CDBB6852BF811D21480B9F59BD53A elollip5
390,326,167 *2747F6854F2841BA2A2C0B3000443EE3B0AD3967 AM/XM
390,326,168 *27481ED83841329DB07A0503DA9537811FA39B1B ANDERSON088
390,326,169 *27428BC5B10643C4D5A516578D8E894583C16F42 anexaria1
390,326,170 *2746F84FE07A4ED15FD7C31ABA9FF98023193789 anlsw
390,326,171 *274168340346700896B6CF3E86F055F251E90A6F [email protected]
390,326,172 *2746D6F964D2B6F5C2F571B0E2170A2B7545EDDD ANTOINE.BORDENET
390,326,173 *274D81F22CF69B46617A2451AC8DF1B13EBB702E ENSEVELIS
390,326,174 *27440B18A4B5A76063D1FF7E2C92D9016E36F2DB erinvolcansmith
390,326,175 *27484572AF6FF3DFE2C94461CEB0F2E013F58ED6 „ERLAUER
390,326,176 *2745F0C10EC2C95C29A03E55E30631954FFFEE6F erpasset
390,326,177 *2744C030EC540B1820BF8545A36A17AB16801481 arielspaeth
390,326,178 *274F5F1EE8950B340AB25D61BAA8277A43D36B0E arlensutliff
390,326,179 *2743D6AE20D962E0756047F9C0E5E2B4DC9F8AFB ESCUCHENMÉ
390,326,180 *274EC3574857C7E1D0849A4769677ADD28B07256 aronzwickl
390,326,181 *274F8BF5BE4F13F7BA9753CB87ABACBBD9E09882 A#ROY
390,326,182 *274686495CBE8060E7A2238282467B3EC4A34F9B arturoyasurek
390,326,183 *2743C0063B6B038D5264367A6C148233B0546248 arw!g
390,326,184 *2743FC92D0A26B0BD043CEAFCF0700A6A890CAC5 ASHLEYWANDELL
390,326,185 *27415F98284FA1108EB6D457DA1C1E44793C7333 a%st9
390,326,186 *274697820935B82D42912BFD0427302A23378C11 AT?1V
390,326,187 *274F9404194D2439F45DAFEE44B862A8E053EAA5 [email protected]
390,326,188 *2742DC3213E14741C5A9EA9D56B466A23A3A2B17 a:/u
390,326,189 *27469C4B8B058D17C2D410397300AE8D6EB2E9D9 f){)
390,326,190 *274AC07F28294F51BB432BDF45CDBA9506E510D7 [email protected]
390,326,191 *2749AF66CACA22460005E23ACAEA3AF12CE62B61 A/VUG
390,326,192 *27447C61D5D3DFA998F013D5FF46189D8B678BA0 aymc
390,326,193 *2747FE1F945D1D00F8B8D542F9E2BF286F12526D azc.s
390,326,194 *274CE48D2752295B461AC173ABFC2F11DFF3C30D b0u$s
390,326,195 *274D26F3D2EE73D9C3FA34DD8070CB23D9BA08CF FILIBERTOBELAK
390,326,196 *274682E47A591B0E71EF11FE590D18A446F29291 FILIBERTO.ERBE
390,326,197 *2747B96453955CC4422F0BA185CEDDEABD3FC9A0 B3KNW
390,326,198 *274BBF6302C2701E1C998006E66B0898411305C7 B6C!3
390,326,199 *27486A6AC9008392C61EB4B2922786064F9D997F fonotpia8
390,326,200 *2741F4D3616BAE1D9311705A6BEF4569B45E3982 foq4
390,326,201 *274B532C544AB115AB329ADDF849A6F97902334D [email protected]
390,326,202 *2741E115211B11B1D06D2872A0F21E823D7F5B6D [email protected]
390,326,203 *274E1281F1F5ACBD177CD2E815A04CF16D08849B forrestgipp
390,326,204 *274E60187B9BC5DBBB85D6461F14B1CA2C20D785 BARCAROLE-VOM-ABSCHIED
390,326,205 *27475BC351BAA0E13E7F708F810119E69303514D BARTRESPINNER
390,326,206 *274C9988465C1EB4837187DE8804D92727F617E2 BASIL.PILLEY
390,326,207 *2749D378E688E4722E2E17392BB113614C23CB63 francissievertsen
390,326,208 *2743E5AC296CC2A2B7E2C6581EA4E81082C156C5 FRAY」
390,326,209 *2747FBC68D24B0061618B2C0E5781A72E2F6C189 FREAKME/SOPHISTICATEDBITCH
390,326,210 *27406D0DFB61476E97E2D16C3C1704A97C4D0829 bci;q
390,326,211 *274ACC46C3EE5F1218C94442AF7F40F5F42B4905 BEAUNECENTRE
390,326,212 *274BABCA24E3A7E1C2476F3E06A32F2CF4C35057 BEDRIEVENPARKS
390,326,213 *27452B5C774D383A11098752159040229A6A5019 gairbag
390,326,214 *274867690416A16FD58EC97A82FDD6A258DAAA4C GAURAV-DASH
390,326,215 *27471DA8329643EF20ABD4DE0E116ACDC63BF686 gavinmulderig
390,326,216 *274F1B8526C0B6A856317D175FAFAC7868A41174 BERT.PFROMMER
390,326,217 *27461D4EF008077442D5283FDCF67357CFBF9F10 GELD0NI4
390,326,218 *274D9A2C8B7459A3E48D0F61E276809EE0160C46 genes-destacadascapitol-building-full-viewjpg
390,326,219 *274C791E996E5373101F91E7598D95A887D8A35B bfub?
390,326,220 *274D369EEC4D222466303FD2AFA2FC375D7AA828 B$GG
390,326,221 *2741D868ED137E7A0D0A607EC151BEDF5E46657D bhd?v
390,326,222 *274BF2A075ED4F5E820859EC5C2769640421F30B GILBYEM
390,326,223 *27440768F04975AC6D8548E8519711D33BBBA999 BI$"J
390,326,224 *2749B63DDFD763BB0E9A7CE3EA1FB01FD4E8EF51 GLENNMCDILL
390,326,225 *274092AFA119B69C000D5F6D8A60DCD9C3B17790 GOATNEWTON
390,326,226 *274B783A1E9EDAE801C810964DE0BC3C95145D1F GRAPHIER
390,326,227 *2745C8D70B8915935C2918A15974B009396EA2BF H4ZIN3$$
390,326,228 *2742078B672FEC61DDA88DE4733839746E67188A bjoernnaundorf
390,326,229 *27446743E96FB799E2C9CE3DE45E735C48749B4F bkleo
390,326,230 *27443006DAC9B5410BBB5F91CF4AE4F8BE9DE94D blendofblues(a)
390,326,231 *274C9B96982B2DE9DD93CC5076A836076D0CBADB harinkle0
390,326,232 *2747703E5D5DB2F485A4C79A59A27B8DA3956955 bo8=w
390,326,233 *2742D874D11B8C02539A726C3821B53A60D0E926 BOBKEPPEL
390,326,234 *27473523BE26EE6532F1A1AE5B10218C9DB9E960 HEADRENT
390,326,235 *2742DFC03906FACDA2BC0C6A4B96F3A8D63E317A [email protected]
390,326,236 *2748C865669D9A3BF0DB8477B095B18E24AA7017 HELGISALLOAARETESAAR
390,326,237 *27419A0918250D2CBA1652C654CC63EC44C9A05B HERECUSED
390,326,238 *274979413053B8BD935F5C73DB6989CBCC047BC1 brant-page
390,326,239 *2749A532E7E08DED352C3FD02C722ED7277CA63E HIZZMORG
390,326,240 *2745B56854693AB5345F49BF0167815B5DBD474C BRENTONDONOFRIO
390,326,241 *274745CC9F61A0548D15BE66104F2413D50845B5 hmongeried
390,326,242 *274955A9542C2CEAC5CBEF3F8C66E404FAE8A691 BRICE.LARCOM
390,326,243 *274761E444F7E69AB53649CBCF4BDBD73858AB2C HOLLIS.GOLAR
390,326,244 *274C6F8ADC633CC652EF1227595AC50651F1D4E2 [email protected]
390,326,245 *2742353349A46B806C045896F903778331BAF4D0 BROCK.THIESFELD
390,326,246 *27460E09920148903D65588B832D76406C827FF7 BRXh
390,326,247 *274E27CECF0543431682B57FA3FAD6C8CBA35871 b-;sb
390,326,248 *2743AF9978C857F1100B925DBAA2B3B5DA179139 HTTPWWW.RENAULT-SPOR
390,326,249 *274D0E4744183A45D0B897FD42263942513B760A btsfhrt0
390,326,250 *274CAB689056117B9AE64C84DE42B7EABC84764C buddyhric
390,326,251 *274BA589FE87F596E67D1C7190F35AFAD91D538C HURTY
390,326,252 *2746A0B646E49264976B8881F217527F4574B345 iamswim56
390,326,253 *2742BABAC9B4B60E00E6FBA72D98C593FAFC9D5A C0CK$
390,326,254 *2749DF8B46B2CAFC343E3178F4572B1BD88995F9 iloveandrea181
390,326,255 *274693766C11CB6F04A0E64A0D6A97ED569D94A7 C8_9
390,326,256 *274C398A3A8F70662D205A27D8D91D6CF760096F CARLOSAGUINALDO
390,326,257 *274A48C9DA8B7962768FBDAE1362E60FDB621878 internetblogs
390,326,258 *274A22F9EDC11DD990A82E4DD0FF1C9929C387AA carsonsantorella
390,326,259 *27433B02BF4B837BD0DB6C4BA94526BBC6531DDD CASSANDRA DAVENPORT
390,326,260 *274CA6ABDAC22DB4CB57A119D4B6E246F5A91691 CATEGORYUSER_NEW-2
390,326,261 *274B230B103819FFA768FEAA89385D0E9909596F CaU$
390,326,262 *27454532DB066E77CD61E16B58891F4A608A7E71 ISKEMBE1
390,326,263 *27484873B40CFE8D8CC62A5A003663CF0E641556 JACKGARDLEY
390,326,264 *27448841F732E0EBA4CA16BEC861B8F8A61CA150 jackmania
390,326,265 *2740042FE0BB53545CA47B9F3B864EC19077A29C CFGB=
390,326,266 *274BE514485E5B46C75453DC2670EF7DAC40B877 CFPBD
390,326,267 *274DF51DC6AC6EC4CEC4F419A1A5BC21A62BB261 CHADBLETHEN
390,326,268 *2741BF269D296D34529FAB2D330C087B44741380 JDM%
390,326,269 *274B23C5620E872992C0DA872451236925CD7080 [email protected]
390,326,270 *274C320A3AC296922D2E3106A7E6F8D04FAEB129 CHESTERLARABEE
390,326,271 *2747CFA988E8B75C067943F5F7FAA2B347814122 JEREJANIAK
390,326,272 *274022699D9708C224DAB3B968709A5A4077158D JERROLD.MELLIERE
390,326,273 *27445975127EA7F9D9567F3C8A31394C7DE4507B CHOKE CONTROL.ENGINE.AIR
390,326,274 *274195CDB12483FAF2E8A55E3BD5630A5499BCB9 JESSE-WHEATLEY
390,326,275 *2746A286856DEBF64DEA1C3501C7AF4519E48BE3 CHONGGRUBMAN
390,326,276 *274D439C2D9505004C46A7AA17645242B635C876 CHONG.HISEY
390,326,277 *2741E75FE03FBBA666C62B440532AC7CF08C4A5B jessica-rodd
390,326,278 *2740271B864F35CE9211C774B86510D3DE77CAC8 chrisaccosta
390,326,279 *274CC2F53AD583D7DC07975924F2699447A46B1B JFILCHECK
390,326,280 *27468EF0643E49A763BEB4B8156D94554B981274 CHRISTINA.LORTON
390,326,281 *2745F913E5E1C54FF089051547D46200F2BF3D22 CHRISTOPHER.BANDLE
390,326,282 *2747FECB527F827DE1AF7D376764640917BC6CDB [email protected]
390,326,283 *27418B73BDE480324AEDB75CB1FEDC5CA2AA365E [email protected]
390,326,284 *2740A1A8A87C8E9D0B13E92BAD9A8023CEF9A007 cib/p
390,326,285 *27463732B6406C9CE9A94E503AB940D297614B91 CJ5J
390,326,286 *27424810FE242FB46F6806C0EA4EF56CC15DF3C9 jordan3798
390,326,287 *2747E29B47129C8818362CFB94D91010AF42BBE4 CMm3
390,326,288 *274B92744D9C88CA74F4052C1CF19366D5997C6B collinhanvey
390,326,289 *2745357D7D8C7DFF5DAAF7E90D04A52CD9165E12 [email protected]
390,326,290 *274A0E6C86C876CBB5813CE9EEBB5A4F057DDB23 CORINA NEGRU
390,326,291 *27450098FC29943E7E372359311B044B9B2FEB69 CORSINI运河将拉文纳市与海连通,建立起了完整的码头体系。
390,326,292 *274413D840A446DD310F3D5EF12D3E0A25F02EFF COXP
390,326,293 *2744CEAE54AAA3719E2D6669EE6A4DE089AD4137 kfjwvbe95
390,326,294 *27426CBEDF0544C92918E0DAF5193EDCF29BB382 KIETH.BARCH
390,326,295 *274AC768C46FB47352604DF1C8EECCCE986DCE44 C:\PROGRAMFILES\MICROSOFTVISUALSTUDIO90\VC\VCWIZARDS\SMARTDEVICEAPPWIZ\MFC\APPLICATION\TEMPLATES\1041\DLGROOTHHC
390,326,296 *274551DEE2BC47C5ADB0D95B548A529B8E492563 KIRSTENCLEVELAND
390,326,297 *274CE1BFDFF788F0ABF4A37CEF4C295837D9D752 KOOSTÖÖLEPINGULE
390,326,298 *27458883AD3646A85C5992440AC01D92932BE375 KOROT
390,326,299 *27462A3E39CA3098C671613924D11698A4059CB2 [email protected]
390,326,300 *274C95CD74A1882FDA6DBE58B32B1E1D31193227 KYONESET
390,326,301 *2749AE3516407F3D80696DD303CA87887EF5E252 CSAの日本法人。
390,326,302 *274BF1481BB08248A7715D7EF6B1368CCC3F72AC cslafrev6
390,326,303 *274A05215439ED43017C5B3E1B8BDA2F0FF0BF50 L4RRYMG0LF
390,326,304 *2742E8BCBED71D49E6F740CBE954F91A067BF5AE CS-NK
390,326,305 *2747CAD6E9032285E405761A36CAB86ADDB6BCF9 [email protected]
390,326,306 *274FB098FFFB3D08B5D70266E2C08D94EE634581 LAIRUCRE4
390,326,307 *2748DB0B1F80A517B2AAE5E7BDE117BBF85A94E8 [email protected]
390,326,308 *274CF2D1B54B9397A85CE158C545CA27F21EFA15 [email protected]
390,326,309 *274E034F37CECA7050EA9CAE4362B4C23039B3AC cun:h
390,326,310 *274EB4AECFBC8323069A607D6105884983902899 latumbafalsa
390,326,311 *2744B74BC0E3DCAE2141645427D1FAE189B096A5 laurenceritchie
390,326,312 *27459A480987E5A7B2B8608DF77775B5526A3DCD LEANDROGUSLER
390,326,313 *274A3948080DD027CD8909975FA25C073B36D9EE CYM_S
390,326,314 *274776328E81BD271080546CDB2988FA45F14657 D0A8
390,326,315 *274291C524A5B159EFDB1A112C580A0CD881E5D6 LEIGHMOLLA
390,326,316 *27462CBC8313A46B4AE9BEBC350AF30E362A6EE1 D112435
390,326,317 *27454D659099F6B5F425433D12E3512935469B53 LENELDA1
390,326,318 *274A81845DD1D51E1BB1274606BC9E2F53EDB01B LEONARDO.LEWIS
390,326,319 *27453DE21E54E089D1F063291770442AA589FC15 d5ngd
390,326,320 *27418347FC33B71BF92E874FB1AA5B5F4E839F22 LILWIGGA
390,326,321 *2740CF247740B3979155E0010C8A1548950EBFCD DARIUS.PASSARELLI
390,326,322 *2744E078456FEC0E72710BB116F0771EE12782DC LITISIA7
390,326,323 *27413221CB86CC4A31C6D8A6C8DC036D30DF2F65 LOVE'SLABOURSLOST(LIVE)
390,326,324 *274FA10E2D1F10AD73CD4B11A5626C71F8D058C4 DEMETRIUSEDWARDS
390,326,325 *274FF5125D5C237CCF8EE2F91A5F6680DE4F1A87 LUIS.FINEY
390,326,326 *274C20818F99380092B8EDC3D9D742A3BAE02436 [email protected]
390,326,327 *27403789B4DFE36B4FCD03F099250A7510A73149 Luna-Pearl-Woolf
390,326,328 *274F7269C7C7F5C6F73620282B120BE62EF57E15 DEORLLU
390,326,329 *27424B6D09BEA90A6053CE0B1B78A38E9A8CB418 [email protected]
390,326,330 *27459CE88C74ECBEC9CD60561B1C4F948ED47D55 LVESALAINEN
390,326,331 *274F21F279C589B587F71B5CD3A39F94F047EA65 —DERECHOS
390,326,332 *274E7558AFC8E847F254C073AB0E07E461481413 DEREK.TOURE
390,326,333 *27411444E49313BDBD31562187FFD97741260B6F DERSZTORFF
390,326,334 *274A07E242F8BA67BCE4806B916DC91F38BF140D MAGOO_RAPPER
390,326,335 *274DDFB4D71D308B0829D993B98DEE7AF5CCD331 DFM0
390,326,336 *2744996D912111D329EE1D9A906BC12C7F7875D6 MARIANO.PATMORE
390,326,337 *274E325EE79B7A0632AD2086E1F73E9398DE21FB MARK-DREWEK
390,326,338 *2747AF3C29DD90F7D4B2DEBC2EFF7E57501DD7D3 MARTINBENDOLPH
390,326,339 *27454A5F51B730472C4ECDAF9B8B95BA2EC83747 MARY-AND-THE-BABY-ELVIS
390,326,340 *274A99A28C76A2D6395678E086B2969FD4847372 DIKHUIDIG0
390,326,341 *2747BD60B2C6608829CD7E1714F6F55795CC7603 DILLONBELLEAU
390,326,342 *274C89AD1E1DEA3E15E72F344EA143B1DDF893CB [email protected]
390,326,343 *2749C7E857208CEEFC226C8A120A15FAF995840F maximoufford
390,326,344 *27455537987DC7B050F192AD6C6AEFB8F5000848 maxwellcastlen
390,326,345 *27477769EC1B8FBD7BF9B963557CFA7249A354F5 m"ck
390,326,346 *2749ECDE248F40C4950DD0D2DA2C77C16D635EDD MENSIKOVNAK
390,326,347 *27422F1BB293B5F4AF5A568CA76596A01EF92908 [email protected]
390,326,348 *27401377A139BFE8D23A899DD13BC0D3C1C8B50C MHAYOU
390,326,349 *274D19A2C2E95B657FDDD46883A0371CFA089462 diwi9
390,326,350 *2749967C24BABE6BA2B4E46D2AB015837555D292 MILLITE'S
390,326,351 *2747C9CC18E97E31E3331ED327852949A56C65F1 dky$x
390,326,352 *2746BB3C8B0A8AC9B55B8803873479CEE3332D7F MITULAHMED
390,326,353 *274C810A22EA1B81B3527FBD3B5A8953C8B8A4B5 D&LUG
390,326,354 *274955F7F1B983EA1E2BF0F3FE23F7743A8116C6 MOCKINGBIRD-FRANKLIN
390,326,355 *27454F86DB917C7009279C7BFABF4A2655710282 dominicjoelson
390,326,356 *2747F70EACF992CDA54F9A36AB3B924F4821584F [email protected]
390,326,357 *274FEBFF6DE0A1E34048A23111ED1F61E7AF1E79 [email protected]
390,326,358 *274B186AD0256C670C5FFFAA44A2554B9DC86A3E montananaturalsinternationalinc|unitedstates
390,326,359 *274E786EB1FA0A6F45854CDC2EE44F62460CFA5B MONTANASOUL
390,326,360 *274C51B9F0CD1D136A51116DB1DF92D5F43D031C MOORECOOTS
390,326,361 *2744CF30A03FB7078D03285625C1910EFB472A17 MOOTORIRUUM
390,326,362 *2742CECC421977070E89FFB2094DF67658B00A6F DOORSLAS2
390,326,363 *2747780AE1B4AD84F810E664931822AF4656E395 [email protected]
390,326,364 *274F019ECFE5AE29C6B41A10C5814A685FF26F94 mrdp
390,326,365 *274FC6E68DCEACD8EA4D6959110F7428E432C606 mtservice
390,326,366 *274D2E3C63F896F48189E2A3B1AD9E6461ABC92A DPDML
390,326,367 *27406D53B4DAD80CCC0E95653D363FE6672C60FF [email protected]
390,326,368 *274445852502D2FAF43C7AE809D1300ACB78818A nadnosing
390,326,369 *274794D3B5A57FB7C5C9AE192677C3A39AD57FFD NATHANAELBORRAYO
390,326,370 *274F443AFD822E790A10C2EA00DD9A4BC044D2D2 NAUTISKELUA
390,326,371 *274F522F392968F81D350C7C572644F60D8869B7 NEAL.DUNKAN
390,326,372 *274C83DD9339068EF1E89C097BE83C0E6ADAFEE0 “NEENER
390,326,373 *27475350D55818B3349A5D581F4D48024B9DD469 [email protected]
390,326,374 *274D451321935EE3DE2C89D2455C9917C647EE2D NESTOR.SCHWENDINGER
390,326,375 *2741E354BE4BA35B26EFA957F3AFF4FF4930BB47 [email protected]
390,326,376 *274F0DED685BD8543F43C303F3CA5B1B69B3778C new9455
390,326,377 *27401C4B2E7B2E158B1D02953E870CF092E87F7B NEZNATE9
390,326,378 *274EE829E6208ECD851BF48AEBC82B65FA1FBEE7 nigelhaselden
390,326,379 *274E74EE78A2A6962A4160A17B9583FB7EEE707D night.come.down
390,326,380 *2745B1126177D54366D1BD65CB0E780B96317069 NILDAFASOULE
390,326,381 *274E85006B858EA25B3B828F9809F6D1C91559ED noitallatsnirotide
390,326,382 *27487479562F63D0DAC32EA5EB0CD8272CABD09E nonbiological.
390,326,383 *27438BA5DCB863A91E3041EB148AFE7A93AD14D9 normandbraskett
390,326,384 *274C0A8A2D6D0EC069AF2E60958A4F7FDFC77282 NORMANDCOVER
390,326,385 *274E400D5C834047A3DBC1E97EEC24084B7C83CC d+ut?
390,326,386 *274238AFBB9E9C080C0A5F2B229D8CCC62B304BA dw##
390,326,387 *274C16AB63305055EC49589F0C5AD7B0F6E24B7F dw%u6
390,326,388 *274A91983390582BB45D7E2B3BC37E966AF50625 OBSERVG8
390,326,389 *274C876D7D7B8D77C815D8C0ADD4ABDDB0AA6E02 [email protected]
390,326,390 *274877BD7D585870119AA49F75173AF12FDDB83A ODETTEGLASS
390,326,391 *274266B417908371812654ED00B277046407E9A6 EALEASING
390,326,392 *2743D2F53E41BED688B66430BC71B88C0A27A28E EANILPMI2
390,326,393 *2742957EAA2E3491467B97E9E458B0A8C39A73FC Of-Here-&-Now
390,326,394 *274EDDAA1A569B752AE0E220313B602987E76B08 ofutnmying
390,326,395 *274F1739695AD81FC126436F21FCAAE24663B9C8 edmundivory
390,326,396 *27426E55D3E2C08F0EFD0417290C033EBCA2E7C2 EDMUNDO.PULLER
390,326,397 *27453A6B205C22EBECD7954761179E4C5DE2C419 EDNAAGLO2
390,326,398 *2742FA2F4661DCE3DE57654000DE55B4E647F4B9 EDTp
390,326,399 *2749559D383C29B2EDC55A1E5DEAEB6B9A0BCC83 OPGESJORDE
390,326,400 *274C8D91FB64FFDD81562EF309FEE1841F1D9E8F ELWOODSTACEY
390,326,401 *274573757EE0036EFDAE21D8D7ED5A68A02336A3 emiliomacintyre
390,326,402 *274D498FC3DE760A097719E0E261F3FE8F92E808 EMMANUEL.GLICKMAN
390,326,403 *27486B57EE271CEE6FABAF77118B697147B9D98C EMMANUEL-WATTS
390,326,404 *2742FCBDBBE8C94345834965E725D1681001FB51 EMPOISSAMES
390,326,405 *274904E52169A203988A21BCB1B391B5B1D677B5 PANOPTIC-VISION
390,326,406 *2747EFC5EDE7E36A99B976CE90AD264B53D313E1 [email protected]
390,326,407 *27478121B0741F462EECE26F8C34AEA2A2EDA9C9 PATRICNE0
390,326,408 *2747BAC172DB1331935BCE1CCB1AB705FC0EEE93 ERASMO.ZAMOSTNY
390,326,409 *2748CED4003B890C4B07FB2E6A22CFC7DEDA39C9 Peaktime,.Volume.3
390,326,410 *2743221319901C691AB07D0A59151BAD438E4F7E PEDRO.CROCKETT
390,326,411 *274E153FD38C5B090C58E2B66132E535C0B20DE0 ERKÖK
390,326,412 *27441561A41ADACC58183BB5567CD9E4DB45133A ERNIELUKAN
390,326,413 *274C4E9BD952478DEBC6850F07EC344527627FDC erniesanke
390,326,414 *27413B239C6EE731A662403BFDD200161008236F ESCHENBA1
390,326,415 *274CE54CC0E40BDD5FFEB0129395D332EC8BDA4E petestan
390,326,416 *27485CB209964CF0EFA98612F36B0A2FE98B03CC pgq
390,326,417 *2748F221E1E6DA817E5D49F12DEE82E37DB12254 ethologie0
390,326,418 *274F39CD6DB197CD51839B6D00266F5D93204F4F etruriae2
390,326,419 *274D2C5F204527E4B55D5E01011E180FA61CFF9D PIERINA LESS
390,326,420 *274FA5E49B2698A060E5CCC15DA51C61A221AB49 EUSEBIODEICHMAN
390,326,421 *274BF266A62197AB2C35CD63D8481322D891F87C pinmuk987/
390,326,422 *274422A4582614B03546BEA4C365D4D243F92809 platepra7
390,326,423 *2748807C24ADEF57BC7E46F26A95761AA1ABDA60 EXEMPL!F!CA+!0NS
390,326,424 *274F77770FEC8921C7347C6C4FDDCEE4E56413A6 FABIAN.SWEATMON
390,326,425 *274C833695964F5A560070024C8DC9C4C29E125C FEDERICO.MICKELS
390,326,426 *27494368BAE27E7631613B7BDC93097A72C7C613 [email protected]
390,326,427 *274082BA565CEDE4F5E46D8EFB37A35D78D1F5FD FIDDLERSDREAM
390,326,428 *27402B13E043EA6916E776B1BE7B49412105945D FLIESßGEWÄSSER
390,326,429 *2740E95A4A901482EA3FF301BFBCE0AB039FFCCD FLOXSTED2
390,326,430 *274DEA5AAAED69565FFA11D7A8B447553CFCFB45 FOAMDISC
390,326,431 *274BCAF38057A0B3EF06B4937746F3F5D5E394C1 FOSTER.LEPISTO
390,326,432 *27479C53FCFA8EB20310C5739E32DC7E5DDC7359 FRANKIETOMME
390,326,433 *274C39C6A69DBA7F088915341AF6D2E21A92559B pourcontrel
390,326,434 *2747443BB382A36F4A24955D524CF4245AEFADD8 [email protected]
390,326,435 *274F4A3FE6F75AAB20C2B939981A40AE18B4877F pronkappelses
390,326,436 *2748745919EB859A946E1B75FFEE711989F25F8A prtndnc6
390,326,437 *27420E9676FA06E02F1B9288290DF292618FD4FC garypiacenza
390,326,438 *274D394D9266074E5B031BA558155E711C84CB46 q) ~0~o>B0
390,326,439 *274F7724E26B53B9329F3FB55B62D5DF753507FA GCB8
390,326,440 *274C468EA231C121460E77F8C410B63CC8B770A0 gemeindebrandinspektor
390,326,441 *274589C17CE49A55E678514E1D9B3ACA8DD3020B quemehashechotu
390,326,442 *274DB135165F7137EF56B037744A2D0609984D1C QUICKSOCIALWEB
390,326,443 *2742544DCDC65846A9B4CC345F35E3A7A6BC2DAB gj12345
390,326,444 *274EB8C85D794B4DD6FE31BB7DA3B72A281F3B53 QUINTINLIEW
390,326,445 *27445871CBECA273B9143304AA041AFF5F37E83F QUINTINMATRANGA
390,326,446 *2744BD4F523ABD414165D253A46CD1FB9E518C02 gloeilicht
390,326,447 *274788EB280A9A51E52B81E6EF1B03BA37D5A243 gnuoyeht
390,326,448 *2746CBD2B28787BC1D82AD56D2C3BCC02C3F0994 GOFISHJED
390,326,449 *274A7F8201B416A2ED44DB6885374CF5E4E72FF6 GOGREEN
390,326,450 *274517778913B09D91D1938543194C09968B2D36 RALPH.PACIFIC
390,326,451 *2745DBE3BDE6683924D0CC39BA0C00FB40BC6E65 gortonian1
390,326,452 *27499CE62017EF32B6BB0E8A44631DDBCA94711F [email protected]
390,326,453 *274502E5D60DAA9386526CDA8C2ECC116301BF29 RANDOLPHSTURM
390,326,454 *2749872E928A159CE5863189685D1A707145A053 graigbutera
390,326,455 *274FC320F186507164A7D2A49015E1386E45E22F GRAIGSLOTEMAKER
390,326,456 *2749E62F088AE1DFE67577434FFA1C617FB03F66 grilden6
390,326,457 *2747B2C35413A53395ED4595865C11D1AEED5C92 großgasthofes
390,326,458 *274C552FA508781A2C3BF61030D8287C725868E9 GSB'
390,326,459 *27493D8827462246171E839D6C58DE53BDD6D6E1 GUADALUPE.DEWITT
390,326,460 *27462B47F25F41F95A7DE7AA556BBC299D6D6E98 GUDAUTA
390,326,461 *274BF70DA76B11A398466AA07ACDCF6E5E45F99F RENNOCK1
390,326,462 *2745802A08B0C186F25E0FEA22B6807963A13CD7 HARRANDT
390,326,463 *274C77EDFF870EA45B990B4BE60D3E3935641A6B RICARDO.SOJA
390,326,464 *2746F3C2FDAD8396D57FD4D0E3707347A7A8E042 Richard.Foster
390,326,465 *2746308F51B3829DAB01DCCE6DC8589C651E9B00 HEATHER.HAVENS
390,326,466 *2748BBBC35A75BA1580CD79A5389180E862D03C8 RIDIRLA0
390,326,467 *2742CA6AC4B776EEE32A5E1B0BEA05ECB4D0D177 ROBBYRUNELS
390,326,468 *274E66AFC5D482781DD804E8B55CFC9D2568D15A [email protected]
390,326,469 *2742D74478DEFD0BB709C32B0E2F06D336B7BB7F robertmartz
390,326,470 *27458C8E82A288029087F1C85121AFFE9E62F254 HFLAHANT
390,326,471 *274EFD2F576F97C3EBDF8C4D7A27AD8AB5B380B9 roccomander
390,326,472 *274F934972B429615F0B1CF599CAEC39A0153CE1 [email protected]
390,326,473 *27415A462EC4529B7079F4FC866205F9CDE82C03 rockinsud
390,326,474 *274E66A99EE45525FC4FB8FE7EA6799058716CAB ROCKYREIDHERD
390,326,475 *274217D6BD54CB17D998D695DF2975E37E9CA9B9 hilberath
390,326,476 *2749E8D435E29183444AC26B1155D5A0DC169445 romanske0
390,326,477 *27491B48B4EE79FD3B7FD3F59E4DD27FD12BBB90 ronaldsinclaire
390,326,478 *274B53E02896DCCE5F7911E5C5C992EC9A756D7F RORY.BACKUS
390,326,479 *274B007A2281775A4FCBD799D773F1813631F5A3 ROSENTALON
390,326,480 *27490EBC584044E1F27952DFEBE960EEA996864F rosverding
390,326,481 *2743D4A55A661E049980792E2266A33BA79FB5BD HONEYCOOL
390,326,482 *27474D4A29B36AAD3C70D3797F77E4955425B86F russische.toepolef
390,326,483 *274DB08713B7D018432F9E85999D55E179891C68 ryddast9
390,326,484 *27488C0F5AC03E1994AEFAA973E553BE5033B6F0 SANDRAINDIANA
390,326,485 *27487AC64C951F84B00E233A39C034673EDA3385 HÜTTENLEUTE
390,326,486 *274047D6352C9B90F9D701AA77040F471C6854E2 scpy
390,326,487 *27488D2E5C6886B3620B70C4C9CF9FBA341B8485 IAMPROKOFIEFF
390,326,488 *274AAD37E9977FCB8F569A93A0CB026177A010F6 IAREGIXE8
390,326,489 *274E56861341CBD29286C2F593F3ED392FF1CCAE i,-f
390,326,490 *274AC338129BF767EB1D56569A6DDAC360AE498E SHANNONDEFABER
390,326,491 *27436AED2DBC7B8EA41418AE58576EA1A19FEC52 shannonpappas
390,326,492 *274661FA183F21820A9135BD6D8E5C4AF776DE50 sheltonstake
390,326,493 *274C3169CBA652F62EA4387C5CB4F2442AB629BA [email protected]
390,326,494 *274C1C749C7C7B60DF430C62DAC4338832559F14 imaektak6
390,326,495 *2744948599A76E149983C45D1A5679C950733AF8 SHITZOMBIES
390,326,496 *274D26F0615119A77E0B5D19FE539C04284B7C7A implementován
390,326,497 *274EDF72AC1BBCC60E30BEB2EAC48015E9E6E55A [email protected]+O
390,326,498 *274DD33C42E31E3380143A4366EB34B6289D169B silascranmer
390,326,499 *274EF7138D19C9656C44892EF065A1EC804BC737 SINGLENUMBERS
390,326,500 *274B7E2BC668CB6C58F255B23876B5C82F39FC94 SINTAKSËN
390,326,501 *27420D29E621634AEC5E87492D53949ABE752352 inschonk
390,326,502 *274D49706C4E87EB0AEB2F269ED5B260CC40C4E7 SLAISTER
390,326,503 *274006B3DB2BA7ECF39DFDAE74A6D1F886721377 ISAACREAUX
390,326,504 *274EA263AB304B3E9B5BFF13D6105CE7B770692E SMQWAIUM79
390,326,505 *2744F337611E078EB216611FF03EE1023026FC29 ISOOJOUKKO
390,326,506 *274160CA9A8188D656D8A53A3C1A3BA5D37EC4FD SNOWDEAN4
390,326,507 *2748FD29F8C1ADE1A9FE991AF277551228EC3821 ITDW
390,326,508 *274AC7A83F75BC831C0055C8FCDF25954C042A96 J81561
390,326,509 *27461BCAD94001DC3F1C0EBAD5D8E60658462566 SONGS4LIFE-RENEWYOURHEART!
390,326,510 *274048F83380F04CFEE8E588C32F3301CD9DCDDD jackwenbbs
390,326,511 *274A76B4BF6CD073E0AEAC2861E4422AD44CF1BB JAIME.ARAUZ
390,326,512 *27467EAF58B05AADF021364D5B04C587E64B802D SPECTROSCOPE
390,326,513 *2749B266F0BA46D354A705E098BBD16FC01FB25E SPRINGDANS6
390,326,514 *274A21EABBBCF00857A96BFAC3A386B6C8FD14B1 SPURNPOINT
390,326,515 *2743130AF1C3EE95EBE5B96E4D62AD7464C201E4 SSARATUS123
390,326,516 *2746E52D117AB0B1E3D2795BA5A354114781A35A JAMIEMATUSKA
390,326,517 *2744F58AED2B9AE8C8528AC86B5479ED65769DEE ST331-RIV
390,326,518 *274C81B1CADA3E4109FDD42397E8E1F7C1855D82 stadavegurinn.er.f
390,326,519 *27495C5A226C6B140700E0C4B69D8EC909A65816 JARODGRADERT
390,326,520 *2746E84F29D8ED64D5C7C8E23F696B9D70F641A7 standarddisclaimer
390,326,521 *2749C82FBBD89E8B0E88331AF1504094315B837E [email protected]
390,326,522 *27461D702FB798E72B3D9D0A1F3677488448C132 STEFFZH
390,326,523 *274718BBAE54D69228AA8F11A80CB91B6B2E51F3 JEN|
390,326,524 *274113052E4DF15665D01EF09A1F3B8ECD9441B3 JEREMY-HENDRICKSON
390,326,525 *2741F6D509C26576766FB800565EE5188701253F STRANGE-BUZZ
390,326,526 *274B347439ED91DEA1CD3CC8ECD7561BA64F5EA9 STRIPESFRAMEWORKORGWWW
390,326,527 *274B6D6852F9C25307C9A94C5C75E45851CB217C stromimg6
390,326,528 *274891268178B542923B6710EF0F32DBBAF77C99 JG.#
390,326,529 *2746BAADDC6518A4B8DC61538DA79BBAAADCC906 [email protected]
390,326,530 *274735B4A054FA600D312C036F6D2DF34D993396 SUMPATANON
390,326,531 *274AABFCBD7135705D74735FE68B719E8A4058EE sunbirdh
390,326,532 *274E395E428A4CBEBE87AFFB10164D73FEC092B6 JOEY4444
390,326,533 *274B774E656CFDA0DA25269175EE854509649E78 johnnysprosty
390,326,534 *27452D1DA263B6EABE0C61D1504B741A22DB5A5E svirpet
390,326,535 *27467836E33FA3FAA84959FF6E45DACC5E05AD7C JONATHANRAGONESE
390,326,536 *2741A557B1ED9516348403B861B624836D802389 JOSHUAJAMESSLEDZ
390,326,537 *27499423104061D241FA795863C8AC7383D427D1 SYDNFILM4
390,326,538 *27459400CFD2FC544E2A43B8C88FE5247E6D9BB9 JUDYFASONE
390,326,539 *2744E9BAA731381E6B0643E4BC2B766D823B88AE JULIE-ROBILLIARD
390,326,540 *27476AD9EE66B9F48DDFDDE6277CAEDEBDF918F4 SZEMKÁROSODÁST
390,326,541 *274827E045A62E38B02663A9F9AF772E697BE04E jYD
390,326,542 *274A0A91ACEF8852D4654DF4DA819D1F386C84E0 k.anne.docto
390,326,543 *2749B111B3349851AFA6472C4820AD0F7918ADBF talkyugioh_episode
390,326,544 *2748646DAE8E6CDB141402353BF49FB5DD2CC8E1 tamburco
390,326,545 *274159D3B826F1F31EA0786B8496DE11B330A3E0 [email protected]
390,326,546 *274BB1F659C5CBDDA6835A701A1B9F824D9EB9C2 TANYAAIRHEAD2
390,326,547 *27422CDB60CA25ECB88D85AB2A7E33214416EF3E KARWIELS4
390,326,548 *2745311888D5583BABC61F413F7F3BB719853B89 TARA-HAAS
390,326,549 *274343DDD80E8C1058B20FE1F561B174F051B273 tarantulid3
390,326,550 *2740952B265D4C2B288B3097311AA88163C1AD7C KBPATUFET66
390,326,551 *274A65322780E8194FFD6C184B683EBDD2108F19 TED.BONEFONT
390,326,552 *2740F9F7F052864A489AAAFBC6CC6DF7F936FC0A TeenageLife
390,326,553 *274BC38F2AA701F2BA17640CE5B7CB3BF568D1D2 KENTON.GRBOYAN
390,326,554 *2749F57A343A0791C582C4268CD3B2AE504C2221 KERMIT.MULHALL
390,326,555 *27408EF602AF7FCD846A78BB8581AE3351E9629E TETOMSIM
390,326,556 *274D09574BD35D5ECE5BCFB09BA8B8C48DC101AE KINCAIDAUSMUS
390,326,557 *27400C81BE77FF171CD6413E44920647BE6E977F THEFRAGRANCEREMAINSINSANE
390,326,558 *274A0997D8C48E08BF452311881BEF7632F5C467 THEMIKEY04
390,326,559 *27479BA862FFDB2369BB5AEDFEF287BF5C3000B2 knighti
390,326,560 *27415C3E7B94B396BDFEFB2FD6DD5012183D17E6 Thổ.Quan
390,326,561 *274FB4634125FB54187ECA9C708E974D080CCB5E THURMAN.BROMBERG
390,326,562 *274B68AEFDB3FD542DA053B27F078FAAB30F0B7F THYREOTOXICOSIS
390,326,563 *274A019D6638307987ED150B38BD963E7BE82CE8 TIDALTAY1DAH0L
390,326,564 *274418CBA3E691BEBAE7CF35EF6AAAD6761E7D6E KREGLICKA)
390,326,565 *274E5007E96D89B54FF5EF0AFEFB83ADF890EFE8 KT!
390,326,566 *274A91AA710DC0B559007377996165963995ED36 laferre7
390,326,567 *274D1809616736440823F2075F6F5E2A9BBD5A1C latimescomclassifie
390,326,568 *2744017E9510CBC0AB7908799D1D5D2BE24A8FBD ledevinduvillage:scene6.duet"tantqu'
390,326,569 *2749D7A65EA4A56800277258095BA942193F9ED7 LEONEL.AVENA
390,326,570 *274565D958525FAB56C1A4B577637189C0973E04 lep94
390,326,571 *2748A618E161A784095AD22FB021AFB0EB9443A4 Lesson-19:-Sentence-Patterns
390,326,572 *2743DCE73DD699F4DD82C604F2663E079BA269F4 TOD.FERENTZ
390,326,573 *274C0A3218D1E4ABE280E99348B3A183F8E96693 tofts50
390,326,574 *274C35C18C0AF0F1B0D7FB30A98125E2059DE25A TOMMIE.SAMY
390,326,575 *274955601489AEAE15076CB0E5B0F1E371846041 TRACEY.HUTCHING
390,326,576 *27468D5675DFAEE254AB6D708964E939A3A3006B TRANSPORTIRAMO1
390,326,577 *274212078C299339835656071251CB753564B1DE TRENKLING
390,326,578 *27439F89F854A69E2443B76DE552A9777FD4C598 trinidadhaskin
390,326,579 *274B2DD2F8214CC4E692CCE6B4578F4DEFED4115 trio sonata in g major bwv 1039, presto
390,326,580 *274B6488DA605A892EE7B75E8DA2FCB56C7105ED LINCOLN729
390,326,581 *2742BAE969653B7DEDA331A587CF58A83160FA8B TRUMANMCNETT
390,326,582 *274A254A29E5CF97E2EFAD6C755AB35E253894DF TRUMANSHINES
390,326,583 *274294E03BBEC615B8298F915B0A655676D2B895 liofirt0
390,326,584 *2740227E781431D322DBDFA5EC142610E973A544 LISA-ORTEZ
390,326,585 *2748E89F416E19D7FA61891690A2B10035BE89A9 TSEROFRETTEL
390,326,586 *274E2B47EF8EDFE8E7FC006392D915B7A14998D7 TSKNEWHCSBA
390,326,587 *274054F7862C4B9E171D93B419480E6F40437C25 TUANCORNACCHIO
390,326,588 *2740EE117A84C44D0F3C1DB699C41D466D2425F1 lk3q
390,326,589 *27467E368FB2A4CC960450FF1482BCC323B53715 lnmusik
390,326,590 *27433D0555893B7A071E3979401AEA21BBB54BE5 U"1Y
390,326,591 *274DE6DD1013F62C36962FD373C577A1E34F2F2B UNBRIEFNESSNING
390,326,592 *2743F2AFF8C739AD9C5329E77A998821DE5C61CA unfeminist
390,326,593 *274E60E80EFBB83636CF974754CB53891CA948E8 LVI LEGISLATURA DEL CONGRESO DEL ESTADO DE PUEBLA
390,326,594 *274077AD51191A55127D5694FB40BA469587EC5A UNGARAPIARENS
390,326,595 *2743F2F292D404974642F7D58677BD5CB4318380 LYDIAGREENE
390,326,596 *274F4BA75096A276513BD89853C231A7D2D4AA23 unsauber2
390,326,597 *2742A87E4AC9B11979B2FEFF422446921AC7AF50 USA35160
390,326,598 *274C763B2DB2BA247C536FDA7FDF3A419514397D MANCOMUNIDAD-DE-POLONIA-LITUANIA-MOSCOVIA
390,326,599 *274E71CFDE77CF7A2D62BA1861041CEF8AC5D921 MANWUERTZ
390,326,600 *274593CF087650A61E522E67F734F7F1538F1A5B [email protected]
390,326,601 *274DE3B7C9E6B1EC2D08A3ACE7E66A61A84957A9 MARCELO.RUDIGER
390,326,602 *2744A373DC052868E50E6140BEC5FD467A552BF0 VALERIABELDEN
390,326,603 *274AF6F4DD80EDCB01A0C776CD8745991995E7D0 VALIANVALLARTA
390,326,604 *274647D014D5099C2F617AA0B33EF9F1C915864D MARIO.SCHOEPPNER
390,326,605 *274737B8091E264F2156A64223E0A7CFC28CB1A4 MARKSPEEGLE
390,326,606 *2746B8E99EAC7313060536F84519176CB4D14482 VERNBERTHELETTE
390,326,607 *274D9DF504EF71B64E4D0A20A4B00AAE16C2798C VERNONFANGMAN
390,326,608 *274BA62AD0A73F04D13C6E140125DF5E22B241EE MAURICE-HOLDER
390,326,609 *274A537592F64273F377E1A19C6106042BEC9857 [email protected]
390,326,610 *2749DE952710D4D3DE4F977A02E47BA299440251 MAYNARD.SEMONE
390,326,611 *2741B6C93722A61D497A1322A89533FC4CB36BBB VICTORY-SHORTS
390,326,612 *2744FCA99863379F91133D1193FAAF9152976391 [email protected]
390,326,613 *274E5123E9D39FAD77A8CCFD3FF4ED0E05E6385D MELANIEHON
390,326,614 *2740E25E1AC181070F6843D384120DD3EB0FEA07 virgilio.pablo
390,326,615 *274ECD3CED9DD490B73CABF51EE7859081D2C5A4 VIVEK-BHUT
390,326,616 *27460C4FE9CE913D70810304194B7B507E26EF69 [email protected]
390,326,617 *274D84A177F291873AD573FF989DD95441E4AAFE MICHAELBAREL
390,326,618 *27422F0F2D9993646D99F2D8B6FC639E52D67739 v!v!5ec+!0n41
390,326,619 *274B2C4BC7CB3F3EC5E4B25B0AE0A63B767C7460 waade.m.ali
390,326,620 *274AE4CF601CFD30E62A672B9BCF5A0FF94A7C2C MIRIMETER
390,326,621 *2746AAEDCEC1264B9956655628A11C5652A1AB97 MISILES.NUCLEARES.DE.LA.UNI
390,326,622 *2749E8C77DBE022C68C3803E6D55947C55602161 WALEED OMAR
390,326,623 *2749FAB7F0CA62A7FF12DA106A3757A3F9BA8A0A MITCHELLOSMANSKI
390,326,624 *274E1DD18970FBC57539E71FE3D8D7ADF9A9A052 mitchokel
390,326,625 *274E9E3C4DFFF37281C27A85EAD98D3E2A464D1A WALTONPHUAPHES
390,326,626 *274701CE19CEA6B714C70C6A290B23512AC5F8B7 [email protected]
390,326,627 *27425BA628048F25AD3D784D806021167F1859C2 MO96
390,326,628 *27452EB2FF0078636F12AA0CDA95E4A1A15C5BB2 wardsajovic
390,326,629 *2747BED16861FBF0671B4E19F96C5C6E3D412CC9 MODESTO.WELBURN
390,326,630 *2746AAA36A8BE412219024C33CD1C87A14228D7F mohammad.salim.chowdhury
390,326,631 *2740D6C44FECA1742B5148F9829DCF4AE27C68A5 mohammad.shah.al.mamun
390,326,632 *2746102561FBBBE2328339BC86A80BA419DDBD74 MOLARIA5
390,326,633 *274F0A2D5907CE155E1799D319ACEB59FDBF6CD0 MONALESTER
390,326,634 *27407B3C63D6AD206197D7628FE3CD1F292EC385 monroemuramoto
390,326,635 *2745692AC93A460D779D83970CE57AE086F03613 monroeweise
390,326,636 *27454321EE594C58F68566A286B773123D2CF54A MONTE.SCHLAFFER
390,326,637 *274AA4295A58F74CB9DE343F873F972A9E8926E3 weezerspeedy
390,326,638 *2740A76D937175B17590D2AD3B6AEB62306A1880 moscowboyschoir
390,326,639 *27489773A690EC55D2D6B25B5C3E36C927700683 [email protected]
390,326,640 *274E17AA90A209C9501F8A19D7EDE6F69D990500 MRLAURA
390,326,641 *274B4CACBB0A6023B5C3842693C1B5F943D0D2A3 WEWELAS5
390,326,642 *27471533AF81C1D902481D6677605F83A4515009 MUTATAISTELUN
390,326,643 *274D6ACF92C5BE3237B9750682F9ED4A650038ED wichinfo
390,326,644 *2748A37872CC5715EAE2DC17C420BC5411B7EDE3 WILBERT.TERMINI
390,326,645 *27428C71A82F15B959E8E35339F65BC3FF5BC75F MYHISTOIRE53
390,326,646 *274F3E38614F76152A5197A7CC0A3D0711C56B45 mzi/
390,326,647 *274AB1F714A09348E2D7FA7A1B36BFF6D3493F25 WILLY.HONN
390,326,648 *27464514650CBEC5B58D247E7A72FB6474690C8F NABITO-DE-TELTOW
390,326,649 *27407A1D6C2D62CAA8546B1966C5C716AFAD3E1B NADEESHA.SUBASINGHE
390,326,650 *274ECDFDFEE963CC1836A9CA7148BE0B2384FEBA NADER-SHARIFI
390,326,651 *27409F8A9FCDEA8AF1BBCEBC6510BB8172413250 WILSON.LONGWITH
390,326,652 *274809B4AAD6994F7D390B01DF15A0C00762DE00 WILTONELD
390,326,653 *274611A1AA89828F91C2653493A0DD3ED76D685E nakafuto
390,326,654 *274CF1BD46F2D35D8ECB6C1F487C4F870DC0A4E7 NAPADAJING
390,326,655 *274CD2AE9FF441FDD449DD959AD446E262394E8A WISAMMONIRAHMAD
390,326,656 *274297A847423FD85407E7C488C6FBF2B58507EB [email protected]
390,326,657 *274B45CC5EE0E0277EADE396AA624E1DCD130B26 nathanomtiveros
390,326,658 *2744CF7937BFDC933396889F0B3690C2D8FA729D worpell123
390,326,659 *274F370B0A5CA99F1C8C3D6C3FD57E0B05D1132E WV{]
390,326,660 *274F768E4B32B76073EF633868012F8E2EC67F6E WWW.CARINGFORCARERS.IE
390,326,661 *27428FEE11827FADE51F6FEAAA63957165D726EC NEPATLALI
390,326,662 *274B1AD0DBDD6A65B7AC8B26D784E62B53A767EE NHITHUCN
390,326,663 *274AD58D9EED0C7B10EC567502DB31F36493CF55 xavierflyboyhenriquez
390,326,664 *2749F7CA0CD164408BDA2473EB41307731E7551F nickjr22
390,326,665 *27417D4286AE1BA0B62BEB0AA4B59317D0F25671 }X{~`-~`-d----B
390,326,666 *2749D22DB82588E54B624BF503213E4482035AEC NITACO
390,326,667 *274861BB80FDCC08C049FD6654F4C2106B36619E northpacificcurrent
390,326,668 *2740587DF4CCF8E2A71D0D36E262AFCD73EF52C6 [email protected]
390,326,669 *274E3B09CFA2ACD0017E40BFFA1938589D03090D [email protected]
390,326,670 *274115735B47FD3E3E4CADDC7EB7E40561B6A769 OCOXIYEYAHE
390,326,671 *2749AC111588F739932A19532CE2A75286F771F6 [email protected]
390,326,672 *274464DF7129C39DF9F59CE4CED54D2EE1D73AD2 [email protected]
390,326,673 *2743AA96B360F68465F8403F63531143EF191FD8 YUN WEN WANG
390,326,674 *27454E09638CC2BB627694964128C1C0A7145160 [email protected]
390,326,675 *27470F9D3A2CAC4080FAD3B2A0C61025E520C330 YXPKKBIH16
390,326,676 *27499666D42D2646DAA37C9D69C8CE650A47C7D9 oidiota
390,326,677 *2743CA184F2DF988C638CD94C90EAED48B2AB965 OLIFNAP
390,326,678 *27420D1AB43E430CF118A3D9576BAB94F0C0DBB1 ZACI.MARIGA
390,326,679 *2747F1CFF60CECFF826ECFF97C6C62798CAD7389 ZACKSTEEHLER
390,326,680 *27413E1CAFFA0DF2F3890B046A7BD77F75425C0C ŽÁDSTI
390,326,681 *2748BF5FD263F838DDDB9C6E27D48D397E7B6B7A ONE-BRIGHTON-SHINING-MOMENT-AS-LUCAS-MAKES-GREEN-HISTORY
390,326,682 *274AC53250819E8A58679833160DCD5BCE29A47A ONTARIOHAILSGINGRICHOFTHENORTH
390,326,683 *274DE5E2D17F28183179977FCA08EC87A9C4B982 OORSUIKER1
390,326,684 *274D80A4485A5F76C7F42BDF9073B943C82C117F [email protected]
390,326,685 *2747B6948A8074D13B66651F5FC13A2B09CCA2A8 (O_)**Q#Q
390,326,686 *274C5EEDB01C272EBD8C94C6A710C34BBE1B9E19 ORFORD?
390,326,687 *2746739FB580C785CEE9FB9EA9A8D57ACC1D4715 ÖSZVESZEDTE
390,326,688 *27443BE855917D0D380B2670149067C5C1771671 ZOSIMAAMISOZ
390,326,689 *2749A5B98935BF77870B3079BF3D52291C302F8D ZYWLQ
390,326,690 *274EAC14A731F4FEA8C0E6D1FAC1E1D62BFD9F08 OZYANDMILLIEENDAFTERTENYEARRUN
390,326,691 *2743AC97169ABA08A2CE212FBA60A7A0AE7D3FEC Α疱疹病毒亞科
390,326,692 *274ECFAD97886781BC97D73534E6F9E480D6F0E4 ΖΑΧΑΡΙΏΝ
390,326,693 *274925D8912063F9E7C8B0CBDC25473D8CCB776A PAGIE JONES
390,326,694 *274481A5E837BA9E2C8B6DC3E9EFAC4D44C598E5 ДОСТИГАВШЕГО
390,326,695 *274E5C40C8AAA51954E6ECEC4B9883939241DA52 PAMELA KERN
390,326,696 *2749C54B960D750EE837D41E7B2C7B42DF1DE104 pamela.samuels
390,326,697 *274CB6DB11650E1F356769107B69F76E71C6A4DF <p><a name="n_282_">282 </a> bordley 8/13/98 gj at 2529
390,326,698 *274999096433E576FD47820C2F50BC50CC0E54C6 КУРДОНЕР
390,326,699 *274C1EE966D93294314D39D2756660D78D1AF6CE «ЛОКОМОТИ́ВНОЕ
390,326,700 *274A926960EC77D16B216AF36E1E8500ED412149 parismulry
390,326,701 *2744D2AA803BD15CCC044F22FB8CBF82FAEDE6F0 мраскова
390,326,702 *274D1770E231D566260F2714E91BE6FF9A7F6903 ОЛИМПИАКОС —
390,326,703 *274FAB6CC4DB2DA57550DD4F5AD2CEF281328D04 СТЕРНСТРАЛЬ
390,326,704 *274E31703BD09E828404B3277F37B09C49E29CC1 PEXTLQV
390,326,705 *274D10673761870A5F12132CB4CFED49BEA13F22 PHANTOMMISTY
390,326,706 *27492D5BC4480794E4774A268478A827A618F744 [email protected]
390,326,707 *274A2B3DC5B922146A26FDEEB6EDF92610913823 PJENRIN1
390,326,708 *274CDCAB6F250017274BB25E92C5AD48BAF3A22A PORTER.GEMMITI
390,326,709 *2748EFA55F353F22849E01D75289245AD2006752 Posenasmilga
390,326,710 *27400E6D8009FCC5713540045BD3E8A094290D30 は容量が制限されたLINUX向けのパッケージ管理システムである。DPKGの影響を受けている。
390,326,711 *274C453A12B84012A4689EA96E1BD578F4DC5CC0 P#P~o><
390,326,712 *2744F776CC67011806B52C19AB999E068ABF3892 prest!d!9!t4t0r
390,326,713 *2746938F19C155826CA49BBDA7D7591FBFFDD98E 通道,ASP
390,326,714 *27426CECFA81EAFDC17A17674F2666BF8796D100 [email protected]*.*.*.{x}
390,326,715 *2742DFA1F55A6D7158FA5B27AA65B8D309316C61 q#####)*(x)
390,326,716 *2740BC397CD42E843DC5DF8300455D3B2038256A (>_0)0~qB
390,326,717 *274EF691042F393023D34BC3205B7BA722885A82 ralphpridgen
390,326,718 *27482BFFEC58433A1E2A6C2B364E75F8043F2C3C ramongillespi
390,326,719 *27477B262B9249FFC0F81551C0CDFD4F1FA5630B randycaldero
390,326,720 *2743204D68EF1073649DBBFC592063667D5C436D rashadmiyashita
390,326,721 *274C4BD34401ACF5F0EFF1126589F669005BCED0 ratzebttrg
390,326,722 *274DF21AFF3F245F95B270DFA9F828A2A0F48FEE RAYGIANNELL
390,326,723 *274E5D74C8D91D827D601AAABB71DDBE63554BC7 06-15-1289
390,326,724 *274D7BB6E685B8AD0E9461F45CC7B5CFB260DE4C [email protected]@+E5
390,326,725 *2741CD926311FACC5794201243A5A7D9E092A4C8 REILLUMINATE
390,326,726 *274070A856BF301CDB7593F7A597E69E498ED69E [email protected]
390,326,727 *274236BFE7B13CB341696B015F97274A4FAE7DA3 RESIDAMUSQUE3
390,326,728 *274E028777A24A7B85CE89887BE86A07F789F8E9 RESINIM1
390,326,729 *2741A7ADBC53068AD6F71DD1CB46FE5C75F66930 RHANSYL
390,326,730 *27402CEFDF6077BBF53B19675FE12B9A2D8950C4 RHROLLANI
390,326,731 *274BBE4D923D0E58B31A4EBACE010384B3394CA7 RHURTA
390,326,732 *2744D95DE205687FFF8D17AF666CF81BCE7FD9EA 0e7292jk2s
390,326,733 *274AB39AAF76A47FEF363F67F6B3125E55F07E5C RICOVERANOS0
390,326,734 *274DAEC7AF8E02AE43058DF37582ED77E47D8A17 1051198 JA.,.ABER.AUCH.LEUTE.WIE.PAUL.LEVI.ODER.GROTEWOHL..
390,326,735 *274F57F418856456D25E481E14FE1C90863BC41C RISKIERTEBSWED
390,326,736 *2746C68A7789E766E34446D098E049FB50657B04 RITKÍTSUK
390,326,737 *274BC298E94D9168CA74DF4C61FD9274A81C3E11 1229347 VUONNA.1968.PIDETYISS
390,326,738 *274442A35ED8A30B738EB614C0DB11420362206A RKEILYST
390,326,739 *274F356CBEFD09E529FD18B4AACC0ACE218B16E4 1297008 STILL-,-HE-HAS-SOME-CONCERNS-.
390,326,740 *274DDC536DCE05976CF87AEE444C538E41A81D38 ROBERTO.LAGADINOS
390,326,741 *2746ED6ACEE8472AC0AF83345D9B810CF622A836 ROCKGREENED
390,326,742 *27468717212E6DC03105CEE3F4A2F652D88DDA5B rockymock
390,326,743 *27436F84ECC5FDB09DA515AA3CF839C06E305727 1437208 PIKANTTI LOPETTAA TOIMINTANSA 1810 L
390,326,744 *27488CB6D174B530825F0753F672FAD65C42AEEB RONALDKLAMN
390,326,745 *274371EE5BC52BEB3509E5D108D6C19D4A7EC070 RONIDI
390,326,746 *2744A2A96656F25A924C057E7164B7B047784B2A 1704536w
390,326,747 *27477AF22549F29406F076987D75591A20AAF316 1909113 KUNNANJOHTAJA:KUNNANHALLITUSP
390,326,748 *2747D8DBAFF31A5B39B5E99A1EDA8BBC38F901C9 1JKLMTTIT
390,326,749 *2746341D0E1369796C80853F2FE8CAC5958F48BD 1legerkorps
390,326,750 *27461ADFF8250CE1A852EFFFA93FB15E8669CA19 1N+ER$+4+E$
390,326,751 *2742E2C31ACF71C67FD0F33D04DB340C4E43250D SCHMOLLERA
390,326,752 *274FC8F91FF65C2A8DD16486513F8038E09A06E2 1.QUEBECPARTEI
390,326,753 *27418C6F6BE351CB4BEF1E12E789F45C2CDF6497 scoutadg1
390,326,754 *274C8B859B2004E09A479342FFD76EDE3108DD11 SEBASTIANHOY
390,326,755 *2743A2A7E3DA34DBC6266A10422EB5D973874A0F seegroges
390,326,756 *27417588CCC27A7391113657CDE66D5BB004E4A7 1.uyuyabildiGim
390,326,757 *274351139882D3298EBC4E365BC80125D06AED03 serraniadelamacarena
390,326,758 *27489708F311E263469DCE82F09B37F0877F6DD0 SHAMUAL8
390,326,759 *2745891ECC917A4162F83CD1547ADE1CE9489F3A SHANNONSCHROER
390,326,760 *274BDD2D6553D7D0435F50D470D099A3156644B3 [email protected]
390,326,761 *27487F46F2EE14A79F312F4E748CB557503AA4E5 SHAUN.SEMIEN
390,326,762 *2744BF0F0F710BB48AFD354020A258B7FE3852FF SHERMAN.BRUSH
390,326,763 *274AC2FEF9742A411159D9723D9C882D4DD02F7D [email protected]
390,326,764 *2749A5ADC08AFB776E915C66915148EBE562049E SHOP.RAMSHACKLEGAMES.CO.UKSHOP
390,326,765 *2743940B20587A674E5B86281F3F29DC5817456D SHORTYRIPPERED
390,326,766 *2746E497D82883856EE95208D58ED4DE06FDA456 showcase-'/S//oU/k/eI/s
390,326,767 *274E321AE5E116CC0B7009D8AB28F49755C93189 20081986
390,326,768 *274FA73BE50923D1017E0711AC920C059F7422D7 SINODABSW2
390,326,769 *2742605412B51694CD51ABB4E4ECCC7CC6F78F56 2369735 erityisen t
390,326,770 *27481C8DDF4F4C1F6781CBF1332687A5FBAFB0CB 2-4-GROOVES
390,326,771 *274129250B32C1943AFC7CAFE320BD1FBD514F20 2-ULOSOTTOVIRANOMAISEN
390,326,772 *274691D5D0A29C4B7F7CE34F81D5C7FFFBF48329 SNOVI-1
390,326,773 *27485797C80A6114F0B30A84CE60D4E6E254DA99 322389 NOIDEN KOLMEN P
390,326,774 *2743A1AB9895E03089F304F088413F077E732964 36.SELAMET
390,326,775 *2744343617D73272B1859403B8005B09D727A5E7 splat~`<3
390,326,776 *2743475C1E2E518D450C0FE9DD9A2F767D1A2738 SPRMRTN1
390,326,777 *274D95792DB10D61A8DA74F78262D9258B51139D SQUATTATES
390,326,778 *2749C912D23C45E2786916E6D44427A38D6A2285 SRAPAK
390,326,779 *274D9620CE9A0EF0E21A45559B19982087B4C0CD SSENETANRONU
390,326,780 *2746F8325F7C14E86C2420553081F659133A5C0C stempelgeschichte
390,326,781 *274565DAF559291BEBCDAAA06FECC595533754F3 470156 pihatoissa.lehmien.v
390,326,782 *274B0FDC62FF3C5576182F1549BEA44E8694333D STORE.ELECTRICALINS
390,326,783 *274544A4A39A4DDB2699BD0F411E619A9B2B9A2D 4fx23k2
390,326,784 *27484A3E6593E64BA048F9C8EB7399E40819CF90 [email protected]
390,326,785 *2743F3ECDA8F92D85C49E78BFAC1E78A98FA0EC1 SUKULAISUUDES1
390,326,786 *274AF8D79B91C9731BA6FCE339CA53490CE97194 [email protected]
390,326,787 *274A08B614E45BD16BB0D048A5A264C86FB25C75 4REMMIZTZ
390,326,788 *2740528A0BA5A9863FA6058F8E74A8B07DD5AEC4 SUPERSEDED5
390,326,789 *274A17B0A3DC0FAE4D731C041B829084C562387F SURLOIIT
390,326,790 *274699FD3E4AAE014B1DFDA79AD0AFA180F9EADF S|YL
390,326,791 *2749226089C0538570C5A867B47F9A56249D346C TAD.LEAF
390,326,792 *274A6FD9EFECF9D27E38926203DCD7758061DEA2 TALKCHRISJP
390,326,793 *274D1A8BC9546D6858F3CD9491415DF81E8C182F TANGGUNSUI
390,326,794 *2742E2E3B33A7646B13F68A1573151F90C62EFC3 TAN.JOVEN.Y.TAN.VIEJO
390,326,795 *2740A01FA8F33EA7A5BAD117D12CFB117D800C07 TAURUSSOCCER
390,326,796 *2742DB0CA57DB26CD74093479B1062487AB5DF7B 5GEREVOLUTIONEERD
390,326,797 *2740735BDCFCA30C1DA5E14B6ECFA2AB80E13FBA TEHNIKO0
390,326,798 *27452EB999B67E2E51F30DB49EAF351C373E5038 terencearaiza
390,326,799 *274D84EAC903931C196365F9DCC3FB2BAE5D3102 [email protected]
390,326,800 *274D3B16495C4AC696AC3CDB0586830BFA1C25FF TERRANCEOBREGON
390,326,801 *274F5156807B072F12EFDC9B4BFFE8C8E3025E63 TERRELL-COSBY
390,326,802 *274C58CE21E6D26371BBFD93F08E9D7340A17DA1 terrence.garrison
390,326,803 *274D27BA0E4F74F751C68D0AE3E1A8B8E73096DF TEZZYT
390,326,804 *27421CA56D0F1321E473E9FE1021821FBD9C31C9 theressa-lawson
390,326,805 *2747EDD367F9C84365924E9943268350D5593428 the-return-of-super-70's-(disc-2)
390,326,806 *274224C5568CDFA959765771AF1161CA6D8694BC THPHRSTCS
390,326,807 *274028408593AEF685E85AF4356440235D7D2F00 [email protected]
390,326,808 *274C2FD1B56AF967BF50BECF08376FE783727C6E [email protected]
390,326,809 *2746F82C49048AD8ED347C8F35E45BE4A95E08A7 6RIAFFIATAVANO
390,326,810 *274CA25EB94F307FFD28498B1DB477C99755D7AF TR1SK41D3K4PHO83
390,326,811 *2746F4BB1298E93656D0FF2E2EFAC0D9939C1E41 trangle.
390,326,812 *27432392CA3239CFA4164F575F52416DA871101D 8MOISSONNANT
390,326,813 *274EE0FC95701641ED6DA6111125F5C2720F587F 8SYSTEMECONOMIC
390,326,814 *274725615CFBB389DD21152BFB3B37357336F4C1 8YLISUURUUDEN
390,326,815 *274285BBCF1312967EC1315FAE4F645B237049F4 tukiran.kaprawi
390,326,816 *27464C3C30D12025766469BB9E39EDC7CD399D8A tuncay.karaduman
390,326,817 *2742E18DCA435665FE24DA4731DC6F2118C7182E 92379 daspp-bueroinbuenosairesmeldetdreineuefamilien
390,326,818 *274159642D714AFD2BC1C3B2783E2A683CC019E1 9KNIGHTBR
390,326,819 *2743AE13EAB8F752A2CB73A6E84AF54D88BD818D UBIT4M34R4PID
390,326,820 *2747BD0339776DCE59A9D14DE53DD109DCDCFB2D A=.0F
390,326,821 *2741B47BC92C4FA6CDD5C8F59732FCE88E9D3E3A ƉƉUMÈRƏ
390,326,822 *274B9F2A74CF2FBBE6A327F02B04D19CC020E5CD A5IVW
390,326,823 *27420E30F87924AE4ED72A6DE54B06017935B882 un5ent1menta1
390,326,824 *274B535516C3B4195594DE2579709317A88E2D5D utrymdeses
390,326,825 *274D1F14FD257A27726C592CFCACC6B9252C399B a#cl(
390,326,826 *274B7C188EDD9B9FBEF8D90FE2B55347EE72FEED ADANKUDO
390,326,827 *27403462A911EF613803138473ECBBAE7079F1ED adrg/
390,326,828 *2746F070F5B61A149063A4B2388D68AB2D0F6843 AFFRMN9
390,326,829 *274E16B91F8993CD76B8629B196829532A746A07 vickibartholf
390,326,830 *274A27834320A61380610F5B2FD980F3803FC5FB video-hits
390,326,831 *274BF7F90F049E1CF1D697B76F607CC67EB8337F AHMED.SAIZ
390,326,832 *274A1B3E987AF180E04064482211A2893F6EFCDC [email protected]
390,326,833 *27402A193EE37E746F446F94049D2F22B0505722 alankuester
390,326,834 *274528C74EECE1AE2C95D5E6C9FE91DB023BB1F0 VORZIARING
390,326,835 *27401A05F7BB4AEC61DAB913128B74DEE239C1CD alhuizen2
390,326,836 *27441DD80057E55913018D04DAF950A256D074A2 [email protected]
390,326,837 *2740FBDAD2AB19AB2F232B9F47AEC9F79112520C allbitte5
390,326,838 *274CF5BC3971F4B7477C3F9FEE45F9C3AD27B9D3 alsaedi
390,326,839 *274EC273A0B5A0E5135A4BB0C4D68F5454AE1482 [email protected]
390,326,840 *274DC6BFAC58B022F2ADC6C617C1BE3D043F5EBC AMBROSESHINABARGER
390,326,841 *274AC49D698978B18BA08E02B5F274E3B4C61EFF am+m
390,326,842 *2743AEA39A7FDA14152C95EC8520DD3FD757AC5C WD$Z
390,326,843 *274BDBC14BC04805AD4DA62FEC250AA0C7FF0E5C wegcijfer8
390,326,844 *274064312D99CBF2BCFCF831645A7753F03859EF WEKELIJKER
390,326,845 *274D7BA82B4A51996BE0784F794ABFA6B0772FA9 WICKY-WAN
390,326,846 *274D039E847E358430C76D0739E881A6D1F16103 wilbertrondon
390,326,847 *274AB69593C08308A326EEF58E07BE38718CC522 ANTONY.DOTEN
390,326,848 *274247B7AC1C44F779EA1A8D36B710F6FB6AF7CA anv=%
390,326,849 *274AFAD182A859A4ED225DB88449DC4081C922DC WUHUANHU
390,326,850 *274D417E045FE1E8F1F942D2137FB8E50A379096 WWWMETDCSTUDIOCOM
390,326,851 *27426572C2A6E7931519633E39133F26B44C627C wwwmillipedecomau
390,326,852 *274E3F37FEE4455A67A92EB8895F9E21C7B060F4 artolia6
390,326,853 *2744B92175F2066DB7DE02BCBAA59D4F0538C5B1 ASPLENDIDSKY
390,326,854 *27479127EDDC09229507CA381B23E21964CF358D a,syi
390,326,855 *274E23017FE30D9E594419E0E03F926249C4F63E a-till-b
390,326,856 *274E352FD89D21476928D032F5F214B9EAF1F901 AUFLSLICHKEIT
390,326,857 *274A7941C1F0DA952688C4C3D397C3B67EACB966 xn6(
390,326,858 *2743854AD2B33541DE58A8CB81ECDBC4DEC8BEA8 xqI
390,326,859 *274868CD451E1DA08256255CC304E477544B058F [email protected]
390,326,860 *274DAFAF084FD8093FA1422552AC13230D2D6D6D av8kc
390,326,861 *274682F2944F20FA6412DFE2E1EF6D0E749E2CEC awho?
390,326,862 *2748443853030972AA76D949200BD7906F3BCB83 YASMINLOCKWASBILLS
390,326,863 *274BD96E176A0EEE3BE6AB4A9C82B6D0B2E97C54 AYcK
390,326,864 *274AA4CFD4B20C11A2A3E4D8C0069DFBAD52B3ED yearningfor
390,326,865 *274B95664A0BD32F9CB377245B9CE3CA27B16CF8 YKB
390,326,866 *274B7402A7B85B9935C912599B0EA10C094B3961 B5:u
390,326,867 *274CF0637885DCFA5A7D0853B63B7128D27800D9 ylyocnu1
390,326,868 *2741378E671A6483A8C017DEF52B42C183D396CC barbara-faber
390,326,869 *2748544E110A119900F396AF53CBB410C1330E6E YOSHITERU.ABE
390,326,870 *274F1014A38786B58BBC5BAD4D26B49F86FC7EE5 [email protected]
390,326,871 *27443844B9870A1BFBE047248F7A5252A4BBD299 YOUKNOW,PART1
390,326,872 *2746FAB92639451CD06EBB02A7CC45487FAEFFED b====b*.sploit
390,326,873 *2748D0C16F0F0832A2D18F30C730668D2A394FB4 YREGDURDESROHKROW
390,326,874 *274DCE63083ACC527F7397DA4518255856BF2A72 BC1896
390,326,875 *27444DF2D19ABBBAF37C23BF636A8B4F5EDD6401 [email protected]
390,326,876 *2746AFB84D5CE6053B2790D6621C8BDD7725E979 BCNY7
390,326,877 *274B3951B797A239A2D782972E3CDF2191803182 B(DB?
390,326,878 *274301F50C838B26147FA52B69F42F78E8A55BE0 B-----D~O~O-SPLAT
390,326,879 *274933927D16FE836FB73A003E403DF073F77736 ZACHERY.REINFELD
390,326,880 *2749F5D63C62331699B6AC26CC8B7187A3A5ED86 [email protected]
390,326,881 *2748D0E0D759D72784C82BAAAC5B4D27BCBFC7F2 ZAGROZIMO0
390,326,882 *274F0DF43D3ABE6ED8C953787BA6FBF7A66284C2 BELIEVE-MY-EYES
390,326,883 *274CCAFCDC84083A7C3DAF6ACB47452CE26C8322 BENPROBERT
390,326,884 *274845B98E2FDDD71C3EB7A76CF42E95CE837947 ZERETLUXE
390,326,885 *274C7840F2C97E53C10AB455DEC3728680502AB1 BERNSWORLD
390,326,886 *274B5D1B704CD6A8E4CA3E1C535E83ABB4F52F7E BETHELSNJORGWWW
390,326,887 *2749907C2ABF8064D55E4C15F35007BEA5CD0A38 [email protected]
390,326,888 *2741C8BFA83D9DC1D80223DEE1C840500BE8E30B bf9cw
390,326,889 *27415D4F7227E6F17C36DB7F61E6C4A101B9B839 bf.yp
390,326,890 *2744F6A2E7D69FEC4606D029CF69EB51AD23B430 BHL5I
390,326,891 *274CD0DFBE474B387002D6CB40B76BDA7F74125F zulkarnaen-mohd-sani
390,326,892 *2747B494FF4FA4C2ECE8A7A00B6F657ACDB977D0 BILLY.MCGAW
390,326,893 *2748F61BDF221D7353065FB64590E124FD81E77F BISTRAST9
390,326,894 *27498C5B85520E6134FE5CCB97658AC7F192509F ΔΟΝΆΓΟΥ
390,326,895 *274E1E4A8563C2BBBD8FEB52AA3B12A55C698535 [email protected]
390,326,896 *274D174B75416DC52F1E6AEAA31821BCD9E46341 ГOСПOДСТВУЮТ
390,326,897 *27401A00E867DB7A9D0484C22515AF3BC923FE9C «гелме
390,326,898 *274E4CBB2503FC8DE9AD04D1075232A8A0F4BCFD BOBBY.ULERY
390,326,899 *2743CF5EAB640C397FA6F9B569B12CD971A57631 сикачинский
390,326,900 *2744A90F4BBCA4978BC061E79983FD5C0D4C55C1 boydrosell
390,326,901 *2742C049E6B1B5F76496181F0C484A2465338537 Bp ~0~o )X(
390,326,902 *274B50C3AD4EB85ACFE00BCCE4136002873C2BD1 brandongoode
390,326,903 *274D1ACABC7747411AAE7721EE12B4E70375B1C5 BringtheDrama(featDownLowRecka,KTez&Rubbabandz)
390,326,904 *2747F3F7CB927F2DDA6573750A401E767391069A BRITONSKIDNAPPEDINNIGERIANOILREGION
390,326,905 *27414C903CBF42CE412A3E882943318BA4FF923B [email protected]
390,326,906 *27468C7325AD083105ADEEC94A95E92FEAA74CCE BR/PT
390,326,907 *274F94DF47841B3F19BB5E25EE7E2972C5CF1F11 の契約が必須、ボーダフォンはvfjp
390,326,908 *2740FC506C4D08F8233B183974775B9F29246F73 BY-YOUR-SIDE-(BEN-WATT-LAZY-DOG-REMIX)
390,326,909 *274F591ACB619874738F9C64156BDDF2E3664DFE プロ野球引退後初のcm出演。cm内で現役時代の試合のプレーが流れる。
390,326,910 *274054F72625366C59D2787543A1AA630DE5E0CB c4u+3rz35
390,326,911 *27493BF5389799AC624F4DD46E9AC4917F0FACA0 canonse
390,326,912 *27430F0560BD61FD211B9767944B53C31D1104E5 carmeloarmold
390,326,913 *27442F8C10EFDA893908E6A7ABC50DD88A80B11B CARMELOTWOHIG
390,326,914 *2748F041797EB247D68A637748B7F46128A3B958 CAROLINA SAUCEDO
390,326,915 *274DCF5C07079B57E380572BA26968BCE697DB7B carolyn-parsons
390,326,916 *2744ED172F146D6C5CD1068A80F92FA843D14A2A cataclysmist1
390,326,917 *2748273FEC292947064BB96851273A25459D52AF 1227606 OLE-HYV
390,326,918 *27476DA6FE83D3889B40438015DE01A7DED68C44 1261532 kirjassaovatedustettuinakaikkit
390,326,919 *2742654881A5680C1773C24E2263C4A15659602B c!+es
390,326,920 *27446A6F8331E407197A98E96B0DF9092CE95A91 12fdpseite
390,326,921 *274DD9C35368BE6976883434FDC0326D5D36EB9F 1435026 SAMA KOSKEE VUORIA , VESIPUTOUKSIA , MAAN HEDELM
390,326,922 *274ADCAE922DB3402F162DC2E6B10C65930FD660 CGVW4
390,326,923 *27442FDA507201146FAD558629ED128561D099C9 1655747 REALISIERUNGSCHANCEN-HAT-DAS-VORHABEN-TROTZDEM-.
390,326,924 *274E9A1A0DA5E19203326F0A451297394865D88B 17.09.1798
390,326,925 *274896DE8E3A0C0607C1A5DCAAD98B99C9EFB869 CHESTERKHOURI
390,326,926 *2743C6089CE2B431AE4E1643662C3165B38B1A1D chrisfazenbaker
390,326,927 *274AB900BD1B6A8C21C07F599907FCD22C3905FD 1-alecci
390,326,928 *274FC8590B505B4C01618322BDB433E7660BBA79 chuckpavelec
390,326,929 *274FF8DECFE1B76AC26E12B5ABD3B2F3AFB96C82 cikw7
390,326,930 *274514D19113ABA3F52AE029BAD0B50802EE1C43 ciu5g
390,326,931 *274F7C0395807EF47A0B987C728B61F33FF1212C 1ensembleschutz
390,326,932 *274FDB9AA1E5193353347D777587AED0DA9A7DD2 C-l
390,326,933 *2744DD139250E761788A2A1FB2AFB9E604F0F74B CLEORHUM
390,326,934 *2740561843DFCA4A9DBD300C7605D1AC0DE02EDB 1 HANDLUNGSGRUNDSAETZE
390,326,935 *2748B84256EEA45CD7415F11F89B9E698496F873 1IBELLEES
390,326,936 *274972FF9A5C0780ED07DED657832621A025DC14 C.LU
390,326,937 *2748BD7FBE623A18086B6188EB9DD37D13545C6B 1.kararliliklarin
390,326,938 *2749AF7F9167A0915EBB6B453D4D9408EB3029C5 CLYDE.SANFLIPPO
390,326,939 *2742156C070082E2093E004E8454CF5B83491BBA c:m(
390,326,940 *2742829F8C4CD68E3BE0FE8A5408E993EBC925FE 1.LILANV
390,326,941 *2744498C3B3B232D864B6F8A6B5D7B4EE1F353CC cnp,d
390,326,942 *274A1D8A222266B93A1C60CFD27ADD18B41C9931 1.PSIEXEKUTIVKOMITEE
390,326,943 *2746A4EDE06CFC27F2A71478820F1761BBDD6D4F 1.RISKILUVUKSI
390,326,944 *2746908FFDB2586DDB688A259B84E7DF33E75BD7 1-SCHUETTELREIMEN
390,326,945 *2749DB81B30977D69D41511FA8D76F6677946775 1.siviilikriisinhallinasta
390,326,946 *27418736EC2A7F665BB2780365BDD6B098426703 1.SVSDIREKTOR
390,326,947 *27469BBD84671905B8DA4FA2CCF24E9A820C620C COLEMANADAMIK
390,326,948 *2747B883BD2C471235CC2B8AC21A6F594B506743 1treuhandverfuegung
390,326,949 *27450BB14E77B8D63C2123BB2284A083BC1C1D2B 1.YARGILANMISLARDIR
390,326,950 *274D1ADD4D8C53AE1ED1F3EE3E2CFBF7A4BBEBA5 [email protected]
390,326,951 *2743350F5B2689C24A5435EBD4252E71244A7A1D comprenais8
390,326,952 *27446BE5327D257F4E508085FDE4363283550BA0 2075353 MITALITTA-J
390,326,953 *274219EAB2172937DE41D047AACB239103F4B336 2288713 laajemmassa.mieless
390,326,954 *2748E696B59D2C26796CC55BAF72F13DC36393DF 237003 ahmojen-jan-eriksson-sai-vierasjoukkueen-palkinnon-
390,326,955 *2745AD62E0AD50EEEF485B0DDB301CE7CCC47B7A 2480239 "pop,thegovernmenthasbannedprogramtrading.
390,326,956 *274F7CE2D2649733068EBDE32CD5BB14B68AAEFA 257 SYNTYNYTT
390,326,957 *274B0509C66F327A83AB3A7952E61711F6B0600E COOL-SANSON
390,326,958 *274D6C36AD2043D820A62440732CC5156933417D COSMOGRA`FICA
390,326,959 *274147E3578659B41F2047F67C8AFF4214E402C2 2asiantuntijakomiteasta
390,326,960 *27460569D53335BB39BDF13A7438C3EA00D12E67 COXP
390,326,961 *2749E134DFE47CC00A68BE97C9D029EE4230CB66 C#PL
390,326,962 *274F388D8313DB08422C40A7C0070A292F929339 30pohjoiskarjala
390,326,963 *2744D3ED92974958C7481846FCA682BE5FB88FA4 C:\PROGRAM FILES\COMMON FILES\ADOBE\INSTALLERS\FAF656EF605427EE2F42989C3AD31B8\RESOURCES\PAGES\INSTALL\FINISH\FINISH.JS
390,326,964 *2744CD9378D5F0B352FDEC4037A6D5AA8E4A74CC [email protected]
390,326,965 *274890123E4DB181285B5CBE7BCF56516CAB228C crpq0
390,326,966 *274DB9320ABC67F724C86959997E62D28C854636 3STRIB4R4
390,326,967 *274BCFB8738D45EB28081DFF52A490B68D34CC24 3UDSKRIGE
390,326,968 *2743EB6044CB516B13BFC6E426C694FBF1E54D96 [email protected]$T$
390,326,969 *274018CB7E7644ABDD339C40B5A1C6367AFDE8EC CU5K:
390,326,970 *274412CE11B5658E0C9BC4BF7BB6D3A250552D65 429468 aynur kolburan 269 egitim tekn .
390,326,971 *274817CA6498B94D6B4A6836F6A6F6364091DBEF cunhall
390,326,972 *27486EDD16812FB5DF9BFBDA0D6A11D948AC5379 CUTKS
390,326,973 *27440D3E54348E8EE11560B9BEA8BBB0CAB658CA c&v;p
390,326,974 *274CEC443090CFB0392A6ECD95193469F7284AFA CWV8S
390,326,975 *274D17D1E4A070E8BCC2649A8200B2506F6E7254 cyr5
390,326,976 *274B2D4E0113BF357A437DF3310EF1F53FD2F138 C#ZO_
390,326,977 *274E0CC4B60DDE95B5F9E5448684A61207E8F08E 4U7OSERUM
390,326,978 *2748F82219D152FA44737638185890E1088F41D8 D36e
390,326,979 *274BC4D0575B7737E283207FAB9503970966AA3F 53408 DC'DENAC'YEINVERTORINCELENMESI25
390,326,980 *274EEF790C5DCA2CE5B3DE8F0DA8256AC45D74B8 d!53mb0w3l3d
390,326,981 *274F0A841A3A47C8811B59C3064DE308A29B4381 d9u:s
390,326,982 *274ADEBCDE3C202B6D1A30CAB17A537E1617C048 DANIALGOODENOUGH
390,326,983 *27441D43D1C5A3272EA25F520F59338624655C56 DANIEL BERGAMIN
390,326,984 *27408B81FC4A2FB65AA2A9EE0A5A74AD160DEB8F 5LGAMIONS
390,326,985 *27436FCEA2789D92A2D9141E87B0BC8847AB416B DANIELLEHAO
390,326,986 *274D8D489D3E56E9BD2E06C67811B64C82C4BF32 DANNIEBRIZUELA
390,326,987 *2740B18DB72D4CF8BA644CF79FEE362E32C36FDA 5MPASSWOR
390,326,988 *274570A0A1D764A764652931E8FC4C038F7C6430 darinhavlin
390,326,989 *2744EA4AD317E4207FA9E9713AEBB28CC3189029 darnellthiesse
390,326,990 *274FFC49CC8D94A2ED699345B3BB5C4B72F1DA5E 5ULTRACENTENARIANISM
390,326,991 *2740EE439D77D1C625531C49D4278B4531F22A6E dawn-yazzie
390,326,992 *27489D25F6510D2D26C2D5ECD2C55D5B38E3E0F8 db2lr
390,326,993 *274DC232347A87B7EBA4EEE1A50B2D3E1C5C3619 DDP69
390,326,994 *2742DDB810B5957E84D28947E4E1128D1247B3FE defactocomwww
390,326,995 *274A55CCACAAAF8002E6170CCFF9AB47D21581A3 DEME+7RA
390,326,996 *2740EE80A74070723E6EB1731351C273F2F7CDF0 [email protected]
390,326,997 *274EF2339EB6E67E96949963367DC1983BCDE8AE DENVERESPINOZA
390,326,998 *2746E334A7181C39DD6AA34A2FDA54139AF83DE9 6RATNALPILLETUCS
390,326,999 *2743ECBF7ED02976EB424580F280C3ECE7C86F63 6SCOLEX
390,327,000 *274BDA5115ACCED734708F726E785C622371C645 6URHOBSW
390,327,001 *2743AE415F7D6E696BB2C2306709A791D0E4539E DF8VW
390,327,002 *274D8ADA9C439A5A17F2E3F08EF01213923E3C30 7ILUVMURRAY0
390,327,003 *274B771A407C2B4E82C0F0F1B6B8E3A09BA86F8B 7MOOKIECANELA
390,327,004 *274BD422C6DE219BF40E6280340837ADA21E5B44 DI-SANT'ANGELO
390,327,005 *27454BFAF7C4E51D8880EC032291ED3502F7CCC5 7SADDLECUTTER
390,327,006 *274E004E2C50C62485645D063073E89CDC25D549 7THATIMPALA3
390,327,007 *274D2C8A4FDC3D061C77CAD31A44506EBDA9BD7E 87829 yleiskaavaty
390,327,008 *274DF5F5DB89B7DDED72F302A1475E3CE0654142 893453 PAKASTEKALANTUONTILASKI2,5MILJOONAAKILOAJAS
390,327,009 *274C21425E34093FB7BFBA73CD1776A5E85804EB dl#dl
390,327,010 *27435594B67D859D554B2B5B9E80647FD809AC2A 8EKTOPIZEI
390,327,011 *274FBCC45506B90E27BF673168AFE4ACB1898BF1 8GARRULITYN
390,327,012 *2745266A3ADE3EBC66BB4528088FC5F75EE711F5 dmg)j
390,327,013 *2742B6872AE40E7D7F12C2F1945023700B555AA7 8YYYYZZZZ
390,327,014 *27402B4E6BD10883FD455C7D9D90389773599EF5 dop3$+3r
390,327,015 *274B1C45DA87B379F16BF7DB4DFD98D970A8382A DOSVEDCI6
390,327,016 *27497CC323F58B534AF8CC8C47E6056DA361FDE3 9b2da87c13aa3aa301d7fef3f7f1375d-fzke8asb
390,327,017 *274722F072F39192F7D3C799DBF6443AA28390AA DOWDYFICKLEN_STADIU
390,327,018 *274BA1F734D13722351F42A8DBA53D3649449BC3 DoYouWannaFreddyB
390,327,019 *274E03C86BAADE666566BDBE6A617AE3101315DA DR09!
390,327,020 *2742EE63C7FBAF6266B78827DE073255A3CAAA3A drbreuerstra
390,327,021 *2741B459B28321C34CAAD141DF16AE67D03921E6 9LIEFDESGEBOD
390,327,022 *274C1E5493A621CC0EE815C5782350C82C03ECEC 9MACHABENSON
390,327,023 *2740179BBD91651F1495109FC0AAA46931348C2D drq$n
390,327,024 *274A50B47D27E68A47787BAAD05087C196442906 9SAAPASJALKARO
390,327,025 *2749018EB9364844940943D584A8AFF01FA35F0A DSKS?
390,327,026 *2742E8075D5E47221C7DDFC892A68D35D38446D8 dubbeltongen0
390,327,027 *2741A579FEBB69D893443C2BE8EBE536799E3F0B DURIGÓN
390,327,028 *274E565EA7E948DB8702ADD291CB8684658FB586 A8VI
390,327,029 *27439BAD8A865934A277146217269F16FB97D630 AAA:|E
390,327,030 *274E42A37BDC0C71B0A78D1D42D5ED91DAB669CF DWOTF
390,327,031 *27436C83BF9289C2A8DB3B316224610730778ECF AABBE\
390,327,032 *27410B2F340842F28BC2AFFEDECAA009A63AF5D4 EDDIE.ALDAZ
390,327,033 *27485FFE395DED2E1F8033C06BA8B9D61FEBCC32 edhht
390,327,034 *2744875590C9E580983F78F2A44D002F219516F9 EDWARD.ESTABAN
390,327,035 *274A6CEAC2AD2843F1786508633B85EE0CBA0613 ee?mh
390,327,036 *27487D02D3A9E1E9CB89CFA8BB4762BA52C51D36 abituris7
390,327,037 *2741D7C10850A61E76BFDBE08A15C312E25BC5BB abramronson
390,327,038 *27456CBD1BC5DA43415F388CB45954D4FC59C093 eiaidnem4
390,327,039 *274C2DA71273B13A31ACA14A05FB10A03CAED5E8 EJHERLING
390,327,040 *274ACBA81967B7285EC3B0C27F114BB42EAE07A5 EJMENE
390,327,041 *274EE766E9BA15B9710AE62A01986619D1C24CAB accessoirisering
390,327,042 *2749BC9AF804845E074CEC72895255FF6F9F067D ACU-6
390,327,043 *274C274A403813FBB76E6F79E4F7D0984E337FFD EL_MACHO.1422
390,327,044 *274FC6AAE4818834338E5B802149B06A8AC69BA5 adriela3
390,327,045 *2742E63442B5DBD49EA0639FE5FC9C04FCB61253 ementius5
390,327,046 *274F6A9319EDBC9E8290FF249C22EBEAC3BF5394 [email protected]
390,327,047 *274AE3BC0EF8D16BB68228BA2AD6549018F82F8A a!g_t
390,327,048 *27492E386C9EDE52B3BC5DCEF7046348C62A492E a.hcw
390,327,049 *27420DDBB85F8269348EB723193AC9F8F415F9F5 enpb_pilhet
390,327,050 *274F4E41AF3BA0268FB2EDF32EBF12807F74760C AIRSA
390,327,051 *274A86E34353394CD284DF5909AC544AE87BF083 AJ7
390,327,052 *274A30C85C9C4D852333450781DAB1B8122CFA22 AJOITUSMENETELMN
390,327,053 *274352B2759FEE3499B73FF396B864E42877AD56 aki1.
390,327,054 *2745EA817E6498D3CA12A9347658097D6C152DE7 ERICKEISENBERGER
390,327,055 *2740B6C914ECF5631714C9D980A0B3AA8A353343 ERICKSHUTT
390,327,056 *274C40FA6E2C99C8EC137E51DC571C12383B9BB6 ERINACEOMORPHA
390,327,057 *274F50B58784FB1680732C34323B570BE1931431 ERNESTOGORDY
390,327,058 *274AD8C7B8A1E72F213F9958BF1BF8B4392E8485 ALEX-HARDIN
390,327,059 *2747B72CA7BE7BB0B850806B3F8B1594F25D133C alex-milich
390,327,060 *274871A0F4F3677CD1082AD320A25D0AF458A0B9 escharcha
390,327,061 *2742304C38A70381EE519A1E1A1BE7298F9FC82D ALLIGATOR
390,327,062 *274468FD159BF1551F78D5DCF2B745BA0D749968 ETPFV
390,327,063 *274C950932163F4D46DAFCAC04174F80B23FD68E ALPHONSE.GALGANO
390,327,064 *274A570277D8EE8A6206242F2FDF3F59491E7085 alvarosaller
390,327,065 *27453C853F565277CE9AD5E2C0513FDE38462C28 Alvin'SnakeEyes'Tyler
390,327,066 *2748E115A7A4CF8F6EE6846D6AF42B2FE9A6637E amorm
390,327,067 *2748F48CBF414CF89F65DA2DC7E9F665A5F4F7F4 [email protected]
390,327,068 *2746AD6BF344AB1107E6B19AFEC9F4E4018149AC an6!
390,327,069 *274EFAE6E56E74808E348D536F01CFB813D4B231 ANDREAS.BALLEN
390,327,070 *2741A28942E0A9F041252CBE32501226BC517835 ANDRES.ALLNUTT
390,327,071 *2741F28EA11DE81052319EEA9A7BA501490FA1F6 EWKIRHCS4
390,327,072 *274799372EBB817338245613401EFB8324CFEE03 ANDY.HASWELL
390,327,073 *274626EED439773ED7C6D8F5CBD27BF3CF6E39A3 [email protected]
390,327,074 *274BADAB534BD3A272D978F1F9EDE7DB3A488AEF EYC0
390,327,075 *27456A16172FFAEA30F3C12D60CDEF8FA9D0D6DD f2or
390,327,076 *27481799C682859B2B58E312CC7DC02E42751B64 F4R7H1N941ES
390,327,077 *2741F1A1BB0065F2A96E89C85EF2C13381F7E740 Failures-are-the-stepping-stones-to-success
390,327,078 *274D0343F47EE6EF8A3489B59AD0C690F7607BB1 FAIN-ANDERTON
390,327,079 *27400F64308311B5E3BC98D43D0A3B90642996E7 ANTOINE.REPETOWSKI
390,327,080 *274A980DF585CC7A2631EB7BD40A3E59ED2F9D75 apically
390,327,081 *27423515916CDEAF016EEA504980A2849D59DFA1 felipebozak
390,327,082 *274ECA0D5529F5F71D075B40FDC5C887DB9FB828 FELTON.AKRIGHT
390,327,083 *27406362269DE15CD8AE6AC2C0DEE4F2F1CA7701 feltonmoenius
390,327,084 *27474F5A07711A832D08CCD4B2200A1B914218F3 AQ09R
390,327,085 *274623DE0C62CC9B5E7CCDD4B966082D632F5461 ARIEL.WILLENBRING
390,327,086 *2744ED9F79417EEA5D1CA0B1ABD80D00B7DB8966 Arj=
390,327,087 *27441C2B3BD512C36D04B5BB32CB34B556093A9D ARTUROYAUCK
390,327,088 *2742F85B87E7385B92645868A529E2D698BC73E2 [email protected]
390,327,089 *274873ECF87BFB37813F8ABB4AC4C83B8C66A1C5 A!SH
390,327,090 *2748E5C6046E646D3807BA1156887C17342C12F8 AS I GO BLIND
390,327,091 *2745396CA57F54ABFC6144618FF4B96A370B6454 findsatbsw
390,327,092 *274BFD7EF8BFBE4E4D37BA79A0AD509388ADE032 [email protected]
390,327,093 *2741E7E9575DA8C3E7BE9E1480351D0E29B24A69 FIRSTSUNG
390,327,094 *2741C330C1BFC57A229B1D22B321C3BD517FB6E9 FJIORHIACEAS
390,327,095 *27495BF1135DAB20CDD5ECE014B548F15AF7E21E atgmk
390,327,096 *274BE2F9003EC6E59AFC8F7ACEE22AEEA583B033 atitr
390,327,097 *2745FD2FFD77A7D2D80B28495CD84868B45C65FE FRANCES.SALSMAN
390,327,098 *274C396256F721746792D7E5925146C0FE2131D7 FRANCIS.BANASZAK
390,327,099 *27483FE6514CFD61DCD3D5391AB626DA4F091450 autumnally?
390,327,100 *274BE0F4AC9C41030B4C3C757F92CF7BD538BDF2 a+v4
390,327,101 *274BF8D2FC000C5AA12A547FA9B9118F40137987 [email protected]
390,327,102 *274A99EF7CC44B9A9989A751E24AEC86C5674FE9 ayus.
390,327,103 *27494050064BABE3E0306DD7EAE91717691FF8B7 b> ~ ` (0_<)
390,327,104 *2748FFF6A1F6E7D2D208887C45D8682E277B36E3 FRUGHIATES
390,327,105 *274004999188471EECFD1E4FF5D39C3700E3442C BASILCAMPTON
390,327,106 *274FC6B89B78527D557FA023097765A96B7C0C60 BBOX.
390,327,107 *274146F0087FCD100B4F0819642F0C7BF546F41C garrycmiel
390,327,108 *27496309F09D625FD1C3002160A449F9710B60A7 garthgreyovich
390,327,109 *274884155FEEFF32FD25EE6AAF7BA18F7ECE7B5E BCH(6
390,327,110 *2747B975864A0DFC36D1241B874AC788BEB2603B gerardspotts
390,327,111 *27415A4EBBBC4635EB7EBE2426B626343ECCB92E BEN-DOVER.BIZWWW
390,327,112 *274825A39A921BAA6769FC7247CB728D991C4C8D germangolphin
390,327,113 *274698A6763029A0545B198D23579CAFE527910E BENJAMINS.
390,327,114 *2747B2B4D307DC5103D827AFEAB67ACECD0B59BC benthemhal
390,327,115 *27410131E1F997EFFADEA78040CAE5C94C2B2A22 BENTONKENNDEY
390,327,116 *27497B51DC12643C8B6BFD4696A8E6B3B164F888 GHIONOIUC
390,327,117 *274495A3A3311A1A0724B9B6C8EB613EA5AADBD7 GILBERTCUENCA
390,327,118 *274910A06EE351A6D1C90312CF25359FC92E2447 bir!e
390,327,119 *2741F4B5FAED5A0484F40F9AED5D05B0A40B9C9B b=l+b
390,327,120 *274B8CDC344F4AA8E4929F3B32F93004F27BECCF b;-n"
390,327,121 *27437A0DE58B51348793184F999AB0088EA9CB23 BN;X
390,327,122 *274A6F45576A9D402C1A38CE2FBA65BCAF07C60D bolognini36
390,327,123 *27496F80D159600D4AE8DB616810C3ED87F08747 B------P-~0~O-}8{
390,327,124 *274C2E42A7D28727527197F00C0BF060ACA8D334 [email protected]
390,327,125 *274BC1358AB1DF008C0359864F51ABBC25888CE3 braggsche
390,327,126 *274DAF285AA42797F3D55AB5C207638EB68F9B26 goyesca
390,327,127 *27410008D6A04FCEB77DAFC277F86D0B4B1510B8 GRACESUNSET
390,327,128 *2746689065AE759F734A5603C52AB9AE363933E2 [email protected]
390,327,129 *2743D354FBCE62532C812E67474F9BC3574E023E BRITTANY_WILLIAMS88
390,327,130 *2744FB66C61D00AD9EB110E33B85B921A40E5920 guga04
390,327,131 *2748CA75FAF258D3189FD9B1647C76E4E0AE8D4D bs,4"
390,327,132 *2747A2BD8217A0B4E28FB38E60B3D3334DBC2388 HABENARIA160
390,327,133 *274F1E8FE433CC94E75BE7F9066067B0F8EE0BF8 HAKKOUICING
390,327,134 *2747BA77DE8378968EBA10CF45679BC15FEAADB3 HANK.ZUBIZARRETA
390,327,135 *27476922EAA554C94259D13E96D2CCCEAC67F4A0 HARRISNARAYAN
390,327,136 *27410B959416F18F29C62F8245A1B3B8635EE431 BURTON.CHMELIK
390,327,137 *2748E51CDDFA3E2DA6FD8C99442416EC1E8B3EE7 bv6?3
390,327,138 *274AE943F830FABB2E31EFD91615A0AAF5A71117 hetyxogm27
390,327,139 *27412B0468DC4B39AECFB6AC04CC84A29CB40140 ĥisābahum
390,327,140 *274CE88423B6A57CD009BEE7F418D903C3E7883F C6E%$
390,327,141 *274ECE34C6B4B7973CD173E18EB168B28CAEBDC6 c&94
390,327,142 *27447B67459850543F8A74246DDF736688600AA9 CAFFINEDREAM
390,327,143 *274DA5326A3155BEF64B2D34E62C6F129F82428F canada1a2b3c
390,327,144 *27451CCA18D773EADDCF1577CE5B350335934B52 [email protected]
390,327,145 *27411A318D17FD0DC4A5EAE51957DE5F9C7920BC httpwww.mobilesigna
390,327,146 *2749115ADCEF077047CB20959B6542AD5B4D850A CARRIE-DANG
390,327,147 *2744D69EEBD5E6B1FF57F9751259FAF8E01DE89F HUOTARINS
390,327,148 *2742297A52D4CDF6DD6471F34D60A525463BE6DD HYELLOWBREASTED.CHAT
390,327,149 *274A23CB88BBE4CD344749B9294B3CD9A75F3FB7 HYMANMCROBERTS
390,327,150 *27426CDB25AF94C16CC2996CB5AD4C722481AF07 [email protected]
390,327,151 *274B5FC553602D95F5AF31ECFBD480C3FAF9FCE0 HYPERVISCOUS?
390,327,152 *274D183133A350D3DEE137E316378F95119B26AB CD+j
390,327,153 *2745D0160E515CF293DDE8B75DCADE45437D7716 CDZ8#
390,327,154 *2743E62E2CB33DB94DE02B396A932A3EC274E6EC IDLE..
390,327,155 *274B85AF46EBD47D3D4A3E6CF5DBD24A127DEB50 Celebration.(Celebrate.Baby!)
390,327,156 *274BC9507840C068C24096D4525F216F69C25D6B ignaciodecuir
390,327,157 *27478213E868454F05E953A406AFF8C29390E981 CETHC
390,327,158 *2741BD7C268F5A2C6EE1A6D9AE5AF1126CE55C46 c+g-e
390,327,159 *274C8BB4091703EA5632B121B040185D4A5556AE cgh.f
390,327,160 *274221A5420D6C228592A01E3B6935711311E872 I'm not the kind of girl you can string along
390,327,161 *2741EC97DC7D7CB1DF1972714A3BF5608CBDDDAB ineedyou(thatthingyoudo)
390,327,162 *274B30539335DA009606BD1F89E1324E6CC8254E CHDMD
390,327,163 *274B89F449FA73A133B30BF78FCAD44D9465020C IPRINYA
390,327,164 *27478DB295AEEC7441E23BB8EC68A7E94145AA4C IPTECH007
390,327,165 *274AC19A482260F34E32AC15F22D8767F1432EF6 chetwisehart
390,327,166 *2749AC7FC3DF8DF2A61434E7FA4D8DCA7D8209BD ISAIAH.HESCHKE
390,327,167 *274166D859573C7A3BBF348934C93E54095BA4A2 chinesepotato
390,327,168 *274C896A392CA52F70DFC3A36E09774D2F5F4516 ISIDRO.NEPHEW
390,327,169 *27447D21172526F2D690F266B6441D47934911A0 ISMAELRUDISILL
390,327,170 *274DD963085FEAF23C50DB2F5B938960F2E32F9F isrealbischof
390,327,171 *27459B3B02B6339C3FCA6986BEAEFFF3E733762F CHRIS.ORUM
390,327,172 *2741D2428CF7451FA25A0FC431E16DC934BB521F christianandon
390,327,173 *274C73CE607755E2D39D050166731CA0B970368E CHRISTOPHER MCCREANOR
390,327,174 *274EC8E1E034D0B7462A9D03CA1C4F8E1FB0FDC3 c!i:-
390,327,175 *2749F5D7849F52EB10F54F8035991379C833419B cinder]
390,327,176 *274C8E50F2A54D82D937A468A63D5EA130517C3C C)J;-
390,327,177 *274DD0FDDC855AD9A1126782EFD58177297D0ACE CK1XT
390,327,178 *274BBF1CFA597739A1B1A8776A059ECD369A1DC1 JEFFERY.QUAGLIATO
390,327,179 *274E0D39BA7658145B7C349F70C9CFF29D26A07F JEFFREYSITTERUD
390,327,180 *274C0C786738020F0F83EA7613323F77426EACF1 jeppe00
390,327,181 *274233F92253742A59DCB7B6C4582B79CCDAB114 JERRY-TEW
390,327,182 *2745C31A8FED19E6141681677CBF365474983B8E jessedermott
390,327,183 *27470199981EFD21F1DCAE14513AF2D23B455187 c(l!b
390,327,184 *2746BB649F81526D4802A1CE30C421ED011B1FE8 cliffmandes
390,327,185 *27403CC87366E7CB8EBE44E42D9E467550DF126C clifton-monroe
390,327,186 *2740DA4FE255AB0F4A415B2463E2801AE85BDAEE clik)
390,327,187 *274533F972DB1251CF11F86850194C2EBD36DC4C [email protected]
390,327,188 *2749795757811E4741A68F72A7D6A400FADE7B63 c$m
390,327,189 *274645CA5637539961E82B9AB6EBBEAB614839D0 COMAPI3
390,327,190 *27400DA3800A09EB6461CD31AE48B7CA9EB0CFB1 JOAQUIN.GOLLER
390,327,191 *274EF8C3CA2B8CD0803F3B369F24BA838DC05FC3 JOEL.STOCKFISCH
390,327,192 *274AC6F6D00CA23E2E8A22B209573F6DE900F24D JOESPHSTROEDE
390,327,193 *27406F1BCE7170CD65EC4F54DB43E1C39102D1C6 JOHDATE0
390,327,194 *27468CEAB6FB09B17F9C4708C21A7366A89E322E JOHNATHAN.LUDEWIG
390,327,195 *2744109CE3B1D3D27AA38659BBD8A39378DFE1A4 johnathonbautiste
390,327,196 *27418B2249AE3782D57219195D96BD9476FBB305 CONNIEENGESSER
390,327,197 *27463DBC19A8CF2CF70EA84063343BA119235C49 CONRAD.SOUTHER
390,327,198 *274C7D773C4A91E0E60C9FC07EEB96B2CA1B53E5 [email protected]
390,327,199 *274614616749C514601AD7E6B5309B1A01311738 COOK:BARBARA
390,327,200 *2749C1ACA6FF79CB4DB7B25DCB7E528801063A07 jospehjergens
390,327,201 *274E24C74925D20FFD449272692EA30D7AB3333D JOYTAMAYO
390,327,202 *274CE8D046EDD1A7D9199C2AC73192CA6CF29FFF julesweber
390,327,203 *274031E2F781BF424FDBDE99BE4DD8B4E19F44C6 CRN0
390,327,204 *274E41A27E1F4DDFE0DD3461C9F8DCA47B8A91ED kathy.minaya
390,327,205 *274F31654C3022C1019CF6FDC76BBA5A998837F4 CryWeisensteinCry(M
390,327,206 *274E31E7275AE816AF4E74BF9AA47FB72EDF9AF8 CT06Z
390,327,207 *274ADF9643AB526FEB3C4EE22179E782BD99D397 c(t#m
390,327,208 *274BD1DFE699CB98D6CE9C9562C84B4CA23573B8 KENDALLSPIER
390,327,209 *274B1DC8903C533E58956719168A297A688AA921 C.U.---REESE-as-he-mechanically-raises-his-beer.--His-knuckles
390,327,210 *274AD7DEB28737F724CE3EE056F790E08C6916DB KENTONSTAVROU
390,327,211 *27424FAC92DA78C08088CB2893701A7CB22EDFFD cvk?d
390,327,212 *2740D3BB1BF466B9628348526B7998A6B7BB52D1 cxz2q
390,327,213 *27450D94EC38594BE4E75A5D82A8B6BFA0F40A23 cypre$$ 0
390,327,214 *274E78C09DF15CFEB471E54F8DF7ABB504E63807 D4ULI
390,327,215 *27494FB3EC5F2A4366DE2C878012BD4DE872274C d8=,1
390,327,216 *274C1DED448E6AD6D7A66C1620ED4E6602144E4C krishnapowar
390,327,217 *2740F3DF6466EC4B729AD378AC38F9ED08607CE0 d8odv
390,327,218 *274DB140023B2EAC51DE51FA2365E126862D5319 DADR7
390,327,219 *2743BD60501B895980A6BA66B190648410CBEC8B DAMIENRODRIGUEL
390,327,220 *2747EFC556F454F216014CB7A5EC91B207F011C1 DAMION.LESA
390,327,221 *274FB6316793D099BAE3619EE545B602E7C666C6 dantm
390,327,222 *2740192EBC0E123792A7BEEEB12C69DDB69709F4 LAWRENCEDOXEY
390,327,223 *274A5CBC1C2CE918D9986187BEEF0060376D9755 LAWRENCE.HARTMAN
390,327,224 *27460B539243A7D0C4777D26FEA6ED26362ECD53 LDER-IN-ZORN
390,327,225 *274CFB3A799BC2F1D27FA2DB537E466A2CAE82FF leavinglazard
390,327,226 *27486DC847C68400CF857806CD57ACEF45F421C6 LEOBIRKLAND
390,327,227 *2747B0382EA0780B543CA1F642AE9191E268251E LEROY.HAVEKOST
390,327,228 *274763A1CF1DC860D1CB9BDDFA89C73F7E48F0EE DARIOBANSAL
390,327,229 *27448B9F2B542382908E56D3C05840CD685FF4CD darrellheupel
390,327,230 *2747DCAD93D22FE3CB78AE94F86530B9DA870427 LEWIS.OBRIAN
390,327,231 *2744F442A72794E9163D3ECBBBE4F40789C6E176 DAS.IST.MEIN.NAME.NUTTE
390,327,232 *274663F6E56702D37C66DC465B0646CAACA9A5C0 daursun5
390,327,233 *27421195F6B531355A814524BE537AC6AF93F952 [email protected]
390,327,234 *274FCC4ED55C4D4767EA91524CCCC567030C611E LINCIANO1
390,327,235 *2744DC5E067D902230A37335C07310D4741C1355 LITA-ALBUM
390,327,236 *274A5675DA82C6985C1D5FCDDB35118FEB929480 [email protected]
390,327,237 *2744D8E5165D01916E604C4BE176150A6A5878F2 LIVEINJAPAN(DISC3:TOKYO17THAUGUST1972)
390,327,238 *274D6B8AE72C9DAF5CBB0ECD560C0D1B145A1CF7 LOGANRUFFINS
390,327,239 *2740E2600C8EAFFAA148C829187014978AE083B8 LOLWAHAHMAD
390,327,240 *274D437C32E73E02152440CB3F13B86F38B6110F lonesomehomeblues
390,327,241 *274BA3460F0F1C0E01D66D0F7115EE9B395253BF d;&b6
390,327,242 *274C0528099BC506A64B4499B9E41812EF356C43 DC/WI
390,327,243 *2748E0A4DD9BCEBA3EEE2D288B50DAA935924EDB DEANDRESTRIKE
390,327,244 *2749E9BC65CFC1A28CF1CB7DF103D7C2C0D49713 LOUWALKINGSTICK
390,327,245 *274B5605EF207950699DE2B49CF0478B25D66486 LUCIANO.STRAIN
390,327,246 *274D1D8A9D2517C514D16532BFBC6AB2FB52C0EF DELMERCWIAKALA
390,327,247 *274F393F7064E1463DBAE336F815A2D98D688157 DEMARCUSPEICK
390,327,248 *2747CC6E0F8C72695392D60FC2C00C09B168BCB2 LUISA
390,327,249 *274755A318C2366911B10E66DDA7704D0E31E5BA [email protected]
390,327,250 *2745E48823F081D35988C3CF95DBD630B43CE72A deq2w
390,327,251 *274D34483A08D9F25F4ADB957F2B32021660E7BE DETAILEDFULLY-RESEAR
390,327,252 *274F0CB8D57DCFD06A25E25FAAF610B919791DB6 [email protected]!+y
390,327,253 *274EA9632E8E9E26481ECEB4DC4A4FD607C7BFA0 M414DROTNESS
390,327,254 *27442F8B284FA35ECF92139BE4734F5DE938D656 MALCOLM-BROOKS
390,327,255 *274BD60C8F7DD0905854E3FC42519F1683CDDBA5 D=HER
390,327,256 *2748C8CFD9506C65BA0C377DB9EFD8D197A8D5ED manfredimanfredi
390,327,257 *2741AEE2D7C3003AE5EA26905AE7442F4280FFF5 DICK.SCHLIEP
390,327,258 *2740EE17F80FECEC3966476F842EF50F626AD6F6 di$?g
390,327,259 *2740FBF32F660C58497B354E4E1B4085B32F086B MARCELO.RODAMIS
390,327,260 *274776FA2665ED1BBE4C263B0056761FA2EEEB7F d/in$
390,327,261 *274B74D8983EF1D6319E3AC96F366B0290B5DA30 MARGARITO.VOSPER
390,327,262 *274B4E04823878A9CDBD5A05ABC5FC6F24BD99A1 DINOLEFFERS
390,327,263 *274D411033C9AB6DE6286BB540FA928FB8E240DA dionim
390,327,264 *27490E8E183A18188D5CABB22664C40690983E74 DISC02TRACK24THECOLOUROFMAGIC
390,327,265 *2741AA0897CC993166FA3433AD4790361C6F4304 marianophanthauong
390,327,266 *27437E1C2FFFC3C4C71DA0C226C63453A0205D02 DIZKV
390,327,267 *27477084F782A0C404E06A67C74B66B4080BE72A DLJIWREVNO
390,327,268 *2742F6D851348378D158DD4BC1EE7E5AD2F1D0DB MATTHEWNEASON
390,327,269 *274D2F3B364940DFC6829D6A906477D2D34FE8CC d#o1l
390,327,270 *27494D598D5D297BE5780A54A1356D4F9DF2672C DOD/R
390,327,271 *274FA36DF252D94565285710CBE054027E1EAED7 doitlikeatruck(realbootybabesremix)
390,327,272 *2748DAB30D42FFBD45405AB3AA51826A7530EB71 merrillgaruti
390,327,273 *274FD424B87D72FB4802292502752F4FEAC9D904 DONOVAN.RIERA
390,327,274 *27480F9E53AB1BFEC1EDBC40C1E5461C752B9131 DON.RAZZE
390,327,275 *27486489318F428564BDC5911EDC15C023876A2E METALLTEILES
390,327,276 *2747D6F7C2826DD2EC7A4F11078FB6F51B9508E8 doodevis
390,327,277 *27441889660B6F5786944122BCCD14A32473DD37 dorseyteare
390,327,278 *274C71D5FB641DCCDFA80CFEC986FDEAC6D0D8B7 MI-CERVEZA?
390,327,279 *274C365C28F4201BDF7AE5C9808CD06E153F3AC0 DOWN.IN.OLD.NEW.ORLEANS
390,327,280 *2745527E2B340D917B0ECE51C00BF4995DEAC71F MICKEY.MANTON
390,327,281 *27417789DD13FA404B5FBD4BC751C1BA4818FF22 MIDTERMS
390,327,282 *2746A87CB530350B14BAA4435180927B471DFB9A milanzega
390,327,283 *274CF02C28309F3D43760040A98A52D344D68C2F DRIESDUVENHAGE
390,327,284 *2743BAF0EEA431B68C6FF4ABBC43A1935BE65F40 [email protected]
390,327,285 *274E3063EF0E17FA47FBD64BC8B84540092A4133 DSANDWICHS
390,327,286 *274272CB5865CA904E6F8BB02931C5CC69991BB3 MNAEEWM
390,327,287 *274AE875FC9D48AF17E5A28A4080D7F80B040BD8 mnking
390,327,288 *27400ABD30A8AEC1DF06A52B032BF38B1428EDE5 DSPNA
390,327,289 *274CCFA87BADE80898D5E97C921AA00B66C3AE43 MOSEIAN2
390,327,290 *274D7047DC7316B9E928AAC42889DAAA98B73C85 dwgpq
390,327,291 *2746ADD91CA8988C2D92AD8A070768DF6F7C8F78 mun.mot.mun-metoden
390,327,292 *274F4A2252777AE6DB4169BB614F0FAA39D4AFDC murraysidler
390,327,293 *2743CCDAB0E16EEDE2F404B449B95D4914CADA93 D"X(F
390,327,294 *27473B2525395E3A3A4AC13E71E92AC480B5A648 ECQWQ
390,327,295 *2741D6C0E6E828ED6FF82D92EE96C3670AEC2208 natthan9
390,327,296 *274D8C0245B323CBC1DA69814A6BC1044B64B5AD ncc1701mickey
390,327,297 *274E971A7FD5DE5AA6BDDD72110000826AB51C62 EDYPRASETYO
390,327,298 *274FBFCC58A6DE641190D11DEF6508914EE2E9F7 [email protected]
390,327,299 *274E27DBB381EE4842BC25CEAB6B82D020DEFE11 NICOLEJOANNOU
390,327,300 *274B6B2B4F494132CF7CD81F7F5A773C1E5F1EDC NKNIGHT8
390,327,301 *274B4267B07892047563C9E5326BC4349883667B no87
390,327,302 *274CBCFB359F703F1EFF2BFACF454E85D4C25267 nothin'butafool
390,327,303 *274D473C37D65C0B554148723747D2F58192B74E nsisken
390,327,304 *2743ED4ABC703F48A2E5815CE5BF587CA549E52D Objurg4+ons
390,327,305 *274CC28EA4E4922BE5BE21EA84A503313AEC87A3 OBSHELIT
390,327,306 *274729D5CAEB0846A33517B0D5F29C9D6ABB784C OCTAVIO.SCHERB
390,327,307 *27486A5B54EDA0EC7A9EC47C8970DD3EFBFC7B99 odellhogy
390,327,308 *2748D23338F9725FE5D872FD83ADD74555DBA082 odissefcik
390,327,309 *2747E20137D91D50C14D5BC31B1B588776FD4BAA (><)O~dq
390,327,310 *274E64216FE9BAB7D60C28066F56352240BB8EBF OMARALABED
390,327,311 *27430C8073A5615AE4ACA6575536CC561E5CF334 OMWHILE3
390,327,312 *274584D8C389898F28AF6B3C84AD2FC3EEE0CA9A elisabeth-wiens
390,327,313 *274CE206C6A2D8A12774B5A719C1DB4C0D1899C2 on-the-beach-of-waikiki
390,327,314 *274FF9DCE94EE977D5CAC06E65E0CF361B5EE405 [email protected]
390,327,315 *274E31AA5589871E321B0C17791CB9EF32B629E9 orkestsuitenr2inbmineur,bwv1067:viibadinerie
390,327,316 *274DB9CB6F3C801C109BD0B5DC6706DBF7049098 OTTO.LEONES
390,327,317 *274F21D099AF47C6C72A190B642B816E89CC9D4A emptysorrow
390,327,318 *274E01342232866F197DEF47FE2D97E2A25B56FA P##> ~0SPLAT
390,327,319 *2748CF385033560921B88B38763FCCF5690E13A9 [email protected]
390,327,320 *274BADC26FA089B600B6FFAAACF3DD5CDFB39490 ERATER
390,327,321 *274ABE1D688BEA26700B099D14C4E672DE1F8A4D etgulfpe5
390,327,322 *2748AA60341C24976C188A4B4BFB87669315E853 PARTY.ALL.NITE
390,327,323 *27473BD7BE480553CA4D925F8FD129FFBEEA4F22 ETREINTS3
390,327,324 *27414CADF139D8C86404FE0D2E2AE7E94536909C eupz2
390,327,325 *27432ADA092AD129DDBD9D1482CC780856AE852B [email protected]
390,327,326 *2745EA918C6474F68989336DF8AD3D8D4DCF242A EVERETTEICARDO
390,327,327 *274E9FC65EC3FD23ED40DD076364477B34C5845D EVERETT.FORSTEDT
390,327,328 *274915D749B5DDDBD3CCAD67368A4536D2C61338 [email protected]
390,327,329 *274465103132FB7616964AA6A0A5927A66D829AA p=====D`~
390,327,330 *274C968669C768DAC25E3F5B87512E7663E22627 ezequielsakuma
390,327,331 *27402A90A591D8712CF9976C0B61FFCE0F4FAD30 PERILING PUTTINGINGREATDANGER
390,327,332 *27410744707A51941AF364C3885F632272009F8F perpylimas
390,327,333 *274C944B55D712AAD522CCDE6AC203EED695CFED fanaticism
390,327,334 *27485A20E549A11A371FF4C427DC93E8109411F3 FAYSSYAF7
390,327,335 *27427C8C2A5F36BF6C8501892E7C21DFDB408E50 FERROCHINABISLERI
390,327,336 *27448952B59BA7315D8793C339A0CB61062DF0F0 plfern9
390,327,337 *27481329396A47ABF51DBE3187FDD95B11147B2F [email protected]
390,327,338 *2745254B0852DA139F24A8704C1D5B879CDBACD9 [email protected]
390,327,339 *274C2C3A9BAA469F91F3396CA3C3C9CA912BFD03 FK9S
390,327,340 *274F5235171C0163B52A963C815065072BA0C848 FLKKEDE7
390,327,341 *2741F3B661C31D55DC4C0F207DCE03BE871F43DD pokolban8
390,327,342 *274775B7BBD4162F099B5D0FD81FBC4B6DC4434D francksauzeequittecanalpourorangetv
390,327,343 *2744B065FAEB804C57DEB55B326535AC0608EF2B FREDBIGGERS
390,327,344 *27411FEC2626D6FD7D24A300541223408A5D831E frost.val
390,327,345 *27452924E5F2E04266FD1E127C13BD26B0A3DA22 fwskippy5
390,327,346 *2745AB54FE3AD8E7EE6ABC3606EADB1B405C0003 [email protected]
390,327,347 *274CE100A9857C1C17888711C28D7BFD1011792A GAMOPHYLLOUS
390,327,348 *274BA68BDC2B785698E3C4858078D34C08AE09D2 garaffi
390,327,349 *274B439747F9420C5AFBAA4C5306649E034CAFFB PTV5473
390,327,350 *274FEC1704CC4C1BC2B769EFEC9C64EE5F1DECB5 [email protected]
390,327,351 *2743427E54C6BB4FAB29DC8DAB2607A0DC505ECA garynosek
390,327,352 *2747A1D884AB28D23B1237284657FD0CE4125483 GAVINBELKE
390,327,353 *2748065471820A627B4A3A0F58B4437242539BF7 q) ~0~o>B0
390,327,354 *274EB7C29C14B506F6337415DAB5A9ED3E8C3761 GENELACHICA
390,327,355 *274552D6A01E9468DAF694C257D125F570E19CD5 q---P`~`~3B<-
390,327,356 *27418CBC1A4F46D247A86341627F90D65C4D7A9B QUEEN81
390,327,357 *274551CDEBC529CADC5ECC4583BE564CFE01EA9C QUIRINALREPUBBLICA
390,327,358 *274378776100291ED771EB75F74DB121B0CF316B RA0UL3
390,327,359 *27473D9006B3F53805F46CE8E13537E05B517F38 [email protected]
390,327,360 *2748D6005B7FC41286FAE31EA5D0DF71CE29EB72 rafaeltorian
390,327,361 *274B3D7F53F50F21F2CF58EEC94B1C72245385C1 [email protected]
390,327,362 *274F3672EEA769224514A0EEAFDE796437BE1CB2 GORDONBEDER
390,327,363 *27432053219B705C7DCAF7A255F2737449DC33BA raphaeltebbe
390,327,364 *27480B4013C07651B9A9FA78FF54D5ADFA43DD7A GRAMPAZZO
390,327,365 *2746A82FAFADD2E42FDF524B288763A12B6541B0 [email protected]
390,327,366 *274FA201578C48AB24C6F93B7E624C4591E09AC3 GRAVITICS9
390,327,367 *274BFBA020E245108021580346877171B8B918ED RAYGOIN
390,327,368 *274E6A2B2F3388ABDC34479DD17568B14DD04B29 GREGORIOGRAGEDA
390,327,369 *274EFD0540C38E55A33738470CBFDE3CA4E1F950 RCLUTATI
390,327,370 *274F5273A9E380BCABDFCB5EBB5D22EDCAAC019C RDIG.(M
390,327,371 *274EE7FC26489D672D0471D1AB0706FC4F795DC4 [email protected]
390,327,372 *2742764A723C9B06A8731C214B38A2C7AC5E065A GRUTTENMEEL9
390,327,373 *274B897A4239654D53EB3DE360A989A4ED006C6A [email protected]
390,327,374 *2749E9C85C86F83610DA6C7763386A0B0C36F59C GUBALANE89
390,327,375 *2743EC85208E4502177DC9180A3ED683735B245F REFUGIOJOBST
390,327,376 *274A9734ACD26D466E13387C4588D11CB5A22C8D REGGIEMACKIMMIE
390,327,377 *27471FDA0BAB1FCDFBEEAA08134B1129813D79CF REGINALDGLANZER
390,327,378 *2749F13E6C7FC8812273E86695E56BDCD6B2AF8B REKOMPENSATION2
390,327,379 *274683534C45EC73D706A7490B44793E7C35D774 RELTUERTS
390,327,380 *274CA1AF2DA53331DB6D0CDE63BD766FD08404E3 RENECANTERO
390,327,381 *274F6543EC669CCF412065A1905469227565E5F9 RESONDRARÍAN
390,327,382 *27429A8CCBAADF6314BA949232EBC28C667347AC RESTAURANLAR
390,327,383 *2741F0ABD5A9D8EB619BC425603EA0EEEBABC991 resulteerde7
390,327,384 *274DA92904691B334C4E097F5FA65C62622C7BC6 RIBAPROPO-ARBORESCENCE-PERSONNALIT
390,327,385 *2741F5BE777FF45863046F61D300E049A37847D5 [email protected]
390,327,386 *274E400905571CDBBB9FA89709CA960A82481F39 RICHARDHUECKMAN
390,327,387 *274BB66BF74769FBAB2296983A3B41B99A896F1F RICH GRIFFITHS
390,327,388 *274E16C5DBA748A399634EEB4B9B9093BC31EA01 HARLAND.THANOS
390,327,389 *274C82EA42996A94FED647389BE93D5C7E301499 ricomarconi
390,327,390 *274590D6330127F08A0DDA4246BF03882647B7BB RIDE-ON-THE-RHYTHM-(STING-1)
390,327,391 *274860EA8FD95E320768015A1D185FEA619989B2 RIEMPENTE2
390,327,392 *274DB15425232931052B6242CD954D31BCADB07F RIGOBERTO.KUMMER
390,327,393 *274FCEEC04D0BE358574ED83CE42EB3766A130F1 harvardbusinesspresswordpresscom
390,327,394 *274E084991F6191A95A397BAF0E17B947DC6F673 hattangas
390,327,395 *27413CDE3FD6E4CA00ACF629B901F1ABE0C33814 robbieswimmer
390,327,396 *2746BA9B132F440E7AB0300346B5BA3C0DC08857 robertomorrin
390,327,397 *274570DAF020271BE3F441CEAC0655A91A08070B ROD.FELICIA
390,327,398 *274FD1E894FFE1D3CB851C2CDE3DAFDA144C5D44 HERBBUDY
390,327,399 *274D5BF52BAD4B6DCFA3CDCD2A735DD6BC530BCB HERSHEL.BRALEY
390,327,400 *27458B920636A2E61D7D28E5E79D5DA1B4AA14AE hibiya’s
390,327,401 *274D0B3CBABD1EB42B008CAC9A9DABACB972500D hipolitopiefer
390,327,402 *274D473AD234FE404878637D07E6C4A139DF7712 hisham-musa
390,327,403 *274E1C4253E276A093CE3579696B72C19C529725 Rome.Munich.Rome
390,327,404 *274BE9D91BD652022DE014D79E3D426123CB5EAB ROMEOSWANSON
390,327,405 *274C682846069DBD467927913BB067EAEEDB3A43 RONNIECARDAZONE
390,327,406 *274FFF1C5859A02903B2DFF2199DC70A58340F0B room.501
390,327,407 *27437CB0B5A103DB8E77879E8E88BF8628E08EC6 ROPINGTEXASING
390,327,408 *27479D9018DA8086C7EECE55DD55957F0F80D5A8 HOOFDOFFICIERSFUNCTIE
390,327,409 *27476A6169DD0A7A8E6B9E73FF54869C26F67039 rosscouse
390,327,410 *27424B1938DBD29718FDC47EE4993EC902430F62 rou-aux-jeux-olympiques
390,327,411 *274D2F8A72F2D03C1B91339E6CED5377F38B96D3 [email protected]
390,327,412 *2745538DDECBEAE717A65952F0D7266453ACC42C HOW.WE.DO.(STRESS.MIX)
390,327,413 *274CCAAAFC55D884EE1A76515891DBA00F7C2A4F hoytstrawderman
390,327,414 *274F9F9C9F31898814ECC6BD6845B38ED0C0E086 RRLANDSK0
390,327,415 *27464A9BDE289F49D7797CCCA751A665E8D8D31B RUDYRANTZ
390,327,416 *274ED5E67CD3A7BCAF032719DD3AB57C4406AE4A ruebennopper
390,327,417 *27445DFC041B9FF688D945D9A700EA30567FAF28 RUL35
390,327,418 *274FD1FE79BC31F77F56711F4B6B612D12D12917 H`U\
390,327,419 *27477EC3C068AB0B7D19A7AC12E0CD08908E8A4E hungsom
390,327,420 *274A635463E8010B8F59FE9FF89322B08B868F74 S7ON1Y
390,327,421 *274F2BFBF9D5BEA75FE9AB95FB04394420263558 SAINTBENEDICT6
390,327,422 *274CA320B69C945242BF2B3B5357280A38ED66EC SALDUTAKOAK
390,327,423 *2746A4F95699551D2000D3577D4365F6BE9AD9FE IAMADG666
390,327,424 *2749B9B3B4DCB5ABEB051A0C1ECA87F35D9DC09D SAMANTHA-GERHART
390,327,425 *274D9E06D68BB5751D42A7477B4E09BA262B38AF iekoksil0
390,327,426 *27466E22E6C5ED5603651D46D141330B6350DE7F samirajamal
390,327,427 *274969452267D94F3E96C278E170BC8A721FAB3E i'maloser(take1and2)
390,327,428 *2748771287841AE6F325FB3F04E8EA5342A774DC immor7a1iz3$
390,327,429 *274D2C0748BACABA144DC891C211FEFE86DD8B71 SÄUBERUNGSLISTEN
390,327,430 *274FFEC62233B7AD96345CFE50F2D1D86A2D2E3E [email protected]
390,327,431 *274F535758A844DAF2884A1D94953754A6DE8146 SAWADEAFFAERE
390,327,432 *274D6DD1F5607790CAB14340E0ED8FF45A309C54 ... into troubled waters, i sink
390,327,433 *2746289AA9B7FBB985CF06621DB16FDB64CFB825 scilbuperimes
390,327,434 *2741746CC99CAA13B753CCC007BA5ED5855A6934 irnipohs0
390,327,435 *27426528B69EAA32E3EF920427E96C463ABA4C39 SCOTT.ABUNDIS
390,327,436 *27455C4B99713815D531623D6D078C8AAEFD489B IRVINGIGGEY
390,327,437 *274DA9CBA7738BEBCA197033C75FA3A94602E4C5 SCOTTIE.HULCY
390,327,438 *2744C65AA8DA85C2E9D264841258019062EF60BE irvintrogdon
390,327,439 *274530ACE68070520CF10B93609AA90C8BEDB0C9 scpy
390,327,440 *2743E2ACA398F2BC80AD156C9DEEBDA7E9464B8B ISAIASSIMSER
390,327,441 *2741A5E05E0E0B884781D6F12B60D97FFEB45F01 ISAUKAYKED
390,327,442 *274D7C1A1E0BA25B362EA40D6415773842AD941B isidrogiza
390,327,443 *2744CD07E16AD13B01EF7015CA4463A3A7E2B81E ISIDRO.RIGGOTT
390,327,444 *274E5EF5846BD0884BC42DD1DD6BD7468B1C7010 ISMAEL.SKINNEN
390,327,445 *274105729D443DDA46BC30C8E54198E406B3E922 ISOFORM.3
390,327,446 *274D92A9A60185A86B62DCC3694365271AEAA2E2 ISREAL.SCHWANDT
390,327,447 *2740C17A262884145C8A48C7359399BAA72FD120 [email protected]
390,327,448 *274E6159F5B692BA489C9028770D8FD6F598FB49 issacbohner
390,327,449 *27470868CE18F169A6150727E0B66EE82BC4FEB5 sellaque5
390,327,450 *274ED623A0D762D9C7215DFE4F50270F8059FA38 IVAN LE GRANGE
390,327,451 *274AFD062DFEC9EBDDDB30E9C99883BB7FCDCB7D SENSUALIDADSED
390,327,452 *2742C2F996BFE421D270054BF294638CB61EB1A0 i.will.talk
390,327,453 *274F346C5931A8CD44E7FE55C3541FDCF408C98E jameyvanez
390,327,454 *274D6BC0E3E34EF6E4C81ED368A38122198A653F JANBOWHALL
390,327,455 *2745DC92B324B61C1DBA35108C9ACC4229513C7E JANE.RODAK
390,327,456 *274D86C1E27B06169504C2B32A4FB712D97797D0 SGR.J
390,327,457 *27425B6EFD785B9264130774F7DCBBDAA7B81AFF SHAHROZ.FARRUKH
390,327,458 *27414039A78ACD9F346F0AEDAE4C631ADCE7FE7A shai-garber
390,327,459 *274C29FE70B09A8EF4EAACE20BF93B55E267C9F7 shane-henrie
390,327,460 *2740C229569B90B46868D331DD412AEF9E396647 JASONSPURLOCK
390,327,461 *274974CB9072B02293E2712DF1420DCC46E50BE9 [email protected]
390,327,462 *2748C8EC870FB6629C780169DBCCFF6E36478175 SHELDONNESSMITH
390,327,463 *274D14802FF6243A9634556F55B1D859617EA5E8 JAYSON.MUSSEL
390,327,464 *274BE6A0DB6E12ADAE35D9758AB21C41B0F840C7 JAY.TAVIS
390,327,465 *2749941FC9E10BCD5968FAB7479BBF916441CDFE JECTAITS4
390,327,466 *274766FBF26214CDA3D50BAFB0E4A1DA81F549DA JEFFREY-OPIANA
390,327,467 *274ABEA1AF34037138BCFB08B0CD4CFF62233E8F SHIMA HUSIN
390,327,468 *274E45F42BEECB69BF53C7376B7D77E75BDC4092 Shi-wo-Yobu-Cell-Game
390,327,469 *27416A1D365B34371BFE11B4FBEB961AB4A858B6 JENNIELARE
390,327,470 *2749C6467C85E857771892CBF597444B80A8C648 jeromesvendsen
390,327,471 *2747A97BEB9DB96E6ADDA0D432ECC3CAA8D3514B JESSIEDARRING
390,327,472 *2745B46678CC383FFE38A16229A1F89F04B4FBA6 siggjarvågen
390,327,473 *274AE4972EABC86A3BA8928D546A72CD74E91D2A SIMBAKOMBAT2
390,327,474 *27421335FC2D9BBF002170EEAB1E671CFC47DCFC simoncaberto
390,327,475 *27456E1B539DD2B9377F2523D6DB7A8E3AD5A178 SIMPLECRUISE
390,327,476 *27487BB5E657D4A72DF3B66218382630D2AC29C7 SIRRASSIRRAS
390,327,477 *2746767B34F2740A80DB0A9DEFE99F08313E777C [email protected]
390,327,478 *2749E4BF60F5EB3960E160CE1249599ABBD847E1 SKYESHARP
390,327,479 *274B16F50AB3D776BC8F486C59D3073A399E0891 SLOANSPACE
390,327,480 *27495D021F1A5361EC8D2A55380366E8104A542E JOHNIE.STRUBER
390,327,481 *274C6373141E2B7B875E811AAA5DFC2265A397C8 JOHNNIE.HALUSKA
390,327,482 *2740D3EB3BE41F13A548E69201C83E17B80790D4 jonasillas
390,327,483 *274AF2ECE0F97FF12B9A8728920911C22CEE112D jose-mauro-de-vasconcelos
390,327,484 *27445553E277848C089FA0180C398A0251EAB2E7 JOSHUA.OLLIG
390,327,485 *2744133576FCA146A824AABDF5F2E5AB4F17492B JOYFOLKING
390,327,486 *274B84C945D1D4FE8FD9758D57BA73A66836D59F [email protected]
390,327,487 *274BE4F1C5802EABABB870C5E887AB47BF1845B1 JZ{;
390,327,488 *2741D558C2EB1CCF052E78856690A0C889B0142D KARŞILAŞTIRMAMAK
390,327,489 *274B3604434E9EB689C40B48498FAA8EE4B38E93 kavajensed
390,327,490 *274FAC5C2CD2825877C62ED261EFD9A17319C0BF KEITH.CARSTARPHEN
390,327,491 *274FFBF43814F1E69DF62B5AEF692D56E71A47A6 KELSIE.THOMAS
390,327,492 *27478EAFFF1175F75C2A4FF410D35CA646759B86 KENDALL.ALTOMONTE
390,327,493 *274CF32BB6BDBF3CC18D28BD417B8DCD46DBC33A SONATA.FOR.MANDOLIN.&.CONTINUO.IN.D.MINOR,.K..90:.II..ALLEGRO
390,327,494 *2742AB68F0CB7A969CF6FB279E53F75DCB9EF969 sonnybroden
390,327,495 *27457A1E207E033E82AEECAE65A491405DB1BC31 KENTON.GOTT
390,327,496 *274764CDF5E758B3551DC0F631A654A68718E3EC KERATINZYSTEN
390,327,497 *2742CDB6CC788946FC0855897EA9FC785EF3B046 KFUTURI
390,327,498 *2741BF3B173E561FE292A63E14B55047F1CD6472 KHALID.BADR
390,327,499 *2747F45A3BA95402B194DB586786FE01293F630C khaskhas8
390,327,500 *274139FE37B7CF1861F5CE0BF357AB693AAFA81C KOKOPU2
390,327,501 *274144872DC04D61A92EE0E41F41BF37A972D991 SORFAJTÁKBÓL
390,327,502 *274BE1B338693183702FDED7744147A74B9CB157 SOTTOPONETE4
390,327,503 *27433F8CCCDBCD7B33E774609B527A95A16B2C75 koreymidget
390,327,504 *27423C8BF8BF13287F483D4407DE2EA9CE98412D SPARROWHOME!
390,327,505 *274234C005405F9BDDE15BE331ABA7982DDCFAFB KRAIG.MEN
390,327,506 *27473247916BB4C45489FF0522564EC063ED54AC SPEECHESFORDR.FRANKENSTEIN:II.NOWISHALLORNAMENTYOU
390,327,507 *274BFECC7FCB4FA58E7BC6A8048221B2C2703F0D kristofermealey
390,327,508 *274837E69CE61AA3E9DA3BF8FD54E56A6B080E81 KRISTRICKETT
390,327,509 *274A47A256EB29873AB5B3964061BC17B5CBA608 SPEEDWAYPORTLAND
390,327,510 *274E278EE9867150181BBC1726BA0A95E527FE79 SPENCER.SEPHTON
390,327,511 *274C68F7061ADD65E40E5D1D805B9E4B246F7EC9 SPERSONNA
390,327,512 *27465247289FF9714D26F575732023D5632A1394 SPICIED4
390,327,513 *2749D38DC4B49E9039DCBC33E2BB60528EA25995 laméntase
390,327,514 *2746E6FA6AA61A52CECF8B3509A9CFF3FA26EBBF [email protected]
390,327,515 *274E537693E94EA6E5992FD28373E7F8EA77FADE SSENEVITCAFEPUTS8
390,327,516 *274B3CFC203C3A7D2D2443214C035EDE680A7981 LANDULARING
390,327,517 *27412D772C48F99B48A9DEC53AE8F81CB2F2660B LARROLL5
390,327,518 *2745426A7D1FBCD4A36EC65E30CB2229D91C8E91 l{aw
390,327,519 *2745B22D2D55CF2FB24BCA3048CA183471906F08 LEGGIADROUS8
390,327,520 *274B73A8E45243F512FABA68223E84E97CDB0844 leslie.sowell
390,327,521 *2741DF61594CE8C5E066F7821F5F3A1CF092DB3D STEVEJACKS
390,327,522 *2742093443C7C4E6DBB60931565F18ED1CA01871 LIGHTSON(DARKDUBDIGIGMIX)
390,327,523 *274A1A7B8CBACD364AA2C441FC1453016140F200 LINDSAY.HOBOCK
390,327,524 *274438F363A8029A951C94E2A96BE674A33F383E [email protected]
390,327,525 *274903ECDF1505FE720D5AB5867EA45F8D3D2DC6 LIU.YAZHOU
390,327,526 *274FF036F781A0454B320C7EEE6BBCAB1E8E182A llama-por-favor
390,327,527 *27430EBE9409A0C21E8990C0D93B1B3D2E8B2A02 LOANSON6
390,327,528 *274A8B2AD087BF0D93FCD8609BFAF4A9020887B8 LOCALIZAÇAO
390,327,529 *274EC8F0D71552D2FB1761AEBD67E299A4D755FF LOG0510
390,327,530 *274BF91468ED6C1A42CBCEA4D1D7E9CF71580EAC LOPESDASILVAGF
390,327,531 *2748A17EC320DCEA486F87277B6C0E44B93D91C2 LOWDER4
390,327,532 *2744EC2EF03D20BAF236A9274B052D0CE166748D sumar.yono
390,327,533 *274AEFA157FDE27FFE95386063B535EF34BEB03E LUCIEN.SIEBENTHAL
390,327,534 *274D85F14CFAEC655234D6206FBE527890EC64D3 LUCIO.STGEORGE
390,327,535 *274C84B194E7B59EFF0EFDE4EB7F242C44292E80 [email protected]
390,327,536 *274BFC6A8C7611EA10405942EBD055A46B3E2514 lwcids
390,327,537 *27459810B3766AFA177BF11BC501BD46BAE13B61 [email protected]
390,327,538 *2741E10D839DD4E7DB15A5B1FFA3E44F77024541 madarquillos
390,327,539 *274107570FFAD9D24D381675B090E993E18F57EC MAJOR.AKANDE
390,327,540 *274574D6B06638160D544A4C50271EB51CBFE593 SURVIVORSHIP
390,327,541 *27446A3622B40B4B9A61CF8AD2294997B08A831C sweatsuit2
390,327,542 *2744FF44C1CA4E34F64A337194A67CE12606F068 marionhogsett
390,327,543 *27417F335B2F0D23D177DF6E86187E2D5E8BE2E6 MARK-MCINERNEY
390,327,544 *2745D79553FA83A32B34292770FC60E56A732CBA mark.olszewski
390,327,545 *274C6080B15B9DE089E1BFF4BB0A5F52B1F78C69 MARNROS
390,327,546 *274B615C5DB7CB757CDBDC4CAE8FDF6FB50EFE8E marquismcnish
390,327,547 *2745774F9EED36810203C22D9BED60BF330BA411 MARSHALLFERUGSON
390,327,548 *2746A97637CA93507889BEFCBC5AE4E7600B34A5 taalzifterij2
390,327,549 *274C8E9C3C8C1683143BAD62502779F5E539FEC3 talk9019248240
390,327,550 *2743ECE9504F592F6F203F600F3BA72EB38E973E TALLESTCOUNTRY
390,327,551 *27450708074CD3482202B603BE3FE3CBD380A07F Matthew.Chapter.19
390,327,552 *2743CC84927E941F5B67805261C5AD49E37869ED tarashalane
390,327,553 *274D90DD7FD177D45EF136FCCEA68CFF9089427D TECHNOLOGIES社は、「XBOX」の商標登録出願を
390,327,554 *2748510D7913228AA922F89139AA59D24D354739 MAXWELLCHALLA
390,327,555 *27477A3E3A96CC4BB77B31D4204C19340684DE4E mayur-thacker
390,327,556 *2745426E305F300BB2283F66DC3ACB3A342E73A8 MAZAFIN
390,327,557 *2741D10F9D8C6E22FFEA4E2B86DA122F4500D7BB MDMA6969
390,327,558 *2748F0016E0703C8A5982C361D3AB8D40E057089 MEARSDON
390,327,559 *2747F6B9EF3F2F6737560916FEEA3E1A7826EBBE melanie.baynes
390,327,560 *2743BEAD24797FA17CBEC76FE535B3395585A3A5 MEL.BUDZYNA
390,327,561 *2743550AFAC3F75A3C682FBA9A3215D26998E620 melissa-de-wit
390,327,562 *27469DBB801C46204E41F7462291F12E322B58DB MELISSAGERING
390,327,563 *2742B950F3016CF5A4B58F96DDA2C9D947154144 [email protected]
390,327,564 *274645105E882F0B2E5182D4A235C44689D275FA MENGHUDIEKING
390,327,565 *274B8207C6FDEA66DCAA777F535E4476BFC4DEC4 TELEFONICA-MOVILES-DE-PANAMA
390,327,566 *27426A82CEDF43E55C40AF40C46958FA384015BB mervinmalcomson
390,327,567 *274065783FB3ADB593DED805951108D3F506643C MERYCERUS
390,327,568 *274F25AB2841BDE070C485DB0C1C1E6A095D9B76 TEODORO.BUSICK
390,327,569 *2748E3BDDE0B3284103B6F1264591E5888A31937 TERRANCE.NADINE
390,327,570 *274FBA6898DB6EF94614EF18D9DF317397744828 MIA.OMAR
390,327,571 *274E9EB52C136203AF9BF4C5F4BA99C388389BCC MICHAEL.WITHIAM
390,327,572 *2742AE7B1974D2ECDD96844958A5C527D7282044 TEXTUREXBSWING
390,327,573 *2741EB507BD2C3F71F7268DBB2ABA06A0CAE3035 michealiniquez
390,327,574 *2744E0DDB32D3BE6C8EBD74096C34A3C37AB95DB THADBARONNE
390,327,575 *274F1198722CABDB0370B060E90E8CD953318291 THANHBREEDEN
390,327,576 *274BAC975813BC206514465AFDF6B15944A0B7D1 thanhgarding
390,327,577 *274E82F4674818493B730F447479A175C9820EBC thateddie1996
390,327,578 *274481FCA10AF49FAE7FD54098A61E2AB4863D64 THATKISSME84
390,327,579 *274D059B039290B29F02BECA838553E62E08AB55 mike-speece
390,327,580 *27435E423753CEB23198468AF6ACBCDFFFA8FAE1 Theme-From-a-Symphony-(Variation-2)
390,327,581 *27463C5BED3230D26D5B680B9393A0ADA51B42DC THEME.FROM.SUPERMAN.(SUPERMAN)
390,327,582 *27439594B69A5448AF4F182BEBE8891AC66B0494 thesphynx97
390,327,583 *27459FEB1F8EA52E16847FE3F54CFDFD34C6C02C THIS-TIME-OF-YEAR
390,327,584 *27471DCE202D19CCA7B38C6330BEE2A0464FB6FF timi
390,327,585 *274BE2EF721237AAB58D679CA36B4423BA4F1048 TINA.ELLEN
390,327,586 *274BAB8C7AAE9E22F4DE8B5BF4E66F388DF48826 tj.durr
390,327,587 *2745F81EDCD04B8808A32C6E4E9C64447A7B328C [email protected]
390,327,588 *27429F09616BF634F539148492AA2F2A7E550B71 mordv
390,327,589 *274275CB7D348A6B8F889AA648C6294D79CA2A70 MOVE STAR, PART 2
390,327,590 *274FEE64515D33FD25D7FC01A66EDB2110A910E6 mphorrmed
390,327,591 *274A8C317FD1E364F67D6D1ABBD39AFBC9B4C70A mun.mot.mun-metoden
390,327,592 *2745AC07FCCA247470FEAA7C16E5CB9403E4DA4E MYBERNARDO61
390,327,593 *274D9F76BE154A5F09A18AF35598C4BF26D86033 tracypengilly
390,327,594 *2749D935D6DFB9DF7ED643CDF24EE0B832998452 MZK2MG
390,327,595 *274F1CEDED2FDE170A9B109B21B2C7CFB4D32C93 treasa-stritzinger
390,327,596 *274A90964D2874B30D4BA4F63C9F0B6930061DEF NAME IN VAIN
390,327,597 *274BD43EDDBF801DCC8E072F19180018D9D6DD20 NEGATIVISMUS“
390,327,598 *274AC3A6098FD8A4DCCC7DC15D83767CC80941FC NEGAZMO2
390,327,599 *274DCFA0F342A4A6967C9C0EE7B3F30925186B2F NEVÓ»
390,327,600 *2744FC2D058D18267E07AC67ED1D01A8DE34C77A TVSWZBG
390,327,601 *2747411C7525EA10B9777BF8E9BC36DFBF832EE3 twice-repeatedtw/ai/s_r/i/'p/i/t/i/d
390,327,602 *274BB985D8548A6AC5FC278634FBFDE341A6B87D TWISTED SUN
390,327,603 *2748F97886260C8789974BE6337E3A1DF85762B0 twyler-gee
390,327,604 *27481720E1BAEE228BF2A54AE89BA70C4C9CB03E nikki.jellison
390,327,605 *2747CDC33C0BC8C52B1CC89B1D2E286043B60AD5 NIRINA400
390,327,606 *2746FADF754113481CCF11B5949FB353F8BA2AB7 UDELADELSEN0
390,327,607 *274A9403B49FEED6F0074B476A805DE6288E3506 noahvaneyck
390,327,608 *27425D903B497482335051C8FBB1B2213A5EC230 nolanhilmes
390,327,609 *274B201A793328E977413531C792A39D6718FEAC norazlinda-zakaria
390,327,610 *27488F7D80163E7A2076B63F77E91AC793DA3809 norbertohaeckel
390,327,611 *27446082872E82CA64839F70A2D7992F8C9B174D UNDERARCHIVED
390,327,612 *2743FA642AB776081F2AE5B0C180BEF795208A68 UNDERGRUNDSLITTERATING
390,327,613 *2749D32E5A687A696BE72BC25F1F1AFA94E2556C UNDERGRUNDSMILJØER
390,327,614 *274397399D2D0927B253DD936B2E7DE727FEC850 NUIESOG7
390,327,615 *27412A740E07468F8326BFB70733243FFC062CEA O101806
390,327,616 *274666D56B21B7798E5610FBED7710B2426EA1A5 O45293
390,327,617 *274C0206F82960401CAED20C88F468B49A10B4B5 OATMEALBOBBY
390,327,618 *27433720D0033E318E811F683872EA05D96C25A8 urginea.mar
390,327,619 *274811C0DC680591C711EFEE0945C1EA31A30D69 ODISCLICK
390,327,620 *27423F7BC250CA17C610148F11607EFC2558513E ODISKNAPKO
390,327,621 *27481001902CB8E499F5C3286681C196F328FDD4 OLEN.GIUFFRE
390,327,622 *2742D7939E47996C63B91D63CECBA887629F5A3C olivia-mulgrew
390,327,623 *274EDE357969CC9B3C3BF9E1A39182EBA7D31462 OMATAETING
390,327,624 *2748663BAEC82B5D497CBEEC0CF0EBAF66252236 ORAHDINAMO1234
390,327,625 *2747D5BB53D162D06EB487BE260F3457FB401389 OREN.MACQUARRIE
390,327,626 *27451FA1C09A03E9B2BDE69B99A242A9D5A4C446 oslena
390,327,627 *27468A84A43C83E04687FAC6B0D79F2514051D75 OTTO.GALLOP
390,327,628 *274CCD62B78B9A23E749AAF7BE591FBC7AB69064 OTTOKOSSE
390,327,629 *274B5E0AA779D350B3FC8CDEB619515B68665D55 ouled-tayeb
390,327,630 *274B3354D34C3E31585678400C3526043DD0C117 overtureno2inbminor4
390,327,631 *27498C0BDB26FA27EF32EB53173F2A6AF76D93FF vadlakunta.srikanth
390,327,632 *274AB6016645F62BEC63B29F95360EA9ABFEDD37 P10749E
390,327,633 *2743A1BFAFB6D59923B2BFDFBD195F162B79233D padure12
390,327,634 *274BAD176A10702D94B9CC91A508CD53BBECDCE5 PARKERDEBROCK
390,327,635 *274723D725DADFB18D6E9333759FFA352085AF05 VALENTINOIZUAGBE
390,327,636 *274DD4DB61783E060715EEB498079830C13D32E1 patellas
390,327,637 *274294738B8A350E24F8B5A528FBA06FB5FDB5C3 VANCEKUTIL
390,327,638 *27464E88BDFEC229B84C6544C779F6D692EE0868 PATRICIA.UVA
390,327,639 *2746856A962031E4853FD3F7E42C1D9C348AAB00 PATRICK2CARDICHON
390,327,640 *2748DEB3E3C8F9650CCAA22BABBE288B0563B7B8 PATRICK.HARVIE
390,327,641 *27477F3E0FE42E71C2CAEB277A488E16D1EAFF53 VANESSASTILLONE
390,327,642 *27492D038792709ADFC7A1BDA1BB26B6F9D53648 VEEOFARRELL
390,327,643 *27478AEB9D7EBF4D2CF822980A7C832C1080F551 VELVETMUSIC9
390,327,644 *27445473A46651322551DBE79C2CE842D0D98B00 VERA.HANJES
390,327,645 *27486258712C07DE29C71BEC9DDD59D8DC2E7BBD VG%3
390,327,646 *27489ADE7FF824436B7BACBCB30BFB222FFDC33D vicki.hittle
390,327,647 *274F5DA34F15D345B1B5F8F76BD2E9D9E76C6F2E victornenage
390,327,648 *27433E5CDB0D179E88617CD054DC179213DE8C95 VINCENT.MOTZ
390,327,649 *2747D0FE25B8BD8F98B37F14554C72598B8B5204 VINCENZO.DAINACK
390,327,650 *27402F88D47425A51AB8685002D9E8E4D433398F [email protected]
390,327,651 *2747F8556F1AED8350D52B1E67BEA9516BEE246C VINTERPALASSET
390,327,652 *274F1DDF7D385BAF11FCB2EE09D798CD51AF5C09 PERFERRE8
390,327,653 *274AA5FA7E900164322C3FB8F8AAF1C4C8987F08 VÎRUM
390,327,654 *274FCCFFB33C7C2272104510ECAB1EA29470DA4B peter.caina
390,327,655 *2740C1C2A160E08EFFBD177BD49C882C0BAC7D9B VNNDANDERN
390,327,656 *27420D2CDFCD32409767A0A897957FE8755E8E88 VOORTLEE
390,327,657 *2747A66728743B7D689B7D7E015C6B89632071AB wademccarl
390,327,658 *2749156C0AFD0B8B8C46CF3455CCF54B9F3EFB78 WAKEDJARADAT
390,327,659 *2745FB4E71B2FB21749767165F4FD78DD7A49509 WALLACE.LINTZ
390,327,660 *274ADE2B53B9ACCBD1C73FDA81F0B8215862C6B4 WANGYONG0910
390,327,661 *274E283E1B249434F48D376A0278DCD1AB226C21 [email protected]
390,327,662 *274698D9A3EBD462EEB9D6D65A4D1419A7E6C01A WARDABISKER
390,327,663 *274B435849C5233C9BB6232DB3BFD0D8DD2D2863 WASAWADEE
390,327,664 *274F63AB959B8CD7F60C00FD0EDE59F932BE043C pfaffle79
390,327,665 *27427D914CF735C04FA80FB54C08129D76C80FE3 [email protected]
390,327,666 *274E109E2B986F78F6929E61224C905CEC6FE0B0 p%mv
390,327,667 *274822A67C236494F64EA095BAAC911AF0953EBC pointcuchullain
390,327,668 *2749356EB7F5B3EEBCD24DCD6FDA99DAF2CDE4F1 [email protected]
390,327,669 *274E45BE164C29E2F39B39460E32D8D054617373 polochloe
390,327,670 *2746958E78A898E01942BBD586CFA89B3E078549 [email protected]
390,327,671 *27410EF7A7C3A34FAFF0CEF6D1FEA33A5713FBE4 whatever_comes/hw//@/t'/E/v/@/r_'k/oU/m/i/z
390,327,672 *274D404FF7DD6A0EA70457E2CEDD4D1F540313F2 PON1ARD$
390,327,673 *274A5770732BF86A73ACB3BC9060D316C5E54778 WHITNEY.CALICA
390,327,674 *27434E09F0747630B5E5DCAA994FEAD2327D1A44 poths123
390,327,675 *274BFB7BA17854E6BC711E5EB16A7306842460AE WILFREDO.PROVENZA
390,327,676 *2746DDF9E6361C9FF3C6C6BB814A73452C413BFC WILLI280390
390,327,677 *2748A9D900930DDAC5EBA02627448E05B0D8FCF2 presunte!
390,327,678 *274E1B9D72E3A6748DA7E6480C425533B54385C4 willythaler
390,327,679 *274190A382336FBA474F24AD2BBB9849F57AD3FD PRUNCZIK2
390,327,680 *274D13827FE86A9ABC4C7E2ECF2961E70149DB23 WILYNLABANEZ
390,327,681 *27456D33B65142D3CD82EB36511F87A87F561C9F pulppusi
390,327,682 *2746C0CBC422061AACC376CF469F55C0144A2E72 WRZIGEN2
390,327,683 *2744AAA7327623CB18C619C00747224F38150B97 [email protected]
390,327,684 *27458FFEF323354B4126B27CFDA9D8B5CDA70687 wwwbusseltonwagovau
390,327,685 *2745A78FD82252DDDE1B95AD4A72A3208470BDE2 RACHELLE.RAE
390,327,686 *27444EEB69B8DB0517CD012C1E842CEA8F717A79 WWWICTPAPYRUSEU
390,327,687 *2747DAE641B0D4AE31B00D63A60C3C6A5E854621 WWWMELISSALIONCOM
390,327,688 *274DBF02D47A7931080AA11E7E5226D636848EED RAMBO1SNICKERS
390,327,689 *274ADAFB461271FFAB27127403B52684F3FD7994 RANDYKOVACH
390,327,690 *27420E1B9C9BD842559C133CE7C3CAD03DA32EE0 X1$S
390,327,691 *2740175220688E09784BFD2F7455FF94D6083CDE }x{ ~` (--b
390,327,692 *2748FC2B60F357048065D4C261A63F8AF59038F2 rayfordbatchelor
390,327,693 *274F5C01840CC50834F0D3193E18BAD0B3A3C610 X+F^
390,327,694 *274FC2DDFE713F75D9AB59D7A9380AFFE37C5990 [email protected]
390,327,695 *27462175261E599252A10565F9FC38CCAC0D35FC RE4PP0RT10NMENT$
390,327,696 *274E3A26B391321964298B7546A1B16BB81FE983 REALDEV1REALISECOM
390,327,697 *2744DAF5FB777389B89F42C0C7B6CF729941BEE4 RÉAPPRENDRAI
390,327,698 *27411439970A50DAA7BAEC99782C2458CF891C3D rebautizares
390,327,699 *274CEEA39EFA27DE1B12BEE436639C779645A435 XYLON CATE
390,327,700 *2743C43CAC3D62C76C021A1F75698B20B32F0927 rehabilitovan-reporter-politike-grigorije-bozovic
390,327,701 *27447B3EBA80A7B267EB206D87BEBD41E9367BDA REIZBAREREN3
390,327,702 *274FB5C291D1B6E384B51E9D87851D9FE1B05BD7 REMMAHYESDNIL
390,327,703 *274FC69D3CFD65A03FDF7633E2F89F4FA56CC13E YASUHISAED
390,327,704 *2740863E17133CA8BEAD0CE53DD25D1C8D57402F YATIN-SHELKE
390,327,705 *274F6CB5C13BB8750C268D97F51C527CCA8D31F6 YENDISANDOVAL
390,327,706 *2740288C48A76064898AA410A6B7481ADAEE1D5C YESSY-BARRAGAN
390,327,707 *2748289639CEA458DF93E6BB1EF6670A55B4993C yeuihydème
390,327,708 *27485BC644F83C282F96984ADFD06884E30898ED YHENGORTIZO
390,327,709 *274380C78742E1