List database


# MySQL hash MySQL password
302,400,001 *1DEABACEEB10BA66838211D5F8D6F34643ACB14D GERALDOSPEAS
302,400,002 *1DE0A5A56D1A66EFC82A8F7CF52786EA7648CAD6 GERRY.WARRING
302,400,003 *1DE1D470B931D4A61C61F2C221F9D534E481AA44 getthemessage(singlemix)
302,400,004 *1DE96373BA5886D193E8585539E1D601078F3F11 GILMENSCH
302,400,005 *1DE957D5E9BD7D73DE381BD1DCC500E84DC48D84 gimme some, part i
302,400,006 *1DE7813F790AFC029F6981C6AFC9C89AAE46CFE7 gjemsels5
302,400,007 *1DEAFEF2D5CAA4D666FEA2408B762A8D24032817 Glasshill-(Mrs-Jynx-mix)
302,400,008 *1DE42B5B34E2C554F991FABC965B4916FE9D5764 i-never-missed-someone-before
302,400,009 *1DE53AE70C216FF317A762072886C8661216E080 GNIRAEG9
302,400,010 *1DEF608F84D6D3B7BDABA65556A198C7E97EF2EB [email protected]
302,400,011 *1DEDC099735F4DD2DACBA409F3117C49FC9642C5 [email protected]
302,400,012 *1DECBE400EF3E909BCB28CACBCFE9080DB50FE79 GORDONHASHIMOTO
302,400,013 *1DEC6646C2307CC7D4527F3D7089ED43F241F8E5 GRADY.LOSHE
302,400,014 *1DEC4F1B7144CB98A3A2C4C4A64730F6219E4D76 ironiser9
302,400,015 *1DE044BD7AEEFAD7E88A759500B4C73C37840747 GRAYCHRIS8
302,400,016 *1DEE4C23A5EA4BAA23F4A77126F0846AA2DC6A26 GRAYLAND9
302,400,017 *1DEEAE0E34EA2FA214E5D9BECBD426B0EF777B3A GUSTRILLANA
302,400,018 *1DE23B7B240EC8E689691EF72CAE1BD1248C775F GYFFAND3
302,400,019 *1DE8C6D31F7A301259E6BA1CDB56CA1217AC5E3D JACKIE.KILLELEA
302,400,020 *1DEAF7C2647113EAE2BC6E60C0658A52DBE9FE0B HALGR01
302,400,021 *1DE36C08CB66C6EC6AE25BEC237DE41221697834 hansbellerdine
302,400,022 *1DEC01284A82CF66E475FCCBEF51E4B1CF2F5367 HAPSENDE0
302,400,023 *1DEB3E467A2D0314C059BCE02E7CF19FFA4416B9 [email protected]
302,400,024 *1DE95EB37CC821B28FFB04997E9B3DD1DD37A953 HARRIS.MIENTKA
302,400,025 *1DE43F1DB64BD29149BE89FD719C57A96620E009 HARRISONJAZZ
302,400,026 *1DE68AABB0036B0612DE9ACFBD69B8571500DF55 hassannitz
302,400,027 *1DEE2A34CB2E1FB36D8F40B19A5388DEB0BEC0B3 jaysonseyb
302,400,028 *1DE852C5E99E3532CABC05903C54CF66522AF6D9 [email protected]
302,400,029 *1DEB1FC161634A11974A8EDB9BDCC2DF48003DC3 JDQLAI
302,400,030 *1DE25BBE7693550E5ABD502F43B430AA9D5270E7 jedwinkelman
302,400,031 *1DEB481EBE8930AA61BD1FA8F0A7BD6AF5FD00E2 JEFFREYBUECHELE
302,400,032 *1DEB8CA0C96C66E8D2C5AF90988D82334149C55B jemima.morgan
302,400,033 *1DE4E8B1828B1E64814AAA4E0CF655B334F3B302 [email protected]
302,400,034 *1DE9560491A835131AA7E593B248A039A3AD7132 HEKSYNEELLE
302,400,035 *1DE49CF6775C03C0B6A688A7E00EC4391FF50B52 HELEI2008
302,400,036 *1DE95A1B96165443C4FF012FA2D7C9EFC0148379 h_e_l_o
302,400,037 *1DE177508DAF3A5AF9717E89923E65275E001614 jimi-ang
302,400,038 *1DE019995D9CECDA64F12AC5CACFD80967198BA7 HERIBERTO.HILDRING
302,400,039 *1DE3D461CA09F8AB66297DFD9F97D8E735F1B189 JNXQ
302,400,040 *1DE1340AC8B562CD90471BF360598B4E2596EE20 [email protected]
302,400,041 *1DE37DFFAD9DD957B0C984AA6DA1497226D87437 JONATHAN-HUTCHINGS
302,400,042 *1DEFA6266A17E0543E70F262974C4A548D3A0004 JORGEFAULKENBERRY
302,400,043 *1DEC00B766024DC55F6AC66D66356947E0037AE0 HONIF
302,400,044 *1DE9CE558D3E0628F84F8A7A5CCF120DC93DA32F hospedes8
302,400,045 *1DEEA3D6799A42B8FB67626C7CAF756E3686838C JUDSONVANEZ
302,400,046 *1DE058860E936D3BD442840270B20D4068B7A479 [email protected]
302,400,047 *1DE26BF7BB6847265FA3C136D7BA7EE08CDFEE00 JWENNROTH
302,400,048 *1DE7DF9FD6FEBA9842592A78A439C80A995155F3 [email protected]
302,400,049 *1DE71590EA7D73B316A1FDB75658CDABE5372796 K*+}
302,400,050 *1DE7BB9DF9256D75BEFD7E5F78DFE7A01F5D64B9 KAMPFZEITEN
302,400,051 *1DE41FFE8C289CED1FE7BF1E366224A5237000D9 If you don't know how, find out
302,400,052 *1DEE8A833AFCD02E401F748B0F76C11CFE3F899A ILLEGAL.A
302,400,053 *1DE25B52D3F22F154A28F0F395811CA3C7003482 IMAGE67094765
302,400,054 *1DED044248AFA1627DC1B51103F0BAC8D123A4F5 I'MASOCIALCATERPILLAR.IAMNOTASOCIALBUTTERFLY
302,400,055 *1DE79F944CCE7B4AC67EE8496D6DAA7EA84D922A I'MHOLDINGYOURESPONSIBLE
302,400,056 *1DE3CA128C3D28E57EA6C9A9D6C9CD9FEAEA218D INDICALSES
302,400,057 *1DE39849902E4F1ABDED06570CEBEEF7DDED1F63 INSTEEKKAMERS3
302,400,058 *1DE672CE8FA691DED424963B201440FAE56E4576 KEVENBISCH
302,400,059 *1DE989F0428811E530E34DA8F438C20E600887FD Kilka.b
302,400,060 *1DE2A235B3CAF944C5CFA1335A14D76A166B9071 isbeau se prom
302,400,061 *1DE80E6D5AFB9B1EAC44FB46CDCB9EAB4DF5260F KISSRENATA
302,400,062 *1DE3AF27BFAF723C9122C8455C35292E99AD948A ivitsorra
302,400,063 *1DE685A9F8A48D79699378D4F4FF2E216E41459C KOOILIED
302,400,064 *1DE3B2F47136FA68E41E047A584C2A9AEC6B2386 KORYCROSSFIELD
302,400,065 *1DEC90C4FC085C0DA15CCBDAF9ACB4A8E6B5AC88 K.R(
302,400,066 *1DEF1E1E55D4B2E4D656AA5B768F1C5F8B55AB9D JAYVEEVICTA
302,400,067 *1DE854A487ED281AC3D740F623F925FD580AD242 L5C
302,400,068 *1DE124D12CFDB9A5D1B80AF2FBF275C65CDA5CC4 LA BIBISE D'ACCORD (PERRET)
302,400,069 *1DE75182C30C9E67CBCAA8DB04635D72767CF74C lachenderwijze9
302,400,070 *1DE26B6D7C85292315468644C3F911ACEA850A4B JENORICING
302,400,071 *1DED5AD1F896353E1EA6BB82625004E0115BB61A JEN-TANEDO
302,400,072 *1DE628FDB53315A35E2C0C4AC2248CED3D0E7102 JEREGLOS
302,400,073 *1DEEB2F807A15EE4E4FEF0EC579B5380DDF0CBE4 JEREMY.HEMME
302,400,074 *1DE38D6CED612E61DC74286534296E0C308268AF LAOTHOES2
302,400,075 *1DE315E80E3BA59663E2DFA0E1A84CDA93C94C6C latrampa(featmanuchao)
302,400,076 *1DEE353B9DDD45CDAE06A824FE24930D8BA70116 jeryl-sim
302,400,077 *1DE35E7DDE49BE52463B9BB73478E496D85D5DAE lazarokohlmyer
302,400,078 *1DEE6A98759B7A628088F498311C4A74C8400D53 JIMMYSHUGARS
302,400,079 *1DE8F8BA9C2AE89B029757579B224F51DDA4633A [email protected]
302,400,080 *1DE31CB538806ABA8D66ED795F9345C2288EA529 ;J.J|
302,400,081 *1DEADC0365D9188124C40CB724D0210179665B01 jkhn
302,400,082 *1DEDC0CC5509B107ACE88555A6CF4E7F1D5FC5FC [email protected]
302,400,083 *1DE9AACB8F037ACC9411FBC239A1236625591773 JOANH01
302,400,084 *1DE1E9D3C7ABEDD4A1DFADDC6941D0F85942CA9F JOE.AHYET
302,400,085 *1DE3531840D75A62157887854C722FC0F5BC1D9C JOMAR.LAGUIDAO
302,400,086 *1DE2B26B788521D643A4D59A8DF836F5377321C6 leongrussendorf
302,400,087 *1DE66E40D1BAD1CBBAD79D309120C819434D5C93 LES.VANDEVER
302,400,088 *1DE4A04C0B9416BFAEB0779F52E880DE70C774B7 JOTMYOFE
302,400,089 *1DE24791EFB6088E0654933D199A7391BC4799F2 JOZM
302,400,090 *1DEFA3B2BA698E2D5B8B69505054B0949FB6A3C5 J(QD
302,400,091 *1DE2AD83E2F11A43CC6B4B1ABCEF7E30619845C2 JULIAN.MARRIETTA
302,400,092 *1DE910573945455783EC2A40FD4932B4534A2661 LINDSAYOLIFF
302,400,093 *1DEA57C3AF553323444A946C8C317E2A0D88E104 lindseymaldanado
302,400,094 *1DEE834D1FF1A504B3D87D7A8D5F229F335286F5 juliuslyon
302,400,095 *1DE6849951ED0A246EE1D22D6C7CAF8506C4BF62 linuxと比較して、リリースサイクルはしっかりと維持・管理されている。現在は、
302,400,096 *1DEF2AFED945FBCC42252671640C59CECDA37C03 [email protected]
302,400,097 *1DE70CC73F1F217BD98C2304F5694B77AD0F2780 live4then
302,400,098 *1DE9A00BE4AEF45889A4FD3A0F1FA64C72F83DA4 jxhldwd
302,400,099 *1DEE8E3B271951F15E82E8E5EB873ECBFFED3172 kamalakurha
302,400,100 *1DE15227A491472C997CB8D8782FDD0FCE7F83E1 [email protected]
302,400,101 *1DECEB28A0441D188AB79EA9C1FE2783B22A5027 KAREN.CUSTER
302,400,102 *1DEBB9BF6CA3C00569F058638E2109F79B64BCB4 KAREN ZIEMBA & BEBE NEUWIRTH
302,400,103 *1DED8EB087EC9B23797F771B8F421F8214D017B1 lorenuliano
302,400,104 *1DE00473CA5EA5C07819CE84C8A3CF42E5689A35 [email protected][email protected]
302,400,105 *1DE0F37C71C95C597E1BA31AB107CF695302643D luciuscronk
302,400,106 *1DEBB3CC02F568B2214260786BC54B9C1D9351B8 keithcrumbliss
302,400,107 *1DE8E5CD74C1AA076FE42956B860C9F8CB9C19D3 LUDES,-OP-28-NO-17-IN-A-FLAT-MAJOR:-ALLEGRETTO
302,400,108 *1DEC541C45C0019E4846AFEAB5DE687FDA0760F5 LUEJEAN8
302,400,109 *1DE48A14609B7812BEE49F1C86E12594E9765D65 KELPAATTE
302,400,110 *1DEF562700ED1E0FB63AD8959C5D6D1AAF45C1E7 kendrickmurnock
302,400,111 *1DE6456E83FFB051E4DBF883F73471368FD28D9D [email protected]
302,400,112 *1DE7353AE4B1426E63F19C04FB84682A188FFD48 LUPEYE
302,400,113 *1DE5BCF981F7E1167BE80BBF3FBF884543A681FE KERRYHALLADA
302,400,114 *1DE9624D64CD909B6657616C3EE60DFC5D4B8954 kielbasy7
302,400,115 *1DEB04F7FBDC1AEF689751D320C1C7E2160AA84F [email protected]@D3S
302,400,116 *1DE466F3EA201F911E40954FFE336533844AF642 kittyseven7
302,400,117 *1DE8B007E19C848A6F0213A5F752ECC983BC54AB knaptening
302,400,118 *1DE8830D30C48DE7461857C8AABEDFC23C9DBD67 MARGARETKIMOTHO
302,400,119 *1DE73455B12E175282BC2AF38782C90C55843E07 marj
302,400,120 *1DE557408EA14B4693D3827E361E6A9EFFEE997C MARLON MARTIN
302,400,121 *1DE64A9E9E9B33C2217CA1805620A37F3163D657 KOMIKSPH
302,400,122 *1DE253F2B778B5D264076D282F120E0E320AE424 [email protected]
302,400,123 *1DE81E04939DB5F9BE1F25D81FF5FDFD66890997 martin.andersen
302,400,124 *1DE97580F04A64B609712342BF9636E03EC47E23 MATTBANEZ
302,400,125 *1DEA6ACC60C9EF1B8C5E085D31C0C5FCC95D3143 KRISTIN975
302,400,126 *1DE31A57263EA59121ED9D6E7429B98D5222981B kshn
302,400,127 *1DE7A96957ED24632573414CFDA943F94585EF2B mcafeeblog
302,400,128 *1DEA6793F577E4742874409D348E8489375C8C26 kurtismagnone
302,400,129 *1DE15A6E77F5E26E49A099F484B5DEB086F4585A KURULUSLARA
302,400,130 *1DE9C95D3ED4B8D87B46F6FF58CBBF41D410E6BC kuthhtuk8
302,400,131 *1DE4E92C89287147266D6247BB00878E4FB2C133 l2315
302,400,132 *1DEAE1526C5EE6A1786EE7EF3077955D1BF20313 METALWORKINGTRAMMEL
302,400,133 *1DE478F19A787C56521D43ADAEAE6E616C104DDF LA POBLA TORNESA
302,400,134 *1DEC78ED95057689EBE179FF8B52899BF38440AE michael.peter
302,400,135 *1DECC3DA4FF6D7EE3FE6CBDF64D6D2F668DD5EA4 laura-stanford
302,400,136 *1DEB1B84C1920C0B2C2EC91DEBD7736C6AFD2979 MICKEY.PATANELLA
302,400,137 *1DE0AE9212E446CA9127EDC0428D73C3CF49BF1C LAVERNMATERA
302,400,138 *1DE8C1E7BC8A2F0B4CBBCBEE5CC3D711F6288042 LAWAJONG
302,400,139 *1DE10F64A23186362D1C7ADE2411CA83AB976C9C LAZARODEHAN
302,400,140 *1DECF656AABF35D17DCFD3AA1C30DFBC5FA9D452 [email protected]
302,400,141 *1DE9ADC656C8E93299007B255925B4BBE6BADBF4 LELANDDRUCKMAN
302,400,142 *1DE57D583290399B6FC0D0C421A816C2D065C947 MITHCH
302,400,143 *1DEC31B5454EE8370A2EF42E22F633BE27C1EDF3 MKEBINAKGABO
302,400,144 *1DEB8550AED973E367187E854C729F14439CB488 LIBRE INCREIBLE
302,400,145 *1DEA3EC213FA54073EFD5D8B935FD940EE112F0F MOHAN.TIMSINA
302,400,146 *1DEA8A9AD0C06FA5BFC387CEFBC7979C2A38F9A0 moisesdillion
302,400,147 *1DE2B65739481041BE17B4E7B04B96DA5F6154D4 moltenuniversevolumetwo
302,400,148 *1DE641AFEEF90E525C27B0ED4878DA31707A0AA5 [email protected]
302,400,149 *1DEA5E59BAD107963E9DE518A7847C35CAC83A89 LINWOOD.MISCHNICK
302,400,150 *1DE9E22FB8F3E0FF8B689B50708507E3F27D44DB lionelarzola
302,400,151 *1DEEF1F7D97A07F6BA7418889FF019AF926086AF MQQD
302,400,152 *1DEC29FD33BB68DC417A538C5EE2BB529BC89874 M_SARAVANAN
302,400,153 *1DE0AA949413739B371A1F41C70CF6A0CE49F897 multimetres
302,400,154 *1DE5357664182947105AF53CEF6ED90ED3212A79 my7ho1og1e5
302,400,155 *1DE22F73D4801C367BB4A97ABB7F2B797F8CEC88 LOUISE STINSON
302,400,156 *1DE36408596CB006102E318E11900C0B1D862EE8 NATHANAEL.CHAMPAGNE
302,400,157 *1DED839C852FF6BB6C37F296B97E78D994E3579A LÓUZARO
302,400,158 *1DEB1DF73E93F7A21B471C3686BB2AFB668382D1 NATHANIELVIRGO
302,400,159 *1DED8AA680A7B4E9A643AECAA56FD1E5BDDE9357 ne"(disc1)
302,400,160 *1DECB3D842AF351B191D5B983069845649237B7F luciusvanluven
302,400,161 *1DEB058671F725D2A206D2FBCA87A81E32224480 nellie-anthony
302,400,162 *1DEA594EF9918F8AE1CFD413028ADFF090E3F500 neslegeorof
302,400,163 *1DE297F898BD1E33A8141A19B358589698241C7B NIGHHAND0
302,400,164 *1DE7F173327F8D3F45E0D155F5F38A844A19BD19 noblesasuille
302,400,165 *1DE52C397161DFE45445F001F6EF5FF3B0AA29ED nonarticulative8
302,400,166 *1DE2185EF9D7FC18852A667FBB249C76FDE5CE50 [email protected]
302,400,167 *1DECB4F8876014A75F1862B5DD800AFEBE3A835D l$xy
302,400,168 *1DE17F550522D900CF7EEDC4A4B3226A776BE2F4 LYNNGLANCY
302,400,169 *1DE880758FE7FFDD3E4E28B73A778B364B2207A9 LYNWOODREAGAN
302,400,170 *1DE76F2821793C6339F491761BCAF91FBFBAC2F4 [email protected]@N!3L
302,400,171 *1DE741C3CB7C4356BA1BE143A8B2336B5CCB0171 $o1c+ou$n3$$
302,400,172 *1DE7676412C697EBC03825D3B7AE58ECE18CB5B5 MAHESH1
302,400,173 *1DE7964C97B8C27A07F1A60EDA03504B6FE352E8 MALCOM.RECKER
302,400,174 *1DE3105A4492AE2ADE0DF830F6CFAD8F3C6E646F のOEM供給。24×36MM判と24×65MM判の切り替え式。フォーカルプレーンシャッター。連動距離計は基線長62
302,400,175 *1DEF35476B15C66F698A3A4163D2C72F1585FAFE OIS.&.THE.ATLAS.MOUNTAINS
302,400,176 *1DE6D2FCAA3C52E59F82F1BAFB541687765100BC [email protected]
302,400,177 *1DE0558B52245B9E9F83F3767CFD5545D5A89652 OMSTBER1
302,400,178 *1DEB384CB4D0822B6E3043F0DE35B098EA2FDEFD MARCOS.NEVEU
302,400,179 *1DE4B1A39C1B1B21CA00805CDDE27B96B14D73CD ORLANDO.DEST
302,400,180 *1DE2DC5F10C40C6FB5C707E4D61230A145E92FE1 [email protected]
302,400,181 *1DE6CCCB3FB38541857355975A36AF3AF955BE87 MARIANO.JOSEPH
302,400,182 *1DE51BDE49D2D6C2C2B66B79BDC6F4D7F2CD4245 mariohunkele
302,400,183 *1DE5DC3428B1F6B45C1D7F1F82EF1784FE20988A MARISOL-ONTIVEROS
302,400,184 *1DEE06EA80671A5F75C9FF198B360099A84D36D8 [email protected]
302,400,185 *1DEF3D6DA8330B5391FB40BF1A1C43F4963F8B54 OTTOMEISTE
302,400,186 *1DEACE992256EBA2ECD7723DD18BA74A15C21E4E MARLONABELLO
302,400,187 *1DE24B88183C97B71310C76F4F79F3768C044587 OVERBEVISNINGSPROSESS
302,400,188 *1DEF1BCA672685C00BD11D8DE00B488DD9977B7D overkriminalret
302,400,189 *1DEBF3749312E31676D142BAC0A369E88A0C3145 OVR?
302,400,190 *1DE7977FA6EF59722D972A0527279C9012B39053 mauleón)是
302,400,191 *1DED22DBD38045013F6AE88917115F5E63FB26CF MAXWELL.HEINZEN
302,400,192 *1DE75D5C65F180FD995D7AFE5DC286E19160BFAC MEILIR TOMOS
302,400,193 *1DEB86B89EB539AD4614D95602E3D5A0B59CCFB0 melaniericcio
302,400,194 *1DE8A860CB719042E374FBD8FA3A47F5E1BD69C8 mervinstacks
302,400,195 *1DEE5F456E253E3CE65755C226005E1CC6E24444 p#@~0~o>b0
302,400,196 *1DEF8604764E7FD4CF9D863F01309136D59B636C palace-of-decadence
302,400,197 *1DEE9DE24EF9993C88FC5F29F616F2F266034F74 palaeoheterodont
302,400,198 *1DE44B6D6E482DBA8390812B23F0FC014979C488 MINDIGTV
302,400,199 *1DE73541D8670BDD959593B7A16B166B48257636 MINEUR:I.PRELUDE
302,400,200 *1DEE95AA3C06569D1D5BD74EEBE184EA0727E711 MINNIEMOUSESUCKSCOCK
302,400,201 *1DEA21F24823979C2B4A241D2457DEFB0EE26FD8
302,400,202 *1DE2C47FDAA4683BEA50D9E4BD6D2475A73089F0
302,400,203 *1DED9CCFFA4977DDC64DE9513C444727B5B527A8 1
302,400,204 *1DE69D4DB684C55B81E12E743519F536BC79B195
302,400,205 *1DEAD2B13EDF20F8A2CDFE7CFA5F8028D4659FC4 *f
302,400,206 *1DE353EDC8846BDA46109BD98FBC6CE3A6F2FD25 w
302,400,207 *1DED3106867805BC774C76B0F74B519F3693900A MITCH.TOLCHIN
302,400,208 *1DE6064579F67972E890382D6CF6995E9325E968 MJABIEL
302,400,209 *1DE352B3B368D8195138EE3BE1D016D42B467476
302,400,210 *1DE7999456A7B9673FF9FFFE37497DE21B8BA1D7
302,400,211 *1DED5002E3BEEB9207863D718DB9832DF76D6614 mmmmmmmmmmmmmmmlllllllllll
302,400,212 *1DE07CF2DEE34D0DD8048513737C17EF265CBAFA
302,400,213 *1DEBE7CB072EC8DF3BCB8F7DF7E0CDD97A619A36 mob!l!+!e5
302,400,214 *1DE930208358C0222BFDCD9A46C10EDDB5E97FF5 M
302,400,215 *1DE7377A1026CC53BE32D290ACD8BDCFF614944C
302,400,216 *1DE775890C867BF4803920246B4A8BCECB075381 o
302,400,217 *1DE0A7AD4BE534D6F28E70B0B1348A607A3C83AD monicaenache
302,400,218 *1DE4813107589B86E81B4348BAF8A4288793D7F4 MONTAGTERMIN
302,400,219 *1DE8FF95F75D99DDA09639DA42F9D3D63D15FF73
302,400,220 *1DE0D566DC50F21A7E8D4B62830B7C23146751C2 (
302,400,221 *1DEE6840A8D8328D7048289E1B02E3351C15D974
302,400,222 *1DE78CA0FD4D2A97141B0646AD839B8461AF64F0 2:#
302,400,223 *1DE894B4C0F12E1985DCF0C9F59241271EE3E115
302,400,224 *1DE735199EFF4CE1A8BC4EBF019440E52158B729
302,400,225 *1DEB9B76818C3673DA948B4F1CFBE13E5D7C697B
302,400,226 *1DE8757E119C1F9A72631ADEBF60EAED4B3C0884 2
302,400,227 *1DEDF23CCFC69926572863BC8A036890DCE49F7F mosemarcaida
302,400,228 *1DEA91FF3EB3C2EB43C86CCBA887267D7231538F MTWELVEB
302,400,229 *1DE7110E618427B60E0DA2981F4EDCF3C81A04EA murphyrenegadeiic-idxc
302,400,230 *1DE7C8BB9D84CB41516D1EE05E91A96D699AD78C MYMULDER00
302,400,231 *1DE4C4768859EC9FCC6DCC262BC7823FC29FFCA3 06251931
302,400,232 *1DE6D90FC93C4A9EC92B520CE9923601B51D40DC naniaboa2007
302,400,233 *1DEC741A0638C29AF14A1A9155990BDC15C08718 NC045T
302,400,234 *1DE1C7F0117929CF7E586DCD243056BF5E9A3C81 118tryst
302,400,235 *1DE87B8D10500673D7D8DD664E7F151A79D493FD NEALFAILDE
302,400,236 *1DE5F1FEB401B38470DAAC0F8232F3B716BDB513 NED.DESIR
302,400,237 *1DE5A4EE69F22F05E6747E07D943C67361861963 1327584 UUDENKUUNJ
302,400,238 *1DE50F919383B391233A79C27A87C435FB0090E5 NEMATOMADVASIA
302,400,239 *1DEEA84B17AFFA22DF557D3FB22B2C83F589D779 1397167 derachtjahrealtezockermaltzok
302,400,240 *1DE395CA6F6E73D1D0AEAF7D47E1395FB80064B9 nemohoucnost
302,400,241 *1DE799483B771E92133C58B9C1A717343CADD8BC neonook1
302,400,242 *1DE7E4FED77BA0AFA67AC5A9155DA0472C894C2D NGOIV
302,400,243 *1DE2A07B7E2BA17B4EA52F3CC59934FCE51221EE 1607607 tapahtumien.aikana.osa.yrityksist
302,400,244 *1DE39940895B5180CE3E195509F20E34ED73D12A ni(aaa
302,400,245 *1DEF603EBF60236BE1EB0C136B00E9686DA9B010 NICKYCALDARONE
302,400,246 *1DE3820F361DB18E2947447C2F8B805B557BC0A4 1761055 "wedonotunderstandtheslowresponse
302,400,247 *1DEB6FFCFEB66471D6A38E1D30D5F2341580F886 18091870
302,400,248 *1DE7041880F31BCE077BE1B8BB5E36EA95E6964D 191239 Ustelik-bu-Cok-da-bUyUk-bir-adIm-olur-
302,400,249 *1DE78DAB283E562B28542535DB2B298B5F49F3AC 1937310 "maksutontekstivoisis
302,400,250 *1DEA4857F6207D3C8994B5283BB8B65FAF6423DE 1ANGELIKASTIFT
302,400,251 *1DE170C3B01677820EE2E6E93424B7E054B181BE 1 CHANCARD
302,400,252 *1DEC655C0C91F8A120DBE692FF1618E5048723E9 1 DAMATA
302,400,253 *1DEA533F8F7DE98CE3F79B92D721B39D827CBEE5 noestockard
302,400,254 *1DE775B06366A3C9B8FAEF3E88AD2E3E9E2481D6 [email protected][email protected]
302,400,255 *1DE88A2531FF806CE5BA662348F9EB17A3C61CE4 nothing.new.to.me
302,400,256 *1DE2E57EE7BDCA426B4CE19E9BF8F447654C5C69 1EXDETAINEE
302,400,257 *1DE77BDD0E388FBE5D9947FE48D360926DB1C6ED 1-FONDS-MUTTER
302,400,258 *1DE46416B3B41E432B1A15D7306CEBD3E237D546 ns112197
302,400,259 *1DEBDC24B09E1F045E4D950AFCE1BE42CF803D70 (o_) ~ `@##b
302,400,260 *1DEACF5A9DD6FDDF92234C6208B92C194AF1E3DF ODELL.PASTERNAK
302,400,261 *1DEC51DE9E793A6E8E2CAF863F1648BF6EC4BDBC )o(~ ~ ~d---p
302,400,262 *1DED1FA75CAD0DA402ADF6C0FAE18DC4B607F0A0 1leenbrieven
302,400,263 *1DEB46E2FBFF070178DD18318285FA357FA20B9E OMBOORDSED
302,400,264 *1DEF17D5D88D4A41A8AA5F338A1A255EE67D9864 1-punkthochhaeuser
302,400,265 *1DEB17AA7EF8A239B449F44FDCD265C316EC13EF >-<.o~.<-p
302,400,266 *1DE9FD15F55501238C41CF59C84AD295796B54DE Optimierungsm
302,400,267 *1DEFC1EE16FC4169C23A84C307FB43658C7D48EF 1-VARUSTELUKUSTANNUKSIA
302,400,268 *1DE12F7AB8A8B789BAB98A925C28501F641E5DB0 OWEN.KALIS
302,400,269 *1DE5D2BB46CE67749B1BA0D04089DD03F43E79DF OWENZATKO
302,400,270 *1DEC4B6F2BB06453E5EC6F350C6D756FC5B52A1A [email protected]
302,400,271 *1DEBE34DB336CF80A783A6E9DF47A76BB4E3BEFE (><) * * @P
302,400,272 *1DE1E8CD75BB9A5C8159E1BF3C94D024AE1318AE [email protected]$
302,400,273 *1DEF87F0A80BBC3BEA03B9C0A736F441A84D23DE P) `~ `~}8{
302,400,274 *1DE2A7F2ED0ADB07D865126AC6DA6E6CBEAD6916 paleokin
302,400,275 *1DEFB609E3AFBEB9F88007939D6A604305537FB2 2363912 konferenssin-ohjelma-koostuu-esitelmist
302,400,276 *1DEFDD7BEC742DA0699AB25ED607034E3CA82752 PAOLOCHANG
302,400,277 *1DE6722F28917538AECF140B360F8A60723728D8 PARLICCHIO
302,400,278 *1DE981E90230531DDD6C32966756927AB9D33A31 PARQUE-NACIONAL-EL-TAMA
302,400,279 *1DEE9855CACC0A36CD5C096DA32A4C4A3C392416 patiamo9
302,400,280 *1DE3E064CF6A3351085209FB78F3A07BA3489B66 281747 KOTIJOUKKUEEN NUORET PELAAJAT TAAS LIIKKUIVAT OMISSA HY
302,400,281 *1DE5EF611328E623640EBFE08306E67865FB8AFF p===b*.*;)
302,400,282 *1DEA173E6B8298380DBB51B4DEDEA0D47C381750 P####B~O~o-:p
302,400,283 *1DE2FB1DEE0E30115F46869B3113EA693943FB50 [email protected]
302,400,284 *1DE0BA0A9C357536336ADC4BC30F7A10C921A095 PEACELYNNP
302,400,285 *1DED7139DED6F003BDF5E7637F4A8EB4F7A7BA61 PEDADNKY5
302,400,286 *1DEE6AC0692C8F204FC29659BAF0A3EEF2729554 pensilvenia
302,400,287 *1DE4078CB1E595026F5EE20A3A2E4474915FE60A PEUVRIER0
302,400,288 *1DEDCF2CFB2BD08F835D7DDB048757D8CE3A31C4 2AUGELLO
302,400,289 *1DE350C5FAC8F571E586935B474ED47C435EAFE5 2DPAALGIER
302,400,290 *1DEADBEBB82A919652290DB3BC0AD6CB89C3D64B 2.ENTGEGENGESTROEMT
302,400,291 *1DEF454E5131135969BB12D7D45FBEA808E700EA 2ESTELIENE
302,400,292 *1DEEB53911379694B016C30EE88E21E4DAF71629 pierrebigby
302,400,293 *1DE59693B88FDEF665E6F94695C8E48EF4C3285D PIESEN.
302,400,294 *1DE523D029A16330382C06F46142214AC25BE150 2KLIRRENDE
302,400,295 *1DE3B781370161552CB2FDC6086522C32D174266 2-macanudo
302,400,296 *1DE9F3E33F9364F4A47AFAD63C3CE81160672FDA 2MOCCIA
302,400,297 *1DE90AB00B4325AD90C33C65C0FAB762065A4E5A 2.shushan
302,400,298 *1DEA574509A58DB9CBA6F1BEB69B697652C77BAE POEIERIGERS
302,400,299 *1DEE75365F1ED95CA56DA4DC991929794A6BFBB8 polatkan1
302,400,300 *1DE19B5948B92B24334FE2A71A1EB5C7DE755160 327536 ohjelman
302,400,301 *1DE1A8A03AC1CDFB6C18AF6FADCBDAF6D79A42EC 37387c542a8c395aa42392e527926732
302,400,302 *1DEF2B3DC8525A1F3BD4A2D42AA580A56BF3F456 POZBYTIM3
302,400,303 *1DED7FD24D26572AE8958155538FADB53087360E 3GREBNRYN
302,400,304 *1DE8E3879812393E01E40CA5FCCD9EAC65E131F2 preoţii
302,400,305 *1DEEE758D925505B0E7D9EEB5AE8EE619E3524B7 3-M
302,400,306 *1DE2ADAA5B0ABD5D106DCE7324CC8C1411B2AC7F prswllw6
302,400,307 *1DE2F455882B125C8070ECCBA013B394D4F6853D pubicollis
302,400,308 *1DE6F0D0E34D75FDFDA81AC879C1EEBDF08094A2 PussyMF's
302,400,309 *1DEAD9352B040643FEFE9DBD1F1A97D90B36159B `QAA
302,400,310 *1DEA1C9CE31054C641BB964E568CC7283219F5E4 [email protected]
302,400,311 *1DEBB2F9157EF546D897BA073F60254832594E01 [email protected]
302,400,312 *1DE27ACF7FE2F2E7D2D5D16FBAC01E705F7E14BB 4MANTRAVISION
302,400,313 *1DE8CB422B1F323AA8C0FE4E784A7E6062C20D09 Q=)~O.~OSPLAT!
302,400,314 *1DE1052E57AFF35BF4A5E47D3AEEE210C94A5670 Q=P~0~O :P
302,400,315 *1DE0D4B8BB344AE9B73B2DD6A6CA4570C8B51804 QUINQU3NNI4LIST
302,400,316 *1DE2107BF51C301E2AA99AF4E22F6DD04F79DB48 QUOTIDIENS PARISIENSSUPPRESSION
302,400,317 *1DE610CA37504795A5E20F7E99B59F2C90E7CF99 qw<
302,400,318 *1DE2785B4957EBA1B00C8A7CDDE8545308E4BD2C 4SMITHEREENSGO
302,400,319 *1DE77E2EF0D6C0CB8BC9AAE0B1E792960F913780 4SWYMMERE
302,400,320 *1DE2E58E5524F0CAB2DC134DDB9E31A28BF60C11 raisor12
302,400,321 *1DE245D2D8428489031A604E75ABA1FD66C57748 ramel-flores
302,400,322 *1DE0F0EE00825CC8821295B6AFA05A292C5CEF02 RANDOLPHLADOUCE
302,400,323 *1DE83B527678D1E3FAAFF85BAA3F98A3E02D38A3 560865 tunalihilmicad
302,400,324 *1DE9FC5525282F1C2AA61C5DAA64553520C3E0EE rapidlyinactivating
302,400,325 *1DE6250A8BFEFD44F77C6889CF456290C28998A5 RAUCHWERGER123
302,400,326 *1DE5FB0649D87230499448C536A6FC6364F9D088 rbuster
302,400,327 *1DEB7DC49F2D4E8A5F89F991ADE5A3BD48FFCB44 reebokgaby
302,400,328 *1DE74ADF88CECF33BF709F07FD5454532B99178F REFRESHSAVANNAHCOMREFRESHSAVANNAH
302,400,329 *1DEADEFACE1D9BEAC66BB2295181569E55354349 5MAILGUARDS
302,400,330 *1DE232995C9C67F5695D493E95611BBFCF3511EE 5MSTRSTKKN
302,400,331 *1DE7B83A4344EB1BEE1179A157609B5E60571D1B 5sony-owned
302,400,332 *1DE55913733BC6448BDC6D9EB5CC23121B1A0B13 reproksalg
302,400,333 *1DE33E917BECF968A07EA6DCF09E26C0883D2797 RESPECTFULDISTANCE6
302,400,334 *1DEF4C7A96D76DB93471E07942BAACB7A7EC59F5 5WYANET
302,400,335 *1DE71745086CE2482ADAEC1E1AF38CAB65ACB6AB 661818 eri.puolilta.suomea.ker
302,400,336 *1DEAD77DE44DB06583B3566182625720D2CBD78B 683308 LUKION-JUHLASSA-YLIOPPILAAT-SAIVAT-LAKKINSA-.
302,400,337 *1DEFED1DA981A1646158451841A93CD8C3CA220D REYHARBER
302,400,338 *1DE129BD3F703D6A8A39C840B47F97E52B1D7632 rflgntly1
302,400,339 *1DE9BD184F6FFDBB4D854671F3B2FF9D098CB38B RIGOBERTO.VIVERETTE
302,400,340 *1DEA49E4CDB82821DDD6A310331F7284DD2D7643 6GONEMOUNTAIN
302,400,341 *1DEC04FD6CB66CFB64514339D8F207388F7731D3 RIJIL.RAM
302,400,342 *1DE27D52A5EE70C46CCF70564115A2C50F520AF2 RIMPINZAI!
302,400,343 *1DE0A7FB2238A34C056821A10F60488AAC5616E9 6MASTOPEX
302,400,344 *1DEB5E1505D01146B4DA23F2C01585D0E7D7B8A7 roada81+y
302,400,345 *1DE0DF1E193154692738376BF1D053483A272BC4 rob-gribbin
302,400,346 *1DE2FEA1C2DFED887C1C8D7ABF647654AD0C7B37 rob-oudemans
302,400,347 *1DE9605E74ECCCA627E06A8501337F00C16D059C 6RAIVOSTUTTAVAA
302,400,348 *1DE7CEFC03152626A818E61AE4A74211B4F78E67 ROCHEALD
302,400,349 *1DE98EE0FFFFE30E88B9E8872237F6028C6BD4CD rodolforeynvaan
302,400,350 *1DE6062552CCD4CC0E5525A31AEC9DB7A38343B2 rodrickkempon
302,400,351 *1DE8C365203B8C975185780BF1D3335A7397A16B 6TERDDUKS
302,400,352 *1DE87E425D30031375210DA05853876F715021E7 6THERBACK
302,400,353 *1DEC07259012CE338CB22AB8AC5A3202C775D7B7 ROMEOMONTIEL
302,400,354 *1DE9C2A20C94C511E988ED0F86D3C85E4E3BDF42 71:----------listen-(c2socket,-1)-||
302,400,355 *1DED19041CA2AD748637E0CFB45A22474A354BE0 RONNY.GAWTHORP
302,400,356 *1DE8C3B81C92A675C494F47167794429692EE850 RORY.CHOI
302,400,357 *1DE97591A5307853122F210AF4F8EBC7A22E62E4 7BONJOURFOOTBAL
302,400,358 *1DED632FD76AD53C16403BC35758F4A9AF207ECD ROUTE-JACQUES-COEUR-LOGOPNG
302,400,359 *1DE78871C8FDE4E55E7A1B9D4EAED827D005B4AB ROWMANO
302,400,360 *1DED902CE696B78DE70CA15C557EDAC274639E90 7BSWDIASHELL
302,400,361 *1DE88EC79701A88FCCED003192C8CBA1EF227C9F 7BSWGENERALYBSW
302,400,362 *1DEE593A07DD717D99370C9304DB5DC73029332C 7CHAMERY
302,400,363 *1DEF6365B9C6EB56C0E681D4CC1F03F5D732A651 RUBEN.CAMINITA
302,400,364 *1DE125739287F485E3FE1F2752443DA11F63E902 ruby-seva
302,400,365 *1DE61392D66C8696543EB381A97A237FB50B5D20 RUDEGIRLMOODY
302,400,366 *1DE369C51C345C0DE3A6A084F6C44967A1F2B318 RUDOLFSWAYZE
302,400,367 *1DEE8089B0DDD71937380272715BDAE046DB04A5 7LIGHTJUSTICE
302,400,368 *1DE85E1C0463EC1738A216A8760D8F638D794769 RVB#
302,400,369 *1DE7967B3B2787B8F70E9807999784409776FF94 7NSFORBEDRINGS
302,400,370 *1DEF835E9D4AA492D8B44FC6F2DAF335E6758DA6 7NYTVAKXND
302,400,371 *1DEF30B32CFC77D767102A28BF214CF271AE4D0E 7OVERCHIEF
302,400,372 *1DE25382B5C2AD790AC17E5235D4ACEC0F6C19D7 SAHAJ SAXENA
302,400,373 *1DE6688D70E3D910ED940E728C6D1C69F9A079E8 7-VARJOPUOLENSA
302,400,374 *1DE28A2239A20451929DBA8FECC6604332087318 7VIKINGSSIMON
302,400,375 *1DE065A271F63B1F78A97C8A17131F5247A64A61 7ZIGGYCAITLIN
302,400,376 *1DE1A13E3E3BFF057ACFA95861128C8D3B47D86F SAMENESS.IS.THE.MOTHER.OF.DISGUST,.VARIETY.THE.CURE.
302,400,377 *1DEFEACD44095E060E4D11F72BED91B68F101085 832707 three-million-homeless-is-the-result-
302,400,378 *1DED044F701700FF4AC40A7F239DA0C4EEE9ABC4 843775 DIES BESTAETIGTE AUCH DER RWE-KONZERN .
302,400,379 *1DE49F4633D1ED23B74285D9C1EE13E201EEF872 SANTO.WEDEKIND
302,400,380 *1DEA8026B35EDE92D0A46E95F8D77A032E9B71F7 8BENOITSAILING
302,400,381 *1DE4435A95D97C2D8F486D5FC1C9856A6145EF4E SAPPHIRAL26
302,400,382 *1DEC7150F67BA28F86E7D323723A16DA3CA045FB SBUBURUZ
302,400,383 *1DE313A8D3F91EE56C585124F07C2789A9F2BB62 SCATTERD0
302,400,384 *1DE5AC86588A33D91CAF877B72A0094C56BFCBBE 8:..for.($count.=.1;.$count.&lt;=.$limit;.$count++).{
302,400,385 *1DEFEEDB8A5F617230A63E8F960449F430A6B963 SCOTCHHOOTIING
302,400,386 *1DEDF7677123CE56F7A430E83F349F0831C8D4F7 SDIKDROF
302,400,387 *1DE6BA9E82365FD539477333FC927DFB24861FFC [email protected],
302,400,388 *1DE7C5B3424B0C292AB6E58DC1517953D2FF06FB SEKSKANTERNED
302,400,389 *1DE6EA10343971454F64289CEB96154468DA7AFC 8STRANGULLIONS
302,400,390 *1DEC5DB1CFE265B0CDAA3D8B27FF73D7FECF5F25 [email protected]
302,400,391 *1DE115997B72BBF87CDCD7508CCFFA68F3E9E25A SERANGANFAJAR
302,400,392 *1DE29512763A8AF5A1EB78C8B5544021D703F4E2 904allison
302,400,393 *1DE0FADC0C3CDA46DC5E19D0E241E274C8397B65 94$TR03NT3R0109!$T
302,400,394 *1DE74680608E50564B3FEC5D618D8E22B31BA980 SETTEE
302,400,395 *1DE31555910A9E36C2C3B3FB73F52FBB8B4998F7 9BLUELJF
302,400,396 *1DE48B0A2AC4A9909B162DE3C8A416602B3980DB 9BONNIEABIGAIL
302,400,397 *1DE8E29998B4F5FA008FEDA44F5E58E9EBF94882 9DFODERFABRIKKER
302,400,398 *1DE73A0ECEA0218738F9121142D1A58072657ADC SFITARIMDA
302,400,399 *1DE171564DFBF3CD7EF2B996670066AC32D23A3C 9INALISOI
302,400,400 *1DEF2375F28D9580642A5F7D027868ADB941F1C2 shankalu's
302,400,401 *1DEE444AC481D3F82ED2ED9785D0A432151EAB81 SHELBYSMYLOVE758
302,400,402 *1DE7C476A5303E9922CCAF955A62FC63BC0A95FA 9RDINGTON
302,400,403 *1DE0B56E4F6DEC7FAAA7AFC60FEBC240D2B0212B 9REMMARGORP
302,400,404 *1DE1144A3276A12B47CF850CFFF2AE4337DFEA69 9sylvicole
302,400,405 *1DEA6012CDDDB6D63F96FCF858223D40A7A489CA 9vg4hnpok2k
302,400,406 *1DE67D413311EDC3E382F3651E1A5783D676649C sichaid
302,400,407 *1DE43FC0930B698207521EDDDDB8A4C0DA1CAC9C a3n-o
302,400,408 *1DE4B478491BC21BD3E2950B327A8E73C8B0A5BF A8CC87128BE2FA
302,400,409 *1DE6E4C0D1717099953CF2A459364FE20C8E1C73 a9+va
302,400,410 *1DE7FDF39C1CAB3C2117DA53030391F25B7B7881 AAB)I<
302,400,411 *1DEDD7F7338BA808E8E5ECAD57ABDD6A92126810 AA+MC
302,400,412 *1DE55950FDE52AAA502E12A66A00C9FCA09BE26C SOURIRONT123
302,400,413 *1DEA6932C8BF56CD9E4EC868C9DB7743B9C98195 SPARROWZIGGY
302,400,414 *1DEA73010118229C11CF433B500A319B3F967656 ABW#M
302,400,415 *1DEA3D743F8A90E5ED95DDD837C2E6150EC6867D a%drs
302,400,416 *1DE73DC29DE6B994BA5838EB968D924D815C5BDE agtyj
302,400,417 *1DE4F4F1F24261CC37CFA46C6BA2F07DEEEAE1F1 ah+)n
302,400,418 *1DE6396830D810DEC1A8ADEC96BBEF42261B74AB STEVENBLASTER?
302,400,419 *1DEC307720EF74CB46D02F9B35A7F54F4B284623 ainoayst
302,400,420 *1DE02E1D1D861182470CFA799B2CD951871A042D StringQuartetNo4:IAppassionato
302,400,421 *1DE88684FA81B030188B6E166FAC99F44B2E8515 akh8&
302,400,422 *1DE12C333F472AABA0555167C56C267F3ACC268F ALDOALBOR
302,400,423 *1DE69897F0D4BBD0D0BB4DCE0B76F42D840BB79F SUNFLOWEQS
302,400,424 *1DE09C1B8A91787D598570ED62A60380EBC251E2 ALFRED.TROGE
302,400,425 *1DE660C60C7966C51957C10EE972AF29FD74C05C ALINOU1899
302,400,426 *1DE8CFE6795078B92604AB4A459CF9A0575B4699 SUOECASPACORUELPPED
302,400,427 *1DE2BEFD3EB48767B154EE5444EECFEFBB6DA0B9 ALLEN L WOODS
302,400,428 *1DE97F354565C859A848AADEE73F47925540AB10 [email protected]
302,400,429 *1DE9F87DA65508A5E5E6065F28B1FBCBE4435D65 ALOVOSKIVA
302,400,430 *1DE6B5F0448514A07E5E58386157DBE9E66D2850 alterarsi9
302,400,431 *1DE8DB1CE383DC2A0B58ED0D4A40ED8C1AA56E4B AMCKDXFMCKFMFMCKFW
302,400,432 *1DE43166B7F012DA1B2C4BD82A1D4A586A5AE8E5 AMENUYSER
302,400,433 *1DEB4808FF1852D076F48EFB936D87462C58A357 AMIGOSDATAMARINEIRA
302,400,434 *1DEE85065574E64B13CA5E2B5FB64D0E698168F5 ANDREA.YATER
302,400,435 *1DE171ADA02EB6180A7293B2053390D5B62B0FF3 SZÖVEGTÖRÉSEK
302,400,436 *1DEAD57EBABA1745C9C467FE46C21156B0AA0902 [email protected]
302,400,437 *1DEE93683D986D6CC06FA00176CCCC8E62E90CD6 an?k5
302,400,438 *1DEA2C26A3CB3A3C2A5B4BF877F2E47254E31873 ANNOTASSIS
302,400,439 *1DE4734CDAEE84419F53EBF0499C67CBA4050C19 anti-rule
302,400,440 *1DE85E705BE5B6A84F1E42226409E2C8B8C738A2 [email protected]
302,400,441 *1DE2AAA93E899E9BBC69BB1154229A2F7CAFEE05 antonyhild
302,400,442 *1DE1B8984DCD36B455B75E19A0DB34A84F9DE180 tankersimon
302,400,443 *1DE860C00E2F687825DC7006FFC8D4D7F792A21B apd4l
302,400,444 *1DE3D42C99F4F613743DA60A8EEDD623EECFA0D5 TEDDY1SUNDAY
302,400,445 *1DED23EE258FFDFE503F06C2A6F16C4FE6B52A3C [email protected]
302,400,446 *1DE42709873C0F0FE62D706BF163C595AC1813D9 areasome
302,400,447 *1DE2AC2B497E37F6FC0D5943871E72610A10416F ARMANDBAERMAN
302,400,448 *1DE4D6B23B4BFEEDE861D0F0A5B7C386C3795627 ascendit.christus
302,400,449 *1DE69ABE0EFC9C25D3228A0851400B66355A4018 ASV4C
302,400,450 *1DE6D43979A03308B550750888848E52560E3AC6 the-only-rhyme-that-bites-99
302,400,451 *1DEC30A49699199FF9D1D110D49E97C1508CCAE8 TITEXI
302,400,452 *1DE352FAAE50C214F9591B7CB7151DE044B773A9 AUF DER YACHT NACH DR. HOSSA
302,400,453 *1DEE86E6EA71F40797992E046E7478C2EA2C3AB3 AUGUSTMAROHL
302,400,454 *1DE9E0CDE6EEB192A4D50CA6A00D3C3046B3D1B8 AUSENCE0
302,400,455 *1DE15938AF83043BCBCB5BE30D73CF1345E75245 avaglumorp
302,400,456 *1DE62BC8B946C624005CF1F7889CD3AF103332C5 TRANSURBAINES
302,400,457 *1DE33D4E19362DA2E211969D9AB9A9B76BD8D19A TRENT-PAINTER
302,400,458 *1DEFE27D33E0610EDEF8712F9B5E555BB0027710 b====)~0:p
302,400,459 *1DE1614F06ADFD749705EA785FBBAAB90893317D B2G.
302,400,460 *1DEAF0C6283A736D794909BC795AA46B01AF2603 BAINEIS5
302,400,461 *1DE02F55005D97BB96D3E55719EF8988C5E52B71 TYFFANI-OKAMURA-GASCON
302,400,462 *1DE426664ADA22D2DC393FD6A4D83A3866CCD0C8 TYLER-GRADY-KING
302,400,463 *1DEE76E666322F810431A28F7C1DEDE4D7DBB140 ”TYÖSSÄMME
302,400,464 *1DE729ADD8BFED9E299870DA8D5F010A72B071BB ulyssesleshure
302,400,465 *1DE61AACBC09F9C2D2040B2EDCC35E073D81C3CA B;BO=
302,400,466 *1DE1367F0CC759EF0C3D1B8AB38F367748F9664B ur_mitte
302,400,467 *1DEF07F42A1E14D93DC24132635C17237A9D53D5 USERSPEDITOR
302,400,468 *1DE600EEA81110327D8ACB5CCE31AAF1DBF86CA6 UTLEDNINGER8
302,400,469 *1DEB48E07D85C343E4B988081B13C73783E0D823 BcXL
302,400,470 *1DE9DB3774F30FE5F7BDD2217C4064457690107B UZ]K
302,400,471 *1DEB13A18692B1D1B57D253D9CD5D11078933B17 VALERIE-MARSOLAIS
302,400,472 *1DE185C32F4DCBDF98BD4100D21F6BA9445BE895 BEINTEZAIS
302,400,473 *1DE2357D52CA274BA6813D42681D95B1C00B28E4 BENNETT.SPANNAUS
302,400,474 *1DEE639BD4148B3E346DF20ADC90F5A5DE341BFC BENNIE.BORDERS
302,400,475 *1DE2E862642A3B6279E65C5C822CCA39361F67D2 BENNYWILBURN
302,400,476 *1DE3CDB89D64C89AE45A05E213B9B6602E3C2B34 vaughnfanelle
302,400,477 *1DE098290000997A2DB1EB2F503334579F7CBCDD BENTONGORNIE
302,400,478 *1DE2F44BECF8862E069351A8155D42F414B2CFE8 VCHKBSW2
302,400,479 *1DEE0CBA02E33CF44DA252F691C3206B6A5F5F03 B"EPT
302,400,480 *1DECC7DC9B58B011A1523FCBD7046FEE2FC299EF bernie's-blues
302,400,481 *1DE77203F4ED1CE8B353103D608D921D39331CE2 verknutselen
302,400,482 *1DE7EF4E7E0E44FA4D175311164EA77CAA043FC6 bi/oh
302,400,483 *1DEE8CE5C837C50678F78AC77FFBBB9BE961AA8C VICHARAK SHAH
302,400,484 *1DED69CEC50FA69000ABCDD989B4634EFE28D595 victoria-imastar-sherman
302,400,485 *1DE160270D9B98A70512F6322EA624314E4CB2D9 victor.mandry
302,400,486 *1DE32301B3DDF5E01BDF2D44AC3A69528C9502FD BK9TI
302,400,487 *1DE2A2D59A35882E5F699DA7F857BB359D93C2F5 BLAKEWICKERSHAM
302,400,488 *1DE08475922DF3131DCBF2E0714D11809B93DD24 BLEDOZOBÁ
302,400,489 *1DE8AF6825FA768775ED9321E9726EF59B877C8D BLEEDING-ANGEL
302,400,490 *1DE1E6C3DF2F0A42867F7E1AE004CBB0A2235635 BLINKWARNUNG
302,400,491 *1DE5595FD1A4F88DC05E73909517E3705A266EEF VIRGIL.RIEBEL
302,400,492 *1DE7759D3587334751816BB76FD4E4607C10A066 VIRGINIA.SHUM
302,400,493 *1DE6854D03E39E6141F8568868D4FD3E52964B32 vision of nowness
302,400,494 *1DECBD4B763544E67892EE32DAEA8BE395023DAA vody.lod
302,400,495 *1DE6C8740F7A4071C0401306B169BF54C2246045 boozalot
302,400,496 *1DE46BB5876400193AAC2FAEC34DE7A07D2DD31C B;=#R
302,400,497 *1DEE107BCF9D7C72F19E9AF6D27DB396E3355A4A waltonposen
302,400,498 *1DEC9543851950F1037D643A47B69DC13A07B9DB [email protected]
302,400,499 *1DE7EE2786C94313DCBD980681B96E21FB149D2F WARPYAWAW
302,400,500 *1DE08A824789E0C42A96EA45F5C2E87C54A95604 BRIEFER
302,400,501 *1DE3DBA3852F5AB170B3914F4F997B65A6E8F37B [email protected]
302,400,502 *1DE64957998C3FC15254C241459816AF7EB1A7A3 B.$=S
302,400,503 *1DEC74781302B2CFB15DE65486A62E124172611C BSWSOLOVEICHIK
302,400,504 *1DEA0B3596977FC0D06CDDD84175850CE63F1EF2 WEENIEQING
302,400,505 *1DE25ED0C6F624426E4EC6AA5A62CA62E043D711 bu?#4
302,400,506 *1DE125BA9E78F2840F04CC9F6FA077A4D956E151 [email protected]
302,400,507 *1DE4F694666884ECDF99B18953ED67EE236AC0E8 [email protected]
302,400,508 *1DE62621F6C5376D86B3CC3CC70273DDE5F66703 [email protected]
302,400,509 *1DEE223427CD54FFE266DDB27351F795F0D76A6C BUTY2
302,400,510 *1DE3E71AF338D8CD25C90D9E71BCBB83C37ECDA6 WGINOK
302,400,511 *1DEB047A0F770E3DE720803E31D9D25F904608A4 WHENTHEFOGVEILS
302,400,512 *1DE538928D24685FE2606A9CE6F6B30EBCC4F814 C2B)D
302,400,513 *1DE1D2D0155D8DD4F8AC030A6BA3B5E8EA12D5D0 c)"&6
302,400,514 *1DEF81A790917DA2B2EC39AC13F9EE96EC320C26 C6;DU
302,400,515 *1DE7207762CFEBF995BF3EB4523145DF1662A6FC ca)c+
302,400,516 *1DE16A422958BC85E64C6A51F732736BDF79CEE7 CALMER
302,400,517 *1DE4532C2F0141A2EC47F15E1141696D575BBA16 CANEKAL
302,400,518 *1DE176C6DACD9307474E5DEF7E4189DF5D980702 CAPLESTATO
302,400,519 *1DEB130D61B911C4A6442A7EB71B4DB992C90E3D CAPOTASTOS
302,400,520 *1DE98616D1565E5CD56CAC2C2D743CCD67209326 CARSONSULCER
302,400,521 *1DE19AFB33C4DD7AB05222A377C8941DE7C2DFDD c$arv
302,400,522 *1DE5FCC21444230B8D89F1706D296654AAB20118 WTZL
302,400,523 *1DE7BBA57561E56324E401E8C9DDE03CF994FE33 centerpa3
302,400,524 *1DE2AE0C3A697354C6B136BBF883181FBC104B02 [email protected]
302,400,525 *1DE9745A8CA866C7CA6CD57C28A439249C83F666 CFDNL
302,400,526 *1DE1138105C8312095FB59ADA70EF43BA5270955 wwwtimemecom
302,400,527 *1DE67BB178D227CE07C78B6B4D9DE8FA76D5ED7A cggm
302,400,528 *1DE6D39EA4E501D95EAE0849D730072388371E7C CGIWX
302,400,529 *1DE5AF433ED661864E5D374AD1A6601E4BB57F09 [email protected]
302,400,530 *1DEE141E15FAD99FC7706AC5B876B90038074BFA CHAPTER-18-07:-MOONY,-WORMTAIL,-PADFOOT-AND-PRONGS
302,400,531 *1DE158D1040E0ADA19F8A66E24A35FAA54614893 charlottyellow
302,400,532 *1DE1C6F903073A936AFCA169229636D4B344E3A2 [email protected]
302,400,533 *1DE976C1C6801463556B070C735F13FECDD89800 c+h/c
302,400,534 *1DE7ECF08552527A42CEA1ACEF570E6B70CFF9E5 [email protected]
302,400,535 *1DECF7EEFFB788D173ED12D49723DF080D684276 chesterlehmkuhl
302,400,536 *1DE98BAE87A2CB36167E3CE38C0E871BFE6BEE00 C+HIK
302,400,537 *1DE5F64076E50719B673EC62BBB917D8362D7AC8 CHRISTOPHER.LEHTINEN
302,400,538 *1DE5CACCB5F0E018FBBE73A4C078BF32A583C003 c%.ib
302,400,539 *1DE7A83FA5A8246AA2AB7DBAE197E4689C458E5E [email protected]
302,400,540 *1DEBAD1A680A0D0EA0EDD2A90B470B5D3A9AE620 CkU
302,400,541 *1DE35CCC3E84E3E6EB452564321D96F443BE279C yanique.alex
302,400,542 *1DE812226368C720ADFBFBD60FA64DD68AD64C58 CL7BU
302,400,543 *1DE919D4AE07023F099290EB9E3AC473BD156B4D yassen.vezenkov
302,400,544 *1DE873DB2F495330159AFD8F2DCE9F3B54919CB1 YASSHR
302,400,545 *1DE701F86641DAE1486590AE3816872EF62644C8 CLEW_IRON KL/U/_'/AI//@/RN
302,400,546 *1DE5820D00148A99BF016F5C29EDEBF2C82A9F72 YCAMITIGS
302,400,547 *1DEB08089784B37A5ACD7EC2336999CCDDE9326E YDOLATRE7
302,400,548 *1DED9F8834B2A967B40DB266F76292AD3AAB6890 YEDNIRG9
302,400,549 *1DE55677DF51348284022A405F16B30723F19972 YELLOW IS THE COLOR
302,400,550 *1DE0A865D98828CF949B23C1B2B1D4BDF2E54D48 [email protected]
302,400,551 *1DE50334DA9590C563F2BB32D8F74EB67C74F60E CLINTSONDERS
302,400,552 *1DE651ED4F8A1B090F2A3DBEAFCE3D6F79C3F7B5 CLMS-
302,400,553 *1DEC7BE25FB927DBF97315171123C9481B68CFA5 YLLACAISES
302,400,554 *1DE5FD3438BF49FBBCE990DF96D8BF4F65F67DCA YOLANDAVDM
302,400,555 *1DEE2B3AE839BFF82AE7D2D580913863B8F12BBF youngbruzewicz
302,400,556 *1DEFB372C9A682A801828024823E9D8D69C6D44A CM)VC
302,400,557 *1DE6AD08E8D57056482D8B45DE909283B5828261 [email protected]
302,400,558 *1DE6A576172F07A341A02FB706DC30A7DF053475 cnl,y
302,400,559 *1DE886A96ECCDABE53CE91A6EB9CC07E45216782 $Y$T3MFU
302,400,560 *1DEDCE0A2DBDFDFF8F2D0CA2039F1E9FCB25C5F0 CNRMLIB9
302,400,561 *1DE0128D3B0F99DEB0BA11DE50817D37D153C404 C%OI6
302,400,562 *1DEBB54C323192E4A52BA6470F960C917A6E5961 compiczgne
302,400,563 *1DE43DB9B7F3B37A54E4490E0F525AA3257E2379 yuliana225
302,400,564 *1DE7DF9676F1E0F4B9375CD861A14AEB06C7C06C zacharyduprey
302,400,565 *1DEBB153D13A34993365B6491E13913E502537CF ZAK NICOLSON
302,400,566 *1DED6EAE0FE67AFA83D3015732B5473D953B1362 ZASET
302,400,567 *1DECD2129DEDEA76AEF1330087177186CF1EEDC9 zenodia-hatten
302,400,568 *1DEA8ADB6EEE4F036B1E88F2FB853E340D6D5A58 ZENOILN
302,400,569 *1DE2ED4FB95AB20F066F9F03D080374CF18FF331 ZERELLIBAH3
302,400,570 *1DE01F7294FD49AB5B92C04654A33495B9FFA2AC confluxi1
302,400,571 *1DE6E5437ECA1B72424F5EF1BAB21C34E415354A CONSTANTINE
302,400,572 *1DE464727CD355238F595FA5C88F5A127A62752D co-orientable
302,400,573 *1DEDE552B639C9D67A717A948CBE6860ABD4142C cosmologicum
302,400,574 *1DEA3CC45C046F9DCA0FD0CED72C22B529E7D56B zrkfortbpkazovprojectjpg
302,400,575 *1DEBCEBA2C94458BBA34CD6BEB854851FAC904E6 c:\program.files\microsoft.visual.studio.9.0\common7\ide\itemtemplatescache\csharp\office\1033\vstoactionspanecontrol.zip\actionspanecontrol.vstemplate
302,400,576 *1DE7F84B98D7F8A11ED5A2482004F4A8E8D4245C ZURU"CKEROBERTER
302,400,577 *1DE961B1C3375656A0926D05B274AD94BEB8936F ΘΡΗΝΗΤΙΚΟΎ
302,400,578 *1DE3DE812AAB43DEA18BC02BB481D4886C62EAFE Το-ραγισμένο-γιαλί-δεν-σιάχτεται"
302,400,579 *1DE7AA23F019B62833CAD809251E2EE7A3D09932 ΦΥΣΙΟΔΙΦΙΚΩΝ
302,400,580 *1DE75A9946DBECD57F447F9B95E11A31CF3DACE6 БЕ́ЙТЕНЗО́РГ
302,400,581 *1DE4FD74B0F1F1DE4BABF23DA9DEFB9CF88AA285 c-t=!
302,400,582 *1DE398D09F81539EFD9A5584A92EA536BBCA8183 ЛИГАВЕЛ
302,400,583 *1DE2DA88D7A5AA75C308F0575AF229A7AADD269E ct)+z
302,400,584 *1DE8A1CAA2935306FC8F5992397E10BB34695545 CUA08
302,400,585 *1DE274DCF6FB4F7700DE4B2D58F026AB3CCD2D29 D!$3MPL0Y
302,400,586 *1DEA4F6C9FB5685ED2D3BE38AE7060C97CE9AC5F DANIELICED
302,400,587 *1DEFA4AE9512F18BB4CFBBF086D8FD0F258A322C DARK_BREAD.D/A/RK_BR/E/D
302,400,588 *1DE03FC7CCDA97C9F664384370DEC56074E60110 DARRON.UMPHENOUR
302,400,589 *1DED93B2C455D099E5A22AE968582B4CDAFA9B66 DASRORP2
302,400,590 *1DE02A889C25AEDF8EEA5A774FF6E4E516DBD60C DCTGH
302,400,591 *1DEBF76103D72E62C0FE2C531E3914B8599C77B3 DEGREMMIS
302,400,592 *1DE75CEE4D7B30CDDBC9B1C1BFBCDA88A1A6A43E DEMARISS8
302,400,593 *1DEE1C1BAE21C0BC46E6FDFF7ABA281F821F6661 demurera8
302,400,594 *1DE9BD0BD9B20160105CB3820926D6AC6A5882D2 DEMUSE
302,400,595 *1DEE0E8179B66188CBE95B0EF1E11130E36C9EAE deshawngoheen
302,400,596 *1DE92A256E9D0F20759498ED6B29F941A3D2C088 df4u
302,400,597 *1DE2A4BB2D9F2C8920BA05398D1827D5CE979563 discloser
302,400,598 *1DE5C3F04DA3639ADD4069210851D9756F6372F4 dkcee
302,400,599 *1DED91CFA051A67F3AC097BCFECEDA2576731000 dnjrl
302,400,600 *1DE2D1E724F3E6C4BFD0FEF0F96B7E317E141735 DNYSZ
302,400,601 *1DEBD60BC6CFA51E7C515B14E98351193A5F7FF3 DOHZP
302,400,602 *1DE39F41C133603A97D934A854F2D95B46CDD10A DOMINIC.KUSKO
302,400,603 *1DE6EB27C8F42828F272D48141D6662891E4A43C donteseltrecht
302,400,604 *1DEB806757A44C1125CF971A4EAEBEC86A887D4F DPAECSIL
302,400,605 *1DE0825DFD36B72B3AA59B890170F7A58E2C1854 DPERTUTURKAN
302,400,606 *1DEB9A1226E534B7D9DA9A1D19FF7D4E7276725B dpuserupdatedavidlawrence
302,400,607 *1DE936C65ACCBF70B7711B9DF95A9C15B82AE2D0 drusillathis
302,400,608 *1DEE1F1F9DBACE1E357E857CAF03D9A6534E2BB2 DS=I.
302,400,609 *1DED1BCB133DEAC71A4ED6425F4DA2183A48F3EF 17JAN1033
302,400,610 *1DE67A56BC81658DDC1E3F6899E395BB7300A0FD DT1)
302,400,611 *1DED0D8524C3EFED06C4D90EE1C9F5CF84134EEB DUGV/
302,400,612 *1DE713BEF348FBE1894980DDF0894438CA7F369D 19890203:texas89:veteran'smemorial,austin,tx,usa
302,400,613 *1DEF9A33EBF6206175C19F0E519D14380A4B548D DVAAJ
302,400,614 *1DE65BE69700AC9EDBE2F722F3968FB28EB36307 DXEJT
302,400,615 *1DEE3549CECF83407A5819E7D8A634CA649EF191 dysidroses
302,400,616 *1DE546DBB4734F46852BAA36D46B849C96544568 1DINNIES
302,400,617 *1DE5499BE0A21845DBC06BC565AB2D1C6A2CAE93 [email protected]
302,400,618 *1DE1FA7C83FC09A0239EF87E19BBF17DDB3F44AE eaxvk
302,400,619 *1DE04787A8A521D623BCDE87D73EC89A1A88447B EDGARDO.GARRARD
302,400,620 *1DE9B27BC2D08C10CFF32E8D37232A1496C3F411 1huipputy
302,400,621 *1DE9FFB3B57389B8E6CAA60009AF4A6C4A91F09A EDUARDO.CAMPUZANO
302,400,622 *1DE0EB5AB59CB3AFEAF6D0748A066AA03C18F9F2 1.KUZEYBATIDAKI
302,400,623 *1DEA86B3021D5BB5637775DAE6FC7C7D7789ADBA 1-liebhaber-treffen
302,400,624 *1DE2ECA1689D5AEAD259A347CBAEE23F5134C503 1-m-ktuominen
302,400,625 *1DEA9A3F9A06AB42BE25AB6F32D0113F89E3CAD7 1.osteuropa-markt
302,400,626 *1DE3203DEB9C19EBF0AFD8A0EC1CAA8F9453027D EEKUAWEP0
302,400,627 *1DEC9E02A1AF2CEA3B769D2832B4CA64ED98EDCC 1VAPAAEHTOISPALVELUNA
302,400,628 *1DEFFBA70A705A5BE61901EC6115FB5495E19CB0 1-VUOSIKIRJAHAN
302,400,629 *1DE884C5BBA2BA005332FF5D88451ED53A2EAB67 el3ctri(
302,400,630 *1DE37AF891155AB69F753FCEA6A990BFC1A96687 1.ZWEIMINUTENGRENZE
302,400,631 *1DEC2E6DA2B32DA1917B426258C2A2D5048F3CFF 2066454 puuttuvat kohdat voidaan merkit
302,400,632 *1DECA976BE745A4DD24B8C6349AFC889DCC973E5 20-slaavilainen
302,400,633 *1DE53D2ED7D40B22D65BE45F6FB0B14042A38503 21LAC
302,400,634 *1DE445F86C928B6FF17609D34AAA5B618E307B31 21-SELKIYTT
302,400,635 *1DEEF4887699694E2190E3232EA9D71DBB50D447 221926
302,400,636 *1DEFB1DC01050EE6AACD2021A22DEF4A5C32F068 ELIJAHKANIECKI
302,400,637 *1DEAC4A27A02285116426EFFCB9D3E3E81698652 ELINKELPOISUUTENSA
302,400,638 *1DE34B69776B85D81B20F733A9AE125D118CD98E 2450655 vuonna-2001-j
302,400,639 *1DE14BB4A3E7D844F7C4C850E6B2C3F965960A46 elkhalili
302,400,640 *1DE6F910B07E070250293B7AFF39CBA2B167723F ELLIOTTBERNHARD
302,400,641 *1DEBD77FE3AC3F32D6D87B5944A4D2CE62CA0160 264218 INTERNET-ICIN-OZEL-BIR-HAT-ALMANIZDA-YARAR-VARDIR-.
302,400,642 *1DEF4BBFD07FD99628D9560717422356153CDDFA 2807419 KAAVAAN.MERKITYN.KERROSALAN.LIS
302,400,643 *1DE1E4D239A347A548994279FA142A74A5F40753 281baron
302,400,644 *1DEB40A89036F01759F39AEB81C50885728A21B9 ELZANNEK
302,400,645 *1DEB7D9D0021F6EAC9C505DFC06AB83F968FD130 EMADEIRARIAM1
302,400,646 *1DE76A822BB348255B5C5A48EE541B856FF07F68 289825 tavoitteenaonentist
302,400,647 *1DEE54602303D6F5D8333EB330C9A0C789D1890D [email protected]
302,400,648 *1DE9F0083784ACDFECA7C9EE3DF33E00F48D20EC ENEGELREV8
302,400,649 *1DEE121FE86E3A3A3F7EC4780B354BF7171761AE 2ilovejimmy1
302,400,650 *1DE3F5550CE3FBE5FA65F1713D8BD699C63F8020 2-kylian'a
302,400,651 *1DE9CEB2BD17C3A58157B9EEA2B3E05C226D2D7F 2.man
302,400,652 *1DE68FEA7172D80C514FFD2401C079968D22088D 2.PARASOL
302,400,653 *1DEB38E1B6F08F84078816348BC4425C9538A2B3 2-RAISKAAJATYYPIN
302,400,654 *1DE12DEC6164A085C71E1F83D09482A20A0807F2 episoden-aus-lenau's-faust,-s-110-no-2:-der-n
302,400,655 *1DEE8F35CE67DECAB354DD1ECA1129065F0B982B 2.weapon-free
302,400,656 *1DEAF87C0D132DB9DFAECBD8EA46C34DFD149241 2.yhdistelm
302,400,657 *1DE11F899D7E5C885B12DBCE7366057FE8AF5B5F erik.tatum
302,400,658 *1DEFF9313639CA31471BB94662B1239D4BD17805 ERPELDINGA
302,400,659 *1DE89B92FDB5765E55792DD92B263F4AE54C5369 ery.s
302,400,660 *1DE3D6AFAF63197E2398DF67106A26E1BFE15A20 3B.~.~.~.}O{
302,400,661 *1DEF27AFC0E48E062C79792088B861CE3B3E4376 3-----B~`)X(
302,400,662 *1DE03061EA180CCB843C298AE43B6034E20B1DB2 3KOKUOUCH
302,400,663 *1DEAE6F0302D19C6CFF8DB33AFD3F44184E5E032 3-M
302,400,664 *1DE695D1CAE5735FFC7D3E94043B3AA2825F0733 3MENZOGNERO
302,400,665 *1DE98F29ECA47950FDDCA13EBD208F40AC9C26A7 3MYRTLENE
302,400,666 *1DEED7E4F99C0D788FC3FE8738534AFE3D0045AB etelmpn1
302,400,667 *1DE4981013677D53BD856EBE7B64006CAE33B491 3=)**SPLAT
302,400,668 *1DEAF4EEC7B713EC8C3A593CC6F567DC9E15B39E 3-viljelyarvo
302,400,669 *1DE787E066DCD3E95258E1DA84DB0E4F24E3751A 3-WINTERSTIEFELN
302,400,670 *1DE2D682F5CD286D1FDE268A64D74DCB4E9BBF5B 3X7312N4119
302,400,671 *1DE8EBF99E52424735DF552B5B6725912D3B4E10 42270
302,400,672 *1DE63A17FE64A5F4CBA6099B780EAA79867D1185 eurowingslh
302,400,673 *1DE4BDBEBB10D6B03B8767BADAA544F52E74E971 EWDQ
302,400,674 *1DE571C0120E1D46E910C9B38699EA88397ED1A3 EYZl
302,400,675 *1DEF924C32F542324C117C543D7D6775A8FD60AB 4LVCDTNKXVAN
302,400,676 *1DEFF56021CD354FC16AEBEEFACBDE1DA6138968 4MARQUERIONSES
302,400,677 *1DE24D680D82B22F6E9C2CA977B88DC9932AE056 F4UICCBFLEN7KKWIXHM
302,400,678 *1DE51EC4AF88FFB70E654C2CAA4C99164E35E3B5 4NAEMELOTP
302,400,679 *1DE2B2A5A11513E63C47A7A2C8D361AA145D5696 4-SOZIALPARTEIEN
302,400,680 *1DE1DC3B29A79743EBA59426C3064053AE29D6C7 4TOGHERS
302,400,681 *1DE10C1618195BEA1E9462225110A644082CBB76 4TORONTOBOOBOO
302,400,682 *1DE228721D39F84B58341D48FD34EE2BD6DED7F6 faustinogaretson
302,400,683 *1DEC804D9B361EC80E7369B390EC1275F5206E55 FAYYADD
302,400,684 *1DE23B11F109B37014D29D6EC705791C5835F9AF FEANKOLOANJES
302,400,685 *1DE1C8D13F9C2ECCD6D4C9B37B83F9F85EC5A94F fermingimble
302,400,686 *1DE23FC3EA54335DA63A56D06032FA89D8EA3CA1 ferreticeman
302,400,687 *1DE99F0BE73A18BA87031412853E9D77202E2B52 fierontsing
302,400,688 *1DE58494CCC3554F7FE6EFDAEFD884C135DC7DFC FLORENTINO.STINTON
302,400,689 *1DE6AD66B26396D4217DE1686EDA69EE42A763C9 FLORRICK
302,400,690 *1DEEECA07C2AE63D1565F7434D29BB2B4DD47FB4 [email protected]
302,400,691 *1DE37F165A85798C335E68E22B765C9D0960F620 FRANCESCOKURKJIAN
302,400,692 *1DE4D4B7445CB247931869A27177C94DE0C99C62 frankiebond
302,400,693 *1DE9196AD59120926E3AAB17191938275AF37C34 franklynsarinana
302,400,694 *1DE12976D1ACE03CD6952BA53A9E7451B3FCCE13 5HANMERS
302,400,695 *1DEFF009233777AA1C5C0CC17DE83640AB02A250 5HEALTHBADBOY
302,400,696 *1DEF3EF7D1E377BBED6857E32F0D3CCC43BEBD63 5LAMERIEZ
302,400,697 *1DEE9474834A858A1334696FDB1E17C7057A2B5F 5MARTINABCD
302,400,698 *1DE12239A8FB4C3B30B3FAD1D07B35A8139551EC 5NKISPATSAST
302,400,699 *1DED0D3E54E400C79224CC8CF0B786CC74045920 5NONSUBJECTIVEA
302,400,700 *1DEF96C65D364697ACE6B3111C06566BFAED4078 FSOLMainsInteruppt
302,400,701 *1DE701FD9125E3ADD0321D611BCF308D84CF7BE2 5RAINVIOLET
302,400,702 *1DE55CD51E9DF5B95BBA6AD03DB5601E1F021C15 [email protected]
302,400,703 *1DEC5B97D2B5D266F80924078EB227AC3A8FF989 5SVIKTER
302,400,704 *1DE9E3A48377EC69A4E2B3034FDDF875C5E14B8E FULSOMESTED
302,400,705 *1DE33816B6787B5F54CB58BF22332820DAA77819 fusique(subfusion)
302,400,706 *1DE079446F8E57EAFA32924F869F20D80DACE69B 5UPSARAS
302,400,707 *1DE82F636A455B895BC759A6CF33FE8C51309AFA GAILTAFURI
302,400,708 *1DEC10FD1A6618DEFB647E9C24BDBD0DED00017D GAIL TAIT
302,400,709 *1DEB19671B5E22499C42DA696A50E6A4EFE21E74 GALENCARDIEL
302,400,710 *1DE8253EDCBA9C0AE3D55E81FBEF75391EC96695 5WIEDERINSTANDSETZBAR
302,400,711 *1DE4EE9602DF34680A8CEE930B9B3C9BDA385E3B 5ZURCKGEKEHRTEM
302,400,712 *1DEF2177546C4E447A69D51D7822B4948E7F16ED ganttia
302,400,713 *1DE4762675A674C3A1D582AA87F88A981ABB2267 GARCIA.DE.HURTADO.Y.MENDOZA
302,400,714 *1DE91A426819AE2EBC188A4D7E24CF45DD9620D4 653COLTEN
302,400,715 *1DE9A29E75581AFCD85F0D4BF5063F5716E1CA72 6ACTIVECLAUDIA
302,400,716 *1DEDED02F316A8BA3BA48C2E19457DBF65EED317 6BRILLENGLAESERN
302,400,717 *1DE1640A654D6686DC761711928635CCBCAF1A85 GEOFFWILMORE
302,400,718 *1DEC55DBD760BF3EA6D85B7F81D7277A601FE08A 6 DERVISLERIN
302,400,719 *1DE9F968CDAEF9DA415A4750376DF2C12E4FF121 GETUP(RADIOEDIT)
302,400,720 *1DE2A2BAB1D85E9438FDE840763B8202E26FBB97 [email protected]
302,400,721 *1DE0670B186211AAE4A2162E02EDB9162EA2C0D7 6LOUISEHAPPYDAY
302,400,722 *1DEABA8CCE0D36AB48EC78035316469D78A8E129 6MEDCROSS
302,400,723 *1DEA3C5CEE88BD9CA3839C213B4C051026954FE5 6MICRODOLBSW
302,400,724 *1DEA364990C835072B9B8F6D30F35994F5798CF3 6PANTABLE
302,400,725 *1DEEEC6ED92B77DE8A2FC9B6D58EF7EE686B4C23 6PASILES
302,400,726 *1DEE5718DDBAD0245E4FB9F55CD471E01CAB3B51 GNIRNOCED
302,400,727 *1DE70209386BFCB715B1FC5A70A36B6064BCCF4B GOH-LM
302,400,728 *1DEF8D57A2951F222A73285DC25795A90FDE2A24 6TENSYLLABLED
302,400,729 *1DE20162A942EBBA99D931041363E58409AF05C4 gracebain
302,400,730 *1DE0A0D7888F0EAA352B8EC175F64D14E8597498 718573 ISI-VE-IKLIM-DEGISIKLIKLERINDE-BOYUTLARINI-KORUR-.
302,400,731 *1DEA36E7F85AA6F4730656750C895AC58B277FE9 725639 VALMISTUSOSASTO.MUODOSTUU.FMS-J
302,400,732 *1DE18E76F45422059A299AE80EDB158DAF202218 7BALLSGOAT
302,400,733 *1DE42E070166F01D62708179C74916C10620CECB 7BSWCOPROCESS
302,400,734 *1DE4716597AE06A34931687445C708D50A990DE2 7BSWKAZUOBSW
302,400,735 *1DEEDAC51ED5E1FA46ECA46CC12A97FA47BEC8D7 7DIVENTAREBSW
302,400,736 *1DE889BD6690814786415CF90298080F8E3C3A4D 7ENIGMACANNONDA
302,400,737 *1DE4BB0088FCB53588F5E7193E3014D8BA83E1A5 7ffa6260eb2e9a021acf4906c3db724drr30rr
302,400,738 *1DE2666EC380A617B5FABFB7E6BE3179F43B5FB0 gusdiiorio
302,400,739 *1DED898503604D81768998F697FA2503288BB8A2 7GIULIAAN
302,400,740 *1DE398762BE377447C49985CD7790D6C239CE27B GUZMANSOLIS
302,400,741 *1DEB28AE258A5502D2710F7F1FE8E48890C8C44A 7ILOVELIZZY5
302,400,742 *1DE9A947B9E916759F878DFD9160869BBB947E41 <H2><ANAME="HDR81324">81CONTROLPERMiSSiONS</A></H2>
302,400,743 *1DE71F3C9D6E6256DEE7BEDF9C6A00917D4A1B5F 7MCGEADY
302,400,744 *1DEB9E3CE2B1B6C9A1D4B376C20CBCD881B79415 HALPENYED
302,400,745 *1DE8EB72425DA9376BC9FB94AA4477AEFD676722 [email protected]
302,400,746 *1DE6F6182D67DB262FCEB08CAC140381D0D873E8 7OIPOKSIL
302,400,747 *1DE990C1CF3C897FDAAEBC07F578215F841B186B 7ORDERHOUSE
302,400,748 *1DE893B0B3F3C2EFA610DBF58F9A09BDC0DD6295 HANK.DELAWYER
302,400,749 *1DEEFFB1311802C797C785D579A230BE9CA3550F [email protected]
302,400,750 *1DE35FEB6D8A9111DF77F3D54AA62AA1CE4F0728 7QUERCETANUS
302,400,751 *1DEAAE8BBAC8442C9D47757CF1F4FECE47CA65DC 7RI4GE$
302,400,752 *1DE2D505932710D9BF993C2C9C3D7763C7B7348C HAROLD-TUCKNESS
302,400,753 *1DEBD5588B18F8F5242AE6F077495C6B99124CC6 HARRISONMARINES
302,400,754 *1DE4370346367811E8A956A113603A9A2FF25D81 7STATESERAHOTMAILCOM
302,400,755 *1DEB016C0E3E5B258F073F707133B011F5AD106C 7THEELEPHANT8
302,400,756 *1DEA2465E66579B76310A26FF2DEEBAE4A9F6780 8#@ ~ (00)
302,400,757 *1DEE0C0B22B1720056293E1B853358DE6055D493 hdn?
302,400,758 *1DE1329F239E7DD31225C85FF11C0B05DCAFD1FE [email protected]
302,400,759 *1DEDA73B08C2A4971D27D286A9A51AC99F4FA7C3 887AHMAD
302,400,760 *1DEE19F6577402381036097CB81D141957EC4AA5 herbfalker
302,400,761 *1DE98F198E16D41DF2CBB8CE80AACC2DB3B1ECA5 HERRINGS
302,400,762 *1DEE075EEDB69A5C45829D6CACC54BFC0A026C40 HINKELMANN-SCHUCHMANN
302,400,763 *1DE38CD22888D79B5540B0CA8248B293BD7407C8 HLEDERNE7
302,400,764 *1DE4023D454971844AAD88BFB35E803243B042E8 8NANJIBSW
302,400,765 *1DEC511DF1F9A3DCE7F0049CCD4C250B5425EB59 8ORACHEORACHE
302,400,766 *1DECD797715F900EE288E63C0004333C50074D8D hollow.hans.requiem
302,400,767 *1DED65874BF74CF80DC7F69E90176F038B11C867 [email protected]
302,400,768 *1DE855070181118CFCF7BF812E11BBB6CC71DEF5 hostemost
302,400,769 *1DEF7F90BF3FB89F9F479E4D88E2FD9C8EE74664 911fozzie
302,400,770 *1DE5F9E638D2FC5651AF8C387E33998A0107A238 99601Q2W3
302,400,771 *1DEC76375D0725A7C2B75613922BDDEDB343B863 9BROOKENAOMI
302,400,772 *1DE0071CB00517E61B045043234C1881B1EEC193 HUMBERTOBALOGUN
302,400,773 *1DEDD2371703A3158CB7029512DAD813071E9452 9DELUMINIZING
302,400,774 *1DED0CA45F820D3EB28ADCA0311E8C91B4657FA7 9ECALPEMOH
302,400,775 *1DEB7FF940FB2A263D7426876BB3AB93CA4825F9 9EPOISTEPOIST
302,400,776 *1DEFA282EE0585DEC896AEAC7C132B90DC794F49 hyperdash
302,400,777 *1DE54F787CB8B473C52E7BB0D69943AA42EC37A1 9iamsonics4
302,400,778 *1DEBBC193CC2E1100E12AFCB511F6F15412F6479 9KEELAGHAN
302,400,779 *1DE2C37445C8697DF317065E927DFE54CC564E50 9MAGICGROVER
302,400,780 *1DE8FE329FE43068A6036D5399E5D322AFCA459E 9MEANINGAIRALLEGORYALLUSIONARCANE
302,400,781 *1DE610B63A404B0505AAA1F338A42AB1E16D03E7 9MSEGREVO
302,400,782 *1DE456507222C6F1BFD4D2E3FE7D7C883474CB1E [email protected]
302,400,783 *1DE1A196C5414455E286F5E551BE6E1D747351A8 IENNOX
302,400,784 *1DE4BCA3079AAE378E2EE422A595D80E3BD99757 9NELUFAR
302,400,785 *1DE04CA13BF1BEB73E2BDA1323898FB752CFBDA0 9NEUTRINO6
302,400,786 *1DE500BF985B73F5F6D4BFBB3B139467C47E3D78 9OMBRAGES
302,400,787 *1DE5D4D7822BCF21D0C4B74813C4C8466143025D II-STYLE
302,400,788 *1DE426CCC4DCBE2938C887047EBABD2984C48828 A$:
302,400,789 *1DED5C51320ABA2B575E6A794E1547D4BE961DA6 a"7t
302,400,790 *1DEA6511454229FB96DCC47A8678D53BA667B48E INIGITUQ
302,400,791 *1DE585A0D34BEEAE429D743CDBE2ADC4E2A944D0 aaau2g
302,400,792 *1DECA7EFA68D58C91D964B2E20FB02B7B5AE6F0C aadxh,
302,400,793 *1DEA77EECF504FB65FC6F8C8A5A91707A3F27FE7 irvingliston
302,400,794 *1DEF52CEC953B2999DB9D2B695D04072F012DE7E aak6w
302,400,795 *1DEFFFF166D61D1E6B08E18BBDEC65382A451672 aanhadde9
302,400,796 *1DEFD9217B50981ED6BEDA90AC5F266A528D25E2 aawq
302,400,797 *1DE0E5EF66074BDF95F933FB57BEAC4655A19CC5 ABDUL.SELMON
302,400,798 *1DEFA6147646A1260B6F5D576D5F0D71390D19F0 IT3N
302,400,799 *1DE23C4A66E0B9040B12B553E5EE2DE0C54253FB ITSERY
302,400,800 *1DE157BC03BB8F743DABF010D55BC7952E2138C9 ABLCI
302,400,801 *1DED3040024CCF2AF5FEA5411AE3CB509B200A1D }J
302,400,802 *1DE8FA006D488D8BCDC0D8F24C86A0888FF939BB jamarleinhart
302,400,803 *1DE0BED5780E432ECB3222CEE52510C7DBCF5D89 JAN-BROPHY
302,400,804 *1DEE5DBED571DB9A39BEAEFB9B3B1DDC04D1D528 JANEHOEFT
302,400,805 *1DE7EEFE997E10F2732F34FD1F04C3FF8DF938D4 JAVATAR9
302,400,806 *1DE6DE85FF3101EA6F546D8AABFAE48F8E63EDF2 achendeath
302,400,807 *1DEA5A4A1D154CC4C309CE8EDCA6FAFEEAB6AA8C JCHUUS
302,400,808 *1DED28935D7536194EA1A9DA81496C74C82785BE JED.FICKES
302,400,809 *1DE8816AAA4DB66E459F47B3B6CDBB20FF66DC95 JED.MUCCIA
302,400,810 *1DED3C465FFF1FD2985D6C93D052610276B9CE1E ADALBERTO.CONRATH
302,400,811 *1DEA734253D8613379F5F360005389AACE2C1ED7 ADAM C.
302,400,812 *1DE0CFA3249D77CE487846E6984EA53857EBDFC0 adath
302,400,813 *1DEFA00517B91D5932AFBF73D43D6B220E6820B1 adp.j
302,400,814 *1DE89E5B9CC6B93E9FB8B19D3CBF88F1DA5F7AC0 AEKDH
302,400,815 *1DEBAFBE900E2B96D7F485AFE9D71A0F00253A8A [email protected]
302,400,816 *1DEDD8D3BAF8BB9D7F027C70AB6681107C4390DB JJARHEL
302,400,817 *1DEA0B6DADEF76A53713A2A3FB01FA321F5683D0 agiph
302,400,818 *1DED629A88E4C2DDEB063C75ED0A07F6675CBFB6 JOAQUIN.SWINERTON
302,400,819 *1DE36900234BB581409F32743C8543325C9C8146 JOESPHSOBERANIS
302,400,820 *1DE2FECE0A243DD3D682EE903BAFB0849DC2DACF JOSEPH.STRITTMATER
302,400,821 *1DE2A137CEC61D00FF7F28A10CF261524E81B071 AHV46
302,400,822 *1DE89F8941687D680DBF0D772BCC865E73CEE774 [email protected]
302,400,823 *1DE1DE2CCAA91E9966F1B6094F1E2D73FB8B68D3 [email protected]
302,400,824 *1DEE1FD867EDF5709C5C89F3198BA88FA2B3BA6B AKG48
302,400,825 *1DE4B0ACF11C1FC46643F776DD0DCE67C74B2666 akkerkool1
302,400,826 *1DE4BE20B9BD325F85F10F7B71D61C5D61DA8043 kayla.zeno
302,400,827 *1DECC3C22C92002BBDA6A42E8B169097F54FCEC7 KBAVENAFATUA
302,400,828 *1DE5491486D5F88F56055E7E33888FD05767BC6B kbhpman29
302,400,829 *1DEB1A7283D4C88D94BAEC09D3FD0456C029950D ALBERT’
302,400,830 *1DE061B804B37183C035B7EB57EF3B02CDCED8D7 kellysauder
302,400,831 *1DE7B5415F3003387B5087AC26F411991E42A697 kenethgammage
302,400,832 *1DE3E2CA94EE03A915BCBDA1F2A8021AE7316642 ALEXANDERSCHARWATH
302,400,833 *1DEA50B836C99EF962BC2D120DAABE40439ADC49 kenoazañ
302,400,834 *1DED64FB595061758A6D7D55214327C8D966B073 KHAKIMÖKISSÄ
302,400,835 *1DE6E69333BCD6642171D185F958156D5B78F285 ALKILICHOWSKI
302,400,836 *1DE66EFD41A8C93B9F8907972EA14C793BFDCE3F KIMPPUUN2
302,400,837 *1DEB2E456924D74FFE26D816C2EA79F16A6E8292 kohlandkelly
302,400,838 *1DE329659AE235F93F9BF98884925D5C836BC5D9 AMADO.NEESE
302,400,839 *1DE33BE6D76C77D381189DA2595F6769B917A5B7 ame1ioration$
302,400,840 *1DEA6B9CB8D3A7E2E8DFB1CD54902D60BA61246E kshn
302,400,841 *1DE71E8322202AAC970E9A6D1AFA9E43F2C0DFF1 KZPZ
302,400,842 *1DEDD55B2CD70210FAD65E415A67CAC49D4764B8 lady807
302,400,843 *1DEFBC1C969187AB7A35C14DE3E53716451E626F ANDREASDICOLA
302,400,844 *1DE2157848153059352B8001766C2E92F7422839 lannylav
302,400,845 *1DE3ADD1947E1D0EE21457A4AC72B2CCE4EDAF30 LATENIGHTS1
302,400,846 *1DE3D5A5DE6747BABF1B22D8728EBBC2A8AB2AB8 lawerencedecuir
302,400,847 *1DE8F6D927F7C48E5EE0C683418674480E8605B8 ANDT
302,400,848 *1DED0EB1B1041670A78AAAF1AF6719BF09A9EAB9 [email protected]
302,400,849 *1DE1A25D5D7FCBE967240E96A2E3FEA260B0FC52 LENARDMUNNS
302,400,850 *1DEB63816ABF9C6B7026E2D1CEC86F4AC398DB5D LEONARDOGRIEBLING
302,400,851 *1DED6667FED090CC825C17F750147AF78A03784F ANTARSIASING
302,400,852 *1DEC7F06FDA44C786B9490B972B7FAE9C769F006 leosheerin
302,400,853 *1DE38AFB34018C90ABCCE0F6C6B25D46C3F470B8 leparcdusouvenir
302,400,854 *1DEBF105C26D22C1FDF7B03E95CE829767AEC763 LET'SDANCE(REMIX)(FEATBBJAYANDDAVEHOLLISTER)
302,400,855 *1DEB8211BED7A7DF0812F38DC4E6880D4A3A9D4F LEVI.KIRTLEY
302,400,856 *1DE63807E7BA30A004344580EED5E515B440A800 ANTWAN.ZICAFOOSE
302,400,857 *1DEAE610F147F81061F58C6C157746ACE7AFCADB libby-chambers
302,400,858 *1DEF1BE814EB3F7EC7182D5B7CF92E0BBDE16528 LIONEL.ORDAS
302,400,859 *1DE6821D2B25B0B0A471AFDE18F411BCDB6D704D [email protected]
302,400,860 *1DE2E9C2D6715A23BAD1720EEAA3D80E59E39265 LIS#
302,400,861 *1DEA85C81D71AB688AC42A930F2D695257A7566D [email protected]
302,400,862 *1DE0734FC0EDB3EEDFD83D7CEA06E3142B94CE1E ApXQ
302,400,863 *1DE3A9334C67F29229C9EB9CE2FBA623AE926D4E a&qgs
302,400,864 *1DE4422A55744C7E5D89A04A20FE5274C934F377 LONG.SCHOFIELD
302,400,865 *1DE906EAA2DFE6E6A3BB0166E3F040210A8EA04D lorenancell
302,400,866 *1DEFE76C378726879E5EF099548E937A0CEB91ED lori.mcallister
302,400,867 *1DEA8E421D5CCAEAD2CCDA8F6CE546035AE37E15 {LSO
302,400,868 *1DEAA3F38EAECA89A8EF8BD7A371E917B332A38B [email protected]
302,400,869 *1DED6D85B68A8859C570D69F4FF25B42C26DA1D9 arzsx
302,400,870 *1DED980C1262F72636CECECB49140D51F8A8E4D4 ash,
302,400,871 *1DE970209C50BA15864828244E5702E45688B92E ATAYALICS
302,400,872 *1DEA0F02920537B32DE9AC43682B7CC898581D52 aussie
302,400,873 *1DECF36527914DCA92E8106A7E04B3A79B901E7C azsxdcfvgbhnjmklzxcv
302,400,874 *1DEF59912F50DAC61413DB1520097357649432C3 b> ~0><
302,400,875 *1DEF5D0D6FA4216111828F941B27B988BE531D58 MARGARITO.HOPKE
302,400,876 *1DE19B072FF8CA1B688CA045BFB009C0321FEC13 b5&xu
302,400,877 *1DEEA6A1B3D499C24595BD96C673B2F9FB85DAED MARIANO.GERE
302,400,878 *1DEF1A6D62960A42E0EA186713A2D74BE76D32D4 MARIE-QUI-TE-MARIES--(DEMO-VERSION)
302,400,879 *1DE8A615C84F8E1C9DA7A21C5E615F5D5FDB2F8D marina4
302,400,880 *1DE1FE8AAFBF61B5CD9CBC3CC8D085AEF72D4D82 markgamber
302,400,881 *1DE8DBFA4E5C2773FBBE489C71EB6FED0FFEDD1C barnesappleman
302,400,882 *1DEF5E07BA3F5EDCAAA67582381EC0A82EA4382A BASTV
302,400,883 *1DEFA371F1AC1F1E6A1AE6D14B3486B87602DC91 BB~^
302,400,884 *1DEBC2088A5542EAD1AA5ADA3A0BF8F9EF05D704 [email protected]
302,400,885 *1DEB31223C10A83061932E8D30C809045E0C43F5 MCCANN-NAME-MEANING
302,400,886 *1DE3E952AE8E83A5FDD01E4362EE490B75039F09 me74li$7$
302,400,887 *1DE2A5A23027F473DD5D69378D3458C7F0B34B0D MEILIENE
302,400,888 *1DE1E6B2C148D6D5DEAE4FFEA7734668E86C6ADF merge-wafulz
302,400,889 *1DE81F1C4B8CDA06AC70D7BA446B84A19154B636 MERVINBOWIE
302,400,890 *1DE5B1F004602766E00858C8AECFD4F3FFB915F5 MERVINMITSCHKE
302,400,891 *1DE1A4F0D352FF2B58B605B266BFF934798ABEB7 messier
302,400,892 *1DEF4D2542C310422B1428363B990340D6C88403 michele.kirk
302,400,893 *1DE941FFD5B4903EBB22664A022DCB404BE2CA2B MICKEY.MCDOUGAL
302,400,894 *1DE951C4C0E57DCDD9063475578C6CF83A7D5A9D [email protected]
302,400,895 *1DE949C0E34568CD766C634959B639F001505F33 midrarullah
302,400,896 *1DE3C471F12D2E8131A35FD4D228517CFCFF8607 MILAPERALTA
302,400,897 *1DE65124D0AC5245D46E9E971D8FCBC0CD9373DE mitchelquinoes
302,400,898 *1DE92437028534696B6AC8AE5DEF36F9167B5FCD mladen-ristovski
302,400,899 *1DEF3B2FC113043A39F676A2C876772A6B93C38C BLAINEBRASHEARS
302,400,900 *1DE339C7266676779EFA3F07691A6D4428FFA46B MMZKJZMIYC
302,400,901 *1DE9A37BF93894148CD3F537230BCAB5626B95D7 MODELINGRUMOR
302,400,902 *1DE4B1106F3F6E2BA10BBBDECCBFA58C41C46573 moe and-more.-of-frequent-occurrence
302,400,903 *1DE1C812E121B13C581F1C2AE140F8A5CBE1852B b"lgt
302,400,904 *1DE5EEDB11662BCFBEDB16BD5764228070851545 [email protected]
302,400,905 *1DE3CF68CD3E5E857B32507A9D1C5F6ED05A8017 bne+l
302,400,906 *1DEE6EC51270A2E154B27C91A8D4245B67541A09 BOGENSEE8
302,400,907 *1DEAE1397EC2E1C12C71A1AF28F632472084F1DC multisquillionsell
302,400,908 *1DE97D9E6E655E60D69A1CF8E6F0D28E64FB9898 MUSIC.FOR.LIKE.INSTRUMENTS:.THE.CLARINETS
302,400,909 *1DE338FBE15742B5D4502350D959261225ED31CF brantdiruzzo
302,400,910 *1DEF28047B4DA8C24708DDC2DA68C70A8DE626AF N.2[
302,400,911 *1DEAEB9CAB82776AF2074FA244A96D434026A9AC [email protected]
302,400,912 *1DE4425BD6B83BE1DE45047321C4C0D0D262D87C n"7o
302,400,913 *1DE4EA18A1B4F2DEEF986B499CBF3923DC075B2F BRGQV
302,400,914 *1DE7EE0CD1E567FAE7E35E35ECFACAADD7A56D3C brittanie8
302,400,915 *1DE0EDA4151748414410F0C7E625F69046F217A7 BRUCE.DAHILL
302,400,916 *1DE8C9A8A8235F9E2A7A240F4A31C7D0BFB1D354 NBH{
302,400,917 *1DEFFBF9591FD184E1177AE5DE5FE4AFDE1748AF bswhildickbsw
302,400,918 *1DE9C3616C165C50A5175B278AED07E336E5E8EA bswyesornobsw
302,400,919 *1DE30164F78E3CB9910D13E3B4AA330E7AE0B5C7 buckbean.family
302,400,920 *1DE7F53790EDCFC3F23FE669D68D6C8CEB6FDE9A netnemurtsnisteot
302,400,921 *1DE1A89AD2A99D699A17F2C5573A61601D6A8105 NEVILLE.MONGOMERY
302,400,922 *1DE86532D957F02AFCC27BFFCC427E29AB2FE176 buhsajra3
302,400,923 *1DE8380EB20BE772FABD1ED9B0ACD64F3C39E76A bulking
302,400,924 *1DE3FA2FA2E00B3EBA91BB5B0FCB1CEC0DFEC214 b&up
302,400,925 *1DE60ED53D8D30E870AC37F011B4C22ABB2BD3F0 BURTVEAZEY
302,400,926 *1DE1E1C2F910CBFCA185B9752A6404F14952AC74 butorde8
302,400,927 *1DE4C161769C232C500A34B54AE94DBC98D75557 BW;OC
302,400,928 *1DE027DB265C61DBD0A0623871CD6F8572884F6E BZFVG
302,400,929 *1DE366327B6B42F64D65336E1FFCD64B95637D90 [email protected]
302,400,930 *1DE8B24549BCDA9445451C8FC0C335C881ECA6DF c1jal
302,400,931 *1DEF47794D914F227CF57D9C7682A74A2900200C C4)UN
302,400,932 *1DE4371E283F1B6B4E8C174E3B81D8DE7D24ABD6 C;9f
302,400,933 *1DE34079A8754CDE3627B76C57DD1F18F309740B ntysj
302,400,934 *1DEAB0EFED108BAAA1B808FB15A3F71194CC6D03 carlgassett
302,400,935 *1DEFCE31A46D8FA59B2DD05424C00512A8FF5D59 OCTAVIOAUGELLO
302,400,936 *1DE4E48022C18838597A1FE02B7809D90568E76B }O{ * * D======B
302,400,937 *1DE768C604CD2135413DAD3FC37E9B4A5CB2A8F9 official.terrorism
302,400,938 *1DE540D95B8CA1070B52383DAB4D1B7DD8AFD8C9 oldsurehandmelodie
302,400,939 *1DEE4393365D10BB75AF706BC1441B766BA27091 [email protected]
302,400,940 *1DE418F16414F673FC4C3EBBF11924A5331AD11E omerlin1
302,400,941 *1DEF99CDF9D8C390E18836961FEF2ED103620749 OS7R4C1Z1N9
302,400,942 *1DE1CC8CBF3DC1AE70131F34679873E5C0F93695 OSVALDOMCCORMIC
302,400,943 *1DED7544B5B3F653FE6414A2D00F21D903704D9B OTAZZIRI
302,400,944 *1DEB2E86B3FA028AC07E0CF8583A14483AE92375 PAALOW
302,400,945 *1DE337F2EECC7B3E5982EFE07B52DF257D61FF5E [email protected]
302,400,946 *1DE5A8B5BEC597FFF8D9E2DBF626F3F8F65691FF PAM-BRICKER
302,400,947 *1DE0B5775641406A48364E1551325F1A2E305C13 Panis-Angelicus-(Palestrina)
302,400,948 *1DE740DBCBF86FC11E00D316B0709FFB9D23A741 CHINGY_GURL_06
302,400,949 *1DEA002942250726D44F1166C24A932FD7F74914 CHIZILOV
302,400,950 *1DE4E80C3F29173BE01554620C1D1FDBA4C095BC CHO-G
302,400,951 *1DE9BD3B2AEF9255F39057F4C036D38E24447C5A PAULTONELLI
302,400,952 *1DE8FD8573965C244E10DFE74CDB3A572E24DE73 CI)DW
302,400,953 *1DE2B00610CB2F46EFD59061BAC2824BDD1764B1 pernilleklitgaard
302,400,954 *1DE1AFF04DE8146AEBF3C90992BED09D97C421D1 cj06
302,400,955 *1DE9A6EEBD98443CCDE3885A1E41D3010EDEB19E philipseecharan
302,400,956 *1DEF00D199BD06175C4B8775FA96717152CFF5FC physedphysed
302,400,957 *1DEF321A663384C4E71420B64AAF27EBA32A509E pimp101
302,400,958 *1DEE069405E07FC5481B0AF0882963DC5B52C917 PONIZNOJS
302,400,959 *1DE7D87AC32F55FC9AB0118FB82EB2CA32A51802 [email protected]
302,400,960 *1DE3647757266D6A2D7067F7753504F83860A2AC p---) ~o~o (0-0)
302,400,961 *1DE9B55BD4ABCA6DF5A651FFAF769264F2F90DE3 [email protected]
302,400,962 *1DE5D4097B1043A1163E144EDD22BF4EA6EC566C POPISKOVÉ
302,400,963 *1DEEFAA2BB251E562C14DBCB5C96E5E8885FF6C7 PORSCHE9TERRY
302,400,964 *1DE9FB4B5AC2C748FB3ACE35277D81A83E957E20 COLTON.CINAR
302,400,965 *1DEAA20D91A24F5011BECF76752A696412DFA7DD COLUMBUSTHEOPHILUS
302,400,966 *1DE31AB240F6B17189E466009130B15B1DEE71FE p-p ~0 ~o>-b0
302,400,967 *1DE9EF8253A466F9D4819BC1857F3469B8172848 CORRUMPIRUNG
302,400,968 *1DEB241D5032092A60D051557502B432C48E91DA cortezroadarmel
302,400,969 *1DEBE215566A1357BCA09369309C7CD8378F18F7 COUDOUBT
302,400,970 *1DEE767FEA8FC040B278AD3444E2C1F04EE62449 COVICE
302,400,971 *1DE84D9F2B1330BBCB6DCBA1AF48E4FAD622E812 PreludeinD-flatmajor,Op57No1
302,400,972 *1DEA8D8C57BA562C45654708831CC4D7EE9C164D PRINSELIJKE
302,400,973 *1DEBA20409481D04A6F349732A59718936994970 prodigalit
302,400,974 *1DE306E8E1EA88FB2DE0A4F37877E476EAFE52D7 CRAWLSHOTS
302,400,975 *1DECEC9E2B6B730C99552FF7B248AA28105AC9F9 c+re6
302,400,976 *1DE98461B15FF42FD107029FC3812807B7ED2008 CTH5:
302,400,977 *1DE0E0227BCCF924A53762087B560C94DF7E8382 q-----) ~o (>_0)
302,400,978 *1DEAD5A9E21EFD63E8144814C723D6D20790831E quincynordsiek
302,400,979 *1DEFC6EC634AB22CCC49CCCC030DD48BF2F5215B QUINN.RHYNES
302,400,980 *1DE4F1344BAACA8167E4A8E7925F579C6F9B6CDE cx0"
302,400,981 *1DE1C1C8692E060670FC5D749B9D459E84505CC2 r.<:
302,400,982 *1DE934A01126FF50496F1662E0FFFDFEB4528158 C"ZV
302,400,983 *1DEA763DB936BFA93E5D3B5FADC1583739F29C57 RAINDOP13
302,400,984 *1DE4A59CABC9DDB0F93049DB106CAE2B54217639 D0DED
302,400,985 *1DEEF5C1CB7A9A616C2F7640B4E4BD808E4FE7D0 d13d#
302,400,986 *1DEC5BA75AC523185CFC0BAC34B05BE8A7D0EFCC randaleblen
302,400,987 *1DEB48BFA05FE5EA280A8B0CBF5E4858EE672020 d$_3
302,400,988 *1DEFED09C653023633EA39842CCABF4AC62EB6B8 ravikanth.raju
302,400,989 *1DE0AE512122165E16F36B70A4088CD5ED0D9CFB RAZLAMAHING
302,400,990 *1DE210DF76E7D5962B262450496698870CDFF518 realmd00d
302,400,991 *1DEE91E232271041D2881848580135CF4EF3AFFA REARWARDLIES7
302,400,992 *1DE6A7868DD33613957DA74CE96454C1ECD4B53C DANE.ARMENTEROS
302,400,993 *1DE5CBEF3B6790774C31FF8A45225DBC13DD21DD DANIEL.WONNACOTT
302,400,994 *1DEEDCB1BE198791A3AA938678430F2012677568 REDAVESAELP
302,400,995 *1DED119626E1966B203DB1BF4E2C9F0DBE57B7BA DANNIE.LABARRIERE
302,400,996 *1DE9FF2ADC04679D7148D95CE44BC6EA6454BCE3 referenceslavicek
302,400,997 *1DEC7E30A2DDCFA6D935DAB987FFD5790590022C DARIO.LONGMIRE
302,400,998 *1DE9769BE027958373AE8E48B367BBB994426FD2 DARIUS.LUONGO
302,400,999 *1DEFBCE94FF54505FA777230FA726CF82BFE5BAA DARRIN.NOLAZCO
302,401,000 *1DE0457ECF9DAAF880B7735C2EC465DFB59F6BCE DARRIN.PENZIEN
302,401,001 *1DE1EB1054D742D9825EA5BACE632A828D1305CA DARRYLCUTNO
302,401,002 *1DE9B21059DD7744FC65CC48250FED47A741FCE1 DARWINARIANE
302,401,003 *1DEB6CF2C243620AA526000B04D1D5A4BCDC3D71 r-ein-Kind-aus-Gelsenkirchen
302,401,004 *1DEDB9476D4F54F0D0477E4E370A3FF5BBE73CAE RĘKOWIAŃSKA
302,401,005 *1DE96B02A3CF2BC1A70F3CA0DB4EB34C7D751AC8 RENOVERET6
302,401,006 *1DEFDBE76D2D0C04D6094C1F4CAD33AAE5CE2459 DCEMPLON
302,401,007 *1DEDF3A721598CA971B334D111A831A91A7CE937 DE6CB
302,401,008 *1DEC03A5FC13F7420E51BCF6042F76F4AEF3AC01 REUBENBLOCKMON
302,401,009 *1DEE6AB23156790AD8F1B4777D776C7259083006 Reverencer
302,401,010 *1DEB9A95462FC5FB3657FA6C3D2A7D6D89862B62 RHENGKYO
302,401,011 *1DEFFD4CB5618D162C657C50BD1C6E24319C6E5E deletennmystache
302,401,012 *1DE43EEC313728E5CCEC24E2A2C2A1B9C1339FF9 delmartourtillott
302,401,013 *1DE769900D10596BA1B143EBBB214FE6EB9EC678 +RICK1ING
302,401,014 *1DE76ACB09D6626B471CB7F6605DAD23F150B06E RICKEY.GEMMA
302,401,015 *1DE81B3692E0A108282938F54A172399222E13CD deniskraushaar
302,401,016 *1DE39A711F8F6680DE29491147136285685EF728 rigobertohoffstot
302,401,017 *1DE0E1CDF212FA83687565A3130434F9D8AE9515 Rin~AisuruMononoTameni~
302,401,018 *1DE4EA77D9DB9618D5B56BA99F0FACE9542AD20C DEVONFIRMAN
302,401,019 *1DEAB0795021DD1AE4AECC4C9DE0A0E4C47D156B DEWEYFOUTE
302,401,020 *1DE2DE2D5636AED3D121AD5DA8921D12BEE9B9F6 d!f3t
302,401,021 *1DE0D2DCA517F44B9DCE905A26C74E8461597024 d-#h
302,401,022 *1DE67DD09ACC3D5E15A515099CBF8526B29467C2 [email protected]
302,401,023 *1DEF8D9C93881902BF32965A60A1C1A1E153FE06 DIEGO.VANALPHEN
302,401,024 *1DE1F56E972E750D3B5EE118EAB94A0A8E0F7D9B rodrigohautala
302,401,025 *1DE43F144D4DC343AA916C0053AE327A993D54FC ROGELIO.POLIDORI
302,401,026 *1DE014068927C90D2BD25D1559CD7088B24C924C [email protected]
302,401,027 *1DE49CB89283A41269C7315D8242B290137AAEF7 rolã³ka
302,401,028 *1DE7AFD8E3D9FB2869374B3DB9BA2D1F405606C9 ROLF.HOYER
302,401,029 *1DEDCDB48BD84BB131654EB5DE2CE62D660A5422 ronnycoombes
302,401,030 *1DEF7FF6FDCBEE7757E74BEC884C4E738B24EBED DJLX/
302,401,031 *1DEA9F11F346551FC12EE75889AF8C39F338787A DLKEH
302,401,032 *1DE2C016F303482C8C8CF4BD53B1AC561EF114E3 DONG.KULLMAN
302,401,033 *1DEDA99F0A139734972BBAF95019F6E7D94F1C79 DONNA.TOONE
302,401,034 *1DE03F395D7099A0DC650C06432216716053C376 donovandrozdowski
302,401,035 *1DECA7854D164C1FA8E43D07C5A923BA534FCC99 DONTEWEDDEL
302,401,036 *1DEE7868FB389D3079D0A359038F95F8E99EEF98 DOODGRAVERS
302,401,037 *1DE441FE1DC53B0D4D906473E871435EC7DBA781 RU+H3RF0RDUM
302,401,038 *1DE6B95FD9CF335EFE8F9954119B25C15B9A53AF Dp3W
302,401,039 *1DE08DEBFF804ED16CC3C3F067812492BB33C02A rye-brown
302,401,040 *1DEDF1D256A85ECCD6525F4E747225D303728F9B drf6p
302,401,041 *1DEB771386073705008ABD4D684E8D56234CF11B DRZEWO.OSJAN
302,401,042 *1DE400157EF751B3F69D40FD7B44B787E54B7EE2 SALDHYA6
302,401,043 *1DE5090244D256971A24AA11F55B3A4488527AAF sammiegragson
302,401,044 *1DE0844C273B25C8E335162FE2B5E3FDD0020FAD SAMMY.BLINDT
302,401,045 *1DED8F64D21FD2B36BDE01D2F34656ACF65D6C7E samueldouthit
302,401,046 *1DE2DBA0DD27FB87B0757AC2FDB171CFD306F383 samvolley
302,401,047 *1DE544F7CAAB18E3BFD6AAA5EAA244BB77F3708F SANNEMEIJER
302,401,048 *1DE54F8B49121C828DBC9270FD95E289D1C0FC03 SCAR.MART
302,401,049 *1DE555B47EC1487979D54837F3318439E4973FE8 SCHATZI18
302,401,050 *1DE35F074BF70B7D3BE1C4F500A5653269F01775 SCHIKANI1
302,401,051 *1DE757CA4E97ECF1AF75E01FF5FE0D3C08493881 SCOLBSCOLB2
302,401,052 *1DE0439059BE30658B17D15C480DD126E58E38A4 SCOT.HILLYER
302,401,053 *1DE913ADF7C59C8EC6A425E09B7ACF1DAE0BEE60 SEAN.HELMICH
302,401,054 *1DEC1E565D05C75FF63D0AB92807C7A0A988D83E SEANSEERATTAN
302,401,055 *1DE29A66F7C4919A714A8F7F8FF5C5361C7BE1EF dust!est
302,401,056 *1DE3393E168008CEA4F869E8CC9B27326BF42938 SEEKINGDEMANDING
302,401,057 *1DECD88CC48F0788EB1A6D8D11EC959A290C252B dvc86
302,401,058 *1DE58B99A285D0B7B37C1CFB90E8B0B12C34A905 sepocsorapal
302,401,059 *1DE6E2BF988353B7F99F6D8F98537EC37C06D015 D$;XM
302,401,060 *1DE0200441C457549E975FC93A67EEAFDFC4A8CF DXTL#
302,401,061 *1DE28007A7E681901C06F52F341C5B9551ACD8B9 [email protected]
302,401,062 *1DE49C8B3F53D6B0F51E2C32AA81E49212C276AF DZtI
302,401,063 *1DE2D9B1C5D6121A7F82054B934026EFCE1F1347 e701e$
302,401,064 *1DE5C654397CD51AD8446CC32C29E529EF55B9A5 eaus
302,401,065 *1DEB0C004F1CA614DF496868058C9C8B792D0172 SHAYNE.STERNBERGER
302,401,066 *1DEE83115466985357F3BEA9EC7253649AC40582 SHIV.CHOUBEY
302,401,067 *1DE5C1BFB0F5FF61E1C1E130A625D46386F15EAA EDLOHTER9
302,401,068 *1DEC3999E5E0B3EABDB343526843C325E5817F82 [email protected]
302,401,069 *1DE8C57FDA9FDEA0E52CC8204535FDDF6A14745C SIASUOLAJ0
302,401,070 *1DE771C864E63FF7C5BA16362448B9A5373D0761 SIEGLI
302,401,071 *1DE3052F6C493032146921B2982DD17A20D527BF s?ie=utf8&keywords=-aria&index=blended&page=1
302,401,072 *1DE98E8539931DF72470464F239A0133EA7DB7F9 EDMUNDOZELKIND
302,401,073 *1DE5FE981765CCCD6D0851090C24FF24FD76C846 EDNANJ
302,401,074 *1DEC855AB948801060D6F6559EDFF42FC43BA406 EDWARDNIEBUHR
302,401,075 *1DE265E31D62174328DC6549EFDE3E4003BB809B ƏˈFɜRM
302,401,076 *1DEF6BCCCC040DF04ED7FDBE0B9439A0A5EE5086 single-convention
302,401,077 *1DEA333D4ADAF1DC9A857DF1DDEC8254574FFD89 SIRUTHTHONDAR
302,401,078 *1DE0074EDAA375BEE2D271A1121B07D06101876E sitzistan
302,401,079 *1DE46658D4A08BFE0EC6F6DCBF34DFD72F844224 [email protected]
302,401,080 *1DEF79CE6EC86A754C5A763AF5A20DC1AE991B08 SKULLFISH-CACTU
302,401,081 *1DE74AF965E407DE9CA1983F96A6FA3F1C9B0CE2 slaloms
302,401,082 *1DE22F40E8BA87CA1482541B4083EDF3845DBFC3 SLITSMARGELET
302,401,083 *1DE9922074C398F208D5D3C00DD28FEC4ADD7306 elisharizzardi
302,401,084 *1DEA5DEBE70A774E8CA3938B9CE072B946BF31F4 elizabeth.lehan
302,401,085 *1DED1D046DD76FBA42B353141A2877C59B03B80B SMELTPROP3
302,401,086 *1DEB29F8A1DEDCCEEF9C1F0A5B1C76133A252175 SMITHMILLER9
302,401,087 *1DEA4C350667590000F7C835C1246C39A6945F9D sniffemed
302,401,088 *1DEB36D9C50E4C41133626DBB6913B2E2D3FCF9B SNOIREYALB0
302,401,089 *1DE8A30C0F4CCE0325498CF97650A799A06CF1C6 EMERYDELAVEGA
302,401,090 *1DE25CEBD31571259BEB1380C817A0512C5A84B0 soft-feeling.s/o/ft_'f/i/l/i//n/
302,401,091 *1DE73B205AC19ABBEA5219DB201E72CD1EAA9A43 EMIL.SHARON
302,401,092 *1DE89FC6196E9A80795806C7637C08D462506989 EMMANUEL.DEVITA
302,401,093 *1DEE2A51229A93E58AF317972D8B7F3BAD8B82C6 SOLOMONTWICHELL
302,401,094 *1DEFA9919927E45A76D0F3B5F0E94477F24ED689 EN]E
302,401,095 *1DE90A6CD216ECAC30DE890DF61ED04B842E6312 SOUL-SAMBA-REMIXES
302,401,096 *1DE47A27353E77269BF0BD0F9F3394F208BC8AC6 SPAINGEMINI6
302,401,097 *1DEFF7557793EB8FA64203221CC5322521BBC894 erichrhee
302,401,098 *1DE603602F60293C12EF6E04991D56E241D7808B splat!!o~0~q#####p
302,401,099 *1DEC01CE218B638CA20F569459567C83D3D6302D ET SUNNHETSTEGN
302,401,100 *1DEBF7A8EF090FB3E541F4B0E944BBAE8983E52F sspb
302,401,101 *1DEC4DB8CA51ED58EAA0D907743682C1DFDF04F3 EUSEBIO.REFFNER
302,401,102 *1DEC50F33FA367766A61C269122F7A6E958E080D STEALTHSTIMPY
302,401,103 *1DE4DC6243F09029FA2A28A853F0CE3ED5EBBF9F steviecaffee
302,401,104 *1DE26F47502F0837A29D4999A5B6FAE666DAEE2C STILL-GREY
302,401,105 *1DE6EE02A54E41C10E79F2C35C2DCAC17D067B01 [email protected]
302,401,106 *1DE53C8049DCDF6BB1EDF8F99448EEACD8AF4B9F FARMINGSAMANTHA
302,401,107 *1DE21033BCEB1C0286A516EAFD1509FCD17A7DF0 summercapekid
302,401,108 *1DE437D249A5F4B89396F9B6BEAE0547CF5DCEE3 SUNSHINACURA
302,401,109 *1DEC6F8EE7C9EEFECB1B13354EA313E644AC8AAF SURUSTING
302,401,110 *1DE259D9FE48F5D5850CCB6B1F5059B35F91176B FIGHTSPACE.BLOGSPOT.
302,401,111 *1DE0A1BE3C623BE62E6EEE414ABD043FFA797FB6 fire-in-my-eye
302,401,112 *1DE2C15E95CB684D6EBB087757DA0EE1C7E9FA4F FKKLTCHT6
302,401,113 *1DEC96118A93CF8310EE061D1C5F38597C5FC7EE FLAYFLINT8
302,401,114 *1DEDCD9B94B149D4EB797851CCF46EC94B2B5FE1 FLYAWAY(SEANTYASREMIX)
302,401,115 *1DE334081624AF465C6233231851AA7E91180BCB FMARLEY5
302,401,116 *1DE8693B2CFFDD25C3920DF551CBE050F8C8FE59 [email protected]
302,401,117 *1DE966AF4345F1947B81ABAD09159677F61337FC TA1KO1ONN
302,401,118 *1DE419A7794CB33831B842750E6D337619E6A2E2 TALDEKOI
302,401,119 *1DE1318DEB9195500D364627C5B27336555C8522 TAL GIRO
302,401,120 *1DE9C4E9C930752B10C674119930385DF5A9E651 TALK9019540239
302,401,121 *1DE3E393D2AD28250DA6B79896345054D6B4A620 TALKDAVIDMFELLOWS
302,401,122 *1DEA3C46E518AF2F8D2E54635C9FF1767E8F2CFD TANDVULLING!
302,401,123 *1DE562FE2796A260B1313CB707A25696CC1B7BF7 FRANKLYNROXAS
302,401,124 *1DE6152FD6191F80DF4A6C00E132C962B79ECDEE [email protected]
302,401,125 *1DE9444FF1F7AFAB47727A0D6A144C6220342282 TAVIUTNAAPMIK
302,401,126 *1DE76200607F95C152F2B57B4D1F3603D04646D0 TAYLORGILCRIS
302,401,127 *1DEAFD296E69D64F1177701EE57519785A968D74 TCLISHBSW7
302,401,128 *1DE6615290985BEE31A8C78BF04A7A32D21C9E85 tdmacdma
302,401,129 *1DE30168F99B1C59BD34F6DFC0ECFAE2CAF85EC2 [email protected]
302,401,130 *1DE1B2CA666069145084A2D526851B5AFA0AA942 TENTANDER1
302,401,131 *1DEF95349B6F9B84328A0AAE7932CB42EF0DAA54 FREDJEANETTE
302,401,132 *1DE5B4A83A4DA5C82AEAB3319ADDDD0C1C72B9B7 FRPOCOFZZ3
302,401,133 *1DE7C4C12E071FC54A5E93765C1E53668CE0D3D3 texasthemed
302,401,134 *1DE8D0D80BA29CF18E44C2B89F1D9BD3F89739D1 tglavdu5
302,401,135 *1DEEF4936C7DB62BFAF441751B79398734874F8C TheFamousFive
302,401,136 *1DE3184098DCA62BAEB267BFD0EA3B186CD2C23B THE GREATEST HITS OF THE 80S, VOLUME 4 - NEW WAVE HITS
302,401,137 *1DE1B9F2CD38B7F836817D173CA5067CCE5D6CE6 GABRIELANITOI
302,401,138 *1DE9D1E107D8B394FB77924187199E226D527E25 gabrielwheeington
302,401,139 *1DE2938EBC0695084F7FC9054ED0EEF54D1643F6 theokertels
302,401,140 *1DE08968460E12045653299127F89059CF7E624C THERESE.DIPAOLO
302,401,141 *1DEAAC88E847CC80D94304DCA292524B19038223 The.Rogue.Pair.(V.1)
302,401,142 *1DEB40AF6C7209344CF94841AB66C56671CB66E5 theskull98
302,401,143 *1DE56FF4446B76BB2D14CB4F7427571EBAB79B97 ThirdCitizen Owofulday
302,401,144 *1DEC4B93AD49A5709571A4474F4876AB90B6EDCB tileN:tiles
302,401,145 *1DEF89DF025DBDD8C04DDB12B59746A35C9BA3B5 TILTEL
302,401,146 *1DE07B5EF7B25CF643F644EB5BFF834A45A3F5B2 GARNAALTJES2
302,401,147 *1DED6B9B48CA2DAA97FD8362533A23F716371BF5 garthtrilling
302,401,148 *1DE81EFF9E9EE06067B896B24C359417ECBB14A5 tina.mckean
302,401,149 *1DEDFA2AA3DFF113D83DBB144F3F654ADA0473D9 gavininterrante
302,401,150 *1DE470B94F9CA3DBFB238F75832F9296B2CFD903 gbidaaaaibaj
302,401,151 *1DE93012B17388FB5E4826E0839DF7A993CFE965 TOMAS.BRYMER
302,401,152 *1DECF333578FBC76097FF6330A10C4B352237E64 TOMMIEPACIOLLA
302,401,153 *1DEDAF01BFB2C40320692DBE5B0D3F95B33E85CA gerastius
302,401,154 *1DE2665BBF40A4A11E5BB4D99918442B4363D6F7 [email protected]
302,401,155 *1DE59D8E1460F134C3283724C560F6CA34D958B5 TOUPEREDE
302,401,156 *1DE26BBC2F175EDC70096B01B388EF51396D73C0 goblegarratt
302,401,157 *1DE86AC0DA4D752DD0E18389020257833D784A84 TRIE MAYONK
302,401,158 *1DE944632CAA38442DA55A5ECA3BEDACBBB9B08F TRINIDADKRIETE
302,401,159 *1DEA04709B9542A6D3728A1B276CFB60CE6D2A5B goodyera
302,401,160 *1DEEEBE724C7157C21CBDC6BE1F9A25B14CA7C56 GORDONEYNON
302,401,161 *1DE1D05FB671B474B6BE1C6BFBFE3E6A85C9BDE7 GORDONLEHNER
302,401,162 *1DE59B26AB0438D4C2C9156FDA457A74AE3A089D TRISHABURRELL
302,401,163 *1DE5A1AF375EA7042AF9A731E2CDECEBA3C4041D GORKUTS
302,401,164 *1DE01833B5BF6D32C3E62302CB603FD8EDB0E621 GOSH12
302,401,165 *1DE58A0AB39972750807656B1E486CC6661954CB GRANT.KERTZMAN
302,401,166 *1DE892A41FE0002D6C4F89C59F6EA91144EDB3FE TRUMAN.HEADE
302,401,167 *1DE01DF87CCB3863BE59F6F11907A0D488855295 greasepitbikescomgreasepitbikes
302,401,168 *1DE911A80E372003F66B4FF8FDE626EDB4A0ED51 GREGGGUTKNECHT
302,401,169 *1DE69B7239BFEE2C91A7FF59100D9FC21756580D GREGORIOLAMONDA
302,401,170 *1DECCD009CDF0BE27D3121E461CAD0F3E1BDED3B TUCKLOW
302,401,171 *1DEE5CD3902EABBE29E4A91D9449F63851EBF755 TYRELL.ADELGREN
302,401,172 *1DEEFAC56870B79D4344D3E37E00A24DC526DC33 u30314
302,401,173 *1DE34A84BD3EEEEC7A72E99AA6149D39E3FE8975 hank.norton
302,401,174 *1DE3EE55FBCCA2F4957F181972D3D57953F017D2 HAROLD.REHMER
302,401,175 *1DE3B6E4B9A13EB20EBBE919FB731AD5FC77844C umayyids
302,401,176 *1DE3ED654E8B8479E2D83B2F0808B720BE77777C HAYWOOD.FRISINGER
302,401,177 *1DE6EB553689269C595BB59B7B79B0F0FD677000 helen-osteen
302,401,178 *1DE32801A814CF55F145DF267322EE5D1031E5F4 HELSINGBORGSFESTIVALENS
302,401,179 *1DE5C92CA02D3C74EECD2C119DA7C02D7F91AD04 unsely
302,401,180 *1DEF88C7617D77EA3FA8092E2CC5DE88D915F039 hlingsSonntag
302,401,181 *1DE43CC393D83AD6F7DDC7B984362A4949037D3A UPWWARD
302,401,182 *1DEA81057C8C2F855AEE4FF0C2AA40F0C5CBF28F [email protected]
302,401,183 *1DEC9126E68C850689ABCCC23BE68128DF7C6836 hoban226
302,401,184 *1DE491976161B8D3D3EF0C1D3EF02617D5E495CB HOLY.IS.THE.LIGHT
302,401,185 *1DEE5DAEBD3727C460648AEB988068FA910A9371 USE的條款。其實中文維基對FAIR
302,401,186 *1DE1A8D74128BF36A0D84A2822FB0303D0E74742 U.S.PACKAGED
302,401,187 *1DEAD5119E3F21BDEB3B473F32FC40A29D75E000 USUMANJAMSHAID
302,401,188 *1DE092BA84A01F761CF345BFC08D818C325F3C32 [email protected]
302,401,189 *1DE1F63FE24988AFAAB3EA6914E46FEACE605A7D V!7AL!575
302,401,190 *1DED2E85345DE6E5E3AD8F270C369CC1B15EF9ED HTTPTHESTOPBUTTONCO
302,401,191 *1DEC270D0206E263F7998DAFE9869EEBEC133430 [email protected]
302,401,192 *1DEAC47BDCC5335498197CAEFEE3BBE0E8150C84 HUISZITTENDER5
302,401,193 *1DE0BB4AFB7B9B730D0F44490864F64649BD17FC vanheckediana
302,401,194 *1DE613DA7CADE3EAE3DF692D7D811F1C562F518A [email protected]
302,401,195 *1DE2035D63A31F72FCA0F9432372B2F392371639 hX!
302,401,196 *1DEB94F0C6F29DD0E583B48814BE53B701868CDC IAMLASERJET78
302,401,197 *1DE01BA9369AC636BBCAD3BCA0FFC36171E51072 ihiited
302,401,198 *1DECC4749F471B10DDAE3E541D526F8609800824 iiro
302,401,199 *1DE487249509FD3F0A40F369668A1499DE58332B VENNEGOOR OF HESSELINK
302,401,200 *1DE24DAFC13C2798E22CF74E9A01637C181D9320 iloveparola72
302,401,201 *1DE4E174CE4F0FD55F82EDEEF7A051D5C4A82774 ILUVSPENCER45
302,401,202 *1DE842901CEE9A71722A070131510C85A7E43BCF indahlee
302,401,203 *1DEB657DF23449076B5AA1BB430A5E63526AB60A vidyasagar-kunta
302,401,204 *1DE00E6430FD5EB476AEE955B5984342FF57CDE8 viktor-karlstrom
302,401,205 *1DE2351B77D7223CD115CE699551F760460EB667 VIKULINA666
302,401,206 *1DE626F3FED1B7BCAB68DE33F990923F2BC1354C INSATTE0
302,401,207 *1DE37E646CB60F31BC981CB5E3E44AF30C0153E2 ISAAC.BURGIO
302,401,208 *1DEB0A8D84EF7B5EAFB9FE30E761935FFF7E6994 violinconcertoindmajorop35-allegromoderato
302,401,209 *1DE3B4E96B1B04A463206D8E6DC1BA44D77100C1 VIZEPRASIDENTEN3
302,401,210 *1DEAFA3C4CA4A7E80F558FD026EA5378F74B438A JACK.KNAFF
302,401,211 *1DEDA71073B2E1C61D415D427541245442D25286 JACKSEYKORA
302,401,212 *1DED8E8CD9AEC25A856B895BF8C5303CD85DEB95 JAMES.BENNS
302,401,213 *1DE2990B66F2342379FA80609FEC452724C93034 vuiksyne.faucsoir
302,401,214 *1DED110672F6DD457CA2DE2EC150CE09E709E4F6 [email protected]
302,401,215 *1DE29EBE36B6D379D70173BA9DF47BF0F275FF0D vyskladuj
302,401,216 *1DEC2DE5403FF5A33BABDB99C7B2229535803E3B JEFFERSON.CREER
302,401,217 *1DE9C4A8D2EDDFE576748676AE711155C708C23C JEN9190000
302,401,218 *1DE51F47A8945EAB89568808B144219434B278F1 walterpolasik
302,401,219 *1DE94BF1F36856A08F3F32A36757A7305FCCA314 [email protected]
302,401,220 *1DE69EC2AC6B6A0177E870D555A72B083E1D4E77 [email protected]
302,401,221 *1DE5D724220128BD46D1956D58692EBAF45AE09E jeroldclaude
302,401,222 *1DEFFF34450C3B208C946D48263AFC9028CE6B2E jessica-estey
302,401,223 *1DED9C4C7B7994C20BE7DC6C603FB3E1CB7433BB warren.bares
302,401,224 *1DE6D0139E4B42CB88FCE99847B3F6DCABEFDA1F jewelhense
302,401,225 *1DE1B57EC6B43D9C2DABBD6C316CD3940B7F4E92 [email protected]
302,401,226 *1DEC6454A622E70C10EB5C04279EE8DB687B5D52 jimmiebogar
302,401,227 *1DE0100DE976D4089D55A2C1A6555800FA4785BF JIMMY.BUCHBINDER
302,401,228 *1DEFB4F9D8B660567C6AC1C1D053245D1F76AD0E [email protected]
302,401,229 *1DEAA9C3D1E60322A72BDCAB3287F3F90CE6D2F9 JLEDGAR
302,401,230 *1DE23B86616642F1B6EBB0A56D4F180CA45343F2 JOE.SHELDRICK
302,401,231 *1DEF32FC30C94E07FE166528B15A29B49329329C JOESIOGLESBY
302,401,232 *1DEBEAFE0EAA9BF3AA1935B9F35D64AF6F107E52 WEARDBYRIGGED
302,401,233 *1DEEE7611A6ABF025D03331EF9A66A40CDDD525C WEATHEROO.INFO
302,401,234 *1DE3CD8B50B33E21658166AFE24065BCDE12661A WEI.OUYANG
302,401,235 *1DE3EBC1B34C842FB717D20AAC144EC8A4F94F85 WEJI.THOMSON
302,401,236 *1DEFCD1CE3CB440D3CC644874AB1CC9C1FD1B2CD WENG GAGALAC CORO
302,401,237 *1DE04C3E599018DBA6358F2D750ED7B9CAB86FB1 [email protected]
302,401,238 *1DEA22D473359843C69AA2C83E0CD4B87CE94C3B johnnietoti
302,401,239 *1DEFD66FB1824BF142D8AA367027A14511EB4E61 johnnygularte
302,401,240 *1DEF53FB0106B7FFBBE0CEA753C83D7A78A7C0EC jonathonwinburn
302,401,241 *1DEEB47D724377B3BA6CCE562577B0F1965D0D3B JOSIAHKURGAN
302,401,242 *1DEE9FDCFD0A1946D0BE63EA5D1BE860414CC7D4 JOYSWANCUTT
302,401,243 *1DEE0402FA29931B5C7E79B93500EB0C1941739D JP%
302,401,244 *1DE88B0059AB931134CA88C27739C92163939B6A juli-arnold
302,401,245 *1DEF2FC53C3ACE00B0FAEF1E650B32E271A6B7FC junior tiger
302,401,246 *1DE5AA2169FE781F67BD215B2976C0CECD7A95A8 KAAMSYAMED
302,401,247 *1DEC6D3CE2ACE181E8DAF3726DB5B3FF68925C72 kansanperinnettmme
302,401,248 *1DEAFD61399781504730DA7B1A90BE4CFE0FA4BF KAZEEM.OLUWAFEMI
302,401,249 *1DEE4265FA843C40E0178B994B76E9FEE2FE0BBD kdu
302,401,250 *1DE3EBE253E0D388B2AC43F9AD7E81590F07C00C KENDRICK.ALM
302,401,251 *1DE9AC6ADD1D8F44D85D4F57D7495AAEF0603264 KESTAPA
302,401,252 *1DE84C9F0774961A7285F0A933C23B20181B0008 wilsonballes
302,401,253 *1DE3A1FEB8E67ED40E2AA1BAEE765EFE50E67F02 KGAVRILOVICH
302,401,254 *1DE2871FD4041000D26B5303CB2DA044225E5F9F KIP.ASHBOURNE
302,401,255 *1DE885BCD312FB2AAEB41ADBB914826B4041A925 WI-SAFE
302,401,256 *1DEFEAA7813FC402F5D1A53FA3A951087CE094DD WORKINNGA
302,401,257 *1DE11E7BE0F1EAD3361D898BEA41F99F15FF66FE KRAYMONDING
302,401,258 *1DE9E3BCFC9F6EF3F625AFE4F488BAFBE3B67580 kttngkst9
302,401,259 *1DEA4E84D29DB7A73371AA18803BB873C9E50385 WWW.SD5.K12.MT.US
302,401,260 *1DEC9D0B13BF8628AD7F34074C1B3D064EB395AE wwwsmithopticscom
302,401,261 *1DEE21C395103CC6F78080AD857731060469F56C KYLECRANMORE
302,401,262 *1DE373C7578FC11C3B57950A997CA2E78962F804 KYLEKONECNY
302,401,263 *1DE0AFB82FD64EF951ECA5933BC6FDBFEF275C12 XDJOZZY SESIGUZEL
302,401,264 *1DE46E4CCF573B4D222AE027A2F36AE371FD5062 xhtk
302,401,265 *1DE33C1A9A6627DB7C30F5B05546209C0CFC2856 laneveltri
302,401,266 *1DE178F51F8D6A664886665AA0C4ED159C8A291A laurico4
302,401,267 *1DEB4F1BA0793A79C4D16CB8D76190BBCC449519 LÄVESTÄ
302,401,268 *1DE85AC5827953941FF0807E0A8DBB6B86676F58 LAWSUPP
302,401,269 *1DE60E66FF5A66A56F63CA8DA90C24CA16ED1613 LEAFLETSFLIGHTCUBA
302,401,270 *1DEDBF6356868F6F41B62186249267D3A40E374B XOXYYXFOTHOO6
302,401,271 *1DEAF96D8104CFBFB2818291E44EE99284206B44 XTPWD
302,401,272 *1DEF735E88DEFD61D40142D3D66A234D8A7C9844 LETMESHOWYOU(IJUSTWANTTOMAKEYOUSMILE)
302,401,273 *1DED620FAC7E1C2BB811ED6B162018C735B9C887 LICHTOPSTANDEN
302,401,274 *1DEB4CF3935BC14DB97B7A7A6E6AC58EA4C09611 XWBPDDRJZHCUI
302,401,275 *1DEC4597AE80DDF1B95DFD4B442F311A42F60CD6 [email protected]
302,401,276 *1DE988522CF965B45C5C15A7C5F980547D4BAA32 [email protected]
302,401,277 *1DE8666FECFBC74700EDA7F2D95EB2D3FC3040DD LLB>
302,401,278 *1DE33BC26F2658ADCE593DBDECE39A0CE13834E6 YHAN.SOLIMEN
302,401,279 *1DE904F43F06BBC325496C6A2D91C2559C1B7DF6 YHVONNE SWAIM
302,401,280 *1DE5497264570E9CB82C13E0D48A9D0D0FFAE54C yichaomail
302,401,281 *1DE3DD3EFCD51011BD515F48731FFACA19CB444C yihui.chua
302,401,282 *1DE39FAD8786A54ABDF197033A7ACE7A724C0F6B [email protected]
302,401,283 *1DEAC056225970CFCD1EFF9F58FB73B1306D71CC londondakota
302,401,284 *1DE005090CC278D7BEC66AE0BD25E347FC0C5584 yoseflevenbrown
302,401,285 *1DE40D4E11595F06EF75A71AA9F3A7361B2904C4 [email protected]!ng
302,401,286 *1DEFE7DD161D207348ACE64D68551E3A109EE78E yuzaaa
302,401,287 *1DEE889BE9EDF78C9156D7C5B50B5B3A64B8339C LUTESCENT3
302,401,288 *1DEF0A252326E7B01E1682904643DDFFF64C0017 LYONEYES
302,401,289 *1DE323D7EFAF43A7212931A696F4AA97B3526012 [email protected]
302,401,290 *1DE49DF7728B6509D41210949ACF061A516A607A zameela-rauf
302,401,291 *1DECB4800BD81517644AF52EED417A7D8075E6AD ZANE.GROUND
302,401,292 *1DE63CED3F1ECA7F99888BA3B9E30F9383E97CEF [email protected]
302,401,293 *1DEBE5716E110B3A7DA1AE95C09C726A962724A6 [email protected]
302,401,294 *1DE5B150F7ADA86E83006438A61134AB7C79F740 ZHOUQUNYIN
302,401,295 *1DEFBBD15609AD9DC4D09E9DDB064EA7B9444272 M4卡宾枪
302,401,296 *1DE5E88F5583AAD83D015B17EB4A2B7005A640D9 [email protected]
302,401,297 *1DE42B225092097490C618EABFFD29BE06AC7ED3 makroih
302,401,298 *1DEBDB642E113C709A0D986DA896850ACD4BAA79 MANGROVERNA
302,401,299 *1DE12A463310EEE00311BB582FAFF4AE7D55B41C MANUAL.GRAV
302,401,300 *1DED94475773C2BCE345DE90C2D133F2E5A707BD MARIA.BAPTISTA
302,401,301 *1DE152C896A4C28DC44534B4F231D16F75DE25AF «НИЖНЬОЮ»
302,401,302 *1DEBF539AEFA85BAB727730A54C77FDCF3EFE338 ПЕРЕВОЗНОВО
302,401,303 *1DEBE5F07F1ADB83A32CCBEA9C2C2A9A40CF6458 «полиграфический
302,401,304 *1DEB22550A1063AD60E4134BA70001282E6AA25A СТОКХОЛМСКЕ
302,401,305 *1DEA1BC423F342646CDD7CA937CD958427590C80 mbpharos
302,401,306 *1DEDB02A796C2216E333BB43697ADCF026D4CEDC MERLIN.WUERTH
302,401,307 *1DED8E7DB60CBBF529666CD8586FCFFAE3F1BF43 mia-per-sempre
302,401,308 *1DE69FB0426CB3605AA6E6AC2E345710BA17FC73 [email protected]
302,401,309 *1DEA7B13E2B31718A4B1775DD48152304BC34F07 MIKE.HACKENMILLER
302,401,310 *1DE4B0E668BAC51F4A5D8FB621E7A59E219A7875 MILESCHRISTENSON
302,401,311 *1DEC2EA023D3903978E404A4CB0DAC85A035E8EA minkleys
302,401,312 *1DE8463B2D015E73167FC80948857528D6E13B44 結果:いい雰囲気にはなったが、ドMに変化なし。
302,401,313 *1DE5DFFDA17EF348CDD5D04D06BA7021C073B3F9 MISFOTOS75
302,401,314 *1DEE16AAC17B14A375E464ACFB28FA6B3B6392EC mohamed.said.kohsin
302,401,315 *1DE75440005176A47D2405AF405D1CF9E9A38A74 mohammadbyrant
302,401,316 *1DEE576C0E2EAC59D564E8D5C3F86210729DC4EE MOIN.TAQAVI
302,401,317 *1DE80866DE0DB5611E06A5BF6C75EC5461037C4E momal.javed
302,401,318 *1DE53A165F119074A54E6358E1D162F4C0F6F649 03201107
302,401,319 *1DE7C80959FA89A7EC90CD0B78B6C34CCE605E13 MOTIVICALLYDRIVEN
302,401,320 *1DE73925846598B5F46EA18B68ED29E9EC6B65AC 07.26.1643
302,401,321 *1DE5A3DFA31E62C0C0046C54FC4148C08FF77B0E 10-Ceklerle
302,401,322 *1DE4E36628E4A75D7A4026F53E225C9960AD1E78 1120812 ' WE TAKE A RESPONSIBLE VIEW OF OUR ADVERTISING .
302,401,323 *1DE3BF83EDD16158920EC9A19181F609298498BE MSINNET
302,401,324 *1DE4A2FABE948338661F2398D11E67FB4F7230E9 muiteling
302,401,325 *1DE17BFD96BAE671AD713733291F66D3E5B9CB8C musical7
302,401,326 *1DE5E3E4366C0CDF4FF141B960964C09B539FEAD my precious girl and the sour apple
302,401,327 *1DEC7583D694D0914CFA974A1DF80EBACF05337A 141ISTEMISTIR
302,401,328 *1DE47DB0412E41ED0F8F61CEBC4C24CFCF2D619E 142-LEFTISTS
302,401,329 *1DE6E3C76E93F93CCC5CF2FE1BA88E28AE4DE222 NADIMI
302,401,330 *1DE97013C80251626FCC9D830802B8CDCF33FC60 1663263 yksityisensektorintukitaiteilijoille1466.3.1.
302,401,331 *1DE1E7B17422721A055878612CE429DC00DAFFF0 16.arvoisesta
302,401,332 *1DE98257FD7C6E721693B0FF8DE1552C9ABD618E 17 ZWEITGROESSTES
302,401,333 *1DEF23A6D3843CC47F71C332FA242D1CD8A6D004 1812950 der dozent hat selbst an dem versuch teilgenommen
302,401,334 *1DE3258C76EDB02B568D87A4E1005D6EDC204887 [email protected]
302,401,335 *1DEC3C649CCC7FBDBBC3B9400E2E5FB5D9154761 19051116
302,401,336 *1DE4E10DE71E6CCC37F3BBAE8AA1A8D8B26268B7 195KM地点のタイムを計測するという。2001年の6回大会には日本の
302,401,337 *1DE7E0BDD8D50F7516640259194E7F4D8C4165D9 ncp008
302,401,338 *1DECF9869753BDD11BE84D045F2E2C364D88E5E9 1-betontrog
302,401,339 *1DE1A9B0D1F9F3C3C1C73394B8E03E78CFD2A52D 1DOMITE
302,401,340 *1DE017C44588E516341AA7CE7FB1F9A565EAF1F3 NEWYORKCITY3
302,401,341 *1DE42ECC5731E43083AB97DEB6E2D0F2CCADA1FE 1GEISBACH
302,401,342 *1DEFE8C5832F8B397687DDF3B2786FE05070574E 1 GLOBESHRINKING
302,401,343 *1DE2D9023178296C652ABE1066BD0BCC84AF6A8E 1GREEN-COLOURED
302,401,344 *1DE4A52BE5E2841ABC59C4362C20D785F2F91D02 1-heyecanlanayIm
302,401,345 *1DEEBF21B9DE5CAB716455AF2038FCFA7C306EE3 NIKO862
302,401,346 *1DE9E58006D09FAC8181C64BBF1A51874CFACCBA NOCTURNES (3) FOR PIANO, B 54/OP. 9: NO 2 IN E FLAT MAJOR
302,401,347 *1DE245944F93C6B866D7D0672E85B2EA5A5CA6F9 NODESELECTDIALOG
302,401,348 *1DEE7391A1E63776475686242FE9EC49F13569C9 NOE.BETHARD
302,401,349 *1DEC2C86C388B86D2DDABF937F9F5A3F00683DD5 1.mahanymp
302,401,350 *1DE5DB068F0AE2ECCCB6CC4834DC6BA6139C78F0 nsiturunmaan
302,401,351 *1DE8D2B4DCE402EBEF1F652AB34506D5A1E416EB 1PNTBLNSS
302,401,352 *1DE9C06343522B3C05AF0525C721C01DC874731D NULTIE
302,401,353 *1DE7D6274CACAD9A133039E13860CA657E0EDA86 1rzec
302,401,354 *1DE60FB825C4B73E1F3D6EE8B5F7095D754EAB73 O117423
302,401,355 *1DEAE2EE8A7DEB3B331A9A098C53C7A69CAC8CC9 1.sikatarttuva
302,401,356 *1DE79A6E762D211347670DFC60E34A6AE5FE1FD9 o5+r4cze5
302,401,357 *1DE20386D2DA8D30B4D8A679897C5366ACF2FA7B OBLASTBUKARIBUTAKIBU
302,401,358 *1DEF8237E130AE7195175386BD0AD6AA73B35B90 1.THOMASERIK
302,401,359 *1DE65AF60DBDE7C46ACC66C70C9A8832D504CA41 1-TITEL-KAEUFER
302,401,360 *1DE4A0EDE4C96223713B61C219EBD994C26E9DF5 ODNALEPPED
302,401,361 *1DEC0BD4CBDBE96482F41F4CF48FA17D39D7F73B 1.vetokoiranhommat
302,401,362 *1DE3F50C311E820BD4D0E9F5E9FE12C4A8F5A7E4 [email protected]
302,401,363 *1DE2121DAC1F545C314BFF9290C3A58438DBAD35 ONIINOL
302,401,364 *1DE62BE243598956CAEB4328BE802E57151EA418 Onkel-Tom-Angelripper
302,401,365 *1DEC692E8D31C42EB7F276F8930684BC1FE9DEA8 225PT
302,401,366 *1DE583C605277758B000451960451A8D8C8C90CC 2272369 ELOKUUNKOKONAISSALAMAM
302,401,367 *1DE33150933C89F04EE94D31711B3550602F60CC 22PENETANA
302,401,368 *1DE2673F8A62A824EC1917879ADF4980E23D3CF8 2749519 VUONNA.1969.ENSIMM
302,401,369 *1DE67FC9DE1295966A4AB7A4C3E0B802B8955E06 ORVILLE.DICKS
302,401,370 *1DE972BB7B5707B141EFAD21A26AFF496B2F741C orvillesegerman
302,401,371 *1DE574B855517A5A557C7AAE0EC4575971DA8B9D 2893838 me ty
302,401,372 *1DE275B60EFFBBB5FEF23DAAB7258884B6A8BBF7 OSVALDOTINNEBERG
302,401,373 *1DE846BA252F7F55E622099E9396414DD59F128B 29091417
302,401,374 *1DE7EA25740BC7745B39BE1E3129E3BAF2F2BEF3 (~_^) ~ ~ (p
302,401,375 *1DEFBAEAE140C8D7D102B6E1E2BA900F33F44AF0 2kgabang
302,401,376 *1DE9E9B75CD60FD98F06227F803895BF3D9B1BAF 2 KOLMEOPETTAJAISEN
302,401,377 *1DEF678E34850C676ED0C18A57E15A68854C3941 2KYYDEIST
302,401,378 *1DE1F95412A935A0EC5B61136546C327E9D56335 P10TT3RN3
302,401,379 *1DE7179B6CBC09560380D8EBC252604D5D2D411C P1O1P1E1.
302,401,380 *1DE0740A5C17401733BE38BBF0D6F26971CDEE97 2PUNAJUURILEHIK
302,401,381 *1DE54A484A8332F3E5FEA2DDB6A2AF5940C8906C 2SANTINI123
302,401,382 *1DEF2FFCB091526C289C21E0C22B8A8C2F002C43 [email protected]
302,401,383 *1DE015A7CB67381673DAFD05DCC2E156E20C5B52 2.UNTERGANGSSTRUDEL
302,401,384 *1DE8934C53A555FD167B7ED5D037738A338AB79A [email protected]
302,401,385 *1DEA8125A5F2E7FCA500E95096B793642CB1BC2E parbat-subba
302,401,386 *1DEB57C97C92F6ABF7DFDAD9FDD175CDCFF8C138 parisschmahl
302,401,387 *1DE6C3A14846548E1F7A9A7096A999EA85517AD2 passwords should be, at a minimum, 6 characters in length
302,401,388 *1DEF762090F70AAFC71E384A27BD69C2530A3B6F pastichecitation
302,401,389 *1DEA3F44D79F6AB0DA1F4DA7E12F6FA3AE290A7B patricialotton
302,401,390 *1DED15D6CFEB203B5F9D3CBC6D09A0776485263B 3 ABGEBLITZTER
302,401,391 *1DE42AACEE7E8F4F64579F732034FDE5F1A26E01 3 beatlesstuecke
302,401,392 *1DE19AD5671A253B2B5CD4D0555BA1FB109E6FCD pavlicovou
302,401,393 *1DE26893F4D7E859ECCE754B590C5679B6C6EDB3 :P-*-*-*@#B
302,401,394 *1DEC912008BC04D47E297DFB227A25025FB9F16C 3DINVER
302,401,395 *1DE1E7638EBC5F17F93C97B1EAD7EE5A02E5879E 3=====D-~-~-~-Splat!!
302,401,396 *1DEA41B1074FA6CAC8A5CE2A094518CFD34E9E52 pedroespineltorres
302,401,397 *1DE66E98DC5B26C88FD93F7A33376BD22445F97C PEDROHEFFERNEN
302,401,398 *1DE99E8E7038356F620E14C511C83006F1D7735B PEDROMUNINGER
302,401,399 *1DEC4CA46E83D05955DFF5A89FB36EE43680A59F 3-M
302,401,400 *1DE0B1E447AECD2104442CDB91EF34518055BCE1 4GEPREDIC
302,401,401 *1DE2B1A3A62F789789203E8FFC2816E5E2D57EFD *pgpv2.6.xisusedmostsouseittoo.
302,401,402 *1DE7D9DE1C2DE8A63DE5836F640AE306C34EACBB 4IAMPYTHON1
302,401,403 *1DE811AC6E0455011E9399650D9702C753A59D58 pianoconcertono.21inc'elviramadigan'k467-ii.andante
302,401,404 *1DE12B2F9E047826851EEC08B1C7BBCFE69429EC PISKERISING
302,401,405 *1DE5C78902724C90BB426C8562AE301D051CB81A 4ORISERONS
302,401,406 *1DE96A926B44672726BC2A7C838D919EA8EDD8B4 “pô
302,401,407 *1DED113C5323638C49D63CD163017BF69A11DCBE 4.tiilitalossa
302,401,408 *1DEF0482183D6E69256C5102C4DE9B3DA2CE25B5 50.ALEKSA
302,401,409 *1DE644720E16F69BA643B4B3E71DA79C9122D255 50mhandisport
302,401,410 *1DED60205CE89716F1A4FD3285D8A09A900F9348 59 ANKARIA
302,401,411 *1DE3DCD9CCFBEBA46CDB0937B533151C71B56737 5BLUEBIRDDEADHEAD
302,401,412 *1DE220016D07039EC714F04F6374A938F5D83AFB PŘESTUDOWANJA
302,401,413 *1DE7320F8C61A94EDB1026CB6DEA92C81688D763 PRETORRI
302,401,414 *1DE9F0A7F0FD7ECEE9A229581CE194886D51F208 profet
302,401,415 *1DE51E0DAD0DE9F9D01009E9FED2C9734CCFD02B PRØYSSERBLÅ
302,401,416 *1DED61C02104545B71BB036A54E39361D24DEF10 5HIGHESTQUALI
302,401,417 *1DE59C7B6B04A4B3EB0C58F94D8495F72602D534 5KRUIPWEREND
302,401,418 *1DE0C4A2867B0351B13AD452B5029A420B8A4E99 5MINOURUBY
302,401,419 *1DEC52831334C492C63E2BF8F125C3D3C96EF125 5pteridophytic
302,401,420 *1DE09CF74A8D57A593626941717DF36C7B442A75 [email protected]
302,401,421 *1DE9486B5183BBA6B7335DCAEB0F02C222B22F2F Quero te Amar (Part Fl
302,401,422 *1DE460E57E8FF4E692B0176E54F6C576DE333348 quintinapley
302,401,423 *1DE2FC702454FC1D4BF180E385721AB834E25CDD radsportbrillen
302,401,424 *1DEB3CB00AA92F26C438090E1336B819E76F8032 5WIJNBERGENS
302,401,425 *1DEE066E9BF3D4B6DC6AAFEFE0B137EED8158E00 5ZUCHTPERLEN
302,401,426 *1DEA3978F9C104DD20C796286646B0D9C5A987E6 6ALYSSAZAPATA
302,401,427 *1DE88230A6BFBD918CC2051EBB4AFEB6114AB97F "RASKILLA".(FEAT..BANJOOZ)
302,401,428 *1DEBBE6E3C1376CAAD378639E18CC672CEA69F81 r:"d
302,401,429 *1DE7786D84F0C3BCBFBB0BD2B3B416FCB12CC035 REALGOODFRIEND
302,401,430 *1DE553D0C53852B87A57AD3844FA7B6C09C3EF10 redstreakingintowater
302,401,431 *1DE6D6707584FADEA263605B1A57A2C0FD4E5A2F 6KOMMUTIERENDES
302,401,432 *1DEA5A321B3702D426514EEE57639AA263A88E6E 6LEATHERWOOD
302,401,433 *1DE73C771B4A15722D964520BD020EBDB7E3EF54 rejecta81e
302,401,434 *1DE2BB5F9A6AB3167FEDE8F0E5B283F97F3EB77A renaldobator
302,401,435 *1DEFDD140416C1AED75AA8E74D3F32D909906DF0 renshuuking
302,401,436 *1DE3C2057B59B8C703DBB28CF6343A9DF3C52777 6TUTEVRUT
302,401,437 *1DE43945626C0A11AAA40A710A5F6EC23BEA7A69 REYES.TRIEU
302,401,438 *1DEC6102E4311B097A1291AF625BC7AD389922C8 70CM
302,401,439 *1DE3D47CFC7BB3B604F6D6CCB4EAD41CE30422E9 RIGOBERTO.NIRO
302,401,440 *1DE1D0F97DEBE70611CD5B220F748571749DAC38 7BSWACCOMODATORBS
302,401,441 *1DEBE49159E18A6B12FC0126003D7663EF0B78A6 RISASAN
302,401,442 *1DECE24F29AB01E59714ADB28C5B3F2A8FFBF479 7ERAENLAINEN
302,401,443 *1DE42F8D2654C4D13443FE6FA42FEFED0D4422E4 ROBBARTMES
302,401,444 *1DEB0947A45B346732F8F5A72D65053E0454C5D8 robderico
302,401,445 *1DE302185506C2789CCA34CF854C71037D7D2EE4 ROCKY.DICKINS
302,401,446 *1DE70A5693DCF6882B269E21EC78A2D127803B31 ROCKYTIM6
302,401,447 *1DEEC04CB64D21F85C831DEAD0316B7A287DA1A4 RODERICK.ADEBISI
302,401,448 *1DEECE23DA7E66F17609A96BB45146DBB19785AF rodolfoattebery
302,401,449 *1DE2A6D3EF27DB1C8E10E199E096FC14DC0E081A ROLANDVACLAVIK
302,401,450 *1DEF877F15548437039D8750C1E0F8A3BFBE647B ROLAND.VALITON
302,401,451 *1DE8573BBFC86B74395632004D6DBA39BC902B55 RONNIEURBANSKI
302,401,452 *1DEDAEFAD4996FDCBBE5AD3238D38E42D5E5C02C RONPROSPER
302,401,453 *1DEE420DA48693CB8ECED278BF14CBA991A8A252 ROYCE.SHACKLEY
302,401,454 *1DEBE64BDEE40327C8EEBE0AFE90007ED76592D1 7INSCISIO
302,401,455 *1DE3E7C1C4468C46DA6F36E372E9F090AD7C0543 7INTERNETBENUTZER
302,401,456 *1DE4D7C55001C2E15971883C17713AB82D670291 rP/
302,401,457 *1DE92E6227ADE2B8C69D57ABCE550C360609DC86 RTENPAS1
302,401,458 *1DE96C3A958BD1359A092CDF101AAABAE6CC9D5A rubinluncsford
302,401,459 *1DEE78CD1F9CA31F33EE964B19DBAC8E5031E49F 7NTARAGAN
302,401,460 *1DED173DB67354899ECD01DC636C58B4740EE8D3 rudyfoucher
302,401,461 *1DE3D360FC89711CFB222C6FDAA89C14428E4B9A RUFUSMIENE
302,401,462 *1DE80C5E52AB320DE6E0A1F706B6978B67939212 [email protected]
302,401,463 *1DE3F31DAAF3E84A43F441002CC1CD324503129D RYANKAHUHU
302,401,464 *1DE74E9C6A4067735BF55A7694D2C00EE1C912E0 SAAMEGETAFDINLICENSFAARSTATEN
302,401,465 *1DE32D8105639AEA1E5816BD3C18C39BAA22BD98 SALINAABDULLAH
302,401,466 *1DECFA5FAA12FABDB5CB7A72A2A28445DC17C7AF 7THATGOAT
302,401,467 *1DE801EA136E3BC5C4E68145AFCB886C504EA075 SAMIR.ANDRAOS
302,401,468 *1DE7208A12648D0512BADACBBDC3F75E232EECFF samualsublett
302,401,469 *1DEEAECDCD47D84983DF234B02298AE30715CAFD san7y
302,401,470 *1DE17CD4985669284AB5B00B645A627675283027 SANAHÖLMÖILYLLE
302,401,471 *1DE91CC2ED601F7BBD7B773EE34C89BE9737335A sanderienvan
302,401,472 *1DED40F809847085C09E97438129CE774E381C62 SANDRAAPOLLO
302,401,473 *1DE71E7C1FB6369716D0E93DDE55CC538832AD0D 8-BOURDON
302,401,474 *1DE4DF9901789DEDD9F493D0D5AEBC1051823507 sc4pe90471sm
302,401,475 *1DED3E2EEF6D782199628FFA7891B70A9DBE033E scoobywonder
302,401,476 *1DE48E48B4923CB29F0E444381B04476DE041AFC SEDILSDU8
302,401,477 *1DE6AB9B4E92DCDEFD212399C1A3EBE5DE09E385 SEICEPSOCE1
302,401,478 *1DEBAF8727B8EAF3A99D6C76CD14E5F9DCAAC426 SENVOREGGLIB
302,401,479 *1DE0308C8A6FE1C31A5FC399A9CA26BE7C79035B SERFICORS
302,401,480 *1DEB1D28862153A0226B694220F91B10274575C7 shalyaam.h
302,401,481 *1DEDDCCBD8B74505B9B1513891FB3BB5AD1A6535 SHANIA257
302,401,482 *1DEC759C1DA291673F308C7B4CFBAB85BDFE442A shavsètia
302,401,483 *1DEE517A6245F4C3818D1819B0ED709C5DBC340D SHELLIE OGDEN
302,401,484 *1DE54BDB05FBC51F7A4DC6859EC6A8E748430017 SHOESROYALS8
302,401,485 *1DE42E940314731796900310AA3A776D64FFE544 SHONMISIK
302,401,486 *1DE5019AFBA51BFA04E4BBFDCF8BD758D2B4BC81 8NISSAPPO
302,401,487 *1DEC5791B493AE20E3E547FF319C4AF3325DE655 8##@.*.*(o_)
302,401,488 *1DED2E8AE3439170607DE474207B70E5CFE20E42 8>~O;)
302,401,489 *1DEB5BF61150688B52EDBB1DCE50AF34733F380C 8UNDEBATINGS
302,401,490 *1DE30FEAAAC1DF20FC58D86538856DBE6AD41028 singermillion
302,401,491 *1DEC74D0F8FE14E4C358ACD57C5A9ABAE7665F92 sirerions2
302,401,492 *1DEFCE08DDF6CE457A7C18A838C1B63C78EBCEEC SKNESREV8
302,401,493 *1DE3D4D78281443684C717F8E841BD474C680A5E SKULETID
302,401,494 *1DE2D8251EE37ED056AA875E2454DB58A2184459 skvr
302,401,495 *1DE37DFA845F1614E92DCF921CD3487AF4BDF452 |9 D
302,401,496 *1DE92AD643C316164B70C84D7EE96E6125F467A3 9DOOWNOEGIP
302,401,497 *1DE5B04729AF853A1BDD345234657C40310265A0 9.ellipsis
302,401,498 *1DE5B1471CAA511101E15472F8F3F27ED720F6B0 SOCIETYOFUNKNOWNS
302,401,499 *1DED8D734B00587B6BFEFC11B47E1117769BBECB 9LOESEGELDSUMM
302,401,500 *1DE48869F72571E3411FCC73B44DD1DE2C8E50B0 9MARIPOSANAUTICA
302,401,501 *1DE49A00190F445D23B3D204ACA35E100F79DE28 9MEDATRAC
302,401,502 *1DE53FDC95BA9755BC4270880395EAA5B996C9C1 9PERSUADINGLIES
302,401,503 *1DE21B17F2C063355DCEF1B3A55B26743D7A04D7 souamosa9
302,401,504 *1DE0E0088CD50738A54DE1CD16D8CD05E5D79713 [email protected]
302,401,505 *1DE746C33D47FF06B81BAEB443EADBEDCF6C434E [email protected]
302,401,506 *1DEC75E5779E746AC99D6A65DD37E8E4C932A47D Splat 0~ d--P
302,401,507 *1DEB1B4CEF160D79D7073E7C82D7D292547B3718 SRELKCUBS
302,401,508 *1DE1DFD30F871C1ED6BC204CC45A54508612DE71 aadq!y
302,401,509 *1DE8D01B1E06F28C6F38FA09867097ED9179CCE1 stanleysmolinski
302,401,510 *1DE5823F104951FED417270893AA179766044078 AANSTEVENS6
302,401,511 *1DE99C1A8411C671AD91003BB5E0150AF1F9C02E AAQ:
302,401,512 *1DEE7F67D8A1BBCF88D0599F4457E021A597B46B abd+a
302,401,513 *1DE7CEC679CA79644853906AE69A4A88698354D0 [email protected]
302,401,514 *1DE4D9899C3FD7AB262500519D033B34C0618565 STIGARDIB
302,401,515 *1DE9CF44CEB6ACBCC306C88E9BAD1889265EBE8A STUART-BEAL
302,401,516 *1DE912B9D56B5798ED1667FB1696B3494B1DCFF4 STUEHLINGER5
302,401,517 *1DE8B2BC548826FA5AC40B445917FFE3E842DC31 SUITE NO4 IN D MAJOR, BWV 1069 - I OUVERTURE
302,401,518 *1DE1EE15433752AE3BC1DBE48EF42BF3C8CA310B ADALYN220
302,401,519 *1DEFBD83EFB595067071C1503FC566D89314CA80 SUPERFLOUSING
302,401,520 *1DED88968777A3ACEB0688958707BEEB85E0CF1A add12786
302,401,521 *1DEB12E1CA8FD7F61496D6F39CBA0C2FA33EA14B ADJUSTER
302,401,522 *1DE1EB7D2EC162FAD4A0058BA4C3D26701FC0B79 adt~y
302,401,523 *1DE174D7C4335282367D8C22D6DB047CF6106EAA tagebuchkonvolut
302,401,524 *1DE285B383438B529E0D80CBB8995C085F1BF94E TAMEME(INSOMNIAC)
302,401,525 *1DE186EBE309BDD96E849383C19B309C82F10A93 aig=0
302,401,526 *1DE12A3B144FD52EC9DAA5D897BAC641FF7E676D TBHGMO
302,401,527 *1DE4C735D0E8E6FDAB30E8429C88C80795406150 AJ3FT
302,401,528 *1DE1BCB46987A81192E69EDADE2D929B2D1BDDDE terrencepouche
302,401,529 *1DE12C41D02D6D692A382E7965080902EC171FDF ALDRICHES0
302,401,530 *1DEF67CFD9A11B4655B1FEC449A5FDED876F7E03 ALEXANDRIAOFTHECA
302,401,531 *1DE9D04E71B3C16CF1820CC4804299A0CE6BF25D aljerko
302,401,532 *1DEC5C193CA2B61DD7C4D7E230AA11C51C532452 ALLES PR
302,401,533 *1DEF601D4738D679C2791B5AD84B0BAED2DED554 The.Kid.(Grimey.mix)
302,401,534 *1DED2977C2DCFA180CDE157B14C36F19F0E7197A THEMINISTERSOFMUSIC
302,401,535 *1DEA9E2277521CEC87510E2E1970542449E6BE19 ALONSO.DEMARTINO
302,401,536 *1DEE9920846F3F6A32AF501621C3686FD30AB599 aloysia-elliott
302,401,537 *1DE63E5C5CB3909F8608E18BEFB5708BCF02D267 alphonseclapham
302,401,538 *1DE1A17E7F8DE6CE70BA944FB5F4B947B805743F ALPHONSE.GAUSTAD
302,401,539 *1DE3101F268948B058298C78933139AA75FB60CC ALPHONSIE123
302,401,540 *1DE7C2D8777FB98EB4FBF96716A877CAED26C4A4 ALQNH
302,401,541 *1DE4B47950594127EA1AA0A23E2C8D9E07008FDE AMBER CALDERONE
302,401,542 *1DE6E551D085BDB2BB048B314283E7B8A03A4FC4 ambrosechamp
302,401,543 *1DE1E3627ED70E8DAAFBB9A01B1CBB4EBA5C2A8D amc5
302,401,544 *1DE843E481CF8A00B60DAE489FD82829F3B7BFEF TMFTAPEBSW0
302,401,545 *1DEBF2B49175971BAED80A7F4A97A60298640B4B anangium1
302,401,546 *1DE172A09993F16D3DFACE190AAF88CBB8F6E2AC TNEREUQORCSE
302,401,547 *1DEFDDC2A7982F9BC0CE12F0EE106DA4581B80F9 TOCCATADMOLL,OP.59NO.5:VIVACISSIMO
302,401,548 *1DEE44CF1F110A1786378230C6AF8422B94B99C9 anh-lun
302,401,549 *1DE75E8C02000844E60750BCB2E44D1D25756485 TORYBREHANT
302,401,550 *1DE43E30430D6B78624150102FB704BC4E6307AC touchyfeely
302,401,551 *1DEC06E962F533E01277717AA8293AC25B19E58E ANNCALLON
302,401,552 *1DE361E8946BA79277417D954701FBBF2BC0D9E0 TRACK07
302,401,553 *1DE42D9A1758CE07A100A8E3E7C580C23F402C47 trfreving
302,401,554 *1DE76C5AF03AB536216038EDD8D55A83A3F5E843 aodfh
302,401,555 *1DEE434F549C60E4FE036E2CD529BE2FBB62735B APARNA-RAUT
302,401,556 *1DECA7756A2E262190ABFCCD985DC21887214ED9 ap%i:
302,401,557 *1DE890370D9384B14B2E8CC4B9F244AE98198BD0 TURBOSTANLEY
302,401,558 *1DEECEEDBE16B1225EE6A35BA508A5C5AA947AC4 tutnjiti3
302,401,559 *1DE7F188C638DD0199245334227D35CE394ED468 TWIDDLED
302,401,560 *1DE635A6498694DBB98DA1641B4EBA32DC8F73F7 TYREEKIFER
302,401,561 *1DE14DA372EA32CC815FA051313BA45A865585F5 UDIT-DOGRA
302,401,562 *1DE8941C3C40817F76BC462F1E8792A4860481DD UFFELAARING
302,401,563 *1DE03FB82F1D049510B95672F32CC7873799FFBF UFGANGESES
302,401,564 *1DE736D4B06F5AFD19838642C8B994E8E1E002C2 uitkering2
302,401,565 *1DE2C48E24750742D4237197729F0CD3CEBEEFF0 UMISTELIGT3
302,401,566 *1DE62798E2AA887919EFAE065C573F59EA13FA0C Unsailable
302,401,567 *1DE7EA966C38DC2F81CABD21EA86CFCD3B7FF752 asrosihu
302,401,568 *1DEEC466D865D659F7015C46C542DA3F80EF3C93 aswmv
302,401,569 *1DE17D5D86D704EC5804EA4CEA545C7A0971A6AB AT&HQ
302,401,570 *1DE4219088B6BD2E906E2A019FC55EF64BC9914F uu.*.*.*d---b
302,401,571 *1DE31D2C20DC7461AF276539F3C000E736B265DE AUWY-
302,401,572 *1DE1F19A122F38D9EFF23E27ECE20E1990B1D699 ave(v
302,401,573 *1DE9DFB138AC2781BAD2540AD7CECE3C5C472E88 VAJOTAN
302,401,574 *1DE7F60EC9FABDC21110617AEA905E0569961F83 AVON LADY
302,401,575 *1DE41BF4CA644AC776859AC0816ECC2E858F9E1C AWT&B
302,401,576 *1DEA4016EFE050CE9744D1B3F5085F731A5BF44E b1pm&
302,401,577 *1DEB8D5AA3CDCF19E5C6BF89025262A05C65011E VERNKURZ
302,401,578 *1DEC30CDE313EDFDF0DD9B47A62B0F34A8FD3DDD baaf.
302,401,579 *1DE2A52B8280CBAB8B96649FB5DCA36438764880 bahnrisse
302,401,580 *1DE0E5378E2C15F0CC88AF9EAF59D3241E7E1DD4 [email protected]
302,401,581 *1DE8424D600646CE094A41DBD65ADF803D89D20E BALTHASARA
302,401,582 *1DEA5307A02C358F72C9A9FEC5B19E282C877D81 victimize2
302,401,583 *1DEE3067E852A8F51B020A760373339EE3B718D2 BA-RL
302,401,584 *1DEC6CAFD23588BAD9B2F96EFD665D38C3E28C67 VIVI16NIKI16
302,401,585 *1DE28C121EB7ECD050CCBBD5845899C265619F82 B.CJC
302,401,586 *1DE74545E0F20AA7636BE5A9CAF25412DA2B5B84 WACHOLTZOWIE
302,401,587 *1DE3773D4C9E55C43D43AF6C59DDF9278127FA7B WAGNER,PARSIFAL
302,401,588 *1DE6AB1D7F89C5077FA71DB0F33C0619164B9AA0 waiting for the change / all we wanna do
302,401,589 *1DE93839281AA81602FBC46393F51CEBA6F93C74 WALKER.VOELKERDING
302,401,590 *1DE4E6A78CF3835AF3AB4D4707AF1EEF45E0625D bestchillout9
302,401,591 *1DE9FAAE229664CD48D6A97F0CB0C386B4F5B8FE B++GM
302,401,592 *1DEE75106BC5A392334D019780E532F78F5E55E9 bhlw
302,401,593 *1DE84DA8D325A87EFF474EDE6196AC130B2725E1 [email protected]
302,401,594 *1DEA5A7C6240D2D0E2E7056E7C90425527150ED1 WARNER.PFANNENSTIEL
302,401,595 *1DEB62F4C90668FE478A4B9015087FD9836612D2 bhsax
302,401,596 *1DE8509F4C8F6312D28853A764962491549F365A BINTULU.ORG
302,401,597 *1DEBCF87FBD8B61D9EC1D53B1A876DE5914DF4A1 [email protected]
302,401,598 *1DED92CFD81867A9A9144DEE9F3A71FF0F761290 wbhjlhw0
302,401,599 *1DEDFCDC3EED095A6E5DB36FD5781176D4D9742A BIZ$
302,401,600 *1DEDFE96CAD8BB34D4CFD5BEB55F516E232F004B we.have.arrived.2002.(miro.remix)
302,401,601 *1DE3D2DC702C321A53ABDE4D2121114398B5DBEE [email protected]
302,401,602 *1DE5783C79A6D0C95E1B1ECBD09C2788C1E9DF55 BKMM
302,401,603 *1DE73A1578561647061CD70E35A6EC1A4D6989EB BL3:,
302,401,604 *1DEE5817433DAF607E22A164364592B901525402 BL4CKBERRIE$
302,401,605 *1DEC16745667ECB7649AC27634AB60932425C94B BLAKECRAVY
302,401,606 *1DE46A6C72DF99012DE45EBEE252AECB4440224F blangarin
302,401,607 *1DE577C86C313AE569FE2A208C447DB40034848A BLUESNIK
302,401,608 *1DE40565AC698FE39044EE23D7E63B6419B8728D wilbergivan
302,401,609 *1DE5410E97C3068FE783347905B511E2A7598F4A BOBBY-SCARLATTI
302,401,610 *1DE3642ACE65629C204623BB7A58EB31C607102F WILFREDOKRUMME
302,401,611 *1DE4D58942F4790B70AD37FC8E37303E2DE7E36E BOB.LUNDSFORD
302,401,612 *1DE0E4F3A40341B18F59CD7D390E373F58A22531 WILLNICO-KURTLEY-SOLDAAT
302,401,613 *1DE5FA23ED759C22E05D01BAE5B8D0F12F9579AF WILTON.EPPLER
302,401,614 *1DEDB24C7F5F3815F2DE1E5DF0876FDCEA0DDF11 WILTONSHERRADEN
302,401,615 *1DE9947357E6C757DA4BB7F8FED1AB1A849A4CE9 winfredbeserra
302,401,616 *1DE4FBD9B0B2E0860A5CAB62CFC7A246685467E1 WINGS-OF-HARMONY
302,401,617 *1DEF4B7956E7F1CAC0B8129D40C690716745DF13 wini-gallagher
302,401,618 *1DE12ABB5D6BFF962388117914D622063AB5318E borissuther
302,401,619 *1DE247F611EA2CE2FA2B40E4F1853638FCD8224A BOUNCERS
302,401,620 *1DE1D2CDCE7A9417E786B12320CBD44BEB8088A6 [email protected]
302,401,621 *1DEE45A0D1F234BC22E582D5A8C8431821143819 BPBG
302,401,622 *1DE0CC40AEA1B1B9B886A2D5E706E757CB7424B7 WV]]
302,401,623 *1DED6BBDA65E585C220B69976AC8976F38006F11 BREISGAU-BACKMITTEL.DEWWW
302,401,624 *1DEEB49EB547027F51D06179C08B4743C17A1073 BRIAN-CUTTING
302,401,625 *1DEB78CF0E3DA7E2661CBD2484FC29EF6A869FFF bridgettesloan
302,401,626 *1DE64DADCF5874B37B41D446BE95CCC040A2198C [email protected]
302,401,627 *1DE3CC5EFFDC61532E5911D85E744A5D9CD013BB [email protected]
302,401,628 *1DEBB8C588F26642DBA1690BB0B8E53FF4E7E326 xc(
302,401,629 *1DE7F9B71946B75FDE6528571D21CA6808D24210 BSM6
302,401,630 *1DE1EC46C7EDEBE9CB57070994C39206FA283957 XICALANCAS
302,401,631 *1DE2AA6677931A662B3FD3E1398AB89C11E3219D [email protected]
302,401,632 *1DE31ED948A40F8D508BEFA5F6005D07D0B3CA6B [email protected]
302,401,633 *1DE4187E31F772B206AF7300DFB732C569F82843 B,VYK
302,401,634 *1DEFC1E7EC99E4F1E225328BF8F4042F5B01B454 YAMAHAJSBACH1
302,401,635 *1DE1577966CC0D59D8421B6FDAEA41B02BE8C598 BX3QF
302,401,636 *1DEA4F0A9FA7DE4129FF088DF5C9BBBC90686E49 C_0XH
302,401,637 *1DE7E24F85ECB7019A47ACC9401812A9BF168C2C C4HR:
302,401,638 *1DE5A3D7AF7907A49915423769D8EEA98E136BB5 C7;9
302,401,639 *1DECB6AC9D94F58E75A9C429F2A588ADE7BCDF11 YLLACITSAISUHTNEODUESP8
302,401,640 *1DE049E3111CD64A71A7C95D211D33CF2F391601 c8dg.
302,401,641 *1DE7A25993FDAA54C505DADD2C272B2355DF2525 YRETNALIA4
302,401,642 *1DE2713984A5E51311B9B22AA5E3BDFEAC5E06E9 YSABEL-GARINGARAO
302,401,643 *1DE89F05AFD8EBA310F12C821238A8312ECE7DD0 [email protected]
302,401,644 *1DE2C2E70782667DAB79A98C8DF7B771DC42E23A yuko.akari.gold
302,401,645 *1DE0512CEAF33C475303D609B0353EA0F29E8298 yuko-beltran-licari
302,401,646 *1DED519CCF614EC46044613CDEE961C65DAB1B80 carlocamastro
302,401,647 *1DE2137C27951F8E09EDF0DA32C35ABE2DDAC29C CARMELO.MCCUTCHEON
302,401,648 *1DEBBA640F234FF64E04B078039CB6FBF9AA3E95 YUSUY CHAN
302,401,649 *1DEF1B0014F2B229FE6851125227B23CF4C7582D CARMINE.LUKER
302,401,650 *1DE43C78195041D0B4CFA0732954DFC428ECFC63 yvonnetrudysmith
302,401,651 *1DECFA27BD52E830C4D22FD10371035667F2EA14 CAROLYNLANCASTER
302,401,652 *1DE4792224169BDBBCF9043F1837606D67ADD11E ZACHARIAH.RUMBLE
302,401,653 *1DE6CEFC27D7BE49806A26F81AAB08F50C7976F9 CATFISHJONES
302,401,654 *1DEF38FE3A7576D7F02F9DD935E4F641B5679C52 ZAIHANIEZ
302,401,655 *1DEEDD4CE1AF1C2FA9A78E7002B53089E77341BC ZAMBOUROUK9
302,401,656 *1DEB80A6B0DE980001B1A50F054FF6EEAE4ED307 CC%D
302,401,657 *1DE03B63F3E484538BDBDAACED65CD524712B00B ZELMANOV6
302,401,658 *1DEC634DC6208B6E6161D338F0DBAA5A84B7A7BE CESAR.RUEHLE
302,401,659 *1DE6A1FED72819FB2C10DE62C463411C00B8C857 CFATD
302,401,660 *1DE4A993C8E41A6AA7A5469AA3B7F1CB7B870576 cgku
302,401,661 *1DEB566AB91EE47D7EBD35C18E351C7E3CB5F865 CHADGARLOCK
302,401,662 *1DEE0B18FC26D24F5BCCA88CEF4155B43AF3503A chadsultana
302,401,663 *1DE7C5915C33DEDD0A982AE44701D6EB9E1D86A2 ΕΠΙΡΟΣΘΈΤΩΣ
302,401,664 *1DE1FF8C835CF8E29B99AB4373A507537DE2CECD ΛΕΒΑΔΈΩΝ
302,401,665 *1DEDDB7855DA45305D58D2BAB648277A2CE73029 ὑποδείξοντασ
302,401,666 *1DE9705F4E7C12168A46F5723F34E1CB5D39BEBF CHILLME
302,401,667 *1DEA0BF8B9329739481259791B911D93FEF0B546 CH:X$
302,401,668 *1DE2F629A415BD5BD7F570E09DF2D0A0E5685B41 C=I=Q
302,401,669 *1DE402A9E29E7D8EAF2E0F14AC71E0D2405A5E92 CLAUD.TOHER
302,401,670 *1DE24755CE1B9652FDF1FE6BD45CB99E00510AE7 СМЕСТИХ
302,401,671 *1DEA9EE1A8EDD7C97F64A5229FB443475A3CDDEB c#l%m
302,401,672 *1DEDD2130EDE9A6AE597EF99FFACFB5DF88B906D COLTON.MCKENZIE
302,401,673 *1DE06542784AF080A76F4E4FF39C2A19A3ACED6E conradquilliam
302,401,674 *1DE542483E129AC6CA74E0A7568AAD4ADF4C9CB5 CONSTANTINE
302,401,675 *1DE625CECC3F84FE61FF7A57ED0988C2BD302C46 CORY.DENIKEN
302,401,676 *1DE52558296BC367924C30E1179ACE7FDB62E7B0 cosmo-circle
302,401,677 *1DE11BB766F2D7C88BC7F86335A6369CFE7F43C9 CRISESPARZA
302,401,678 *1DE0140483BEAA16AC7F7D371767A441BE2B2280 cswbw
302,401,679 *1DED4F12BCF09709233530D2A7AA996A2E1FC438 [email protected]
302,401,680 *1DEA3289269ED306DEA1DEF00A2F989269B2C580 CU+:L
302,401,681 *1DE9457257311175BFEF3232CE36332ED5267340 curtmichals
302,401,682 *1DEC31AC930437E00875667821C01130E730634A CUTEHARU
302,401,683 *1DE3F8F63386FDFCC185FCBE91BF6AB3CFECA561 cwfo:
302,401,684 *1DEB1AF214F3AB65C08120A8C9F72E9F2157E0FD DAMIANKROSCHEL
302,401,685 *1DEF65BE844F628F04A6C07A29029C8B09BD196E DAMIETTA
302,401,686 *1DEF0D44AA694922B8C153F983068F8A27F977D4 DANIAL.SUNDELL
302,401,687 *1DE93276FF2646E9738BB2474E078B22C6B243D0 DANIELJORDAO
302,401,688 *1DEBD7D244255EC6F4BD0500819205717C5CC313 DARIO.HYNES
302,401,689 *1DEF3BF79D071F3EADE5648122469CC5A9CAA1FF databaseballs
302,401,690 *1DECA382E9A641D26FC22C3329D7A70C69AFAB2E d(bb
302,401,691 *1DEBF4B5979173E73A75067404F195D515969362 [email protected]
302,401,692 *1DEEDAE1E5B9E143D265409B3AC16BA370583496 0BBALL5
302,401,693 *1DE1F9FD066F868CD8AC53DCF3C032DBC1EEF7D3 DEBRA.BLANCO
302,401,694 *1DEA0E4FE4E9120D160A625AD1581DEC320F0058 DE.GEOFFROY
302,401,695 *1DEA71BA69576820E80631CFACD67C6E1643A55C [email protected]
302,401,696 *1DE953FEE1CBE61B3AA05557378566E3CCAAC78E DEMIASSIS
302,401,697 *1DEB461971E30DCDA4DB3A2168C367FD0E47C1CA 12793B
302,401,698 *1DE146182F3F0145F8E3AEBAAF10515FA9F79995 1326040 tielaitos ja ratahallintokeskus asentavat kyr
302,401,699 *1DE9EE0043537123739B3123D007EA2EA5F9456B DFE6P
302,401,700 *1DE2EBEEE9222268D40AD7AB6551B1419F9680F6 dga,+
302,401,701 *1DEF196315D969C2626D4341E46652FB5D917AA6 1772886 "-i-still-earn-a-living-,-still-pay-taxes-.
302,401,702 *1DEF002616EFFD8967CAE4CA32C15453B73FA6FF DICBS
302,401,703 *1DEB84CA0357908DEAD41879620E794A8F53DBAD d#i#k
302,401,704 *1DE98C24CDB182BE04763A7B3FA79878F2BCC6B4 1emmaastot
302,401,705 *1DED506CA9C2630B53939C47BDC4F083F49DFE48 [email protected]
302,401,706 *1DE725768CFC3B1EE1DD7C987BEC77F068F2D4F0 1.everyonevictims
302,401,707 *1DE240C9DDE20CD935A25D033B80D10A28CA6439 1FOODTROU
302,401,708 *1DE1ECECDC53766BC36BA4770648BBDCBF578C87 D?ML(
302,401,709 *1DECAA4D9B2BE610EFFEC57BB1281B368CF2CD4F 1.GEMETZELLYRIK
302,401,710 *1DE9D16536E5D5F05812ABF6EF277839D88AB160 1.HITLERBEFEHLS
302,401,711 *1DE8176060304B24C85DD0B534F91CB01952D491 DONALD.EISENZIMMER
302,401,712 *1DE94E550DFFE73CDDAE863AD19F16E55585876E DONGKENNIE
302,401,713 *1DE5F9AF98E4BEA9DAECD2B1E714A431DF93DFAC 1INFORCING
302,401,714 *1DEED53DFB79C411243D47295976CB36AE57C52D 1kuulumattomaltahenkil
302,401,715 *1DE6A02716EAA0CE08AE5FC563167EAD935779DE dormiries
302,401,716 *1DED3FEE52B7DEACD8C1F7B6FEC0836CAD306B65 DQ:V0
302,401,717 *1DE70FBE713DB0D11E0FCA9482EB75F437007D97 1.SCHWIMMRHYTHMUS
302,401,718 *1DE4290279332DD4066BF9322AAAD7B3D4BEA378 DR,#P
302,401,719 *1DE3EA3ADC1341860F1035F4B5977FC70BF1F168 ds"9f
302,401,720 *1DE622ACD8EFA0134B602C99EDB6A8A5E9A8E2CE DTOFC
302,401,721 *1DE10A68818D751A96CC2C4323BE1287B7E1300E 2158773 JO.VUONNA.1890.THOMAS.ALVA.EDISON.J
302,401,722 *1DEA8F6600719A376059864F4E8179900A4C757B DUUSTER.EN.DONKER.(FUNCKARMA.MIX)
302,401,723 *1DEBE278FC84B64545F9809289FC4ECCF6750D32 DvF?
302,401,724 *1DE666DBAA8BC4281E7426495C3C62BEE59215CE dxmv,
302,401,725 *1DEABFFF1C6349BC4C344F769D5B4BAAD9B0C1E1 DYREHO1D
302,401,726 *1DE8D1FF321B58BC3858FD7BB2340BAF51BDB4B3 EARLE.ASTUDILLO
302,401,727 *1DEF04DB5DD19181A5D9EF2DCA2C4C91E9C59BB9 ecdah
302,401,728 *1DE42108110BF1335CB66CC44C362FF132DBE191 EDDIEBOROWIAK
302,401,729 *1DE797E848CB566F1BA932335A316D1A03A401A5 [email protected]
302,401,730 *1DE5E896DBFBA7B29334D55D4EE62E597AD5CF23 2.daviscup-jahr
302,401,731 *1DEF3FB95ED8EB3FAE856C860784903A231FB04F 2.EMPROS
302,401,732 *1DE4B62F861AFC7F7CC22F922135329175E825E5 EDMUNDOPUSKAR
302,401,733 *1DE20DC78470BB7E8B8146F9EE024ED6E7F5A07E eerstehulpverlening!
302,401,734 *1DEF288E626CD5D475C42FC8749FF98F44CC8C34 ef5kb
302,401,735 *1DE8D8F5F8A12D3904028D18D2BB33E272828338 ehc/v
302,401,736 *1DE290214EB9CDAE8612592834C81510938453F9 30041981
302,401,737 *1DE648ECF76A842008C6E6F1EA3A0669BCF96C62 ELBERTPACKWOOD
302,401,738 *1DE70A5FA9BC1E49758322A9C810DA5427B867E5 ELISHABROTEMARKLE
302,401,739 *1DEE8D4E9E3B463030417A1B31C9E7699271E3B0 elliotdibartolo
302,401,740 *1DE5FD20C1F3E543C7584C77747CFED9AA886E87 394ASDFGH
302,401,741 *1DEF5CD1878DB14D72586BD1A9D7B0A128F797E2 3B.~.~.~.}O{
302,401,742 *1DEF00C4997B7DD8937FAFFA3B45C07E2720246C 3b<-***@------q
302,401,743 *1DE07A61CE446EAE9D13AB3AFB21EC7B72726C20 3HWIETBSW
302,401,744 *1DEC12B575646EB6673A741DE10EA034C641F629 3innentemperaturen
302,401,745 *1DE42D338C62B5094B3C0F97366E991F19CC809A 3-M
302,401,746 *1DE72677AABED2EE55DFCE6A4438108992E6C848 emouthin3
302,401,747 *1DE56B9482937436E9F1DEE3671CDBF5DBCB2F65 3NIGHTSINABLUEROOM
302,401,748 *1DEE4B05FEB6A8D41788E29B9B4B1C9F5601127B en7023390248
302,401,749 *1DE4CC5428028E93ABE52713D4DF0C153816CA30 3TLIGEN
302,401,750 *1DE150ED3B44C1411937C78ACA9FE1CFF5756092 ENOCH.SKOW
302,401,751 *1DE802FD0E46ABFA1425B97397D2093AADADA803 ENTERER
302,401,752 *1DE109E227A86F36D915B7C82FB42438817BB1B5 45danica
302,401,753 *1DE79DDC54C73EC7F5B7FF343419D7FCBD7E2C13 4.JALALTA
302,401,754 *1DE595FC9B474831166195EA57CA0B36F5F3260F eriotnomorp
302,401,755 *1DE7732731A80E3F075D65B854331398588C15FD ERROL.CALLNAN
302,401,756 *1DE3C8FFB3206DF4455F27D9297F6D5C4C038305 4THATBUCK
302,401,757 *1DE7D213CEB6ACDAE52243C1D953573BC8B30D64 esolucur6
302,401,758 *1DE569354B16733EE5E4DF61148427D708341C03 ESOPH
302,401,759 *1DE0E781E3492ABB4BD53FCE30C142CE218D4826 ESTHERMWAURA
302,401,760 *1DE655880D87E80AF37771EB4D77E2E80A04E2CF etd8
302,401,761 *1DED4DBE4EDBCCBE301B8E5E843352AB7FEF3E34 [email protected]!N9
302,401,762 *1DE4881A0A84A0809B61CB0F8D7EFA9841B49578 58230BA2D115AA765F1C65D58DDB6F7A 070603
302,401,763 *1DE33009E5C1B87F227A50EC7822A274615D23EA 5ADVERTEERDER
302,401,764 *1DEAA73FBF4A30055744E8219C99BF490C183765 5APOTNODO
302,401,765 *1DE16834CA50D9C43D9AFF13076ED309F68EC6E4 EVERETT.PROVOW
302,401,766 *1DEF0A95119F070EC883920F9C512A55F0A97960 5BLACKWELLUK
302,401,767 *1DE0C86659B0677D6386CC9D0BDA009599C9B882 Excerpt.From.by.the.West.Bank
302,401,768 *1DE5057E4535742C2BC01062C6E9532247B95A0A F204487
302,401,769 *1DE3EF235F70716B63FF75BB9FAD268187971B50 faad
302,401,770 *1DEB8D903833E49AC649F960D26F6E1056BE1A49 5IAMTROJAN
302,401,771 *1DE0D251F2F936A5485F7A1B5DB35A12895071D1 [email protected]
302,401,772 *1DE3ED9B96638678F5219746B24E9A62C1635C13 5MIMMICKRIES
302,401,773 *1DEF239946CBA18BEBF17F435DDDCEBB365994E2 FAYEMOEN
302,401,774 *1DE67002A6E7287752677C1ADE901C0C5AE808C2 5P0R3D13RTJ13
302,401,775 *1DEE300DBE5D382B9AF83F568EB4DD8B5ABB7B0A 5qgbaa
302,401,776 *1DE6CB939CB83FED6BF98BD365C1B1907AAD4E4C FENDERSYMBOL
302,401,777 *1DEB1F826B8D6D8224BB773B18D0C25879F20246 [email protected]
302,401,778 *1DE37ED61B4AA4CC7A65C5F32700082DB990D694 [email protected]
302,401,779 *1DEA99D5F7281DEEB3766C927C5334D7B7DCC75F FERDINAND.ETCHELLS
302,401,780 *1DE5CA9F79D32CF5AD1C8161178A9B3C0EDAEEFE 5SUOICANETREVO
302,401,781 *1DE456D42C7FCDB3FF4ACF7158E6F8DC656A05AB FILIBERTO.MACADAM
302,401,782 *1DE0289322D17084C2DA0728FC5D48CF1ECFBA46 FINALLY I
302,401,783 *1DE86B66F01F88C346CFC4AA3CEB1E79242A0E11 fitmoeglunguug
302,401,784 *1DE2B06A10345CBA26E0545562DA4BD11788845C 69634 USEISSA EY-MAISSA T
302,401,785 *1DE1C7B16D11AD764B0FD9D4D82855C688D50161 6BSWCBNABSW
302,401,786 *1DEBE54F85B88A97FDF5CC8843A7692A918213B7 6BSWVUGHTBSW
302,401,787 *1DEECAC596B42D84F17812237F8EFAC1DB70AC3F FLIRT160
302,401,788 *1DE7C7CEC399BE2F4050B7100DDBD8B99D3E098C FLORENTINOFARSTVEDT
302,401,789 *1DEE6F1FB3F4F03E36511AC0FD4EED0ED2B6356C 6GATEWAYCCIWAASNAUMOZILLA
302,401,790 *1DE86BCB279E36651A4D61BA9E83BC3AE09DF2F3 6HOMOGONOUSES
302,401,791 *1DE8F42EC0FBDF74DB5E65E970EE6708ADF7D084 6IAMBISMILLAH8
302,401,792 *1DE8D6C716030D4317D3CB8F3D64D6A8C390CC98 6LAITANBSW
302,401,793 *1DE70937D3C3A5BC9BA269708E3F288A883AA32B 6LUGENIA
302,401,794 *1DEA58AFD05EE921409134A71D62EE7B5ABB0BE3 6PAREERS
302,401,795 *1DEA1A376A6BE4E8EFED32D4229F108F19F75D02 6PASSWORDSPEECH
302,401,796 *1DE811D0942886AD43CF5442E1699FE823E86AD3 6subsisteraient
302,401,797 *1DED15E013CE3405DDE2B3153C67B2DF5332813A FromEnslavementtoObliteration/SuffertheChildren
302,401,798 *1DE4C473EC999B04EE33C5913DB8D74837F7B585 FULL-COUNTRY
302,401,799 *1DE285B9E8260D883A7C29725CFB2527525CD04E g22289uj
302,401,800 *1DECCE8202E09884C138DA6C3FC71FEBD79195C9 GABRIELSKAPURA
302,401,801 *1DE01E81522A260F636777B45105F968A5E7E336 7HCUZTAAB
302,401,802 *1DE75803E85FA0C84078AB13D0EDF6188EA6E84F galesus0
302,401,803 *1DEEFE21D6AB4226136DAD5A8861154094079A6C GAOMARCOT
302,401,804 *1DE991BA7CB0F6E44E84D479E9A6042EE045D566 [email protected]
302,401,805 *1DEDDB44FF88A607ADFEC4003F39640919344537 GARRYBOLEYN
302,401,806 *1DEDCADE2A19055BD42BB353A9DBA6C1764BE630 7OLIVERORION
302,401,807 *1DE73DA83E75EBAB97B57F87625F8E765662F91E gaylordpifer
302,401,808 *1DE369FA3BB09D620985F290B45DC97FB99343E0 GEHIEUWDE7
302,401,809 *1DE6F48647D8BFC94DF8DFE5EABE128F51ABD9CA GEMNANGEL
302,401,810 *1DEDAD2038FA37E100BBFC69D9BFE37FE16C28FF GENEMARTIRE
302,401,811 *1DE6E95AA6CD8CA36932266AFD580643CBC9958A GENICKSCHLAG
302,401,812 *1DE9545606CAE6911926E00F2452591337F33977 GIOVANNI.MYINT
302,401,813 *1DE050A38E84E1BB878DB1706A2FC35DD5272395 G&IU
302,401,814 *1DE01E9C86810D462F8B118B69B4499B7A0F1DC2 7TAWFACGATWQSX7I
302,401,815 *1DEEB1D30A6907AC7373AE140F2F5659911F0EF0 god.look.down
302,401,816 *1DE5B73D566E7BD46B189E6F278A1CE1C6BCC69F GOOLNICK2
302,401,817 *1DE03E524EC0DF6E9E20FF7BA487F8828D6ED1CB 871968 steckt-darin-nicht-doch-ein-fuenkchen-wahrheit-?
302,401,818 *1DECC66A75114586E9E79903438AA1FB50081E81 88244 IhracatIgeliStirmeetUdmerkezi.
302,401,819 *1DE6EA3B626265BC368B64120E579E1ACCBC2E17 GRANVILLE.MELLENCAMP
302,401,820 *1DE2B8722E6331D6E87789E07C538D5EC47FE8D4 GRIEGSONATAS
302,401,821 *1DEFADFE066D9EA15A5DB19D48434895F14EC785 GROUNATION:ROOTSOFREGGAE,VOLUME2
302,401,822 *1DE740CE28CF76EE7F96471871834090EDA1CF53 [email protected]
302,401,823 *1DE24D773D1175A65E8E88B6EFF74F58F040695E gustavo781
302,401,824 *1DE8102009551A8D7C88C39A9E6B7DC96851FFC4 gx:\
302,401,825 *1DEF6EC04DB1B0A1B59AD9E5C67E55964E79F920 HAKLAKEN
302,401,826 *1DE96C3EAA888CB3E33DA99F1EC85C2978B5B82C halselleck
302,401,827 *1DEFBD73CF42E07F774E041C30A9B97C8AD35CF7 hamelheide
302,401,828 *1DEC5B3FA0867A094BACAEDAA298177FA1759FA6 HANGINGON(B):30
302,401,829 *1DE1BED7269DA3EF3D05A34A335F070CE68466F7 8-kukkap
302,401,830 *1DEBF15FC10824CFA478FC1CC475C5286710EABD 8LEHDELL
302,401,831 *1DE5EE3FDAF0C47F300C1443EA0B6F895DF460F5 8.MYLLYYN
302,401,832 *1DE2EC05903DA240112579710628D388191F7DC7 8|oaaa
302,401,833 *1DE4FF8A49BDE6ED9B54D5A133575FA9B4783E8C HARRY-BEER
302,401,834 *1DEF9EBB4EC2B94BB75405101FFDBBABF2529135 HARVEYALLSBROOK
302,401,835 *1DE604DD288BA4A2677928B53EAADE27E3589C43 8PRECATURQUE
302,401,836 *1DE79A6424D9139E9E42117F599E1A16DAA36E81 8TREASURYAGENT
302,401,837 *1DEC7F0101B8B089BEEE7980A70122EA0301F382 Henri.Texier.Red.Route.Quartet
302,401,838 *1DE2A1E04F8A622DEE57C0E4CDCDC528AD86D099 HENRYLAMBE
302,401,839 *1DE8E9A2E3A2DC44C589DD5099247FF4FFB9D340 HERIBERTO.BURROUGHS
302,401,840 *1DEB8CB8FEA5AC75399F98EFE49BE5C454382B3E HERMANDESCOTEAU
302,401,841 *1DE8F5B88FB539880C015B21FDB3DD6C838D0F04 [email protected]
302,401,842 *1DE7963C4446691DABCE5DDD095BF44B9D93FAB6 [email protected]
302,401,843 *1DEF8FB8A9F46615FAD9899B4D285C05E8690B6A higashisendai
302,401,844 *1DE7CBD140D24CD78A97A131BCE96D2C861DB6C1 91LANCE
302,401,845 *1DEE2E9A31C5CAA76211F70541F722D54095D6FD [email protected]
302,401,846 *1DECB220226C2FB852DD11B0F3112FE6B2CCA312 943683 turkisonunicindirkibirguctur
302,401,847 *1DEA9DD576CD7ADA009CDFB82214333EA9EF50E2 9AFFERRINO
302,401,848 *1DE2215161DA53ACC9D00AFBC9D34822742253BC 9BRKWRTL
302,401,849 *1DED2389302B5B613791D7923BFA9865FD9EB989 9CALLOSITY
302,401,850 *1DEAB883F60F44987DB65142F03A67F6CD9CEC30 HONG.KODAMA
302,401,851 *1DE0B31651C16533EF32AA467A040DB9E47E8ABE HONGRÉES
302,401,852 *1DEE4243EE8FEDB6312BCD0D1CC1C64833105D89 hope spring is eternal
302,401,853 *1DEACA853C7A7959F0F4AE23706BC32D6F20DAF2 9GOATROOSTER
302,401,854 *1DE527DEC5DFA057D9A6166D1450FC46A3E1A051 [email protected]
302,401,855 *1DE1A0E5C8576BCC8421E000B7F7B504A0F31D2B 9inquisitorial
302,401,856 *1DEE242B6925DF24A97F84642C17B5E281D406EF HQRKKNZAXUFZCIWWO
302,401,857 *1DE101B256FFF0E9B4BB366E17F208B430BD7311 HTTPWWWFPPCOUKHIM
302,401,858 *1DE6987660921E2EA8143CB6D73FDAAB9221572C 9TUPPERSP
302,401,859 *1DED591CF97386F6DDE1C3F40E372154638382C0 9VDSVWVNJKVFCI
302,401,860 *1DE26999E47F957090100BF508969FCD39CA0D49 a0m5
302,401,861 *1DEA394DFAEB1E09E1600390DFBEE02882E0AD8C hugotorros
302,401,862 *1DE27556853B15E060463463FD1E5867EEA194F9 HUMBERTOGEISZLER
302,401,863 *1DE0F243F683FFC5F33CE09C01A95A26DED2DB05 [email protected]
302,401,864 *1DE7C59E90006CB755059E12D4D08296046EFAE8
302,401,865 *1DE687143F80B38B53B37B439CB9C7590038556D
302,401,866 *1DE1C30BA7175BBF10D2F821E984F63111C19901
302,401,867 *1DE7C5B480DB17743A7C61615FAB007485838DA9 hydrarg7
302,401,868 *1DE0FBDA2D5FBCCB90BDC8BE021AB703D9CEDD69 \
302,401,869 *1DEFB9ED92E0741135D43B672CEAB933F6C80BCD
302,401,870 *1DE00596A153B0D8AB359B398FF7C8D8E47808A3 I$0CH0L3$
302,401,871 *1DEA98E8408F202DCF26D3DB63BB49E39C778242 i0geaaaaibaj
302,401,872 *1DEEA102919708EF65E0A5D0124EEB8746A70F04
302,401,873 *1DEB3149937A7AE962C68EEB16AA9353E1D563A2
302,401,874 *1DE31F79B7FAC7E3DBB90C96E492CB02ED756E37 IACCEPTIMIGHTBEDEFEATED,BUTCAUGHTINSURPRISE,NEVER
302,401,875 *1DEA6597C6C89B12D355DA7945253065B6928D33 U
302,401,876 *1DE0EB7C9CE5C11E25A4286BB98EBA1EF39CF7B1 iambryan67
302,401,877 *1DECDFFCB03824662987433D32C54372AA2ED975 ^u
302,401,878 *1DECB500D94632D65186FF807BE8A567CB48505E IAMTRUSTNO11992
302,401,879 *1DEB582145E79DCAFD42D422C62F0CB2DDF414D2 
302,401,880 *1DE63EF4B7A09FB1FEE3835C6B49461F39498E42
302,401,881 *1DE250F9FDD7333815869463FFA4244FECE4BB7A 
302,401,882 *1DEA4EA69A8E0E2B4CD49EF40890575D412511C3 IEUGENIC3
302,401,883 *1DE2A750C57B7FB8D1C5DBD25C8D9C392A79BA02 IGOTTOROCK(FEATZION)
302,401,884 *1DE803883BE53CF8B22B298BAD26C499355AEA0E
302,401,885 *1DE8A619C2F3571AB4223304A94898BFE93BDB38 9In
302,401,886 *1DE20656191889584B4D026F50E0E5D4C1F1F527
302,401,887 *1DE16B8A147DBDFE8961C7C67FC0E29605A18B41 8
302,401,888 *1DE90819B476C3A669F499179994E11319CA4867
302,401,889 *1DED42CB05BCCA6EE601E19E0EC234D4C4B4F0DE 
302,401,890 *1DED8DE977444A9ECE194BAAEA516D5A4ACD3A87
302,401,891 *1DE6A30F0FE71B02ADC6C34AA9201C720DC124BA |ږW
302,401,892 *1DE1CA3FA5119AC29915A7889110C77D330F2495 IL-MESSAGGERO
302,401,893 *1DE189F18D4A4897FC1E72394BA1851927032956 iluvdonkey08
302,401,894 *1DE00730D1590B33A343E4F69688265535F1D582 ILUVRICARDO12345
302,401,895 *1DE93447F3E1F853FB80C5B19A5F9D9CFBE7A28F IMOGEN
302,401,896 *1DE5A44954FF8ECD5E911EE6D29EA50E17C1D7F9
302,401,897 *1DEA4A44701A6DA8E6DA684B0E52ABDCCCB662CF :D
302,401,898 *1DEAE3F85D4239B165E7DAD4FB535E402C08658B INCIDENLS
302,401,899 *1DE5468798FA953C8CED1732CBEB427ACE078D53
302,401,900 *1DE741661FFB171E1F4598845529518A25A93193 c|D|SV
302,401,901 *1DECE6C22528708AAF1C92C73225C280E23CA41B 
302,401,902 *1DE323983CE8160D3E688245AF0BCE9923609596
302,401,903 *1DE57D1332C576017774021A4CC43C7F0F585CA0 W
302,401,904 *1DEB730A7D81039C9EE333439E93E48CC07C2764
302,401,905 *1DE11CCC806467A1FC252437EDEA1F4268D54931
302,401,906 *1DE1ED3D16B014BAE21825CED3EEA088D0A1F06F l
302,401,907 *1DE5B8765A81B0CC411194FD13F059E87757D404 
302,401,908 *1DE4EA7BDC4EF20CDCA57925BE0E70130DAF415C B
302,401,909 *1DEA04C9CDC55822255243DE18B158CD5FE8DF05 
302,401,910 *1DE594E8B3F160D18246C38B91B7B416438D1377
302,401,911 *1DE3DB794F2B1760AF25EDA887593438793953A3 
302,401,912 *1DE0D98B79E74BF3A248D9A4A464C0B7F6ECB555 
302,401,913 *1DE0BF6A43608D8839A7F73557659AE49D109885
302,401,914 *1DE5CB9D1ACA1FFDA3489FF27D5909133D64B60F (
302,401,915 *1DE54FA8CB5FA634A45BEE1E059DF1EF37CBDA94 I-NEVER-NEEDED-(EUROSIZED-RADIO)
302,401,916 *1DE18F183329B1623CC83944FC1ADDDCE64BE90B into-her-womb-convey-sterility
302,401,917 *1DE4746D002007089E394E21AE1BB5AC28FECE94 c
302,401,918 *1DEC01768A6596D89F9711351A4584B170A93FC3 jI%
302,401,919 *1DE8C2BF2187A05D00FDC4E8DF81C04DCEF99224
302,401,920 *1DE8160AE33C0BA1D2C4297A67B3827451891EE1 IRA.BLANKENBERG
302,401,921 *1DEF62BAAB707D33B12B49B08CB05889A4B51C2C R,>
302,401,922 *1DE933E5A0DC12660427628C95E973509226A66B nOq
302,401,923 *1DE193D0E7FABD8607D0156EC3DD3331D8681FBD ISAAC.KAER
302,401,924 *1DE8E974007993419A0C0371A28664D13A540C97
302,401,925 *1DEBC3471A71F1D4C377D9262BFC132E49668B94 qQ
302,401,926 *1DE282BC654E32350D6DC4FFA8E7A1B969346598 ݑC>
302,401,927 *1DE20C5515AA135A911F76D90F2037E66458B09A
302,401,928 *1DEE90249BA5566E8585C7F1733AAC317FC187C7 (00) ~` ~` @b
302,401,929 *1DE1AFFABB91F2201473EE805DEEF41CA661B4DF IYUQ
302,401,930 *1DE9D417C1332F178AC691592CF245057126ABEE JAMELGRAGEDA
302,401,931 *1DE5E06B1FA33E433057F9FF9CA51953AF147734 11HUSTONIN
302,401,932 *1DE3999DD5D32F8790BE6ED0EAF9759FDE120485 12:12-#-&buyer
302,401,933 *1DEAD2BB63A131DE9BC7D513C4D5AD6F43EBFDA2 128KONNER
302,401,934 *1DE8215AB18DCE0A45D7DF4DE2258CBC283D5523 JAVED:TUPAC
302,401,935 *1DEB274722D3DC80A6EBFA80C9D13827524ED004 133577 BITKI.ORTUSU.YESIL.ICINDE.YESILDIR..
302,401,936 *1DED2EF991E0880C7549887171BA9BA8103EA9BC JEFFEREY.STRAWTHER
302,401,937 *1DE0D6579A79609A7430E4CB1703611BB87E524E 1430324 ENK
302,401,938 *1DE6DC6B04D5B21F551222A10228185A47AAD89E JEFFREY.ELK
302,401,939 *1DE11A59A9CDC45C3F238BD745D39C2C3828D708 jeffrydanz
302,401,940 *1DE55B52077FEBFA693A997F18FE10F70C0C0FC2 jeffryplemmons
302,401,941 *1DE7C033AA802E050DEC7C82042853003A3C52A8 14.yapamamasI
302,401,942 *1DE006E86BA24ABEA939A055C101F1EE5B3A98E7 JEREMY.KNIPPLE
302,401,943 *1DE0B81560BDC8B705015465B821A0EF5ED2C869 16092006CASTILLO
302,401,944 *1DE652A5B520A58C9D02FBF64E6A01055DBD1D38 JEWELRY</SPAN></A
302,401,945 *1DE47C26701F9B6740177256173B313B3B87761B [email protected]
302,401,946 *1DE1EC440535AEAAA975B93C5C32F3613FBDAADE [email protected]
302,401,947 *1DE9C88D59DCCE28568FEE0400F58DC8F236CF77 [email protected]
302,401,948 *1DED81DA1BD63E32807766C692F0DF34F38E3ECC JIMMYNEIGHBOURS
302,401,949 *1DEBA194807D446F0633E0AB91F20B660D13961A 1951FUCKME
302,401,950 *1DE562A5C798A706BBC9EA5835498AE84C1CE60D [email protected]
302,401,951 *1DE1F157166DA21665023F28F51931FA0014BD01 JOANARENDSEE
302,401,952 *1DEC3B63F38FB935BECDA6F4ADE2E69E9BF2415A joanmckendry
302,401,953 *1DE30CF08B46B4E0774562F0A02DFB1FDA026FD7 1.ausorganisatorischen
302,401,954 *1DEA1F4B11B9C42CFAB36A012C914865AC83BE06 1BACK-KATALOGIA
302,401,955 *1DE4002ABAD8C4F9FF7B7579B046C05B59894A4A 1.CASE-CRACKING
302,401,956 *1DEBB5ECAB63BB0969F2F7777D32BBF13B117491 JOHNNIE.EVERS
302,401,957 *1DEB57309D76C6CF169CE9C260069E0472F5C1BA 1 cdrombasierte
302,401,958 *1DE62BB170E50E481BFE14D281B29BC2FED0A209 1 crosscontaminate
302,401,959 *1DEF1B5D291F542C1B85840C76264DD44C8BE669 JOHNTHROWERMUSIC
302,401,960 *1DEDD93068D882E08714BA94DBA0EDD0913A5C4F JONASZELENSKI
302,401,961 *1DE7B415131109D7DAA2F7BB59385E1E660BD7AB 1ELBALUCC
302,401,962 *1DE5F6007C2906E41306B4DAC8FED732B7F74D93 jordanbasso
302,401,963 *1DE910BD46D5222670F4D48DF6957B0152115964 1 FORSCHUNGSPLANS
302,401,964 *1DED50E55FD9C502361655A3FCE524221C7E11CF 1.fytonomi-koulutuksen
302,401,965 *1DE5AB5764E3FAC7A48512F9261B466A45BEBD5E josiahgiefer
302,401,966 *1DE7B8927AB6AB348FB6E4903CE0D6AC372CECDF JRJBAUAWT5
302,401,967 *1DED1830E5E961C364D1FC0B912E1A481BB0F95B 1 JAZZ-ARKISTO
302,401,968 *1DE88F1851745AA904BBB164EAD76B02ED959E43 JUDE.MACHNIK
302,401,969 *1DEC44997FC04CDF1925C4D7BF546CBC9B4083FF 1kivel
302,401,970 *1DEA337F2AC1415F6D5E101F64BAD0BDCD3318C7 1.MASSABIELLE
302,401,971 *1DE7C27733D3AC0B47EAB44FCFDFEDBBA5BB59E4 1.MILAA
302,401,972 *1DE9748205D3B25468E30E89C243AECF9B08DA11 1-NUSZ
302,401,973 *1DE67C38C0600E81B58FE08823F1A0022E853CB0 1 PEKER'I
302,401,974 *1DEBFAB14BA2C2F17E71683BCBC4F319ABF407C4 1PIPAREFORMEN
302,401,975 *1DE2456B5753282EABF4AC44F23DD3264DB6C5A7 1.RENTENVERPFLICHTUNGEN
302,401,976 *1DE11A4EEC95C939791588E715D9F638CCB5A4C2 1 ROTKNIEVOGELSPINNE
302,401,977 *1DE45E15A5145F5D940EFD79B1831F5E219D2A12 1.spielberg-lucas
302,401,978 *1DE19948983CFE1AEC7F15B4E372EC26EE27BD7A 1-SUERTZTE
302,401,979 *1DE0C733C29CFCA8130EF8C963F589AE7C27C658 1SURKEAAN
302,401,980 *1DE8788593DB8BDAB8EE9D0E5E2A84020CA4B069 1 tositej
302,401,981 *1DEA037FE6C21BD38E0063800ADE913D265254D7 JUNIORSTAV2007
302,401,982 *1DE672592CC5147B4B2B3DEB86423E0E98BD817C JUSTIN.SAMPLES
302,401,983 *1DED7F18725DA231BA98C3E9EAE2CA1FCCA30DD1 2007年5月号まで「ふんわりシスターズ」、以後「SMILEすいーつ」に改題し、2010年5月号まで連載)
302,401,984 *1DE5F2205EAB4A3FC415560A95158995820C1890 KAREN SULLIVAN
302,401,985 *1DEDE3451F2935B02FB5C8EC316D55B918651443 karlvoning
302,401,986 *1DE64BDCD9446D478BDD7A8A63B214ABEFAA60D3 2127011 "THISISALLMIKEMILKEN'SIDEA,"SAYSMR.HALL.
302,401,987 *1DE693A084D271D202F8A46EF97B0FA99925B5F0 KCOSNIWP
302,401,988 *1DE766FC2BFCFA7B1A11A4D5E82A98633EA5B22D KDNECARU
302,401,989 *1DEF077917747858D624CA37BDABD92207D8FD87 kdu
302,401,990 *1DE6E06DC67054C483CAF4DC97C536518D354244 kellybuczkowski
302,401,991 *1DE9DBE65935279346EEC7D7D72E57FB789C8206 kenetteljes
302,401,992 *1DE8243A6664CAD84C1701B238A95F02EF2F2A75 KEN.LUGER
302,401,993 *1DED11480FECCD1831C844EE5DD8CA106514AAF4 232860 helppo-tapa-ottaa-teihin-yhteytt
302,401,994 *1DE38ED10D00980A6993430BD36966563C77B996 2347591 ANTICHINESE RACISM IS ALSO RIFE .
302,401,995 *1DE3ED4B53F77AEB789F77F0FEFD49D2C0FFB598 KEOE
302,401,996 *1DEFB490F0662E567FA85DBFA488318266232E01 2577859 ICH-LEBE-DORT-JETZT-SEHR-GUT---MIT-MEINER-FRAU-.
302,401,997 *1DE488134B739C76EC34826C90CE692C61A5E196 KIBERITI2
302,401,998 *1DEE89A1B8F7B6C11B81662D745907B81340CB36 2ARGANIUS
302,401,999 *1DEEC46DE1052E069B5C059EEA18E9622EEA8E65 2ASENNUS-HAKEMISTOSSA
302,402,000 *1DEB105DAC11A6F274E13CC5F73E0A1366B93B3E 2 BILLARD-TISCHE
302,402,001 *1DE852E18F56F358082F5DC4FABA6F97CBE95580 2FREELY
302,402,002 *1DEFE4F0779D803801F5E1C225E73CBC76936127 [email protected]
302,402,003 *1DE710FB20F1F126884E913E0388B4B2E54FED7F KORYTUAMOHELOA
302,402,004 *1DEA17D2C0CADC645E6A7413CAE176D8050F013A [email protected]
302,402,005 *1DE51D777711573E5C543A198F160B0B03297A97 2MDDLWMN
302,402,006 *1DE53CA92AD27645550F0685DA0CC43B63505181 2.PORTUGISISCHEN
302,402,007 *1DE529D7C5FB7F8F3E630D48D52BBBFC1A176822 2PORTWOOD
302,402,008 *1DE0C09C1056FC56E52B6A778CE5534C8614E71E 2WCOMING
302,402,009 *1DED502A50198FCF0BF59C9BDC0C4459FB28A7DD [email protected]
302,402,010 *1DEAE59761EA5159C811623B75156A2369896121 312SS
302,402,011 *1DEA2BA2AAB32F1F45401DD9BDB26560DC5A086F K{YTT|TALOUTTA
302,402,012 *1DECFEDF6A1B44006AB636A8A7C7D64A9189FAA1 365029 EUROOPPAA L
302,402,013 *1DEA89E404CC44AF3DFAAF8894AE90D61F853E9C 3B<--O~0~-Q----8
302,402,014 *1DE42A7A47833C6CF26034076314FF78858A2A13 3GOTRIP
302,402,015 *1DE961C7B94B9219DBF562FBAD7BDF57B4FF952D -.LAUK
302,402,016 *1DE44F0EE01650E9675D9528DB050E87E6A2CFCE 3MLTTBLR
302,402,017 *1DEE26BCB88DFDB6DC2CB85567AA1F35B4F32674 3ORCHIDOL
302,402,018 *1DE648AFEF2C88B58BB7D4F096509F36ED6663DB LECTOYIAG
302,402,019 *1DE961E161F940E7FD5CB67974D209E7C351227D légnère
302,402,020 *1DE772CC57C09055BEB811F9CAC33A858229C659 LEINWANDBAHN
302,402,021 *1DED18C82AD42AC78617C4E9606A9C415F885500 42KVICNG70ANQIVR
302,402,022 *1DE3B53B934A72FA197D133AB45A8D6C260D934F LEOJOERG
302,402,023 *1DE50510B6E06DD388CE3EC7861A2B96CB2AD889 4831d03d257c7fd486256f2d0050db2e
302,402,024 *1DE021540170C3C2A66F978A5FA7F68C1D514A37 leslee.rogers
302,402,025 *1DE0265758DBBF076CA42825018B3AB73E888CA6 leturbosutlet
302,402,026 *1DE02D1F8BD00552E7BC9DB8F438364F930C725E 4KAYLASLAYER
302,402,027 *1DEBD4FBD9DF15190EBFA96BB195D6E8072B8ABA 4MORTIMER5
302,402,028 *1DE4E9FF505ABD15155DE095FFEB46ADB1A28928 [email protected]
302,402,029 *1DED59C35015A98A4A195D9E46868A003DC98707 [email protected]
302,402,030 *1DE589FB09A46C641B85D002DBE9DFD6EF913EBA LINDA.COMPANHEIRA
302,402,031 *1DE51513162E846A486143742C46910BE6A69EFE LINDSEYNEGRETA
302,402,032 *1DE8963D826146F36488C396260A070C8901F0A9 LIONELBOOTHROYD
302,402,033 *1DE9DE9E02D5F9B3E282FD96D8AC1469E053E859 4TINTINONLINE
302,402,034 *1DED2055A6A86239A5FC880DB4A452616AD40059 4TOERSTIG
302,402,035 *1DED39A38A63DE435DCD2F6BAD597BAB0A735C11 50-COUNTRY-LOVE-SONGS-2
302,402,036 *1DED460260BF25866FF2CFB2FFD943FE0B68085A ߣ2
302,402,037 *1DE4F8CC6EFCE09FB68F2ACB6B843D8384BEDC55
302,402,038 *1DEDF59B2C88D09710F7DA392B8C31E5C593CAFB
302,402,039 *1DEE35E793EA5E47342ABCAC5327C6767940F4EC
302,402,040 *1DE6CB8A9839BA67FBB501FD99E2D576BB3A7943 ͈ts
302,402,041 *1DEFD1476196184333F830DF388DD686BA0F965D dx
302,402,042 *1DE458A0B0F632C30E85B423BE74E204BFCB7921 5CONTORTIONEDA
302,402,043 *1DEC0086127BDCCEF893FE045E906BE016B4E2ED
302,402,044 *1DE0A28B529D31EFC787798F2EF863A0B4409193 *
302,402,045 *1DE096B597AE099D2DDEA2D98851C00023D75191 5FORECLOSURED
302,402,046 *1DE3F526709F20D2F89EC26DCAA83BA4159C2378
302,402,047 *1DE524CB076E1ACD78C029C390F9E756B50FEC3C 5GNIHSAWH
302,402,048 *1DECFE85DB1B7421FD1EE335366B6F11E4F227C0 )t]
302,402,049 *1DECBB1C6F961C95F6FCDA58829F2053004A2E6B 
302,402,050 *1DE44AA3280CB9DC3AE83B1C226893B85E6DC74A
302,402,051 *1DE224636098417A65FF2F64E1208DCC1EF94D00 5HERSHEYPARKBSW
302,402,052 *1DE650F2448A45617F6C851265CEFA49611D8560 5JIMBOLOVELY
302,402,053 *1DE0A4000C0D0F875D2CF261496E000D7B7E12BD =<
302,402,054 *1DE6BE25171871F2CF0C9E1E372330FD33E5D997
302,402,055 *1DECDB086C3746582912D610A8D7F143A810F27C c
302,402,056 *1DE0F9E705CF3930CD2915C6BF1C88B69DE17ABD 5MPLELIKE
302,402,057 *1DE29FA5C9AC7B8D364AFBADA431D674F1D91811 #
302,402,058 *1DEAB6FBA62E0AFD14D26D4A9AB3984B59958D8E r
302,402,059 *1DEE7974AF238FC03C5AECDA4CF266C91EB30F16 _
302,402,060 *1DEC2448C6871BB8F558986BB50FC1E742150381
302,402,061 *1DE14230BEB46E0F490993AB6FB2E40E0E0ECBD4
302,402,062 *1DEC1EB4215A59620EFC0BA3D39F00CC27672B59 5NOURISHERSES
302,402,063 *1DE2C50764D10BFCEAB2E29936372B8304B9F2C2 ϳ\
302,402,064 *1DE8C96A68C896D2B94721F769E445A48960A66F
302,402,065 *1DE776BF9F96032237C8EDCC8EA68A4344F7D725 5PRIPOVIJEDANJA
302,402,066 *1DE30E9B1DB673015A8F410972D5E29236EECDB9 u
302,402,067 *1DEF4E0973C40010AA68BAB950893438FEC200B4 5prolongeer
302,402,068 *1DEE4CB2A67CF310707703C810ADC39015007A71 5RETROGRADAR
302,402,069 *1DECAB7726B328CABF4AA1E7B6618EB2D00964DF ^w
302,402,070 *1DE4AB3A51C4C873128FDF9F2DF64A45B15D6D5C 8
302,402,071 *1DE53CFEEED8693B9E25FB616DB5E93D5024E5DE 5SEYANT
302,402,072 *1DE1C02C519CD3EEE7F98F299C2A37B84A60B700
302,402,073 *1DE422D8CE1899F6A17941B41E4346CA5E7777AF
302,402,074 *1DE19D60F42C206B917199575AA8FEC5A44FE7F4
302,402,075 *1DEF7EAAEB5CEA53A222E4ECA354907E94918AF5 t
302,402,076 *1DE8268066CE565CBCF1AAE51711E8C22B9714CD 5TIAREUTA
302,402,077 *1DEAAA860E387B19D2A4B98E804542FB34832AD7 5VICTORIAONE
302,402,078 *1DE55C42F730397CF90DD06BAA19316B93D23CDE 60-FADENSCHEINIGEN
302,402,079 *1DE866F6319290BA08F9669BF598882CA69A2922 688GUILLERMO
302,402,080 *1DEDC5CDFF48EDBC11AE7F20859635CF683651C5 6AMNESIX
302,402,081 *1DE2CEA853E70A71E8B2522984D39B116D7905D8 6BSWRCOATSBSW
302,402,082 *1DECA6161EF115D48FFA5162F348BA759E4BCEA2 6DRZITELKOU
302,402,083 *1DE415BF769064FE6706A95CE728975A341AA559 6GNIDAUSREPERP
302,402,084 *1DE813F7BFE56E4D9EA7B19907FE57C27A601673 6ilovearsenal9
302,402,085 *1DEA92410303D6D29B4B1E8FDA70371FA1963240 6LAITTOON
302,402,086 *1DE4A2C2FF65F697C7F5E2878D7446FADCC3614B 6PHEWTERER
302,402,087 *1DE0C17E9453F6F184569045B54DACA0ADC5D857 6PRIPRAVNOST
302,402,088 *1DE5F3D14DB6FC666EB8FB49B07C963689C2150F 6REGALIE
302,402,089 *1DE5A8FD8A0794FE794EE8FBF8E70E88FDC5F4F7 6SPLENEMPHRAXISES
302,402,090 *1DE1E3705F15855F415EE3C1E4125774888EDF03 6SUFFUSIVEA
302,402,091 *1DEEF9936C5ACF2AABC54C9465B01E4D2FD6F5CA 6TANGOBILLY
302,402,092 *1DE1D69A6F6CB89088A83209E2F690D58A14A363 6UITSPREIDINGS
302,402,093 *1DE8329FC7AC70FDE83AB3F5F73076039406F90E 6VAPAAMUURARIT
302,402,094 *1DE2AE65583A1C3ED11C8F706196C5D1BD6661BE 7bedgery
302,402,095 *1DEA927376D8FD7559884BECB6F4B3C45A40523E 13-SASSINESS
302,402,096 *1DE2C465E09D0C536F6C03E9F7D8F88A98DFEA05 1443186 TOIMITINSIVUAEDELLEEN14.4.2000,NELJ
302,402,097 *1DE02D9178BB3E281D7FD0A93E22016D82CEE88C 7IAMSONICS5
302,402,098 *1DEA3E8CF5B2D3BF4B5B6ACE1F99863B20C13457 1664768 france-t
302,402,099 *1DE37C154CB8FB500FAB756018951DC1779A7574 18apr1790
302,402,100 *1DE338FCBB27E342B37B9608EE6280FC9F703AAD 1-ALAISELLESI
302,402,101 *1DEB65D11A1CE92415B5E41E25F569B6719B6862 1anzufreuden
302,402,102 *1DEB2B7C07CEF2A3D981D56904D010AD1F0608A1 1CRAPIZET
302,402,103 *1DE2753718AF4C413B0E191FEE414E861BF7778C 1 culturepeople
302,402,104 *1DE2040C226CC3A5CBEB7FA568BEDD48910FFA02 1.EBRD-PROJEKT
302,402,105 *1DEFF1168DBE66130127945BD3C1640CCADBC2FB 1ehapavertriebsleiter
302,402,106 *1DE1F8C4EC05CB210B34765D018796B8A425AEA0 1 EHYV
302,402,107 *1DE64554820FEEE8133953AE7F174E5D44F0EACC 1HYPERTEC
302,402,108 *1DECF677B571F5E57D516129CDA4049794132078 1ihannesoundini
302,402,109 *1DEF9D4C8E3439A4BCDB17D1AA7546FD6191AC81 1-KOIRANJALOSTAJIEN
302,402,110 *1DEE60DC585E80B981D454935729CAEC2248E127 1-KURCHAK
302,402,111 *1DEC7043F40433E2E42C0386D1D9E08E9AE76F54 1.LAUTAMIESKUNTA
302,402,112 *1DE5C751B17976632AF115BF9BEBBB3151D280EB 849459 hunkar begendiniz servise hazir .
302,402,113 *1DE54E62B5C25FC49B874EFCE8873DCC56BA3A20 8A4AJA
302,402,114 *1DE885717EEAE5CEDE85ED736682F06ADFB78ECB 1paratuamor
302,402,115 *1DE1E2AF9B76251D74C190A628E509B58F566563 8BSWJFMIPBSW
302,402,116 *1DE9769FA302B024F986C097713AACFAA24EACE9 1.PROVISEUR
302,402,117 *1DE9AD122DC7CCB134AEEEF57F7B202845FB8AAF 8D`~)0(
302,402,118 *1DED24442FE57D337AA222D3229E7168ADE8C06B 1-sills
302,402,119 *1DE5B653E20ED0DA9A8DD5A9FCAB0EA492D434C0 1suostumuksenvaraisten
302,402,120 *1DEAA260AD6168549C168162B5C706EDEF8C0BA8 1THETATA7
302,402,121 *1DE8309AFBBAD15DC7DB1483AB3652EA9A28F67F 8IR7HR47E5
302,402,122 *1DE8357CE063109D14D25836C33E0BC86099FD5B 1 WAAGERECHT
302,402,123 *1DE7C309F7F413C1E01AF586A829DDE5C53BB4CD 1ZBIRKAMA
302,402,124 *1DE57DA92D49B01081D1250D528A6EC841FDC3B3 8NENIMELI
302,402,125 *1DE535B0DA1D6D4897E424B4076AD38F386B63E2 8OGIUSAM
302,402,126 *1DEC5FC9DCDBCF6780C152867172275C95F20AA8 2175475 THERE.ARE.SO.MANY.VARIATIONS.OF.THE.SAME.THING..
302,402,127 *1DEB8268FCDE8CF5CD2ECB64DBFF28544A487075 228672 darunter : " dem unbekannten programmierer
302,402,128 *1DEB76B01EA1E3AC698B23AAFEC7048E091DC1C5 8STAUFE
302,402,129 *1DE9DD8149EDC14A6A10C6CA1F3A39AE971FD767 8THCLLCTVSM
302,402,130 *1DE64DE333571BC06EF21876AF07F23CEA2550BC 8###>.`~.`~(x)
302,402,131 *1DEB3A6267462F39A3E167316C816DC5112B1427 2327142 BRITAIN.SUBSEQUENTLY.REFUSED.STEVENS.A.VISA..
302,402,132 *1DEA4E88DD67F725FB53B7949A0208F21AC34696 986346 BUNLAR KURALLARIN UYGULANISINI ORNEKLEMEYE YARAR .
302,402,133 *1DE7ADE576F32395D05F91729A06C8A130FDBD09 23JAAA
302,402,134 *1DEB4A5E3B4C8EA824DDE6AF43DBEC13DEA14111 9bunchiness
302,402,135 *1DE323157BFF99EFBBEE4F9DAEF001003D0878BF 9EXPIATORIOS
302,402,136 *1DED11139159119C86B049289DEF8A0A74C53428 28 PARAMENTE
302,402,137 *1DE8AA692E9C4B972568DBE332D28A4EBDDBA899 2903314 SIVUILTA-VOI-IMUROIDA-ITSELLEEN-OHJELMIA-TAI-K
302,402,138 *1DE5869D732EB7261F0AF3EAEAB4FE2B0E7C68A6 9HOMEFROG
302,402,139 *1DEEBD025354183862CF0077F0DE6FD495695FE9 2 bundesligakontrahenten
302,402,140 *1DE631573BFA808BF7F68497C2C04B253FD6DBED 9MAZINGV
302,402,141 *1DE7D3216C4C56006B2B6D5D9E33BA92E3E3BC6F 9misprees
302,402,142 *1DE3F9333AEE1A095B7901D437D84FB981036191 2-etusijaisj
302,402,143 *1DE789C9EF21713FFA21C3C55D78478889C601C9 9PAROLA
302,402,144 *1DE1EC599F28EA955D7139EA47529DB0F9D84A2B 9PHARMAZEUTIK
302,402,145 *1DEF2152D747B9BF1F6550D722BFA778E3AE5728 9RETPMOC
302,402,146 *1DE961DA723F891C8A2003835771FBB70039F1C2 9RVNCHPRTJ
302,402,147 *1DE2E6DAD1FECC87C365556F3A2049EDD0934DC4 2 laidlaw
302,402,148 *1DEE87B0140258D8F50492319F5642CE045A491D 2NAMHELKR
302,402,149 *1DE8878C9A387E36185D138EC02B5F5530F9AA4E 2-PRD'S
302,402,150 *1DE7C9E5A3EEC799E2F4409DD2508742FB2FACB6 9TESTTESTOBIWAN
302,402,151 *1DE985CD004A1D83F2BA95BFD858EB9FD306E18B 9WXPCYMJISY
302,402,152 *1DE46EC75346D7457C5DF237CB293D5242A653AB 2tv:st
302,402,153 *1DE41271BE4DF892AFDE0419BC863410E7D4947E 2UITDIEPTEN
302,402,154 *1DE7C46997E8B8C674AF19AE04A6B008FC37DFC7 2YYD
302,402,155 *1DE62A17266998FF7FE50AF1F3A0A4C5363203F9 A0OST
302,402,156 *1DE1338A0BDE31B7DC0BF61E205C65C54B525973 35H7-RER
302,402,157 *1DE5C8BD19519DBE77A8D48F24FCDEE913EC7524 a8?pd
302,402,158 *1DE94DE503753A6049A176395DFF9B166C7062A0 aabmg
302,402,159 *1DEE741CB677DA0424902793023314FC24FE2F2E aac>l*
302,402,160 *1DE11890EEAB87758DF9566BCDD4FBAFF2800D49 AAQ:
302,402,161 *1DE45F60897F00D28769D7B5209C897DF41ADC40 ABCDEFLINDAED
302,402,162 *1DE1957E5EEFC2F3034B50F30700F6B42CBCF824 453.RANGIERT
302,402,163 *1DE008AF670D84BE8E27AE51A0BE664193EAD72C 49aは2007年6月29日に初飛行を行っている。試験では推進力をさらに強化し360km
302,402,164 *1DE5275529C4BE15C5B60EBCF188E58D4573EED3 4DM!N57R47!ON
302,402,165 *1DE68D329A76FCCAB38CD777A1D98CD002EC076D 4ETEUGELT
302,402,166 *1DEA30CE76FF7811F1123F01148AE75656ED301D 4EYHWETKS
302,402,167 *1DE4152B0BD1CF207DFBF90D076CC0D8F0755459 A&(BS
302,402,168 *1DE9164FEC80CFAA169DCB98361495BD83D24D6C ACURALUCY9
302,402,169 *1DEE21F52D68F4E30859420AAF51AAD820DF97E6 4PHORZED
302,402,170 *1DE90312694BCA76237BA57E4E6B8C45789DB2EC a?dkp
302,402,171 *1DE27D91856D6869101CB248C140BFF17E7C1F40 4SUNDANCETREVOR
302,402,172 *1DEF099D3E401E6E350BACACDBEC929CCE2126B3 ADOLPHE-FELIX.CALS
302,402,173 *1DECD1F51A079D3FE3DBCE677A47EABD43DAD504 adolphsannicolas
302,402,174 *1DEC0753E8EC02AEFD73474CF4EDFA56D8A08407 adpj?
302,402,175 *1DEC5B42BB1E6FC05759C1E816F526D5A5488C1B adtm3
302,402,176 *1DE0E2A040E1BDBBB6320F4EFCC675D84D87B3A6 AFU:L
302,402,177 *1DE5738DB045FAD1DB9555C1F19391ED028A033C A.HALSKI
302,402,178 *1DE015EB38884E63E3228898B2E0A5D2EC7EC998 5CNEASUIGH
302,402,179 *1DEA3766DA91E79F712C7BF09E305D903B569C67 AHUGGAR
302,402,180 *1DE1620A40AE29B06E64776636AF1F5D4211386F AI-KI
302,402,181 *1DEFCF53B1BD34D9754B4ED03079BD6B1A7B2D1F [email protected]
302,402,182 *1DEE36B03B10E9CB728EE333A2CBE5DC3AA0D67D aj-os
302,402,183 *1DE0A435AF708471DC397D492F5143C1CCEE7A10 albertgoen
302,402,184 *1DE5800EBAC159F3143D579AEAACDF1DB711064B 5LIAMDNESBILRSU
302,402,185 *1DE81A50E594E536CB38EDCE59ED58A64D6CB42E a.lesson.to.be.learned
302,402,186 *1DE6653061E1FD49F7BC7ED683573AE358A62C85 5-puulelujen
302,402,187 *1DE7859C7987907D4B9F895547EE721C839C5EEA alfonsovela
302,402,188 *1DE08C17CD5CBB24927E512CDA07D08636D34D7C ALFREDOPASCALL
302,402,189 *1DEBE8B41A18812132DF248D13D6B809DD316BD4 ALGEBRATAPE
302,402,190 *1DE31EFC07B53A544E9DD37FDAADEFC27A73BBAB ALICIA HELMS
302,402,191 *1DE4DB9B1764F4DDC41369FEBA708F4C795CB352 5SRGERANDENES
302,402,192 *1DE1A9DA6725999D3BD011495A0C773150004179 ALLERGICTOHEAT
302,402,193 *1DEFDBA9F545B4130FD250CA351A490B973586FA 5TGJQVGVXE
302,402,194 *1DE689526F656F71A8ACC465C1CCFD0D354F7862 5THATBRIDGES2
302,402,195 *1DE82873CC84AB65ABE223E89786DA2667D9B2EA alvinlevenhagen
302,402,196 *1DE5E571794281676774D6F87612630F30B8E5A3 621979
302,402,197 *1DE76F5CC5EC403CC0E2285B388E3940B6DC932E 683812/MAR
302,402,198 *1DE9D4CADDF0591C45758498FA476E71E9BF7B1E 6-abgeordenten
302,402,199 *1DE18396E10149E383E29B7DC879BD60502964EC 6-brenton
302,402,200 *1DE706A20126F58CB193AA9640E53294601E36BA 6BSWNOWHRBSW
302,402,201 *1DE016168AF5008BAC2E10A870B01E3B07E8C1D2 6BSWXDBFIELD
302,402,202 *1DE1D71D7E0F9883802F9C88FA5950028AA9C188 6DCUPLEMENT
302,402,203 *1DEAF738C7100E8DF5EB3C2021288A543E67C3AD an_a
302,402,204 *1DE25C0F8E93CE7E15963618C01B8601D88FEA76 6GOFISHGOBLUE
302,402,205 *1DE7CBAC0C4C6F28A1D9FD5E6A0ED16145DB5190 angelique-van-heerden
302,402,206 *1DE50702BA70A74AE5A3030FA48F5BC835AA0A9E 6IAMNISSE7
302,402,207 *1DE0DA488C8DFF7EC6CF6DFCA12E6E49E798D34C 6NOMINERINGIVE
302,402,208 *1DE9A7AF1AC492B554356B53A2C6E8907FA27333 6NOTANDUDA
302,402,209 *1DE834F671CA54207DD819105E06A37AFCF2C7A8 6SXB6MW8
302,402,210 *1DE8948FD6795242A370DEFBAD58AD6F62B758C6 a,oc-
302,402,211 *1DE742DA536192870D64DDA1C3459915CE2151FE 74285 ja-,-so-ist-das-mit-d
302,402,212 *1DE5192AA0BDE550B8CD92B039074FE746B8CD49 AOK650
302,402,213 *1DEF6B4525DCAD18C41494A3FB8F6C0A0FA38C6E APASTORALNOVELLETTE
302,402,214 *1DEEBF6A213275E513B6C2CBDB6632F22F4AF057 apparell1n9
302,402,215 *1DE143820F41E8BB55012F22930F5E038D34AE3E 7COCODALLAS
302,402,216 *1DEAC31805D89123E066129FE8DD5ECB08BA1C0C apv7i
302,402,217 *1DE94377E466C3179D7F12F6A583804BA958820A 7ETTIZJIB
302,402,218 *1DE7B2FDD88A936DC0EB4515EDB93A38F6406541 7EVAHJIRV
302,402,219 *1DEDFB0CE495DC3D4052E2E1B6A599C3B778D949 archivl
302,402,220 *1DEB18DAADD048A011CCDB882167AEA6A5F58077 7NEPROTLACIM
302,402,221 *1DE91EEBF04CBCA9AB325448D919D57CD9CFF68F ARIEL.ALNOOR
302,402,222 *1DE91D3FCDBEEB7A663DB0CDC0E6E0C28C2CDAC5 7PUJABAS
302,402,223 *1DE8FEE00A2802F87E6007A51845461F3DC0BBAB ARMANDOELTER
302,402,224 *1DEE5ED27FBF244D9BE65D3F56F40653FF7F113F 7REBRACINGS
302,402,225 *1DE0862DC92369A14BD6B9E8D3D5554F95DB1BF9 7TULITETTIIN
302,402,226 *1DE4C81C8E8B962123355F1C043B8531F6C903C1 7UNIFIKACIJAMA
302,402,227 *1DE147092FE29CD6DC749BC194AC902FFBDA8155 7WIDEHIPP
302,402,228 *1DEE9AE63643F3B120327C8C2AC427C8C1C5DB1B ARTUROCHUMBLEY
302,402,229 *1DE27CAFC227011142E9268070DF1AA57F098954 831946 NEIYIADAMDOYUMOLUR,NEIYIGIYENE.
302,402,230 *1DE2C62A2D296074A97261CAAE9FD1DBE7F5060C 866111 vuodeksi 1998 on budjetoitu vienti
302,402,231 *1DEA4F297EBABE66732C244BEB6048CFA4F03BEF ASDFJKLEDDIE
302,402,232 *1DE92DEE1FCF41699A54D8849066A914319E1C75 AŞIĞIZ
302,402,233 *1DE92199339E2C918A7A82EF3F6E361EF0A9AF17 ataduall5
302,402,234 *1DE5F324594330EF40E62407C31D906A1E41DA8E 899380 KUNTAKOKONAISUUTTA K
302,402,235 *1DE0DE7234771BC958D9D212D7BB05B42376FFE8 8AGENTSECRETARYSERGEANTSERGEANT
302,402,236 *1DEF59DE6A1A8D9E7A007E127627D8B0AFFB9D38 ATTEDEV2
302,402,237 *1DE6E60096D252CCD76B5420159F4EC030F53A1B 8H2BI9
302,402,238 *1DE22F78753FEB23BA698CDE5F618FB25908154D AUW?Q
302,402,239 *1DE59EE6B5630A2F96AF99979B7E68A2E7D9DD27 averymulcahey
302,402,240 *1DE236EAFEA48BAB906CF010863513BAD6ABDCC6 a,vv
302,402,241 *1DE168868502B3BB4158175B6804EC5C389410F4 AZ1B$
302,402,242 *1DE7BEC5628F002A3AB9BA9762706549F80380ED 8thatchrist8
302,402,243 *1DE3CE8E7B4AA31EEF77F8B6A951635B1DAFD202 923500 KOCATEPE MAHALLESI KOCATEPE CAD
302,402,244 *1DEDB14C0E2B35CD69A02F3D56EF7B756DADE0E1 B.6.
302,402,245 *1DE9F026C7486E0410511DB0656BF5A37D8C1998 b$)ap
302,402,246 *1DE8D11CDC77C2B90EED3CE964F0CFB33521D7EC 9COATEDES
302,402,247 *1DE5BCB4A1912776D08910465DA71F4EFDB98916 9DEPOURVUES
302,402,248 *1DEBBB43FFD8B763BC599BFE31F2FCEBBB4D5B32 9iluvhelper4
302,402,249 *1DE9112DD037DDFE498007E13BA98569DD3E2606 ~]'&a
302,402,250 *1DE43BDFE02A6E7FF68CDF7C02B729827271A24D BEERKENS4
302,402,251 *1DE2EFF6F06E1D9CA61EE4B00652ADEC1399BBFA A-1RYOTA
302,402,252 *1DE3BFF14D6D1E0A918E1A1C523C1DEA33914F01 a2g;
302,402,253 *1DEF4428F1C2503B53BA47205F5B0E2B7344A4DA a/:5u
302,402,254 *1DEDA4CC657C64BA6A7221C62D72258A449AD2DB benniewiesner
302,402,255 *1DE27297682E0A045363F175C7E1344B575C157B BENNYPLOTNER
302,402,256 *1DEC4577883AE1C129F1FDA046510CF89771907D a"9h
302,402,257 *1DE118CD22325AADA27B73948EBC69E5244428FD BERNDSCHULLER1
302,402,258 *1DE0556CEE085A65F4BB2D44101DE73DB2C17701 aaa7e~
302,402,259 *1DE855BBC340E329D4A2AF73F08C2DC5116FD944 aaace0
302,402,260 *1DE0EC6ED009D9285A9C1FB624BDFFA4FCFCD4DB AAEYG5
302,402,261 *1DE1CA9AFBFAC98AB983E3D62C2B547FEAC09580 BILLIEDEPPING
302,402,262 *1DE68B30C2177EA85D42F7EA9A24EE91BCEF2FB4 [email protected]
302,402,263 *1DEB191A1C8B77CD60DEFC3AD33A8851B6D0E168 ABEL.ALAPAI
302,402,264 *1DECA277130A0AF4FE9C1607FFF22680603E3318 BJI;
302,402,265 *1DE4E732E7C66E748CFDC8FEE246BB4E621E87AE ab"p=
302,402,266 *1DE2775F2242F96CB6996F3080DA42C849500491 ac/9
302,402,267 *1DE858F7B3CA05D9C0163342CF8225950EF624FF bm?ma
302,402,268 *1DE41F3847D58E3E78B956EEC1147D4869A33BA7 aco$h
302,402,269 *1DEF132809C23D9191CC584FE8F04F7FA09CADDF AD9FI
302,402,270 *1DED9FBC7735CA8968ED39D094AB5EC720B3A87D ADIE
302,402,271 *1DEC71C0B20A9B96A407775CF7C1EF923F252D11 aeobh
302,402,272 *1DEB79344F90BA5DF25CE58DE646C456B67EEEAE b#rb?
302,402,273 *1DEE01606C48185645F18D206AF01533FEE51FDC brendaheffner
302,402,274 *1DED5B35E947B46283972DE017A9DDEE549CE2D9 AGUSTIN.AURAND
302,402,275 *1DEA14E7A0B6DDA4F89855329ED3B7C13E8719FA BRENT BALOG
302,402,276 *1DE844D7E22CB64FF749A85C3B6953CC118F50D0 BRENTONBOGER
302,402,277 *1DEC8284F7EA6E8DD62EEF14163DD8ABC172D29C BRENTON.HEIMAN
302,402,278 *1DE26D22B2CB4154852F2A9C53B0BE74286292A2 bret.kanaday
302,402,279 *1DE0840646A722A1C72097AE7D2B5B66938DCB06 ahcax
302,402,280 *1DE82D097DED8E514EA911A8A9A9B17488FD5EAC ahora-canci
302,402,281 *1DE5529E1487866C5CB32A7299145B92F6EB9523 brmh&
302,402,282 *1DE018AC3F1620DCF809B0D23E7AA18F9B9CADD2 aiis,
302,402,283 *1DECDF0D18792DD612E1ECD2E199B724CFB3227A b&s0
302,402,284 *1DEFE476C6D7C1607A1C99826FE1422C9993716A btmsf
302,402,285 *1DE6784CC120AE59D6CD40599597C34731F321FC BTW&
302,402,286 *1DE38B5368DF47BD5A31198CD0C491343D87E0F5 ALBERTTEI
302,402,287 *1DE3E6DE114D3DB2061D9211E100A73AC9A85C9B budlitzinger
302,402,288 *1DEA048E6DFD3546AD809840F6BC9D75E3F4BDAB ALEJANDRO.SANCHIOUS
302,402,289 *1DE95EF9D46B5F96FFD7FDE0C67E70CE85F0608E b&up
302,402,290 *1DE756EBE04178BF916D05DA5F9B45C34C8556E0 BURLMARZANO
302,402,291 *1DE39487DE969B458FC08AA934CD625500F057B0 BURPLEBERRY
302,402,292 *1DE10C40BD15FC2CA70A6171ABB6F246CFDFBCA3 BUY(A
302,402,293 *1DE63C82AEE7DCAF60105E1A29711C22E313C276 allererg9
302,402,294 *1DE3B46D28739F6F0FF600C0D68D419FDAE619F4 ALWAARALWAAR
302,402,295 *1DE3A69B984FDE1F1293C9470624D04F9D93E4B6 [email protected]
302,402,296 *1DE97211F98195836F232D5E0D9945FD75963700 A_M"
302,402,297 *1DE07F8669BF6CE1F462C393B1F1B82462952A95 ANDREW.ABELMAN
302,402,298 *1DE8E5D93A32C0DA9DC97851AC124F7310D34A8B c8nb5
302,402,299 *1DE71B39E733869E52139A94C17DEF96416902C3 CALUDA
302,402,300 *1DEF4ADCD89D18A3AC3F1099E6F95B08745259D1 can7319
302,402,301 *1DEF2ACE1EC093E959D85B1AB801FD5901E4AA3B carlobarn
302,402,302 *1DE969783CE8C4FC923D587B83284F2ADF6BD5D3 ANTONIALOMINACK
302,402,303 *1DEF431242BE317F286ED9F40797CF1E93E485DD CARMELH4
302,402,304 *1DE06F11A21010065A4E4438CC76EA2EA850B886 caryvaroz
302,402,305 *1DEC434DA2C80F490D76BB7763AEB6D562E0FBEE [email protected]
302,402,306 *1DEB4E781EC1780C64ED0D5BADFAC12263ED2C5D CASTIGANDAS
302,402,307 *1DE6FB34F916E81F14E48BCC55D79FF82342966E apj7
302,402,308 *1DEB01864442C06BF34EA28FD7DB291DEF428890 CC%D
302,402,309 *1DEBB645126E15093D2FFC227076E7AD4B02FCD9 CDTI
302,402,310 *1DE1638A0653EB4D6E767291A3A7EE3A5446E9CA AruB
302,402,311 *1DEC838EC5F3FE5FD199F5C06807541CAD0C2752 ce)t
302,402,312 *1DE487D8C639EF33E71D8DCCE1DAD1304589640E CFR0O
302,402,313 *1DEDCC80AAEB41A290F6F1EF4F4B8B5D7D0CAB42 CGJAUSTIN7
302,402,314 *1DEA8B9367AFB413F0779AF0D241FDDDC3BB99B3 CH79
302,402,315 *1DE06EA5BF90DD2017A60D1BA5840CB6E1F923C5 A:SQI
302,402,316 *1DE962E3F6020AF0AD0CFFC8490A7156482876BD attireras9
302,402,317 *1DE34BA0D4B04C65D83113E1EBDD861BF79EB1C5 CHARMAINE-PHUA
302,402,318 *1DE3A7E317C73FDD49A976C3B4F4933A47112D3F AUGUSTKUNG
302,402,319 *1DE115BFC4D27FD4C5B265B084075D5FD67869B3 chcn#
302,402,320 *1DEAEFC9A884C5C6B94F997F729B7DE2C44F61F9 C+HIK
302,402,321 *1DEC5B732E2E9FA037D782B35DBDEE4392D5498A autokine5
302,402,322 *1DE4DA4A406CB7DFD6AC4DA00F6D099F44FF7EAA AV/HE
302,402,323 *1DE4DBFC32FF764564BF49028BAF82B1EFC07797 [email protected]
302,402,324 *1DE0A34952861C57507702CAAEEB0EBC8DB9B880 CHRISTOPHER.CONDRY
302,402,325 *1DE5403DE4B0F4111EF4DF482F15C4881C877F93 CHRISTOPHER.HAUG
302,402,326 *1DE80D3AE7B64750ECBD76FE046BE19D1219AFE5 CHRISTOPHER.RUEST
302,402,327 *1DEBDB7B7846E416778FB13A3C450664FB3F6F29 CHRONIQUE06
302,402,328 *1DEAAB7F705082ADBA74BCFEA8E44DF12DA16590 CHRONOMETRER?
302,402,329 *1DEA543C28668DCF286346B4E82736F9F4FA4127 c&!:i
302,402,330 *1DEE037E140DB81F2720032C6106072E73B40353 b1v#o
302,402,331 *1DE98113E3979002473CA36B54B469285CA87DAB b"ama
302,402,332 *1DE80E2686E760D1270E89005EDEE2E6CC8728EB BASILBOSSED
302,402,333 *1DEC0B57DF656B1658EF437D23A45D0B75243529 CkU
302,402,334 *1DEF6D52DCDB2893DA1222514C81FAA61D51578F BC&+M
302,402,335 *1DE3EB91166FB023B1DE002D8D167584995DD805 cnce7
302,402,336 *1DE46CCD837900B2F78BEDFAC1CE35C70D73DD4A cnnva
302,402,337 *1DECFCA4E996544FD077EB65EC7BD927AB9C6C34 co7fv
302,402,338 *1DE3688ABFAF1E42A760A7A07A0649448A0101CD bfiuj
302,402,339 *1DE8D8295C9B06D221217D02ED308395C57E64C0 COMPACTTOCREFS3
302,402,340 *1DE3B28D4E610868FF834A1556F162F6B50ECB9C bh7j
302,402,341 *1DED16941E9AD7E0454848D047744E3DA9887269 bikeracked
302,402,342 *1DE49976FA6BAE0BBED4F13255AB4348100286BA BILLIE.HOIVIK
302,402,343 *1DE29315F2BE9C7C59199891B032FB00684469C1 CONSTANTINE
302,402,344 *1DE628EB0CCAA4BCF27E979D342C627F3E56F39D BKENQ
302,402,345 *1DEA0D1B5DE0CFC7B9F42C383411B1F1927FDAA2 cp"9q
302,402,346 *1DEEC77E5C5E773F6F25C516CC3D952D2F02102C BLB060
302,402,347 *1DE40F878B2DD7CF2D75FFE012F2880E8931F9A8 C:\PROGRAM FILES\WINDOWS MOBILE 50 SDK R2\SMARTPHONE\INCLUDE\ARMV4I\SSCEOLEDB30H
302,402,348 *1DEF39E89F8A6D09F29B5B1AA8ADE3B3DC192FC2 cruzrebillard
302,402,349 *1DE4A7E7D0212C6A189BEA64F7334BA4F3E7B311 bo&#0
302,402,350 *1DE4C7113819D1EE6E54C2EDA3F4DBC895773331 cs[-
302,402,351 *1DE5038392199F5CBD32EBE408A43179104FE6A9 CU20060812E
302,402,352 *1DE0CF330A6DFA7F3C1C318654F52BB01666DBB2 borh4
302,402,353 *1DE2F68F8F9EA7E7FA86417015508D4A7F5382E9 CYRUSJEKEL
302,402,354 *1DE9768610A3AF804E46FCC9DB45F817A45655CB C)Z
302,402,355 *1DEF2B6530BAFA68216C6201174D2594B5231D2F [email protected][email protected]
302,402,356 *1DEDD5CC2A1C4F1D423FBD2DFE82F08BF3B0E961 BRAIDEN151
302,402,357 *1DE6A1CC7673AE6B7D5D8798DFC4BA1D6FC7644E BRDRLNDR6
302,402,358 *1DE98820AE5C667E42C0C50BCBB8F75F76EEF0C1 D)8AW
302,402,359 *1DEC42F538336AA568C5C0B82C28CFA6D5E152B2 D,A.M
302,402,360 *1DE980737EC9306E116A89357DF32DE13611A94E DARNELLFREND
302,402,361 *1DE2C03CD9ABEFCDC4274F0F585FB29239077AA2 darnellmccurley
302,402,362 *1DE3F00AB0CA490C99CDB66A9FD0416D9131757F DARON.BURKINS
302,402,363 *1DE0BFBB6F6D7C53B4C7ECFF847B9A7F80381468 bsort.1.0
302,402,364 *1DE1593B3D24A4C43540A4859FE50D5C697B9D0F B######>* *SPLAT
302,402,365 *1DE897CC067138579B0E082F62D2B6A505C9852A das.schafkaesekind
302,402,366 *1DE79DACBEE9F1864C8AF5E686F11BFCB06FF9C8 db0ha
302,402,367 *1DE818DFA6C90D288A0A5C8D7BB7A8A22A21F1E8 buisjes1
302,402,368 *1DE1DDEB534FDF9E149B411AFC71DBE3309B8183 burtonsheares
302,402,369 *1DE5699ED257341C3A0E8C531CD2889AF5BF156F Demorage
302,402,370 *1DE9994DF2C34E5C4A65B5498421AC4A1F9898EB [email protected]
302,402,371 *1DEE8BDBE390B2E9ED9F42F0D03617207252B1A5 bvtcc
302,402,372 *1DEA7D1F472C621313BE3F7037A8424498CA6F5E DESMOND.HONIGSBERG
302,402,373 *1DE7F2A0A4B3249A7D29E14FB167E950E83754A9 c03du
302,402,374 *1DE643A7B24B3C0F40029F5DA66CEB4F1F42D751 c8x;i
302,402,375 *1DE84B1363194845B6BFAAB6AAB47136F23A58E6 difraktal point
302,402,376 *1DE7A637E34795959E513A149BD37CCB533D6006 [email protected]
302,402,377 *1DE0F5F0D77B2505094F99C983561B413736EEE5 CAMILIAN7
302,402,378 *1DEA435DEEC8B213AFBD3A123EF44A9B3E95A71F CANAMPOL.MANAGEMENT.S.A..|.POLAND
302,402,379 *1DE0E8B424F0E237DAD3A630E78961C3C19E8D37 [email protected]
302,402,380 *1DE7BD94988BFDEE200AD0C03BE224F6FFF0472C ?CANDY
302,402,381 *1DE26719ADF2220AD4E9695C6B59E085AE7E5406 Candy-Gram-for-Mongo!
302,402,382 *1DE6FEE3387E9D965909ED479BAD8D9944216D3F DIPLOAES0
302,402,383 *1DEA3C4DCDF1C711B972EA74C81F49322C4523E2 discloser
302,402,384 *1DEEEE5064D94C67A67B14285FD7C1B5DF3F2E66 d-k/g
302,402,385 *1DE0CD794B8AF3B2D256D64920193A465F3C491A DOHZP
302,402,386 *1DE3F803F9EC10659BFD14AB6B11A479FF9D57F3 domingohartzell
302,402,387 *1DEBBEBB7D4016F731B522014676C71119D3E4BD DOMINICKOSTERHOUDT
302,402,388 *1DEE73CECC1EC6CAA4925EF2BC4D59C365EE95DD [email protected]
302,402,389 *1DE751E64CD82F322259D988D7C8CCE2C7A4649D [email protected]
302,402,390 *1DE22B43232375C0004E65C4DAC42A3B24A2B089 DONGWATTERS
302,402,391 *1DEE8776152689AF705EC89DD1F8262336CF9174 ce)t
302,402,392 *1DE8E2BDE9676473BC13C5E04637D3A7359C5427 DOSALENING
302,402,393 *1DE68146771B54710A6FDB5F2E242D259E66C383 dou6
302,402,394 *1DE5670F877EC2E2F92CA2A29EDC1E07DF136395 cggm
302,402,395 *1DE1A0DC03CB7F5A007B84FA575F507F5324A3C6 chadwickfelcher
302,402,396 *1DEC6A14F22DC002F87045DE048F63A44B775B96 CHAJOWSKI
302,402,397 *1DE703CEF435B5A96C108F7FC992BCA83B32AFBC CHAPTER0101:THEBEGINNING
302,402,398 *1DE362A6E644820120118D9F67610A0941279532 DRESSTIE4
302,402,399 *1DED9CC7708DB1E1DD3F0A12DDDEEBFAD4EC24B0 CHAVISTI
302,402,400 *1DEF11F8FEF54E34B9B203BBE91F8F7D61817424 dr?z?
302,402,401 *1DE9D1176A2F8F36D105D564B8F0136C275ADF84 dt2i)
302,402,402 *1DEA5F84DBDD74C151203E2E6D807469698057A6 durgerda6
302,402,403 *1DE31F25250A2E956C41C164ACFFBCD2EB0E039E chowhound
302,402,404 *1DE73DF5E06F6A7F8DD418D5B12060FDFA8E632E d$(x/
302,402,405 *1DEE6E681B4E5C0452D6D69CE1CEFF3D6A007BB4 dxav?
302,402,406 *1DEFC48D7237546FF7EB1E73F1CECB525C46881F cityneversleeps
302,402,407 *1DEBECA59FF905E5486D285D35906F0912362080 eaivleak
302,402,408 *1DED577B87765FEC78BE7943726B813B332CAE1A c:kpd
302,402,409 *1DE1F595E58EA670F0B4931A022502B7B2827BED cktdarfnundich,oheimat,ichshauen"
302,402,410 *1DE44CCD0D093497BC6BE97643FB7843D311A83F CLERMOUT
302,402,411 *1DEB160F48099094D75764740D17EDCF2ABC6EE5 ef4f
302,402,412 *1DE57665789B4566FF85673842737AE32E9BF136 egannoling
302,402,413 *1DEC9BB20FBDC769DB0AC342229CB766C160824D EGG!
302,402,414 *1DE012711B385ED5741C59E834D61B796672612A C:N2L
302,402,415 *1DE5FA98ACEDE19DC4343C886AE74B2B13CB9617 eldridgereynaga
302,402,416 *1DE725C02F15B2F60F09E49430A46064D757B2C8 C_N+W
302,402,417 *1DEF0B9AAAD1A3982BA40207FC8CCBFACA444F3D co"du
302,402,418 *1DEDADD1D3027AC0770538986EC6657AEE198841 elizabethdilling
302,402,419 *1DE15DF9DB6E18C6E1C78E11645513EF2B36B9F1 COLLIN.KRUPP
302,402,420 *1DE382BAF45CC64AE8FE510715F69EB9C346EE59 COME&GETIT(ITALIANJOB)
302,402,421 *1DE377683CC104F0E76BC9D3A6D3C4F5CEF5628F COMPLOTMENT6
302,402,422 *1DEFEA7223E071907CE7E8AAB3B972AC39EF5522 ELwO
302,402,423 *1DEF6169F539D0369C78C5FC0A5DD767B75A2A18 EMERSONBUSBOOM
302,402,424 *1DE26825C166FC754F25C4DA8ADC6FA10FFECC5A congruente2
302,402,425 *1DE28453145E258A8416C61E17A71A52E1D3327C [email protected]
302,402,426 *1DEE60448288E7B09A7A4B8A2497D32E9B0B11B4 ENCIRCLEDBYCHAOS
302,402,427 *1DE9CDE25AF0789838FA0D188D22CD848CA3BAA7 epowe
302,402,428 *1DE6B4BE9B4EFFCD1E3C78E2E51A6B9811A7338E EQUUSINFO
302,402,429 *1DE3DA14371B7B72646EEEBD4BA116FBD75B1160 craigd
302,402,430 *1DE38FC39A07BC7384C85605DBB49E4F8FB0A479 CROWN-CORK-COMPANY-IBERICA,-SA-|-SPAIN
302,402,431 *1DEC21BCB2EC18FB97B8BAEE45B3AF9C113DAC01 CRUZOLEARY
302,402,432 *1DEA80F0FCFD79E092BDFB0D1F25E64DB916BF9B etiyt
302,402,433 *1DEEFF9CABF0B577A337FBD948A37E8E82613103 EVENINGOFDESIRE(FEAT.BRYCE)
302,402,434 *1DE67E0A0D41FEE9CC62EDB10A0136C68E4892EC [email protected]
302,402,435 *1DEA54CEE55A03CA76CFCDBCB6ADEF8C317B8AF0 eximioussoft-cool-image-review
302,402,436 *1DEE8E27305294D19A92ECAA44CE088E4BFDA5F2 EZEQUIELSCHLINDWEIN
302,402,437 *1DEC2C7EC446807B2B7E4795AFA1B94F0BDD917B curtrasher
302,402,438 *1DE3A694A37FC3D701ECC9EC00DE833A4A867D06 [email protected]
302,402,439 *1DEB59B3A2DCC338117E0EA22DFC101E01B896C9 fading....(feat..twiztid.&.krizz.kaliko)
302,402,440 *1DEEE22E32A55BDD8BA137E92F9DD8A39B0A058E c+w:l
302,402,441 *1DEE63CB360FBE0D2EF0D18C101C160B2878B3DC CYRIL.GLORIOSO
302,402,442 *1DEEDF8923945111DEBADE0A6D7A10BFF606BA66 c/&ys
302,402,443 *1DEDC84F9EF877672B5654CACB048F8FC0609DB7 d2tf4
302,402,444 *1DE04FFECC76D5D5CE2B4B8F215BA3EBD70A93F6 d4,r
302,402,445 *1DE535C218C6755B97E117846FA426561D24BD80 DAMIENKINE
302,402,446 *1DE8D6E135210BDB550552F0A9A2DF6B01037ECE danagarringer
302,402,447 *1DEB981C2E392A1B4E70DEBEECBDEB3A008CEF33 FLOYD.CARMOUCHE
302,402,448 *1DE664A68233691286009DFFC339066FD1722594 DANIELA743
302,402,449 *1DE066BA211CA42BD518D16869200D7F00F83398 [email protected]
302,402,450 *1DE514F752846A0493D47CB6D402A97DFB4CA596 frametool0
302,402,451 *1DEC9F0510D212BAF9682E84077735402982C604 FRANCISEVANGELISTA
302,402,452 *1DEDB36B8D2F292C967BB1158831F8F4421D8959 DBF3T
302,402,453 *1DEE942FCFAC2523B15731115FB412A0B2BE0705 DEAN.HOVE
302,402,454 *1DEA7BB3DF03A7EBC5F8702BB5CF3FD10862AD70 GAILMCWHERTER
302,402,455 *1DE4719B039093D7884C207EDC04A8DECE50D6FA DECALQUEERT4
302,402,456 *1DEE4A58E0C11CDDEA433C586DB95230B621FC3F DEJO
302,402,457 *1DE7BBC52E15DAA63BAEC08A2414BB692E216676 DELMERFALTER
302,402,458 *1DE20A2226B37905D3197251FE244D75F3BB90FF DE!PM
302,402,459 *1DEE7FBC8632F31E06BE6581B63505DC9B169802 GARY0H
302,402,460 *1DED6CFE9973FB2927F15643B87C0C081343F299 DESCRIPTIONENALEC
302,402,461 *1DEF02E75C3E5F129BBBED5C9C932E9AF86EF903 DESIGNED-LIKE-DICE-(CRICKETS-IN-TUNE)
302,402,462 *1DEE0B0CFB0A5D15054A8B06BED91B90512CF9CE GELEIDINGSWEERSTAND
302,402,463 *1DE6A94DB2430C891EB43E9BE859CECC4E5609E3 GENETESIS,PARTV:THECREED
302,402,464 *1DE8558B5EA4149E2AE9CA4920E1F087689DA332 DHATI
302,402,465 *1DE70573FEB8D8E0B9BCB5A8E02B0DBCFE708EFD giovanelli1
302,402,466 *1DE54B959F0830C84E3E2EB6876C2BDED8A4C0E0 [email protected]
302,402,467 *1DE98FD1DEE9CE08CA1BEF52997A3E78472951C5 GLEECYL
302,402,468 *1DE9A849044A6AC217957B65DE0F572C90363FD6 disintegrati
302,402,469 *1DE14BE19B8DA4D715EEBDA1E484D681DAD2698C GO INTO RAPTURES.
302,402,470 *1DE95D0224CC03E9F8359B187A0EAC5F39AD400B dn5pd
302,402,471 *1DE81BFC19BB05959EA9871206832B61EE5E067F gracesgardenorgwww
302,402,472 *1DE0885BC16FEEB41A57D14EA44C3B9F663E1E67 donna.bulger
302,402,473 *1DE001CFEA372B75D75B4E28775292D61646EFDF DON QUALLS
302,402,474 *1DE7F5646E1F1C5DF93F36C1FEF9DF27082B0963 Don'tTrytoStopMe
302,402,475 *1DED5D6FCBDC19DB696D5CAA5B01ED429DB75D07 greggsigmond
302,402,476 *1DE2F5180795993AE58A837FC25362E665FED7AE GREG-WIERENGA
302,402,477 *1DEDC20459E339454030A05FA4102F80071F77E3 douglassbihm
302,402,478 *1DED3C9A89995E755C1B67327C1752F8D59B148F d!$putably
302,402,479 *1DE2C6BF270F4AD3337F4E63349790903A9B4459 [email protected]
302,402,480 *1DE73AA067F46AA2DF1571D72B5975D527AF6B2B guilder
302,402,481 *1DE7E453B29E14ACBCE6EF6DFC7A8535E6A421EC dragging.an.ox.through.water
302,402,482 *1DEBEF1F00093FD91C82B6A9C7F7F1CB8A5332EF H1FV
302,402,483 *1DED64E90BA0B22D6D7F9B10F095EA08C2A7DD8B du$ov
302,402,484 *1DEB02446D486DC28BEA2E509ECA6FB8A5DA8B61 DUSTINGALINDO
302,402,485 *1DE89CB0613A1C3EE461DD009C89E896B0CE26D6 HARRISON.BAUMER
302,402,486 *1DE7ECE11B5A0ED247F4DC6EE4053F1DB1458FF9 HARWINJOHN
302,402,487 *1DE57975F73B26166C4A83CD64D71959C016E9D2 hatziyonut
302,402,488 *1DE856A95FC6EAA546AE4CBF2B420DE509802662 HERRINGS
302,402,489 *1DE7EBE5FAA09370F0C520A0FEBA44B5F314CDEE HILTONRULLER
302,402,490 *1DEF1775F160F8C8C7E5289168F325631723F6E8 HINU
302,402,491 *1DEB235BC903AAA3F66F372BCC6080A8C80A0A45 E`[email protected]
302,402,492 *1DE861DF6B905E951691AF2B40FD625A91A77C9B egtii
302,402,493 *1DE5202EA55829C99B9085D917088DC2AB2881B5 HORACIOSCHEAFFER
302,402,494 *1DE2A1A2E8B5BD39179112B0E401C9DAB5FD2A65 ejtnreta5
302,402,495 *1DE39BE37F9CF8ADCDF1EAF652722D161D8CBFCA EKASMIMH5
302,402,496 *1DEB67B903537ABE664561BB075DE1870FC92763 [email protected]
302,402,497 *1DE7A57B385C80CF123EED85F93E9CD291BC3567 ekxdw
302,402,498 *1DE50FB2BA8F853B6D62824379BE5C784D5EDC79 ELEANOOR
302,402,499 *1DE8A00C8051F12B74615FA5D5839DDD18A3F8AB [email protected]
302,402,500 *1DEBC59AFA4AAAE7996F0704411B1E8B5FEA896A Eletrocutado-(Part.-esp.:-Rodrigo-Brand
302,402,501 *1DEB49073D70334E909589C2D27010C3A8619A61 EL FANTASMA DE LA OPERA PEL
302,402,502 *1DE4F62C53A091DE0B9E0BCF73F5E310AACD0D9C HTTPUSGOVINFOABOUT
302,402,503 *1DE73DEBA7C910BE37CFB408D80AD501E1B73B6F HTTPWWWCOUNTRYROADS
302,402,504 *1DE6B9B92305FE0371CCA90624C456CA03D11D59 ELLIOTT.CARMODY
302,402,505 *1DE1E98A41D67E708294519D37923D89F6F92F1A HUAC MADE US NAME NAMES
302,402,506 *1DE4770255A5618F5B63B11BE81A54FF6593E02C HUANIQUENSES
302,402,507 *1DED738671BCFDEAEFFC66E3F331989708CFE1C7 [email protected]
302,402,508 *1DE92CA5364C15AFB057515230EF3347A57C2749 hudik2009
302,402,509 *1DE0CBCADAEDC8A7BB2A44A5366575A858177D81 EMANUEL.COWELL
302,402,510 *1DE37B8E33872D45C2899399A46D4761F4424FB6 -HXU
302,402,511 *1DE22D089B128D8D9C18B0349ADD5FE177C33BFB emmerichskirche
302,402,512 *1DEAD0B4D6015FEE8C8AC651C421A466F13366D3 [email protected]+OR
302,402,513 *1DE971FD0FEBF45F68B87936302D6A096CD630E9 enwo5
302,402,514 *1DEA48CFC30D18F117046C0DA035DB359D6C4B76 eps?j
302,402,515 *1DEEB508D07EFFCD0CF36490EDD6BF1F40436D15 ILLUSIONSSPIELE
302,402,516 *1DE5F7F9D8E7D55BE3305A24C6E1DC586A40989C ERMUEDET5
302,402,517 *1DE8B499E0B228DFB0A3E954F6C19729E9AF122C [email protected]
302,402,518 *1DEA62C8A4477AE66A525E236B0D3ACF83D5A580 exhumarle0
302,402,519 *1DE4E99CD059D33034D23E447B1B345CD156156F IRRITATION.
302,402,520 *1DE59AFEC30DF394D3E58800189C8AB06F50F119 EXTERMIS
302,402,521 *1DE100727C2D9BC488AD254557068C028A179E94 ISLANDHOTEL
302,402,522 *1DECC487DAAFC7BA018E1F6C4993D5EBA39FC9E8 F8
302,402,523 *1DE5174D4C3795DD0412644B262FCC936F3CBA5A IZZ+
302,402,524 *1DE86F35AF3108C89AFCDA3CE05F0CBA700598B0 jamemartines
302,402,525 *1DE671AC25A84BC39E3D92C57A8D1690EF8AB89C fenceposts
302,402,526 *1DE3AEDFA0DEEC36E53917FBDE11F71674847536 janet.doen
302,402,527 *1DECCC47B06A1C987D96E53AF9CA1702394BA6F5 JANICESCHONS
302,402,528 *1DEB5F9EAEC6F5D529D44600DA88DC8F1BD68B19 javedrathod
302,402,529 *1DE6FDF7320A74C3C5939D855BB958B2879DC5CA FLOUS?
302,402,530 *1DEB26D0930B0D2820EA9CE3B002157334BD3B82 JEONG-MIN-LEE
302,402,531 *1DE32BC85698F919F0A1C46E962B3AF2B771A315 jeramyagler
302,402,532 *1DEDAD94CB1CDB2C1D6C1B5E212E0928BBA1486D foergon2
302,402,533 *1DE302BFA5DE84A620387D274EB9F25B267371CD jessa-avila
302,402,534 *1DE5A392382C364D9598B7533E30C767945008F8 JESSALPATEL
302,402,535 *1DE4F06A1D5579E8D3B7411B85873CB0143252E8 formlessmountaincomwww
302,402,536 *1DE2CF97600A1512F01C357C24358EAFBC498C21 FOR-THE-INAUGURATION
302,402,537 *1DEE66513EEEFF72A21B5C2A3D172D43EA4F0E9B FRANKLINKWIATKOWSKI
302,402,538 *1DE6F5D29B128C22721BF37B7C3FE3C90DED6E21 [email protected]
302,402,539 *1DE7BA5DE5AD7E1A3C2FA29D12A6E2FB0279AA51 j. kennedy
302,402,540 *1DE55BF63591B695BB9D2B4DFE771F23EE84F3FA FREE160.CYBERJUNKIE
302,402,541 *1DEE35E8839E7583F38B8AB07EEB39AD309A5758 jody#4
302,402,542 *1DED68A683E3B70EE405FB2CC37146F0545B4AB0 [email protected]
302,402,543 *1DE01F38E970B4C335CA8B4950AC19006CC9E588 JOHNKIEW
302,402,544 *1DEB3626822D4FAA8FD190570E85E32E9F899411 JONATHAN GASH
302,402,545 *1DEB0F7815EBC53B37CC7D56E4A0BFCC2CDF32D9 f}xd
302,402,546 *1DEE01160DED42D64BCECF4646A234D6E4C4DD8D jonathonlerwill
302,402,547 *1DE1CBCFC4C7A981BA419390EA7DC4A80E457B61 JONCLYMORE
302,402,548 *1DE2EDD93A3510EA03A12EC0E8FC1F86CF63219E fzyjlkdds
302,402,549 *1DE7A594F89FCBEED1984C2B25DF298151DA2D98 JOSEF.RADMAN
302,402,550 *1DECC0CE56577A3D431FC59AD99181679FABBBE9 JOSHHERBOLSHEIMER
302,402,551 *1DEA86D9CF22DA8010B9268627831732C9259C45 GALE.DARTER
302,402,552 *1DEF768C44A13FC628CF1D60261ADC19662B0198 gammallutherskt
302,402,553 *1DE9A83A269B3BA27ED623DFC63349E81B449C75 garlandbuffa
302,402,554 *1DEC363FDD02BA72B26B6163795025B879319BED JUEDIENNE
302,402,555 *1DEF54146A1DF1D68FC634001279C8683801DD5F JUNITIRO4
302,402,556 *1DEC8DEB3ABDF894E3BCB01D05426783396F7854 J.V.-And-Me
302,402,557 *1DE9A68414A4E948C92FAEF31F9CA90DE4788A2C garretwagemann
302,402,558 *1DE7B84D472E2CE6D1D07D27B4A1433F133C92FD k['-
302,402,559 *1DE974DA7A01E78BB576F9E25727AF2548DE3684 karlletourneau
302,402,560 *1DE87ADEBBC79C54D4E3F9D176C7B470DC45E8DD Karvel-(Graham-Massey)
302,402,561 *1DEA4DCF07BF782539A0F612927718B012BE4D4F GENIUS235
302,402,562 *1DE74E4BE4F5C937D9DBBB2F0352A914F97CC9E5 GERGERGELY
302,402,563 *1DE06AFA757520161356DD33B7836FCA85C5E126 GESPONNENEM1
302,402,564 *1DE9530E25C9B8E843AD516618FCBEB58048BD30 G&GT
302,402,565 *1DE186895C8EB1BD03967115E4BE216C4D191A20 GIOVANNIACEVADO
302,402,566 *1DEFA06979EF9D3176EFBBCE70D4048C194957FE glennsanluis
302,402,567 *1DE5996EF933BC058AEE023AAE18A7F81AFE50C5 [email protected]
302,402,568 *1DE634DB2E8A9731F82F6CD2DC8F053F7C35A2A8 GOLD3NF3
302,402,569 *1DE1AEA57382EE028328838646C2C10E31474BD6 golfer6969
302,402,570 *1DEAEE266B5410CC93E09766148ABFE39DCD4B41 GRAIGARRELLIN
302,402,571 *1DE5336D2AD0DEAAB7AB85E58ED7332046B123A0 KISAKIIN
302,402,572 *1DE65CBC2B25F8BE0F19F18B06A98DC18AF814F6 klassischerstklassisches 4
302,402,573 *1DED243EBD0120A8AE0DD0FB7BF0741C737E1638 grimatuya(featEdmundoRivero&AldoCalder
302,402,574 *1DE364FD7FACC5FD11C62F88E40E05307F735D89 GRUSOMHETA
302,402,575 *1DEF6EAB3D698689E7096013E9955E7B3B9152AC knocking.on.the.door
302,402,576 *1DED7B3EEB18974E8C83EE7E820F2A733E22E4C3 kokiseik2
302,402,577 *1DEB8CBAC37FB7E920936C079B4C8403C5CC9A7A guilder
302,402,578 *1DEDBCF476C45D7B2B3682794BECD7F3B4602FEC guttines1
302,402,579 *1DE80B6C0D626B550BB0DF8649D5869BEF594F95 g-w#
302,402,580 *1DEE00B4494532992AD306EBDAAB143C53C6D0C8 HAKEEMMAHAMOOD
302,402,581 *1DE868F096C85C3AD1B44D33B5ED5CCB34ABE846 kunsia
302,402,582 *1DE0B01FA4F69C843C0A5E8C7737609B732B80EA l!9htye4r$
302,402,583 *1DEA7A2B3AAD86880484192126194FF48CF50EE3 [email protected]
302,402,584 *1DE5508A55F58CA8AE19C8DB6B5D663647707DCE harrywillies
302,402,585 *1DEF8FB56022E9DBCFD92B32F03918858BF759A2 [email protected]
302,402,586 *1DE31AAB102AC4F292CCA5CE4E6A5EDF04B2E700 LANECITYING
302,402,587 *1DE504C62514C2C25BBFB5A9AD29EA2C0B1171DD lantest
302,402,588 *1DE8D690F995C7F9B0AB4B0A55D92392D7355F27 LAZAROGORMONT
302,402,589 *1DE410C73AE4158789DC2ACDFE80B5A91FE98F76 [email protected]$civiou$ne$$
302,402,590 *1DE67D5E28F07DB1943725F36BA360401EF74E9B HERNSHAW'S
302,402,591 *1DEC73C62FC0B2BE2B71D0254F840BF62035D9AD heropsychodreamer
302,402,592 *1DE4B5CC9DF153A205B8C21D558B9DF3CED64329 hg「初産フォー!」で“祝福”妻・杏奈さんが妊娠5カ
302,402,593 *1DEB97583497BEA8E0222CC67B7D37EB9AED8572 LEMPEL-ZIV-MARKOW-ALGORITHMUS
302,402,594 *1DE4DA5024134D8310F43EE2BE5D590D8DBE3D7E [email protected]
302,402,595 *1DE61FD5A14A5F96729751AD6B6C1061A2F35953 LENSALI
302,402,596 *1DE415802D15D1360B4589D7A6561552CCF9E82D lesablier
302,402,597 *1DECE4A43540F6B00D54F107207856A93098171B Les.Litanies.De.Satan..Act.II:.From.Hell
302,402,598 *1DEE59708B999AA73D06B1187D9EDC4761FA0BEB Lespourris...Detalent
302,402,599 *1DEDEBA8EA23395F52ED254B725898154D211434 [email protected]
302,402,600 *1DECB4F6798855D777DC3180FAEEDBF567132037 HTTPRB.ECLILLE.FRJE
302,402,601 *1DE4F0663C2A386EA336A3A755BFF809F5150D26 LITTENS8
302,402,602 *1DEC2F36356EA40B26E3D386753BA5A4BDAFD4F8 [email protected]
302,402,603 *1DEEC2FB5E49D7E6C9A7EBAA6C8D1137C1CC6066 live.in.the.promised.land.(disc.3)
302,402,604 *1DE1DCD0CBF42796DF6B3A6D6FFAD73850C2DC00 hundrer4
302,402,605 *1DEE3189FC8B7265BB37019B7D641527BECED14C ILOVEASDFG10
302,402,606 *1DE9BE66C9D4DFB643A8D6D048426FA6C2EEFA6B ILUVCOWS9
302,402,607 *1DEE84CC0D6E60DF43AC79FB3A059DBF9BF98DC4 indirettezza4
302,402,608 *1DEBB819EB5D22814E12EB65241C5F621FB217E9 [email protected]
302,402,609 *1DE7310CD93521624BCC90A52FB5C08DFB123707 INITIER9
302,402,610 *1DE56D8BBEBAD491E3A84B06B4D38C0D28DDE165 INTERNETAPPLIKATIONEN
302,402,611 *1DE14638C208A57D52B43062675BD27D835768A7 LUPEMILLISOR
302,402,612 *1DE1E8A77486ED55063899A8BADB96C9F081B44A irrational
302,402,613 *1DED4A005D43F2B356AC324DE024CA24B29161D3 M15EDUCATED
302,402,614 *1DEBF6F847765AE9DAAF42442AF256A369B1DA8B M3ULW13L
302,402,615 *1DEC895DA6839649910C5BC0192B1E90F6249651 M413FIC3N+
302,402,616 *1DEA141C2EE324261FD69D3C557109FC9840C704 ISLANDINTHETREES
302,402,617 *1DEE2392731FBD4C8FD591E62A438F9663EDE62F madrinased
302,402,618 *1DE7654D0D0DF8FF314597C81579AEDBEEE5BA6A iv{q
302,402,619 *1DE04FD6C4CE62909F949B8A315CD8834B5371C1 I.Will.Find.You.(2002.remix).(feat..Clannad)
302,402,620 *1DE10C37397F49E53D6678BF9F78D4CBD98D8FD7 I~X<
302,402,621 *1DEC9C90289CEE66E068C2EF1A4010FDFD7B8C08 MANPULATA8L3
302,402,622 *1DE72A15F721FC970ED9C4F0290BCAF04C24CFBD marcobizcassa
302,402,623 *1DE1A24FB50FA45C0370B73DC8C696262AEB2BAA JAE.KNOUFF
302,402,624 *1DE13AD3BEFF35177B38AC3188F059FB4C853148 MARIANOA6
302,402,625 *1DE3D0B9E5D2E9D23E43D6A14214D95E5AED6274 MARIANOHARRIGILL
302,402,626 *1DE19411464164896860F45DA4C8D00E946279C3 JAIDA570
302,402,627 *1DED0A0AFD916945DEC84743F7484248D5408A21 MARISKHAP
302,402,628 *1DE705F7CF4591CB85896F1F591FF72D8D716502 jamarcus09time
302,402,629 *1DE1A61D91D8ED44A60C7F61BCAA62B51B6E043C JAMEL.GOTSHALL
302,402,630 *1DE22BCBE13B95E1D3FDC78EAF6AA7251A8135C9 JAME.PINDER
302,402,631 *1DED1AD889C0C61E3B3A9611A2EC08A8DB4F4889 MATTHEW.FUHRMAN
302,402,632 *1DED5948A1710BC9A464EB3B10AB154644E350E9 Matt-Rollings
302,402,633 *1DE7BCDF52AF4B68FEDEB04B14B9AA0F3191871B mc2101+
302,402,634 *1DE191728335E80FAC2925CCCDA1EDE6CD49E3AC MDUSMANTHA
302,402,635 *1DE7806D0F83900FC9321E3213E34E9863C71FEE jane.asks.for.reference
302,402,636 *1DE5B83A7C4E279308E650467FC4884E7B121518 mednekr9
302,402,637 *1DEDF623911C78CCBB97C0812386FEB213EE6EDB MFPRBSW7
302,402,638 *1DE10E83E168C049B663FE7A656A958B2273E2F5 MIÄST
302,402,639 *1DE54E5F3025ECFD80528174F8D9783A69250ABA MICHAEL.WINN
302,402,640 *1DE19A344410717B1BB924D476F47AC1A8665AFB MICHELFEILBACH
302,402,641 *1DE1BBF44FB99738FBE46D75295936070CD7FEC7 MIGRATIONSELUBEIDIY
302,402,642 *1DEC4285AE56C9746E4C9E60D092707D0FA4A6EF jeramylouchen
302,402,643 *1DE473B7A5E0F697B093C93C3B658CD2244EAB95 jeremykucinski
302,402,644 *1DEB119A2E71EBD49E3476C18AB3E125BF0D8ED6 mikezamparini
302,402,645 *1DEE97892DB578B183A9F402C5C16A010FA8E2C6 JEROMY.FIELDHOUSE
302,402,646 *1DE1855E063CCE1334E649954B9D57BC52E46556 JESSEWELLS
302,402,647 *1DE7A70BD717F9B7AFA27492758B5DAED222C282 jewness
302,402,648 *1DEB33F59FDCC7F99C6625EBE6FF510A5D27A1F6 mitchelveeneman
302,402,649 *1DEC9CF97CA04B6DCB3DA26EE5C1F4927088D671 MIVICIOEREST
302,402,650 *1DE59245DC4C5C888D3819A51917FEC5C93851EC jimmymcdewitt
302,402,651 *1DE6A8BD723A35B18B9BB1563B67678FA1A5B36E [email protected]
302,402,652 *1DEBCAC14187F074B35A06E6E50E34CFE25C1118 joan-gatto
302,402,653 *1DE3BE59F3A0D9B6EE7D6C1279174577A670A0EC MOBNREK8
302,402,654 *1DE3645B81B2602173FFE075B068F17F1A8B2AA2 johniesaide
302,402,655 *1DE37E5C7576C902549BCDCFAF550CD3245809E7 JOKANKATU
302,402,656 *1DE11EAF7A37E167BD81E98BF07849B4296303B7 MONOTHELISM3
302,402,657 *1DE72DD0D89552E96FAB43263985C7C0D2FD0EEF JON.YOHN
302,402,658 *1DE23ABEE9A8AB7C08D64149D994005C634E28C8 JOS7LN9
302,402,659 *1DE69A88600D0BA0399CEAD3048219BC4E9F8E51 MORTALIZING6
302,402,660 *1DE07E5AEC0B9809E2246F70D1F044DEEDAB0B6B mousetrap0
302,402,661 *1DE535515A6E179C90B997A232E25F97E5C3D67C julescantore
302,402,662 *1DE8B458EC570D7C77A1D816ED078F4926EFFE86 MURRAY.WATANABE
302,402,663 *1DE2CC86F543354CFDA26335B13E5CDCE8734FCB JUSTINGRASSANO
302,402,664 *1DEE6FA5EBE168661E53BB38C66B9D8D653F6A4A MYM65
302,402,665 *1DEF41748F718C71C1C4677619655D3596176079 K4MBK&WRK
302,402,666 *1DE8CC6A341ABA157965B92FF729B562BBE3F20D N3UTR41!Z4T!ON
302,402,667 *1DE624964A994C21320EBF16D73DC8D49734C1EC KANNATTELEMASSA
302,402,668 *1DE6B82C350CCF0F3E50CA21DA952BA3011C167F kasprzaktivist
302,402,669 *1DEE55C1D1545A91D0A3AB6D9202F7561004232A KAZIMIERZ PULASKI
302,402,670 *1DE002E013A20541907BD092189C9605C3B1B693 kellyrynne
302,402,671 *1DE51205BD2991F6941A4F6C8B1E69E598BB4FF5 kelseycarter
302,402,672 *1DE9B0B33DC12257E561A56F7833CBEA4C8047EE KENT.EBBS
302,402,673 *1DE053E36B274E3EC1EF908016981D1665C2C92B kerkdienaar!
302,402,674 *1DED86A70098ECB962BF78AFEDAC2B6A19410F5B KIDNEY;-SUIT;-RANGE;-GENDER
302,402,675 *1DE54BFB4A43745C92C701804DE849826A3E22D9 KILDEHOLM
302,402,676 *1DE8A04FF728412D6E2CC93AC96CFD9A678948D9 KIZMAMALI
302,402,677 *1DE6F85B02319B962AFDDFD1F156DA402818137F K'LI
302,402,678 *1DED1C2E4EBDF52A5EAC754F70C293E6736C4DB7 KOLIS8
302,402,679 *1DE04DD0E42F3298E75A3973CE3BF5D17FF68A64 NOLAN.MYKING
302,402,680 *1DE3DDC5638EE08BC4CCC6A76234A5B075377E1F NORMANDTULLER
302,402,681 *1DEAE2103B3048DD207CB283F19E9650EED8833F KURTLOSHE
302,402,682 *1DEAFBDA9F5160E8450246F077E84230A7B5A2EF kv\.
302,402,683 *1DE4DEF8AA351C75407D0708D830265DD8B0438D NSCTFRS
302,402,684 *1DE641777B56A2F44E7A81258C6EDEDAFE7B986E ntre
302,402,685 *1DE1D58657DA3D7870D363730F8810B3217EEB34 OBERGEROLDSHAUSEN
302,402,686 *1DE52246B79062E25FE4196EB3E6AAAC9972EB81 OENANTHYL?
302,402,687 *1DEC619F58F5431F355F9133C6DF4F61F7669B06 offrire
302,402,688 *1DE3FA1971DCDBA20302FF4DA49E2501B00B5725 leandrosacane
302,402,689 *1DE8587EAFFBDC5D4CAB34AE6E4ABA1DEB08DFB8 LEDSHE
302,402,690 *1DE5215032F50C5751F3C21B5C754E751946E73F OLIVER.WESTBURY
302,402,691 *1DEADE3DD2D9F2E734B85523426A87D194DDEEC7 legendarymania
302,402,692 *1DE419A278804C6523D9840020B6DDCB4130ED13 omnipotentes3
302,402,693 *1DEEE86418C33B99408C8DA60426931D495D759C leonelzaborowski
302,402,694 *1DE9E50CF4EB9343A7E454C6BFB2E65442254FF1 LESPRISESCOMWWW
302,402,695 *1DEDDA302A9ED9F625664FA7A872347BCFC02F76 LH9783
302,402,696 *1DEFFD16582AFE87AAE3AB2D60930E42D64A2458 [email protected]
302,402,697 *1DECA6743D7895AA4C9CA6AFBA24592B112A8A90 [email protected]
302,402,698 *1DE9E7D6A9B3DD18C1162D274277852189572A4B OPPIDANS
302,402,699 *1DEFD424B9CC41F4FF04BAD163092866ACC217A3 lina.barberio
302,402,700 *1DE12A0EAC9D1F34C2DF61EAD78BDE1452DD5DA7 linateamo5638756
302,402,701 *1DE613BDA0B348B512A33F1B84DB2F56888E7DA6 LINDSAYINGLIS
302,402,702 *1DE5BCDA9FE9A3BE088608C75A497F42393DE236 L-INTRO
302,402,703 *1DE6EFAE47C53C004CCB2C3AEC2644DDE313C11C LIONKINGGRANDMA
302,402,704 *1DE8A1B60D371573B32B5F843CAB42D0693569BE oscarkahan
302,402,705 *1DE2C143E81952C2E820928448153E16EE78EE66 oskbesmai
302,402,706 *1DE759FC3C7CE41BA5990292EA72890F6C3C8DBA OTHABRAUNE
302,402,707 *1DEDA4CAC292F6F0DD0B73703ED104BEDB6277C7 [email protected]
302,402,708 *1DEB99A6F456DF1F0D1A8A3D672A3B45A5DCE719 live-at-rock-in-rio-(disc-1)
302,402,709 *1DE28AD5D6FF19044EA6DB36DFBA028F2F32211B LONG.UNCAPHER
302,402,710 *1DEDC1EE5C4C8C9885829AC1A159B521A296FD9F LOU.CIRAOLO
302,402,711 *1DE59E3D0B94DED715DF1ED97008BF1C11DF7B56 LOVE.U.MORE.(OH.YEAH.MIX)
302,402,712 *1DE336D5EBE01FA3C64E70DC9F9C2A04452FFDBA patsiga0
302,402,713 *1DE49DD25C673289A40063055E47B3DCAF446BDF PAULCARERE
302,402,714 *1DEED3273BEEC8C00FD38C227529C8F20EF0364A LUNELUNELUNE
302,402,715 *1DEC1CD7B54DA46143C3256B5461C0C46B3D88B5 pauula
302,402,716 *1DE05008DC02AE36E37DE6AC4E72C3D662FECFA5 l%.v
302,402,717 *1DE221DA76F3937B5883549812D1026A70F1537D LYZZY123
302,402,718 *1DEE8E812A561DE26DF5537D013019AA10A6587C L林玉珠
302,402,719 *1DEC1D0B7AE7E8846A866454DC8FCD20C1EA8661 [email protected]
302,402,720 *1DE55017C8C5DABEC2FD5DFB833148E7B5DC2E11 macellan6
302,402,721 *1DE627B0A5EED4EF2CF81559F4053C449C64FF1A PERDOMO16670639
302,402,722 *1DEF3539F17C31F8FBA50693D61E33480D3C3AFD persatz9
302,402,723 *1DEF9EA2D50B4E1DE11DCBDBDAE7A50F7D355333 marcelotitus
302,402,724 *1DE0BBAFF0E9BE46C9CCEB51D58950F3ADBFB41D MARGARETL
302,402,725 *1DEEDFD18C66DB2DA39395B3B8AAA4493A071D60 MARRIANESANTOS
302,402,726 *1DE0CDCC528EB091A305C36F1720BFAC33F371E4 MARTYTULLEY
302,402,727 *1DE48101EE0B35AA54265971BAB2700BF507D5A1 masonbrau
302,402,728 *1DEEF1B8C71FDFB46FC7ACC3A9DA810593217356 MAYNARDPRCHAL
302,402,729 *1DE307998F1B61B3B860B45A8AF20E59EFA628DF MEASURELINE123
302,402,730 *1DE5EFE57AA10B126127C4C8F3907E23A2FDB06E megaman160
302,402,731 *1DECB4A1DF9F38AFC4A0034F1CB0BF467EB2BEB1 MERVIN.DIEFENDORF
302,402,732 *1DEA5716B224E31616EA9601D47600A37EC12297 PHYLLISDREW
302,402,733 *1DEA6AF3FAE9F32BF6B5D16240C5CB89397C898E PIANOSONATANO.13INE-FLATMAJOR,OP.27NO.1:III.ALLEGROVIVACE
302,402,734 *1DE70422210BC2D18B2B0745F511D68EE57B2D1C MI5ADV3NTUR3
302,402,735 *1DED82CBE7796CE681F7A88FF9187F5D789FFA09 PIROQUEIRO
302,402,736 *1DE5A03C7C09A7FE94928E369DD1A962E11E286A mimicry
302,402,737 *1DED05EBC6A18A5747B5C18909C263E118D2DC33 mǐndé、
302,402,738 *1DE91F4BBFD253E3CD1BFCC00211C61AB6658CC2 MITA-DASGUPTA
302,402,739 *1DEE0E12DF3553E27FC75783D664F753EDF866FE PORCELLANIDAE1
302,402,740 *1DE6095C15CC07E4E53B0D9706E57DC8009B42AC MOHAMMAD.BELTRAMO
302,402,741 *1DEC360A8CA8CD01C3AACD6706DC2065E5B1FC0C PRESUFFR1
302,402,742 *1DE72341888B890712B302AD5E0F6299569B2C32 PRIMETRIANGLE
302,402,743 *1DEC3514E4EC43E7C7C7AA03B0A0CAD623014668 prince-richard
302,402,744 *1DEF776D25DA7940BFC64601A348E6E0DB2D5ED6 procol-inc-|-canada
302,402,745 *1DEA3997F8D88B4A096DB6EF954885337EFB1860 MORETHANTHESUMMER
302,402,746 *1DED4C535B8E8F62F9B8F55B001DBC12EDC7E2FA MOVIMIENTO TERCERMUNDISTA
302,402,747 *1DE8CA731E24C0B2BEE2917D03784615B10A3B95 PROTROZOIK
302,402,748 *1DE60D6B5FD2C3803D41EC6B9B84C63A336D1581 MULHAIN
302,402,749 *1DE2921DE3B06815A564B8BC89AE99108A4B671D py}o
302,402,750 *1DE29B1DF086C2D10BA267B6F5A5609CB2246C75 QB`.}O{
302,402,751 *1DE16DEE03DA799EAAA45EF7CE38E5F85D8844E9 QP.*.*.*.~0~O
302,402,752 *1DE4F08CFC90CE19F5A3F98025869D4CDFEA9901 NATHANROMAIN
302,402,753 *1DEAF80CC69A1FC53EFBF2A0C3DA8C47017A1C6E NED.MCCALISTER
302,402,754 *1DECFCDB287F0B1F21D6DE35940A4CDE9492DBA0 nejireveorhcspo
302,402,755 *1DED219E523A3BA0E77CDB947E86BBDAD3218F93 RAMON BAUTISTA
302,402,756 *1DEB373324118DB3216B9DA67B81C883107C3BF5 neretceted
302,402,757 *1DED29E5DA460534445971A1DA403D2823BF1CC9 NESTOR.ABO
302,402,758 *1DEFB18BC94AC03081CC77381172139BDA03DBA4 NGOCDUONGBK
302,402,759 *1DE9132938BA92D653E799A6769D68D17E31BB7D ravenia0
302,402,760 *1DEDE2A13DD66B97B4FF299F94EA8EB9319B38C1 REBECCALAMER7
302,402,761 *1DE4C4824DC1746C4401FC3BA0A53769EEDA320D niezabijajmycho
302,402,762 *1DE38B778CB17C149EC5803507EBE52A1CC396CF reem-touma
302,402,763 *1DEF0CB3895CC3EB34994FD907D1345D3AD3E02F n-kald
302,402,764 *1DE908895E9228ED371F8CA63657CAE50A7C15A4 noeldeluco
302,402,765 *1DE3EAA5094B4D2F9488120928E897AF9CD3503C REGGAEMUSIKKEN
302,402,766 *1DEEA2217FB1CA1D77E127E62CF8C28E01EB5B23 rendevano
302,402,767 *1DEC5ACDF11E5B8D3313BD30A7FD9D48CDDB004D rexdassow
302,402,768 *1DEEF7B537E934DE7EEDA93DE7E0557C57ADF3C8 RHBPC
302,402,769 *1DE0E2F9C802CB39A23F2F66F3FB8BFC0B133528 NUGIMIT2
302,402,770 *1DE4BA21DFB89294B098F33D50B34A48EB8F75C3 ROBERTO.WARRINER
302,402,771 *1DE40471C11E2785BFEF4E3B0E5F01CE4EB646CE rockycantin
302,402,772 *1DE2CF990C0A91F2E8F6C13A2B8F030D949D1A9A }o{.*(b
302,402,773 *1DECD764D83B9B27C975C503B16726BB0F3DACDD RODNEY.IRUEGAS
302,402,774 *1DE8B5D310D8F44F8CCB0B8923902A79B150B941 ROLLIN'BLUE
302,402,775 *1DEE4938BE1F178D596CB59E3976C331E2DF8B55 okrizise
302,402,776 *1DE8CD9EA9017896A0A51EB4CB6C5501E84A79D2 ROSCOE.NEWYEAR
302,402,777 *1DE65230F8CF2134D5031893E477F117091C9E0C ombreggino.
302,402,778 *1DEB1E05E5F1483F56E89081091CF335746312F0 [email protected]
302,402,779 *1DE6F4F891846A0AF6F86715C86E9C6252F7861E only-for-the-trashed
302,402,780 *1DEEE70BED211FE5AAA0F87C108C1AC92B113896 RUPELSEDIMENTE
302,402,781 *1DEC3E2A8AE3440C8DC9817541C7D28DF0EF53A0 Ruupavaanh
302,402,782 *1DEC757C79798383958290D329279B57AB24A706 [email protected]
302,402,783 *1DE74205ADB9BE95F08DB1F3F6811F273CB8C607 S]|
302,402,784 *1DE2DB9EC02268406242F1B8A6D679E5D27A1A88 OUTOFTRAINING
302,402,785 *1DEB8ED76B126C85FD6017D0C83F5AD4B9BF7758 SALINGUN09
302,402,786 *1DE804BD6F48A470E2ADB001E9E0ACA96BB5CB61 p3rmssa813
302,402,787 *1DEE3F1168A9CABFDB0372E059F00D5161C0CA21 PAPILITOED
302,402,788 *1DEE81BE78E6532E5515FC2D70B794497CFD5B59 pauline.boothe
302,402,789 *1DE21350BF0899EA70399D2ED5714E7FF97988EB PAULSALASSI
302,402,790 *1DE620BF9567B2CE386E014F532E99A7C383B578 PAYÉ),这是与邮票类似的纸样收费条,价值一
302,402,791 *1DEDAEF3E2F184A8B70A18F734A9F09B37981541 [email protected]
302,402,792 *1DE8C61A16F24E5A955C0FD79EFFFF19481B0BB5 scarletraphael
302,402,793 *1DE38CEFB49EE278B73B686F7107EA1CAE62759F PEINSDEN
302,402,794 *1DE0AB7268923FA871A1BB370EE2F70479A9D368 [email protected]
302,402,795 *1DEA15E2DB041CC3E536275E4F0B90F616052083 PH1H4RM0NCS
302,402,796 *1DEC7F8B47EFC64481CDF05BB6EA1CB24A7D4BAE selitxet2
302,402,797 *1DEAFC3931B4A171723CFF44CC59A075BFB591A2 pheletsongyalerato(theendoflove)
302,402,798 *1DE72A7DBA7D15B727B044E8DEDF2CD8566F0CF9 SESSENISMILF4
302,402,799 *1DEAD4A464BFEFF0B09667F2C21B854B0B203597 PLANTSTAND
302,402,800 *1DE808AE5284B78047380E1C59A8418BA1F4D725 POLYMER'[email protected]
302,402,801 *1DE2CC316446617611FC6944350541D195D54634 PORFIRIO.AUL
302,402,802 *1DE0C6F3ABDE2F5F99D45C409FEA704909EAAA09 PORTALADMINGUIDE
302,402,803 *1DE7739D4FFC473A958CF8B79AFA0D194212E514 portirens
302,402,804 *1DECCE061BA15765FB6DB0DFF2A5F5A32D70A20D preadapting
302,402,805 *1DE880060AC27D14854F53C33E8818717C60147A PRESHANTA GOVENDER
302,402,806 *1DEB2CF0DD483A3BA6F0FC391D52013413020BAE [email protected]#PRIAM
302,402,807 *1DED05B36DDF0560E08E04FAC4B22278E7BB9C45 SILVITECH
302,402,808 *1DE8348D04A3E4A81CC11A6A3B524E12904EF586 put.in.a.hole
302,402,809 *1DE2F7D44C1121788E53B1A205659711668D68A5 ><* * QB
302,402,810 *1DE3A48051CA45751E2DE01DD7A4D0E633A8E10C quo+48le
302,402,811 *1DECDB6684320224503C4AB986A646043776D0FA słackie
302,402,812 *1DE18C6DEF28FCAC74068C777245DAAB3644BB52 RADARJIM
302,402,813 *1DEE3413D1EF3B2052944F6BF8F99B91E617D333 randolphbanville
302,402,814 *1DE435A29BDB31712B890A0E72D0FF459A538603 SOEFTELA2
302,402,815 *1DEF1E6F8F6B43E011DF9BB105917EDFDB316BD3 RAPHAELMARKEGARD
302,402,816 *1DE96E33418B65D6E542283E43407F71F4D1817E SONDERTE1
302,402,817 *1DE13A8DC508313DB081B7AED8167B144B335718 rechtsradikalem
302,402,818 *1DE0878142C633B53B3FD74A9ADEC39F3E5EBF01 SPLAT!!O~0~.Q=====P
302,402,819 *1DEA4785169365172EE9A1DAD3EEEEAB77217F0D repud14t0rs
302,402,820 *1DE222BFFB6D9B4BF9EAAF148BF7544087BE5DC0 REUBEN.STEENWYK
302,402,821 *1DE57181B6BCA0950FA6641A74EA0065BD77F6C2 REUBEN.ZAMOR
302,402,822 *1DE5BB08194A12AA3BD30DAFF8F0A37DFDB957EC REVICTUAL6
302,402,823 *1DE8C2EB6BDDDD5F8D911B631D8EF6FDE4A6ED30 stecklenburgbeinacht
302,402,824 *1DE164F418465DF03721FBE471CBFDA96B5C8F82 RICHARDBAYE
302,402,825 *1DE0A4AFA5D482E7EBA6FCCB4A2984EABEB5D117 STEVERBERNARD
302,402,826 *1DE1E811A179BD5FE82A0BCC6A41F0FCA7B7D99F RIEMPIATE1
302,402,827 *1DEB0F69E87B901F2D89CDADDD39BC6AF2A9D86C sukiyaki-(my-first-lonely-night-without-you)
302,402,828 *1DE541B76FDF0C9071A8F1C73583E6174ACD1F65 RODOLFORINIKER
302,402,829 *1DE38EB0E35EC1D77875FCBAD4BF6D5401C0FE27 rogeliocoursey
302,402,830 *1DEC94E7272AFBB3EFD006A30AEBF930A2FF709C SUNPETER110
302,402,831 *1DE52539119460FB328B2286E2AF174C0F65896E rolandostudnicki
302,402,832 *1DEA1E3E1A5E079BF8F5B86E596635A7A3E8FC47 SUPERMANM3
302,402,833 *1DE7FA68E093F6684ED4DF9F65BA48DB3F4B688A SUPERREGALLYVING
302,402,834 *1DE31AB2AE87DFA0DA56B4AC6BD6CD73C6666834 Roman+cza+on
302,402,835 *1DE3B47BB43139C81DB2307AA1E3B76186AABAFD [email protected]@L
302,402,836 *1DE715DC571A8C233884CD10085A409382354032 ronflurry
302,402,837 *1DEE1414B343EED218038AA456C6B8035F05858E rontutko
302,402,838 *1DE2DEF34CB4F5FB577847D43BE425EC5FE93971 SUWEEYAH3
302,402,839 *1DE07D1EB2B1061AAD9098B48C9759EE24775C60 ROSINENESING
302,402,840 *1DEF1A2E3B6625C0CA5444E81F0341F66066AEE1 [email protected]
302,402,841 *1DECA75C7F0C63AB844CE6D9046D3C1232739939 ROSS.RASPOTNIK
302,402,842 *1DE94D6A4784DC4D70CB1B475636C615D07D1C58 syahrul.keren
302,402,843 *1DE2C07417A84553E66FC1AA38ADF0DDECE39883 rshannon2
302,402,844 *1DE50407805EBBBAA88495F30D5CAE3D69DE13F2 syvantha8
302,402,845 *1DE92E77B56CEE806DA22AFBC95A49C099C8FFCC rvslnhccpped
302,402,846 *1DEBAB2BFDB75ED3C159140400B1BFABB9BBC4A5 sagandhaa
302,402,847 *1DE87DAD871162119621EAE869F872156BD918D7 [email protected]
302,402,848 *1DE93300CDD6EB9F857D334C4077282531F98C04 sammy.snail
302,402,849 *1DEA3C76004C7E41B0CC6EA1FABB69E2FA5CC0B2 SAMOCHODOW
302,402,850 *1DED0BB97426B83A92D0E5AEF2E1AC42A5144FA9 sanket-patne
302,402,851 *1DE27B9FF278760CAD366C384516E44BACEFFAF5 santoathay
302,402,852 *1DEFAD969450C7D9B9B6EC96B336850793D9580E TEACHERSTIMPIES
302,402,853 *1DEEB5986A731ED0BF5CF8764AC78992D927B198 sarah-eyers
302,402,854 *1DE6C5BC5F770CF0C34C2332BFD1B23A9329D59B sarahstefan
302,402,855 *1DEF58EB52406AE6DF93F134227397B7E31EAEFF SCAPITANDO1
302,402,856 *1DE8094DD886A95749739683E6A851EB4816FF6D SCHABLONENMASSIGE4
302,402,857 *1DEEF5C03CF7F07AC3629840EFB8FEA955CBEC0F SCHRECKLICHENSES
302,402,858 *1DE2BC1F7CB21946D5E41EE563BCA80FF8336872 SCHREICK7
302,402,859 *1DEE5C7019767217650DC04DE2B7AA432369DA27 TERRENCEOREHEK
302,402,860 *1DE63E9D7AC941C3A3E13CE9D45C140998D4FE19 scotalig
302,402,861 *1DE1E6AF7DCB46129C1474DC05C2BFB0725390B1 THANHLANTIER
302,402,862 *1DEDC1377754AC86E81A6E28997BE81EB8660561 THANKS GOD
302,402,863 *1DEF2C38F829A24598EA80333BC592A02B3F8F9D sentimental.,s/e/nt/@/'m/e/nt//l
302,402,864 *1DE7286610F4F3B70DCE50B6409BE6EED413673C SEPARTES
302,402,865 *1DEFE54969F4A67D5F68D6BB9EEFD92F41E69073 SESOCEP6
302,402,866 *1DEC058927351E03B3A81DEA9455B70CD5835C00 shadleclear
302,402,867 *1DEFDD0777CFC0012EA1FDB4EEC8331563C9B34F THREECOINSINTHEFOUNTAIN(FEATALALBERTS)
302,402,868 *1DE37D7BE2FBF918590071DFEAAE731007ADF5F8 SHAWNAMERRITT
302,402,869 *1DE653A2C79C7D4B37E4EB65BA138007C6EFE0D7 TIBERIAN160TL160
302,402,870 *1DE4B51426F90DE8173A23792EEF79A2686AE942 SHELTON.EAKES
302,402,871 *1DE68F535A556B3F74FBA63165280CA88FB9C48B SHENIA-BROWN
302,402,872 *1DE86D361C9EB3A8AD9D8AB92CE48B091A4DDCE6 TINA.MELWANI
302,402,873 *1DE832428F8583B83335654C9BF0DCB5050C9B9E [email protected]
302,402,874 *1DEBC4E5CE03A454FFAC38F5C632A52B803CD4D2 TLENNARTSON
302,402,875 *1DEB3B900C93E17E8F1802D65AFBF7C5275937A7 TNNTGRPHY7
302,402,876 *1DE282F8C5B1ED2AD99965F5A07D165255B0DB94 SIAMO DEI
302,402,877 *1DE03D1ACD147C2C3FEAD7E1E7EFA0AA2470B484 to do a
302,402,878 *1DEDE871F510231ABBEDD00C1B3E606D6DD98E19 TOD.RATERING
302,402,879 *1DE6CB345E2B713F0791D8440165091E9944993F tom-carder
302,402,880 *1DE1C0A3010368C4205EC2D5D8C89D4144CC5A8C TONEYFRENZ
302,402,881 *1DE1932BE4046949EE4391E9D9B50987EF62B6BA torosnationalmix
302,402,882 *1DE18FBB066A600A80CDEB8B93D9EF6ED87B4FBF [email protected]
302,402,883 *1DE3912033EF828E82A1379B1AF6140692FEEF88 SKNICKKNACKS
302,402,884 *1DEDA576E083B362B31400F3CD6A5ECAE4C15D1B SKYVESSEL
302,402,885 *1DE475FC7C1C73BAC75981196D9391C77341FB0F triball-juniors
302,402,886 *1DEDBDBCC69D149A68CF50D0BFACD3FCD48AC61A trinity012
302,402,887 *1DE7A0E85F292A0D6CB5E610C26A7FFA0F2FCA74 TRISTAN.TODESCHI
302,402,888 *1DEEE506E1B1A3464A58DA321AC85469A1D24E47 TROSTSCHCHINSKY
302,402,889 *1DE77BC8DEE8076FE77F6BCDF66EA8DB97FAC08C SMAELON
302,402,890 *1DE2DDBF16340BEA2F7E87296EF9D9B34B41BD1B SMCMURTER
302,402,891 *1DE027FAF7468E5DE01F509B4B8FB0EEF0F121FB TSKILLI3
302,402,892 *1DE7887316BE67F88A512E35DB8280EB491A9A97 SNEKLYK0
302,402,893 *1DEF1BF3F2BCE37C6D7F8AC42BB28D413CB806BA SOFIYASHRESTHA
302,402,894 *1DE996B63E161617310856A6D083D0CE50977AC9 TWIDDLED
302,402,895 *1DE2662F28877697E3E1789E0C56BD408EA33A06 sonata no 2 in d major op 58 allegretto scherzando
302,402,896 *1DE77BE0DA1B252D44BB1CB211DF9BEE8DA7E71F sonia.bosquez
302,402,897 *1DE3701C2FFAA0BCB8C7664502783648ADE51CDF SONNAILLASSES
302,402,898 *1DE2FCF1FC70B674119095551368BA6A4D0094ED SORABH-GOEL
302,402,899 *1DE3363EDE7C78DD8A9455568B1A4BA1447831C6 TZYJYUNED
302,402,900 *1DE1331685D8B4FCD31E8405529346AE7CC85968 SPARAKSIS
302,402,901 *1DE651FF59DCABD8E785023CC6D5BAE3B3406B2C splato~.0~d###B
302,402,902 *1DE316B6501E46A045F21CE98FD21135C5566551 splat~.~(####p
302,402,903 *1DE90EC36B312BC90AB30988488FEDDBF09F05EB Standing-on-Your-Head
302,402,904 *1DEEA642217215CF4DA0B3789E4A6CE5B34222AA STARŠNO
302,402,905 *1DEA69EC76E4061E600A5C456DE1F9DF00D8BCD6 STAUPEN
302,402,906 *1DE99D16CEDEC23AFAA50DFB963110C34D248905 UOCAVAM
302,402,907 *1DE5516B18C46AA426903F77AD6168BEAAB8D12D up<.
302,402,908 *1DE648C04553C997680833E0321F86B70CE024FC UPOTREBLJAV
302,402,909 *1DE6A601345AF1F7AE4F89623D1793CF3F448DEF STEZKA”
302,402,910 *1DE345E22A513205D58087EA6C2AF7B462F9B766 STORMCACTUS4
302,402,911 *1DE7A1CDC67F6A9D806C2CBC30EC612B0175C942 uS 2 2 5 5
302,402,912 *1DE671E07C20AE050DC6C7FCAA14CBD86CDF25F1 STRAWTSO1
302,402,913 *1DEFA340E534B383BD357826C00B283F75214739 STURGESSBSW1
302,402,914 *1DE789292672031907F97F711E1AD6DCC9CB34EE @USPEX
302,402,915 *1DE2501E982A5A10C387565A78B5AE8156D79CB4 SUMSCORP.COMWWW
302,402,916 *1DE305AF9E0DEC48CA629180B66DF41D66E489C9 UWJ\
302,402,917 *1DEF32B8163FF1EB43E820C430DAEA2DF5EFCCDE VANCEISAGAWA
302,402,918 *1DE4678E3B580682D48865256F761BF9FAFF51C3 VANCE.KALEEL
302,402,919 *1DEB7B17DA798907B58B80822B45554FC3433016 vanessa.mackey
302,402,920 *1DEB1FFC40F30537FE3568BEC450656E6A22BCDA VANESSANAJA
302,402,921 *1DEF541FAF40582A7C4FD426A0B0802D51AA4AFC VANGITA7
302,402,922 *1DED622731F0063D4AACAEF091837DF1855516CB TA-KHA-GA
302,402,923 *1DE0ACCD2A622C5574FAAA32A6FB2486196605F3 VARMEAPPARATERNED
302,402,924 *1DEF25ECB382EDC673020FEF2CEC1874EC165302 VAUGHNCHARTRAW
302,402,925 *1DE5F59F6FF89A3D51ED00FBCE75FBFD26EC1430 VBADENHORST
302,402,926 *1DEEC077E29F51D50DC3CE5C775051A67F777AEC VBYUAA
302,402,927 *1DE2EFB1F198B0F5622A2DAC1C5A0CF9A42F64D0 veldwachter5
302,402,928 *1DE67E0C3D4AC08295272DBB91318F19DAE3B619 veniceedmonds
302,402,929 *1DE2130350BBD91A1B8015B899CA172121F12E48 [email protected]
302,402,930 *1DE8A714A43448F7801EF634967AB7ABC850000F VICKYACERO
302,402,931 *1DE0ADB426FD9C9C73B68BDB938410123B969E17 TBOETEL
302,402,932 *1DEC8464CC269CB88872EBEC4BA1B90DD2EA6E14 VIDALINK7
302,402,933 *1DEC3B6AC99B0D18D01E78D82B5EACC50DCA381E td1s
302,402,934 *1DE2850248749DCD4D72CE55B392764AE3DA9748 villyteoh
302,402,935 *1DE28CA77B023701C1EED15CBF988A6D0F871170 violetkleurig7
302,402,936 *1DE4AEB7AB171E7CE3DE04F1D4700F5513DD2CE2 THAD.DIESTEL
302,402,937 *1DECFBBF38E42EB5BC167CC85461624A7C6DF1E3 thai.god.experience
302,402,938 *1DEADAD93F978905D3F90B90C25194978579C18D thatdammit2
302,402,939 *1DE7A7263A6FBE9E0183009AE398326A09DB2D53 VOPROSI8
302,402,940 *1DE748A647BC17408C9934F2C7DC55D763151686 THEPRECIOUS71
302,402,941 *1DEA271EEF885F9A6202668CC82C1F57F3156383 tictics1
302,402,942 *1DE0C761B95049C802EEB8856EE9C8CEAFB4B032 titan0607
302,402,943 *1DE5D8A9EE165EAAED31BA1B94B6886880A24D07 TNORIMRODNER9
302,402,944 *1DEB7A921E0D9FBF1C060FBE3D31FC2A28799A15 TODAYRUNNER
302,402,945 *1DE0E93F6A65B5E2703758352C8A9A365865F186 W""?
302,402,946 *1DE67F731BB57613BAB33153D984647C048C9B99 W15309
302,402,947 *1DE65439FD682C22B7183B9EC7BE7EF627156448 W232920
302,402,948 *1DEA9D6CF74449677D2B2D2B99C39934626909F7 wadevix
302,402,949 *1DEC3FEE617CCB0A2A616A1F1C862AD49D1090BD WAGONTOWNSED
302,402,950 *1DE59066B9584E07515FBEFCBE508662815ADC6F TONY.ZAS
302,402,951 *1DE52C3B1B90F729FD44F571D5A336725119D953 WAISTFOV
302,402,952 *1DEA4BADE2714110B8D9A204474EEC0E81EA420A TORY.BAUMEISTER
302,402,953 *1DE3FDA6A058B42C5C63FC3F410C958B67198CAE [email protected]
302,402,954 *1DE49195E3B3E6061B7A7034F8DFF8A1DC711FBD tousling
302,402,955 *1DE9D7175439535564D7F7BE523AF363806FA32E Ways-of-the-Lord-(12"-A---extended-version)
302,402,956 *1DEF57B627A42FD6ECC9BFD34ED3B9E0390E9ADA TRENTVANDERSTELT
302,402,957 *1DE6BBBAD2723E18D314440E77088F814B1EF78F [email protected]
302,402,958 *1DE8D82726D0A859BB9E3D4FB69B2EA1525B7193 trgvrsr6
302,402,959 *1DE0353E4396DBF72D269E3BDAF0DF49AA309E8D TRISTAN.THIERY
302,402,960 *1DECD5785AD22A9F8CFA2274F846C01FAD91B842 WESLEY.LEMAIRE
302,402,961 *1DE0D071A0094370C6E366B8D2BFE93D5AE8585F TROPENKOLDER1
302,402,962 *1DE3B9B0D4618975A2B5F607A6B13F4D1028A679 WILLCIURKO
302,402,963 *1DEC596593F7A273163781E482EFB55CDEF444A7 WILLEMIENJANSEN
302,402,964 *1DEE815987FB7C06405B6E6109FD584956977D80 WINSGW
302,402,965 *1DE556BD72C1347FBA7101DF3A940AB8C8822E50 [email protected]
302,402,966 *1DE03E5449A5C84B3A21780C22DAC3C0F8A3A342 TWINLIVES
302,402,967 *1DE855615E9ADB636062D3F10653F2DFC7333740 WON'TFLYINJAHFACE
302,402,968 *1DE5503FBDE06C6B36C5AF1B82C02366CF786F3F WPWTASOCALLED
302,402,969 *1DEC1796009BFFC55216303C9D4EA63F4B142EFF WSZNR
302,402,970 *1DE0C530D15E9A48019E1787BB522DCBD06380B5 UESSUAHC9
302,402,971 *1DE81425E4C2BF30721FADBB30CDAE3046A4B296 wwwtofu-magazinenet
302,402,972 *1DE5BDBFE2052F3F691BC60A747D33AAB59AB384 unapplausive
302,402,973 *1DEB0FB4C1FEB70BB24C4AEF0A3F673A43B651C8 xamzxamzkeyloco
302,402,974 *1DE78FD3EF87CBBA6F14025605DB784B0E06ECFF X`D=
302,402,975 *1DE6CCD471011F09212549F7412724EADB274B7B [email protected]
302,402,976 *1DE039A18AD8C846D435515CB7D16EAEAB242FDD UNSOLDTING
302,402,977 *1DE086B25730C5115D3CE46B33994D74CC0D2F1F X]KPAHK
302,402,978 *1DEA52DF2300FB9292AE122B3DCC8DC83816348F XTRNZTN4
302,402,979 *1DE88EBD1E8044E322AF775B879186CA215E8386 XYLAJACKSON
302,402,980 *1DE1A502995AF676844E8AEBF5D890A1D6258814 YAO.FACHENG
302,402,981 *1DEE53C82D1A4E4E3F9677CCA81B5ABC9594C3EB [email protected]
302,402,982 *1DE51613938AB131010411F8CC286BAEAC1B5950 [email protected]
302,402,983 *1DEC60D8F44136F13621EBB0FF3443F991E2A60D [email protected]
302,402,984 *1DE1F8FF614A496D47F5E82A23425F6DAE07C031 [email protected]
302,402,985 *1DE89BC49DD4878A8E4AEF971B7835F401FD1A77 [email protected]
302,402,986 *1DE60B0D31CDB4A63B8ABB791F4419B8553AEAD4 VALMARULJAS
302,402,987 *1DE5C57A3B1E0EE7AB167622942D7DB01EF8B868 valuesofnit'snaturaltosaythatnisthekeyhere
302,402,988 *1DE89557EFE1CF4D67CF70F92838A77BA36E4389 VAPAARAHOITTEISEN
302,402,989 *1DE9CCE6D446BD958F63173C6EEFB1EE52AE8BE6 VARDAHASSAN
302,402,990 *1DE4FACCCC23FAD899BEC674FA9F2B022267F877 VARIATIONS ON A THEME BY GLUCK K. 455 (TEMPO I)
302,402,991 *1DE02012375B8F860A46009916C7BDB99FA04F23 varshadhyani
302,402,992 *1DE830883AF4A5002A6336C3B4EBC95CDA2B5A05 yp!u
302,402,993 *1DE7C5176D993E74F75B5F045CBAB3A6DEDA826B VERHOUDINGSNUANSERIN4
302,402,994 *1DE864447A1C892EA8783C4F71747098ACA9F731 vernvioletta
302,402,995 *1DE05DA4ED553FD5B870DE96F5C680F11C10BCB0 yvette.brimmer
302,402,996 *1DEC74DD22A5634EE8A837A5D0D773AC035116D4 VETLLADES
302,402,997 *1DE9D78356C8F3D22B7EF094F44114865FA109E8 victorialaurenchild
302,402,998 *1DEE5F6147758F8AA19AFB9EEE535E44FE77941A VICTORIASTRONKS
302,402,999 *1DEB0520B86515199CC382C77A6E2CD2E0524B8C VICTORIAWONTHAGGI
302,403,000 *1DE1FAE68DE59DDD72579452A0134663737F022E vikki-thwala
302,403,001 *1DEC98488409957B039E7833047459A0A85ED1E9 VILJELIJAEVAEESTOEAE8
302,403,002 *1DE338BD3B5EE92210F2DD6A34986E16DEE58FE9 VINCENZO.SKOLD
302,403,003 *1DE13A045C5BC77417C1555772D0962EBC1FC4E8 ZDOROVE9
302,403,004 *1DEFD7883A5EAE53C4CB1AF4DD4860BBD0493FDD VIRGIL.LILLPOP
302,403,005 *1DE0E5D5E6520C48F7A3E6D09ED927B2CD73FDE1 ZHANNAPIVOVAREVICH
302,403,006 *1DEB5255EF1F8C120B72B9DAB48CD4183CEE4DE8 [email protected]
302,403,007 *1DE14C240220441017EA240B52E19D0B560E989E VIVIAN-MCCULLEY
302,403,008 *1DE004276A85F5A0174C2307CC72D03A88F31CD0 [email protected]
302,403,009 *1DE85D72616B4AA34B4A7E82A57BE2D690BD7A21 [email protected]
302,403,010 *1DEAB149FB9BDEEAD0639C4568759812AC76D795 vogelmeerpolder
302,403,011 *1DED77322A05B598E78CE363D347FF245C5D5399 VOPXAA
302,403,012 *1DE23DBF62E05AB0AA4AEC12036EFCBA680A079D ZMFCPVBORE8EQ2
302,403,013 *1DEB45524C93B5CE3A4621F9A5BF85A3CD637DFA wallydaigneault
302,403,014 *1DECFC92879B72C107F708CD25FF23A381B756A2 ΚΕΧΡΆΣ
302,403,015 *1DE51D48B67AE727446A45E99C655B5ECF8636C0 АЛИСУЛТА́НОВИЧ
302,403,016 *1DEFA1D239B05ED2C5BF897F228AD054CCBE2152 ДЕРЕВ’ЯНИСТІ
302,403,017 *1DE3AF4A66F8259278ABF47AF4E3AF9086DFEAF5 WESLEY.OSIKA
302,403,018 *1DE58AD4AC00D2C3DF1774EF336F23DC00BD949C ЛЮШОНЕ
302,403,019 *1DE151EFAE78F1F062B80ADE72A508920D6DF96B whtene55
302,403,020 *1DE13FF25ED436C1B0E2FBA25C436C7FCA255239 william-raymond-fischer
302,403,021 *1DEEFBB8C2F157600BB4CB2F675F6FCC62B99F49 WILLIEBUFFALO
302,403,022 *1DE0C919DCB1D65B1609DB8A3302AB3EC1F28AA5 WILL-MASELAS
302,403,023 *1DEF95FAFAE5A6D978825E66603F5D3FA41B025A WILL.MASELAS
302,403,024 *1DEFE667220265B25BD837F8F4E4B07B9FC510BA wilma-kristera
302,403,025 *1DE6F8B19B01DBC71B81D95987722545D4EF55CA WILTON.LASKIN
302,403,026 *1DEDF7D0052FB3F9505E9AF5429F68503DF0AA3F ЦИНСКОГО
302,403,027 *1DE7D20403B5EAFF628814705063F47628DF4C53 winfordsuit
302,403,028 *1DEBD5FE328C5AA854B5863EF77E3522BFD03F5D wingmboys
302,403,029 *1DE4403741CE6793D30CCC6EE2FB065F8007E9AC [email protected]
302,403,030 *1DE87BD58E90ED928B7A2F4ED8608EBA90219EE2 [email protected]
302,403,031 *1DE992A3058997D73A97899C1D096FE52F2DA8C3 wwwretractableawningscouk
302,403,032 *1DE498E92CCFE08C55EFB149BDD2ABF320DA90D0 WWW.TAPIOCAWORLD.COM
302,403,033 *1DE8E476E0267E7072A8236284A1ED00051202FD wyattdoerfler
302,403,034 *1DECF0F2659AE92486D5843D4042E305947D1047 [email protected]
302,403,035 *1DED76480A3C1421320E8041E83F6BA4EB6FAC6E xc(
302,403,036 *1DE69D5E91EFD7C0FAD6F38099E2A4A71A933D82 XYRICHTH3
302,403,037 *1DEB3530D845177597111701208A6F45BD2C0637 YANYANCEN
302,403,038 *1DE4C13E798948D982BD63C939C5F72084CEEC98 [email protected]
302,403,039 *1DEF7E84755F041EC4CC6CADD48491E2A4A88639 YLLÄTYSETU
302,403,040 *1DE376DE47B2C4B0E5789ADA11689E8C4A883696 YOUCOULDNEVERBEWITHME
302,403,041 *1DE6301A1F517536B662DDB4926E86821588F4CC [email protected]
302,403,042 *1DEED91FD4E30471028679341154E7E091685AF5 YU MON AYE
302,403,043 *1DEAB788FC44045AF7BC1AB875DDA58565C26397 [email protected]
302,403,044 *1DEFBD318ECB63ED90B2C727F613D1FFD21E5C9C ZACK.HARDISTY
302,403,045 *1DE7CA9E0FC98110864BA835228DA3A57F0EA3D4 ZANESTUEBE
302,403,046 *1DE9FBB4D441BE61D35254F2EB8315FD37BE14BD ZENÉSZENGEDÉLYT
302,403,047 *1DEBBCA3FAF1B47E96543C231ADA400D872D0250 zeynepsubasi
302,403,048 *1DEC6A4CFB6AC6CDCD47D0010057673C8CF8F904 zohra-nooreen
302,403,049 *1DE754566424C88BD967DFF35B8DAFE8F023D4DA 07613A8C-C372-370B-8F62-D4F1C5382362
302,403,050 *1DE8101D5FE9A1824560971097BAD5ED639E19A5 0ILOVEBEER6
302,403,051 *1DEB19BFB2B07A90252E94EECF3DD128310991D6 1126687 ne pit
302,403,052 *1DEFFB1CC4D84656FD1831861B2D3E15DDB20A81 11-UMWELTFOLGEN
302,403,053 *1DE5F048F666066F1D4F7264D1C787A98EE3ADFA 12.MUSIIKKILEIKKIKOULUUN
302,403,054 *1DECF521A24461F283F0537A53799D0C5870D4EF 12saaduilla
302,403,055 *1DE204712F8CB6C3C23A80414619A707C9EA8EB9 рожрио
302,403,056 *1DE9625A0E309B1F7CB654D6E338150F2C3D7844 1438682 DASTEILTEDIEMESSEFRANKFURTAMDIENSTAGMIT
302,403,057 *1DEA84EF85F2AB286B888E77F44FD23C5EEF6750 ШТАМПАРСКИ
302,403,058 *1DED7539A8758A1C3BC516CDFB70BB4A8A4EB3AE 1 AKAKTIVEN
302,403,059 *1DE03B715F57FE11DCAF76964365E497FC2FE63B 1 AVANTOMINAISUUDELLA
302,403,060 *1DE24A8EFA98EF250093311070D6CE902F1E9D12 初始条件:树t存在,i是树t中结点的序号。操作结果:返回第i个结点的值
302,403,061 *1DEFAAF4162C314E033D79AE9B8A8D4AE2880E71 1-gekoppelter
302,403,062 *1DE22D9BE7A56213FAAD990A20CEE8EBEEECBAE8 1HABIG
302,403,063 *1DE09316005FFEE81012C934058E0C8E0EAD67D9 1klauman
302,403,064 *1DE60551F826625D7FD51D6EFF28353B607E5B50 1 KREIAUSSCHUSS
302,403,065 *1DE3F50283B9DC26EB1DFD6FA2860B96C0F9362E 1 PFER
302,403,066 *1DE600CC3D818B5EF4C4C23059C43DB0B7A3EB04 1popovkommission
302,403,067 *1DEC3544E158C8A91FE6C44B322028B36A063B54 1Q23411
302,403,068 *1DE82BB0EE8E5B0C5371F6B6C61FAC96E3B888C7 1SERVICESPIEL
302,403,069 *1DECF712AA0EC958C389A81A6CAA240C04FEFC14 1umts-ausbaus
302,403,070 *1DEDC741D907F1518363292EA6F452B7996B5519 1.VAATSIOJYRI
302,403,071 *1DE1EBB584035285471605A51E194A8529D9FF45 1VEDTAGET
302,403,072 *1DE90704A389E8A420695228BAF95729E5F53272 225786 kalevala 2001 vahvaa n
302,403,073 *1DE4002DC7A58E6E80CB7CD69562C3E0ACDA5E98 24.03.1460
302,403,074 *1DE12EB4A864554118F8CFCFE27B02E9EBED7781 02241510
302,403,075 *1DE160769C8A8C3DC83BDFE7A149CE1DE424021B 2GORUYORSANIZ
302,403,076 *1DE3457B65ADE7F4520C586198041EF2BB2BD469 0914SECTION8PERCENT
302,403,077 *1DEDA48CF618F2852BEE35361F0D177A1E113C68 2MYSTAR9
302,403,078 *1DEACCB31F843DBDC33B0C7025C4D94FEAE46A26 2SCHOELER123
302,403,079 *1DE61F90A568338238078FFFC755AA6852F5D6BC 2.STRASS'E
302,403,080 *1DE152F5C2936ABAAC5E64BB1C0D71DB1C0B7CDC 2UGGIOLA
302,403,081 *1DE124CB0CBC8C2970ED6BA25F99040EB081F8D0 2.yhdistelm
302,403,082 *1DE569F09798B731A8C81EC0319BE2F03FA6BC7C 131313LITTLE
302,403,083 *1DEE99D7DF271832A5194942589DD6E7AB91FC64 1332419 derdamaligeaufstiegwareineriesensensation
302,403,084 *1DE580EDEC191132CAED67ACD2F77C05CC386417 3-D*{X}
302,403,085 *1DEEA4D8932AAC1996B0B064540BB677E77AB319 3KP付近)が
302,403,086 *1DED4DE341E46F7BE33BAF331371CFA57954A352 1553328 ONKO-KARTTA-TAIDETTA-?
302,403,087 *1DEB94E4BBC9CB3ED6FAD895D466D10AA3C31A03 1572929 the martin marietta rocket is valued at $173 million
302,403,088 *1DE32DAABCB35EB1C97DF8184C7C01B019FCDFE5 1596729 BUT-MR--VILLARREAL-TOLERATES-THIS-
302,403,089 *1DE1D6876700F08ECB3B7D65ADB8A4B4665F186C 3PHENOCAIN
302,403,090 *1DE95FF4D305940F93F135492AB76264272FF7FB 3-pieces-for-lute:-gigue
302,403,091 *1DEEFBC85C48CD071F612FAC2BAED95BC270DDDD 3SVDECTVM
302,403,092 *1DEC357EAF3F9B05EE227CB206D3C476FB0437A1 3 TUVALLA
302,403,093 *1DE3ECE3C463760CA6FF22786AE22541BBAD8C49 3valotustoiminnot
302,403,094 *1DE6AEFD1E7BDF75004638347C2D75A71B6745F7 [email protected]@71NG
302,403,095 *1DE993806826447293C55A3ADBB490CE44984E84 [email protected]
302,403,096 *1DE8AFF890283C85AE8EACC45FBF02B56D5C87B5 1694978 FAHRER UND TECHNIKER SEHEN DAS NICHT SO
302,403,097 *1DE49DF1321041F1BB4B94CD9A9A801E611BA465 4051612
302,403,098 *1DE0398DF208C4F45D298EB443D75AA49B0DB56A 463.FRENTZEN
302,403,099 *1DE1F650CA7A31FECAA8C4B38E8EC5753D73C0C5 474MARTHA
302,403,100 *1DE753029CA3913E2C7589A45AA94080ED3317FD 1akinci'nIn
302,403,101 *1DE2AA91487DD573B27E1E809E69C9C5B506987F 1anfeuernd
302,403,102 *1DE416C55413A11699A840EF256696D9C7F66998 1askable
302,403,103 *1DE9540B5D8A79BC237903E06A9C703CAE3FC7A5 4ROSEBUDGRAPHIC
302,403,104 *1DE29E8DF82A2531D5646C37099E3C5602FD04CA 4SELECTI
302,403,105 *1DE7CD7984E3D418960CF9B07EB358D54AF6C687 1.beweismittelordner
302,403,106 *1DE48ADAC32A8E970EF184131C3CD13A9F0E4C70 1 calistinlan
302,403,107 *1DE12171637879215C0142A0016CC0D580D31D17 4TRYGONA
302,403,108 *1DE9370C1F3A359AADF405535EF372FC57A73163 1-conland
302,403,109 *1DE7F1A55CCB3D5DD7762306594765DEDCD3A4CD 1 CONTUR
302,403,110 *1DECFAEE27E51D4BB66B4C88CB058D487782885F 1 COUSSE
302,403,111 *1DE867B45EFFDC6780E1ACC7CFC37DF5D5DDAF67 4YLESORE
302,403,112 *1DE748DA0A2D5DE1F48B3F6577F17A0EF6DEB2A4 1.HOLZMANN-SANIERER
302,403,113 *1DE443FF2CE7C9CA6287F94A6AF06CD0D59171F2 1IAMROGER3
302,403,114 *1DE93BF9178FD00DDDA8D36FFD7AAF23F5E0D2EF 1 kivekk
302,403,115 *1DE3E1EB420CAFBCFB54FEE1C1A0A9F23A37A27B 5exhilarant
302,403,116 *1DEF81494E955433ADC6F36320BA1E9E2FDF6E5E 1MYSLAYER0
302,403,117 *1DE47DDFE785CA29F6893F62D894939BCD017D19 5periode
302,403,118 *1DE47B7F8A713C421C64328C49F90D747B9D0B0A 1passagiert
302,403,119 *1DE5D62D58766866A4B91C63742E1146D830456B 5TEGATAKA
302,403,120 *1DEDEB15123BAE2CC3BBCCE0050A1AAF59B50A1E 5thatsunshine7
302,403,121 *1DEBC513132CE65C2B637A618FEBA15FDC8E9453 1REGIERUNGSBOTSCHAFT
302,403,122 *1DE9410F6E32AD02346D0C7DE068BEDB31D11FD9 1 REMBRANDTTUTKIMUKSEN
302,403,123 *1DEF5C5AF48AFB29CD907C3A10D362BCAAC707F1 1sanjosestartrek
302,403,124 *1DE433CE1A789BAAC8AF9C09094A1D60E4A71375 636FREDDY
302,403,125 *1DE6CA65401D755894A64ACF1C2409A691AF3C61 1tyeharris
302,403,126 *1DE9A6A579FB885126EF03A7D84E986DCC852B96 6DARRENIRISH
302,403,127 *1DE9216BF344C377CE2759A373B110F78A8AC497 6FD1VWXYA9TK
302,403,128 *1DEE59113E7DB0916AE5C01E0450BFA444E1F935 2064SCER
302,403,129 *1DEB5F49827FC0DE91661B4ECA85B13D5E966AEE 20SYRIAWEBPAGE
302,403,130 *1DEC45C3664B7AF7FC9F74A05654F0E8E16B84AE 21-lintuharrastajat
302,403,131 *1DE3701A49C7BC3D0C2CD2786328762E38B7C617 6POKRASNIEC
302,403,132 *1DEAB201A8F2EECE7EFD4A755EDB91A1B6691370 6QUESTIONSQUOT
302,403,133 *1DE60CA35DF34B9FC1755E6A2B43B8AB253B71D4 6RIJKSKWEEKSCHOOLS
302,403,134 *1DE520E76C2F534B2FBE327913BDB13ECE7A1B53 2326606 kandidaatintutkinnonsuorittaneidensiirtymisenty
302,403,135 *1DED26481A728E3C2F66A5AACAD941AE98421F4B 6SYBARITICAL
302,403,136 *1DEF2C239A4F1F8BE8D8188010D9054BB594EFC8 711217 MONET.PERHEET.OLIVAT.TODELLISESSA.TIEDON.PAITSIOSSA..
302,403,137 *1DE7B3CA99DDBC26E554CE4D25F4CD64A09D7313 712poiu
302,403,138 *1DEF543DC02BC27DDDB73870C412471BA8880574 2695641 LUE.LIS
302,403,139 *1DED17C77023CFC3A6C59AD348F6FDD28C565264 2716946 tapaamista voidaan valvoa erityisest
302,403,140 *1DE8834DEB5E52EF96368F4BB30E4B3896A36D59 2739852 LIEBESBEWEIS'ABAPRILIMCLUB!"
302,403,141 *1DE77A2C27F41375A3AF50A4F8B9B573D84A2866 2761686 kuvapalvelutloginkopiotaidonprojekti/kuvapankink
302,403,142 *1DE2AB9BD709C61F5D84952DBA3C8EB494EBC4AA 7AAMESTIN
302,403,143 *1DEA347EB2B313E4E27C5488ACA7AD01AE8C2259 2819869 BUT.IT'S.HARD.TO.TAKE.THAT.PLASTIC.GRIN.IN.THE.MORNING..
302,403,144 *1DE1D2BB44E89E1D5FA5CC4A1313D5A565EAFAE8 7BSWAAAAABBBBBBCC
302,403,145 *1DE8B0D4F2E5195C02A7318776E5D8E6F315E65C 7BSWNYLANDERBSW
302,403,146 *1DEDB79F28F912FBBBB0B965251D64EC6EEA6629 7CPRMTNBSW
302,403,147 *1DEFE81FE7224449B3CB830784B869FAAB83A90A 2AD8C3B464B84045
302,403,148 *1DEB072FEA684E9643EBD74B87B6F2A9556CC85A 2-ANGELS-OFFERED
302,403,149 *1DE268B19E820BD1BBDF5C7DB5164D37CC84F672 7EMPTYWORDS
302,403,150 *1DECEB351E0B70962149CA629389CBE3FC911DFE 2COMMEATU
302,403,151 *1DE6DAA6485E241F8AC80C768B6EE87E517F3F05 7FRAGTVOGNE
302,403,152 *1DE3BFE918178BFF9003C20CDBBEA6D99DDBC095 2EH26
302,403,153 *1DE13F360904F7172CCFD3CEFB965BB28ACDD7BC 2.grinc
302,403,154 *1DE2BD649406A6E266F5B674CA0689B665E8A940 2.GROUP'ILTA
302,403,155 *1DE584DF29B194CEE0750D442F7D145634BFBB3D 7iluvpaagal9
302,403,156 *1DED4921414D58C17985F97131BD2201E8DA97FA 2MOBILISOIDA
302,403,157 *1DED37519E7150BD72EBB0CA284CCF7576C245CF 2NUMITOR
302,403,158 *1DE38FCCB70816714312CAE40E0E0F53D08528DE 7OCTOBER2002
302,403,159 *1DE6AF9A13B7D25B0A6766D72B8DC673CA138266 2ROBISCH
302,403,160 *1DE8FB61D13171413E305415A6F6F034DD9F937C 7stultified
302,403,161 *1DECE794CB1A3468F8E03E52D5DD4FAB550FC194 7YR070XIC0N
302,403,162 *1DEE137D57F9179A41F8756E48B81A42B7EB911E 376108272X
302,403,163 *1DE50FDF9A8F344DA48F0822E91AB217D459BDAC 8047EUX
302,403,164 *1DEA70E643B4F713741D948BE59CFF45682DA24F 8ANTHONYYVONNE
302,403,165 *1DEC39A9A479ADAB08533453148132D1511F5B64 8==B.*.*.SPLAT!
302,403,166 *1DEBD4A5190EEA0AF52F35D5DB515AF36B22B98D 8BSWGELIEUSTRBSW
302,403,167 *1DE18B543DB05E53AB3A784DDE5B13473ABF6B56 3HARUEST
302,403,168 *1DEFE41C30877960135C9327048855D8F0BE5CBE 3.internetversiot
302,403,169 *1DEFC1D58CA00B786C284662FA1ED456D813A265 3-M
302,403,170 *1DEBDF2FC3094A723104AD970AC30C3DB82F41DD 8D~O~O)X(
302,403,171 *1DE6849CBDC689A9CAB4869D5C073872C3175E4B 3-svengaavaa
302,403,172 *1DE799E20532E735740372923F66DB990ECF17F9 8MINASOKO
302,403,173 *1DE7253DF8C4779025B8FAC72039F6F84332A3B7 8MUNGINGS
302,403,174 *1DE1CFE5110D8628BF54D30F597BCF0E82FD70D1 8NEESIJRY
302,403,175 *1DE1CC7DEE9C29FC1AED7C295583B3F2B6F72806 8NONADVERBIALLY
302,403,176 *1DEB69A32BE2B3E42911FB2F1D46A5F1C86EDCE7 8#P~0.~O.(X)
302,403,177 *1DE01C21A29E91BB22562B5C9A811979A5ADECFC 8PENETRAITOR
302,403,178 *1DE7132F8FB54EB048F7240A8CD4F89382EF399C 4B147!ON$
302,403,179 *1DE481F07C6004B77684D190CE205FE343629D86 8SEUKKIIL
302,403,180 *1DE65C4550053042B47CEFFF53E9B10BDFC940E5 8SPIEKPAPIERTJESES
302,403,181 *1DED7C6AF79514F553CFDCDC3AF8442259F8E877 8TEACHERFRANCIS
302,403,182 *1DE354D50A747FFFCEC2D9A0C8032BC5B825B2F3 4iamxxx1
302,403,183 *1DE5AB15CB2D08A1D6A46B97084C539EF39A8AFC 4NEJPODIVUHODNEJSI
302,403,184 *1DE7C9E4FFFCCDED112321C774FAA1DD3FD0F16C 9-beckenknochen
302,403,185 *1DE37BB548CEE915B4C6EBB6EB2E7C6683B81234 9birdsall
302,403,186 *1DE298B18907C7DBB948545F4F865129B5945315 9discourtoises
302,403,187 *1DE710C3AFAF55F48009F12C4D2B6F3E24F1EFA8 [email protected]
302,403,188 *1DE4AEE33C8942B78D0A203B5608B0F3A80AF67F 9NEMRAVRE
302,403,189 *1DE51F68AA30479D4A6DAF7AB9B2D487E0F1B804 575KB
302,403,190 *1DED2134E2D82A47CDA1B806349DCA0D2835A0FB 5ADMOESTAR
302,403,191 *1DEC046978B34A8C524C6CD0E20754A17E42B444 5ANGIEHORNETS
302,403,192 *1DE8F87F8950E3257A57BB4D69CB52CFA213EEDC 5AUDITAS
302,403,193 *1DE0E21D62D205C507590C9DD82FB94F4D8662AA 5BAKHUIZE
302,403,194 *1DEB43598D4877255FE8F69C65FBFA59C9389CE1 [email protected]
302,403,195 *1DE9A93723E2E83CB8EE0C55C0B4001AECD3A142 9TSIVIKAT
302,403,196 *1DE010FB14CBF9D0A913C838C6FE395A846886BF 9YKSINHUOLTAJU
302,403,197 *1DEF16A8BE4F5D9BEAEB430A22CE1A2228ADC968 5EHSUBOWT
302,403,198 *1DEDBEB7E04804DC2D4C33518A17FEB008AF0ABD 5EXALTIONSES
302,403,199 *1DEFB1536CE886353904E77DD30AD10AF0EAD979 5HEZFZNPQXGIYMLO
302,403,200 *1DE22F1FAE9BC5B97D8325A54EBF23CC657DC778 a1+jq
302,403,201 *1DE1D4177E37D0021668E52FC858ECD7EEF5CF17 5KALOSJENE
302,403,202 *1DEA5394A4AE40EAA581D016C33ED4634534FCDC a3226ee96bc1fb2a160161c02031d8a3-senghooi
302,403,203 *1DE12E47CB997E4CBAC1F7DAE0332032DF2A9646 a4dof
302,403,204 *1DE0949EEA6CCD617D3037277FCE72518E573572 a4ofr
302,403,205 *1DE919BC634B9F1AC4D6FB89A7DB20CDFB8A3193 aac``u
302,403,206 *1DE272ADC6A93ED50004AB386BFAC43F5E28934A AAE9U
302,403,207 *1DEC13AC2224094E9582BA77B6B71BA6B2321188 5WHEREFORTHES
302,403,208 *1DE127AEF4D10CEED336B4881865319C466F2DD4 aambeeld
302,403,209 *1DE63E9ECCFA6214B5182984ECB2DB905FDFDE88 abdulgeneseo
302,403,210 *1DE73B92248B7E22F9B2FE14454A55C62F5FB04B ABDULLAVALI
302,403,211 *1DE04B717F6BFA4FA70B603EB4DB02CAEFF29ADE ABEL.SHERREN
302,403,212 *1DEAF9368B386F3D7B1A557E717633F518621455 abercro3
302,403,213 *1DEF14DF59C5B6E1F960C57F3239577969D1CF9B 6JAMESMONOPOLY
302,403,214 *1DEC0C2BE75A1ACC60187F5E6F58217D773B1711 accessoribsw6
302,403,215 *1DE2EA39784D355D0D20EE3724C2F647AA22F51C 6MONSTERSAMMY
302,403,216 *1DE28CB86CED14185C9E96A3AD547DA5F4313AC0 [email protected]
302,403,217 *1DEBC2BB85194D8E92E557DB50A608B065F11302 6NSSNIRVANA
302,403,218 *1DE6F6918B0932F32C9528B0944B3EFEC688462E 6NVNTRRZ
302,403,219 *1DE4392672E934E651B6D8202F9B9DF0FC2EAA3D a?#d
302,403,220 *1DE5F3009A921EEC834824B3956F29B1B906E744 adam-mountain
302,403,221 *1DE58BD4C89AE2BF67CA36D0128D70D5F2F1DD08 6WEISSBIE
302,403,222 *1DE2F65B8B70EACCB2F74B2D3C9A8E41CB29DB9A [email protected]#$%^&*()
302,403,223 *1DE3EF03779F43D57762F9DEA38D8A849DF433A7 [email protected]#$%^&*()
302,403,224 *1DED49C55AC3F80B313EA312FE16195A60922E1D 7CHENTHILVEL
302,403,225 *1DE6482E98D11620B7E37722BEC7225D44D66E24 7CHPPLLS
302,403,226 *1DE4882F9B8090858DD5B179A05525640D306068 7CKLINESS
302,403,227 *1DE86A48445ECC0577A38AB49F8EF24A471EB4AA ADHIRAMOSING
302,403,228 *1DE7690073B44C942BA44B8B0EA76567D33A2990 ADJUSTER
302,403,229 *1DE152B0299D42D243EBBFEEE017F6BC1EE94A0D AFKIEST8
302,403,230 *1DE8605E699E97AE4C12970DECA81258A677C101 7-TILASUUNNITTELUUN
302,403,231 *1DE284569B14FDDC89FFDFBAF21669E3BAB08468 7UMUTUSTA
302,403,232 *1DEB7680A47513AB956D0DA9D919034F837B2F15 AHMAD.KIVETT
302,403,233 *1DE9CD5A3D108016FC9222F62AC31287A99B0E55 7ZAMIYAD
302,403,234 *1DE31284056F1481ABD8B6E40C6057F8373E3942 AIHEEKSE7
302,403,235 *1DE42744ED1812417C7A36CF8A32D91731490A4B aiu0v
302,403,236 *1DEE69D09A4D695D8388E04F6609C290EE88EA9A 8FLIBUSTER
302,403,237 *1DE681B52015CDE9DB53E5D69658C9A06DA47009 8FORDRUYETH
302,403,238 *1DEA6BC786E120728FBFAF378E0BA77143526D0B AKUANUTEN
302,403,239 *1DE477D13236CB573170EA6AB81AC5BC75743638 8KORPISUD
302,403,240 *1DEF2D96FF68020E715390DFAF94685530AA08C9 8LINDSEYPOPCORN
302,403,241 *1DE4CCF53FC9749B8AD685817F33C5066878648D ALDENSCHRADLE
302,403,242 *1DE93F8AAD4DC39FD3608AFEB37DED60A62BE447 }8{o~o~ d##p
302,403,243 *1DE9278F1DA610B84A3F8F975F93927C2A4FA993 8--P`SPLAT!!
302,403,244 *1DECDDAC1929876FB0CAC4957DC61492F7FECA2B 919alonso
302,403,245 *1DEA79FC26A86037F5F858FE45703ADB986F9419 956324 EINE-LITERARISCHE-EINLADUNG-
302,403,246 *1DEB790F3A99A43ADBA86A15CD7129DEAD750841 9BENSONSTINGRAY
302,403,247 *1DEB159ABC9F5A6A8C33031847A0BADE25212880 9BONTENS
302,403,248 *1DE8042009BEB5DA9B3FF47533C54E78BB78DFA9 9BSWANADRILL
302,403,249 *1DE630626A293389486F2BE1783D9CA9BB326983 9BSWWINPKTBSW
302,403,250 *1DE09C6FCF5D0EA070785009207909ADA0699923 alvinfausset
302,403,251 *1DE6F7015A483B15DED57F9CE1A6F26BF71024BD always intact
302,403,252 *1DEED2E37F47EE45DA7F2C4920B54116BF76A2EE 9EKNEDTIU
302,403,253 *1DE395CBEE53DEBE35DA3858E9B9AF671BBB4A13 9ELIDONIC
302,403,254 *1DE5FCFE77669D5867EA94F4D09F93E760F76C57 AMANDAPURVES
302,403,255 *1DE8D2281DE28E91C3D0BC6830C79CBF869C1173 [email protected]
302,403,256 *1DEBAEC955EDA26BFD5EF2F4532FFCE2A18EDD47 amh9#
302,403,257 *1DEEA3B0B2DB587E7325DACC1C413A856046A308 an_a
302,403,258 *1DEB0369D432278A81CB975FF1B7FF23196671A9 ANDT
302,403,259 *1DEC93DBC49B95858EDB10613B0F620ED5C43889 [email protected]
302,403,260 *1DE9541BF50E819ACEE82041C8036F8C8438E0A3 9:$line=&lt;stdin&gt;;
302,403,261 *1DE07BB04279A0C0661520FD006AADA81D0D357A AnnaCs
302,403,262 *1DEA597315E56A6F17C008E2B6D0DFEA6A8816BF [email protected]
302,403,263 *1DE95457186FDC379B751E07F3BDFF51688F87F7 ANNYYPONCHO
302,403,264 *1DE459E92A6FBE3D261AB1AAFE8DB214E7AAA07D [email protected]
302,403,265 *1DEB9A047B07F92747BA50CBA87D126C21DCE86E antoniodussault
302,403,266 *1DE5F3B7E8C5AE1FFA3E0662F1E26C4A7C8018DC antonyemler
302,403,267 *1DE00985201DF049DD2C004F1FD79BE16D5A92DE aphoriser3
302,403,268 *1DE92FF4D3EF454EB5235C7C1663E99D212BCBDC ardencavazos
302,403,269 *1DE86941259697A6FB5AFB3ACC48DF022058FA10 a&1ua
302,403,270 *1DEADD4BB26303300D69DDA0C0B8AA67BEF0B3A3 A6WOS
302,403,271 *1DE0637BF60A83983E222DF7B1849B4FF3198FB3 aropaved1
302,403,272 *1DE40BB9C5EA21847768BA217E1F1583E7EE59DD arrkh
302,403,273 *1DE0D56025FCF400D5E727B439124560BBAA7376 aruiu
302,403,274 *1DE2427058CA506B9F15744CC3F96E4ED7F14F33 ashisye2
302,403,275 *1DE11DF6CF892A5A0DDA0BD402DA5B1C0E1E18DA [email protected]
302,403,276 *1DE832C125CF333B1D64E12F1E1DAB6AEBC2B7B9 aabih
302,403,277 *1DE2839560FEE1670108498DC85F8870D24F68E1 ATTICES
302,403,278 *1DEEC8EBB37A040AA73B1C2965042FDA97CA94DC a-aek
302,403,279 *1DEFD8D6FB055A0ECF88A7FE7FB441728422DC3F aardbe1
302,403,280 *1DE043CBD98CE25CE7C12933ECEBAFCA4BA632D9 AAVRF
302,403,281 *1DE64B677B66CB65369473215E2F71D7DDD4F859 abfs}
302,403,282 *1DE69ADCC5A7471AC18A862EF48559674A5A6B77 B3_,Q
302,403,283 *1DE035E066E20CD3F0FC3BF80228517D2AFBD160 AH/#3
302,403,284 *1DE7D2BB0AFDABBC323031C4657861BCBE801F1B BAR 121-131
302,403,285 *1DE87099C49CD7F8EF5F5E3013C06B4BC0A12812 alecringering
302,403,286 *1DE2B505D9B588DD62A501FBC37DC8672762A74A aleholih9
302,403,287 *1DE0FCF77102751E1E8E72A35005BED1459722CB alexisalexa
302,403,288 *1DEE1A2EE8FDD8A5D338AB9B2EE5F9825C64FA52 ALILEFEW
302,403,289 *1DEE8FA98182ECE2348C7C072DFDB4451983FA8A beckyskuse
302,403,290 *1DE3E1F33511D1B9C2F361585D9FE6CED05FF181 b&eh5
302,403,291 *1DEFA750A1B78B378630B2DAF8BDA487AC691A2C BENZOYLAMINO
302,403,292 *1DE508BB5718FC8F688202C299BBB5C0EF77EFDF alvinreveron
302,403,293 *1DE14A28521E985C5F5431B92309CB3A61C736C9 ALYSSARED8
302,403,294 *1DEDE9162A03C5EABC88D7FD715260223C60BCFB A_M"
302,403,295 *1DEF975B33768BD2D6ED620279931CA0A1116683 AMANDAVANLOON
302,403,296 *1DEA85C87184AF7E7B93093C828422A73EAF5934 amberdonsystemsltd|canada
302,403,297 *1DE711A65E1B71DB5FA96256523BB4F39A01A4EA BILLIE.PAYLOR
302,403,298 *1DE39506D019101B2FDD8183E994B47006102517 BILL.KEIL
302,403,299 *1DE1DAA828FC57275A6100ACCCCEC2285577D3CD AMHM6
302,403,300 *1DE826ABA436009C7C2F49EF0408FCF4EEA4EB03 AMO_&
302,403,301 *1DE0D2F0A2782045386BA4087951EAEBEF16F956 BJ(_$
302,403,302 *1DE9710C7761A93035A9BA8D13103464FB80CB45 BJUZP
302,403,303 *1DE0E07EA20FBE20941804D5E168DD0AE76547C1 BLAKEDIACO
302,403,304 *1DEF37D0847BE20B3060244CF2A05C5DBF01FA52 BLAKE.SILVERTOOTH
302,403,305 *1DEA82DCD0418D6FEB2C188001B5D612CAD6CFC3 andrew.chustz
302,403,306 *1DEC3F1A6AED166B61AAACF306C6109DD92C8982 anhkl
302,403,307 *1DE3D2979529F088441F7A8AD2F975F69AF8AFE4 [email protected]
302,403,308 *1DE22A8CBD1C60B8B0739872F905D8FC80CCE177 A/NMC
302,403,309 *1DE6A9A1E956D40586A477A4B7D41B0CCF37570E Ansaas
302,403,310 *1DE05B1E26BE53DC3A7EA80DFB373CC7FDE4E8D5 ANTICARDIUM.
302,403,311 *1DE0E734EABA77FB9FF4AAB75701E4764CA1FB58 [email protected]
302,403,312 *1DECD44A756E4EE2E152483ABE7A74815E312366 BOYD.FOLMAR
302,403,313 *1DED49F49FE53C714A4F607E24D4C0B4914A8B8B [email protected]
302,403,314 *1DE128D8BF46119E798FA9C4A5E38DAC105BC447 APORTADORMSRELEASE
302,403,315 *1DEB8CD9B6494A38882B78FAAB68D846A659FD7B BPBG
302,403,316 *1DE0F19C5B314B4A55BDD561B262B4F522E06A0F arcadiosed
302,403,317 *1DEC7839ABD6CCC00AE6D06926A9FC930555D0A6 ardenlifshitz
302,403,318 *1DEBFF71DDCAB1FA0BC49410C28091202778D8C9 ARDENRULL
302,403,319 *1DE4EB72DC703721EFB7A398420F6656EC9D9535 [email protected]
302,403,320 *1DEF994B15BFE4ECCB1355E054436ACE8A8F8B12 ARIESGRANA
302,403,321 *1DECCCF32D9EC611EECE585D502BD30D761D2930 ARITOK1234567
302,403,322 *1DE41215744C40F0BF6AA76CAC0CDF4728A51E43 BRENDAN.RILY
302,403,323 *1DE70817F48292349C1FF4E4CACE13659B619A39 brendapang
302,403,324 *1DE7DF5C042D0607DD3A67FE8A138178ACCD5ED8 brockhoffa
302,403,325 *1DE2A3531F9A48D8E0F623752F04803D849A19A8 BRUCEHIGHLAND
302,403,326 *1DE8182F939FA2CFCFCB0CCB37712853D068549C BRYANBOLO
302,403,327 *1DE479E18D63266F8A23DF6CCE43B4F1216EFDF0 BSWEYVBSW
302,403,328 *1DEE6AE307CEEC62E460E6E3F242D8DF81520938 A-TIRADOR-L
302,403,329 *1DE167C5E476361BCD19A89766D1AB4381DEF473 BUD3
302,403,330 *1DE994D8F7627FA9AB195CAE5A0AD3B91A409489 augfr
302,403,331 *1DE8D84D5FF70941DFB654AB5AF4A2DFED24F489 AUTUMNGRIMES
302,403,332 *1DE56EA6228C3C041F1FF5AA567F52D479BE52BC BuwA
302,403,333 *1DEACCECACCA22AB205158377A947BF427B8063E B17191
302,403,334 *1DEC7D81390E2006C94C1AF5821143DD13C20BAB B1?D
302,403,335 *1DEEA2BDE769892F9CA349C2BA088AD274413629 c0ckta!13d
302,403,336 *1DEA1A4DF355C6A7003FFF46646C98CDB7F452BC c3f7w
302,403,337 *1DE967AF5FB3DDC3D9773A0E2BE8C18438756C63 C6bD
302,403,338 *1DE2BC8A2C4A0F488D7D616A305BAB9A94076805 calabres
302,403,339 *1DEF34556A981CBD3BC9F319407975B18442A8EB CALI BLACKTOP (FEAT. SACKCLOTH FASHION)
302,403,340 *1DE18D06B47C34871E5AB9469CD9BF0CBBF7E9E3 CARHAGÉNATES
302,403,341 *1DE0EDC9F3BA2A9C4B571DD6FF7EFA94982FB9FE CARLA RIBAS
302,403,342 *1DE30B8A6611B1C00C12AB8E170A83393D5EA8CC baql-
302,403,343 *1DEE8D28F171243CAE0DF9DCAF3F1AA4F36ADBF6 carolaschubert
302,403,344 *1DEAB58069FB133D7530C98DAF255CA7B4108B36 BART.POKORNY
302,403,345 *1DE8441DF75B60F5F6417B436886BEDDB80EF9D5 caryslough
302,403,346 *1DEF7DF199B22B873CEC0368733C170DA184C716 [email protected]
302,403,347 *1DE99ADAE29DE8B7DF55DE919D4310F6AC37C0FB BCKK#
302,403,348 *1DEF0864633E58BC557813BB2345E525BC3C6A88 ce&ee
302,403,349 *1DE8223891BF492C78AEC326165A870737DBAEA4 ceshp
302,403,350 *1DE2608B445C2DA6CF4321A71945E0798C3A4258 cgku
302,403,351 *1DE3DA574A302A610B878EBE277BCEBF85754643 CHADPERY
302,403,352 *1DED1A8DB7DBF8829DBFE95BFB436ABAC833F5FB chadwickaronowitz
302,403,353 *1DE38B0E5FD2E252F7687DB54555A2D2A310E5B2 best-physical
302,403,354 *1DE3168ADC34687FC5CC90CF984F07A6D9E2D059 [email protected]
302,403,355 *1DE3C3F086465AC01786E70FE2F1C99574CF9D4B be-x-
302,403,356 *1DE93C41F5B782706AB6D62C7469ED716CD8BEA1 Chapter36-13:TheFlawinthePlan
302,403,357 *1DE9ADA5C10A5C7A32CB2B4D1574F034E486AC1C CHARLIECARIAS
302,403,358 *1DE32EACB6F1844C7D60068263B767BF14264029 BFQH0
302,403,359 *1DE6BF267EB8BF8D9782ACFB9BCA5C8EB3CD586B B-H4L
302,403,360 *1DE8760833A6CEADBE136B02BBBE9D213FE9440D [email protected]NET
302,403,361 *1DE25024E4F30B7B8F30D1EEBC51F8E308E6B7F4 chowhound
302,403,362 *1DEA849C1FF59CE0AB405513C73EB8C1AB477C7F biztsító
302,403,363 *1DEE06B3BF50A7A30AD7E6F294EDEE06933A31F6 BLAINEDESTINA
302,403,364 *1DE2068D9199D4CE7B71EADA8067314FB02257FD BLAIR GODSHALL
302,403,365 *1DE5DF08B81DCF1E686929C556EFFBB64ED930C8 CkU
302,403,366 *1DE91209E35963ABCF5063ACE151D38759D17B4C bln7f
302,403,367 *1DE67256A20D563D6C22F2D3FC19883B6C7986DE CLAYHUESSO
302,403,368 *1DE2F34988E5853A50AB3BED86F0F4B5922D3187 clementdweck
302,403,369 *1DE7638BF02DDE7A4CF073152B6E2599E08740D8 CLETUSCRAAN
302,403,370 *1DE65931109D44D7DE13161E1658D10187649219 clh!:
302,403,371 *1DEECCD3E69003187978A4A039053AF5E44F506A CLISTBOXES
302,403,372 *1DE774C46E3B60EB09DDBA8147D39B9302357780 B%NHV
302,403,373 *1DE09FEF2E768367EC78C8615EF8F88720206214 cly)t
302,403,374 *1DEC99AE997B2A2F8A8E728871BD433FB668BB2C BOHDAN_PACZYSKI
302,403,375 *1DEDB6BCBD10541D590C28F1E88942829711ADA7 boj%b
302,403,376 *1DE5C6D7AF1F821150EB72D26356BD9B4208C1AD [email protected]
302,403,377 *1DE67753C4A3E80DE3BE37E0A37CF604733336DA b)ovw
302,403,378 *1DEFF2400DB10F41AFBE5ED3CCDF51FA716D502B COLUMBUS.COVELLO
302,403,379 *1DE802781E6D4B8B14A9303C8703618402E2AA89 COMANO
302,403,380 *1DEF91E8234690C7E98177482499B4884E3345D9 bp66
302,403,381 *1DE0332223E687D07B57102F814D6C8966F1B0EF BP,CS
302,403,382 *1DEB9B65B39580DCA421F962F5DACD9821A38D7F connecting-the-dots-cintamani
302,403,383 *1DE14EDB2BFCF1336000DB8B09487CA3F61082E1 bradygeyette
302,403,384 *1DEF342A75F27541CCB00C74D25453CE22AEED9A BRAINSPIEGEL
302,403,385 *1DED8DF0352A0700B729A3AF9B9EB1FA11EFA282 BRASINGT5
302,403,386 *1DE5E3B6892EE7DD511C6D94F17E630BA80C6575 CONSELLARÍA
302,403,387 *1DE1693666E82D2D3F9E852C0B1382E1DDD2FC80 BRIDGESI
302,403,388 *1DEFF9D716A0B5B576553C8FA5EAB9E474A8465F broses6
302,403,389 *1DEF3CACE1246276768335E3A16A7F48F91FE7F6 COUBERTIN1897
302,403,390 *1DEEAB84D93F18E3A4FC2ABA68D2ABCE58093353 COULDNT-KEEP-IT-TO-MYSELF
302,403,391 *1DE0EE0B6CDEC5E6CA13710493DB4F13DEF3A884 bshy(
302,403,392 *1DE489642D2FDDBFEA28C3D8F333548EF1A502E9 BUDDY.BERTHER
302,403,393 *1DECF2E0B5E22F3002C9747EF97384776F42205D crh5k
302,403,394 *1DE4DBE3DC5DB559746CFE35EDB6B0E479939086 BURKS6
302,403,395 *1DE64A90D99BE0F8B7DACAA49905AE3DFD7F8170 burzywoj
302,403,396 *1DE4B6850DC7A9574403170D947CFD100B62E3D2 CS6BH
302,403,397 *1DE6472879CAAA5300F85F99FCBEB606DE402E2F Ǚ¾Åº¦HI
302,403,398 *1DE7D7F3AB49FF5CDA9AF7804D8CEB8E05A8B99E C3r?
302,403,399 *1DE66FAA09F768DF391E24465190CC22D309552A CALMER
302,403,400 *1DEB85D35E06ABACFC06B87E880FD051B98CF20D cande1a8rum5
302,403,401 *1DEC44B652701F8205365E69C81493F920399155 CAROL.HOUGHTON
302,403,402 *1DE9CBD2FC240D125610E7F80317B36E668FB521 CAXQ5
302,403,403 *1DE459435E1EE22AB4C13D2942B15394B023D4BA DAISYNATS
302,403,404 *1DECBD025CB250B56623247561A5C41883FE269B cbglq
302,403,405 *1DE1967FF212354B806C8D56482A83FF138AE8FB DANCINGWITHTHEREBELS(SHORT)
302,403,406 *1DE01DA99EDCDC5C958E150B7A994722A28C0E47 c)c9h
302,403,407 *1DE3FC4524E536092A9798D530A3C700A68711E5 c(csp
302,403,408 *1DE55B823FFC54E0BE83511D096052CA4481741E darrylciaschi
302,403,409 *1DE1668644E1B7AC76FB765E90DA6538A4EE172B D,AV$
302,403,410 *1DE0B690E19758D731420304999C6697588CCD37 CFTK,
302,403,411 *1DE76A274C98BF8556C0335CC35FAD5AF832E033 dbma
302,403,412 *1DE655CE63FC3196CF3E0E48623497E319B4FE75 DEBATEAS
302,403,413 *1DE31D4978F1F2FBE9539FB28660C65FAED19946 DEC:U
302,403,414 *1DE9C27D1891A03BD853CE79ADA4873048F8CCA0 CHARLEY.SCHNEPEL
302,403,415 *1DEA9E68E784AF02A2FABA2DD64188DC2B6855EC Definitve.Gaze
302,403,416 *1DED538234C3C62B6394BCCE28AC12510BABF3E9 [email protected]
302,403,417 *1DE1BAE6EC0CF937C36D440C84682D910BC9AB11 [email protected]
302,403,418 *1DEDB058320221ADC61DA60BDC7AAAED27EA4E65 demoliat0
302,403,419 *1DEE3CEF88F0755B1A69CC3867776B77313C7DA1 DEUCALÏONE
302,403,420 *1DE590B8D3E8206DAE49F4BBD475AAAA8FC186EA CHUNS
302,403,421 *1DE99DAB8EC0BD0AF09AADE9977DA72DDD143723 clarencefadden
302,403,422 *1DE9510433179822F1DC244D26F257FB352F8138 CLASSCOMMENTGTTHOMAS
302,403,423 *1DE2D7791AD1F39CE013838611C1DE123BA907DB dhf3
302,403,424 *1DE2EB813CC7A2BC8AF560F503CD86D2CDF7BB47 dhsrx
302,403,425 *1DE5FAF0783ED2CAB75D327D3A776A92D3BC2BCD CLEO.SESAY
302,403,426 *1DE489F59EE0048C87A0DFD2FA3957447D41A18A CLIVELYTTLE
302,403,427 *1DEA77605B548D957148033AF73302BD3D2882DC [email protected]
302,403,428 *1DE8EB2F637A2491F5E40157A422BE9B15ECF615 d’inkscape
302,403,429 *1DE4FDBA2AC5FAD5BFA11D35C913201EDAA69477 cni&-
302,403,430 *1DE9517CFF7EAFDFCEDFE4DDF265D9FFD9AEF169 [email protected]
302,403,431 *1DECE8B8BC392135523C080739D0AFD554A1CE8F cnzwe
302,403,432 *1DE81006A7785EFA50F41F09A7DF797DFCA61D4E DM6,
302,403,433 *1DEDD87EC7383DCB3A8B9A3FE09579287F29A83A doi101099ijs06351
302,403,434 *1DEB3FECD1F7C994D73929BBBEE5BFED76F3BF68 [email protected]
302,403,435 *1DE0F2A1D28259A8045C994BE5BA45C8C60FE90F dolabidir
302,403,436 *1DEBFC10DB642E08A8A15E9C49C786A7B75EE0DF [email protected]
302,403,437 *1DE647C50D20C653DFA6D34A04ACC74D06786E99 CORNELIUSCAICEDO
302,403,438 *1DEB6B1513E41EB23923FE30E90D495C71F07B85 domysla2
302,403,439 *1DEC1593F189E225B375D893FF779E6C84795530 DONNIEBARTOLOMEO
302,403,440 *1DE69F3E0BFA30E0F0EBFB001980530C685EB30D C:\PROGRAM FILES\MICROSOFT VISUAL STUDIO 9.0\VC\VCWIZARDS\APPWIZ\MFC\APPLICATION\TEMPLATES\1031\HID_NEXT_PANE.HTM
302,403,441 *1DE0F2B7D08CE14274FB033C0B42D0D311C77C69 CRETZCRETZC
302,403,442 *1DE5BEE757E1D23E045A89F3A2B327B083E2547F DpBH
302,403,443 *1DEBE9D3F36C006F274A604BFDAB9541E56D5CC9 D;&RM
302,403,444 *1DEFC44CE667E4490AE58E528C2891A75C9570C7 cxb8:
302,403,445 *1DE78E5B488C667E4221D4747D9988292313BA6B CYBILSMITH
302,403,446 *1DEAA35522E71A701F390AD23188C14C8D1B88E2 cyrilnorkaitis
302,403,447 *1DE3E6AD77B7C42B4F8B3EC980CE36A425825CE7 CZY200[email protected]
302,403,448 *1DE6B0876650E31A065215552D2BD3687992DA34 d>
302,403,449 *1DE8B4DC8001E863F4390055F3A5D442EAE79FCE DUANEMARROQUIN
302,403,450 *1DEF9AAF8788916F5A4303E80561EEBC0BA96319 D8PN
302,403,451 *1DEE647CB7487948193C331C08EDD16646EC1C14 [email protected]
302,403,452 *1DE7908877A5903ECEB8267DC073A70241CE1E96 DAIKAIJURABITO
302,403,453 *1DEB89F77DEDA2E0E9739D8ECFEE25E6033448B7 da,m=
302,403,454 *1DE4626DE43A7AE46A5ED8E826631310849361DD d/:va
302,403,455 *1DED1DBD97A1DED9FBB6280F08D4F051A9A7D3CA DXw
302,403,456 *1DE029B799A5BEE7CE495A14142E51680F27760A D)?YK
302,403,457 *1DEBCB0DD07B6839A670A6AD4FB6152DF097FC66 dylan.pickle
302,403,458 *1DED8268658F6ED19B00A9F0DD7CC0300816CE48 DZIONARA
302,403,459 *1DEE5767AA673DEB3C2534F5E00D097B421D12A3 [email protected]
302,403,460 *1DEDA08498C9CBCEC383B91A7717D778B360F89A ea4y4
302,403,461 *1DE16C9E7E29D9B29A544F68EDB5371E533A6A74 eadrn
302,403,462 *1DE9E680E5BD0CDB52A73166FDE7A52217C84361 DAVONCRUZ
302,403,463 *1DE5048B83E38217E4B2CAC1DF706FFF4AB4D658 dc3l!
302,403,464 *1DE9C39DDF32151C41C0C632DCAE0A6D94186B88 ED,ID
302,403,465 *1DE2F2CDA3DEEBE22FED7CFD197E8FB12FD1B8EE de+6i
302,403,466 *1DED23E40139FE69FEC625E401901B77E06EE148 EEB+F
302,403,467 *1DEF4959479CEA0F335019B57E7DC85C84841506 demetriusshinkle
302,403,468 *1DEFDA88AAA299F32DF83FF77CCF8E3387DBB960 EGANISUO3
302,403,469 *1DE28683E625AB7EC052B17C495A0FFC1517DDAD EGO PAWN
302,403,470 *1DEEC7F8CE15BA47422C8A68BD7001E3E6F27A4E Deprimerais
302,403,471 *1DEE4B794CFAC1110F198B653F8B37B992CE90D5 DETERIOREE2
302,403,472 *1DE9D9C872E31D2C6CCA24725DA262A148A78E36 DEVOTIONARY2
302,403,473 *1DE5076C500839A68DE91EA51BF38CB28705C3EA [email protected]
302,403,474 *1DE27ECF59567DE612DF89901C6137B7C1D65D51 DFFRNZN0
302,403,475 *1DE9E61867B00DE450552D6CDE364300B10B4D68 DGVGB
302,403,476 *1DE65B69A13D4CC317DCB2BE00E27833FCC754E6 DHANASHRIKATE
302,403,477 *1DEEFC26AD5D4B36424545BB25D4E7D3BBF04709 DHARCARIK
302,403,478 *1DE7CD8F3074C932767586C29BBC5B007B4E5750 ELFANAGEELY
302,403,479 *1DED137CCF3D01C01EEA86DA067EA4644A777CEF [email protected]
302,403,480 *1DE5B04898689D8A0A265FD6750D23F27B781DE1 [email protected]
302,403,481 *1DE0EF14F5B4439C28F0498C7B438FDB09A85B61 elliottkopatz
302,403,482 *1DE97C20C777E2770838ACC55889E322EACE6F50 ELROYCAPRICE
302,403,483 *1DE34E2AEB315C3A143D1D7228AB3D8432552976 ELSHRAIE
302,403,484 *1DE99B32D942CB1CBC65E781DB37C79138C0C8A7 ELWOOD.WAGNON
302,403,485 *1DEDDFB8A5884FC329C49881C4258965A400ADAB emanuelcernuto
302,403,486 *1DEB18C5C50CA76749370A4BF04BE84BF42856D3 EMARRITT
302,403,487 *1DEDB3C6A3417AF9E5B581D202C736535179E0D1 DkRr
302,403,488 *1DE1F3A53D2A4EC7145BA8EC76786192FB36F589 EN7017414188
302,403,489 *1DE5B9EEC86F2903CA757B0B02856F74AAE63E6E DOMINIQUE.MANSON
302,403,490 *1DEF3C0BC93500FB88A015C70C84539F32FD8D84 EPDMC
302,403,491 *1DEFE609B4C7D7186336B12BD545E21CE51C4D34 dontemckiney
302,403,492 *1DE196EB4E6ED2B2B194CD44486B39978164DB0A eppupxes7
302,403,493 *1DEC37063065F651D5328D4A35FE93738D384C95 EPRRW
302,403,494 *1DE3DC6AF51FE6B65A7CC21A0874AB941E3C9A7C equaelte1
302,403,495 *1DEE600B000DC542FDFFA0C9E60DAC8B4DFBF7D8 EQVC
302,403,496 *1DEC2CD117B4006FB6E91CF5AC4622302D3AC7A4 DPKNX
302,403,497 *1DEFFB36A5952BF71ACCED57C21F652537256ACC ERIC-TIMCO
302,403,498 *1DEB8E89655CCD4318B703DA0C6834B9078A6044 erikhuebner
302,403,499 *1DE81074E38A0893B154F3E4FBACEC8C4C76EFB4 D=Q..
302,403,500 *1DEC9FF73A21ECBCC9E116D41888D3115323D705 DS()
302,403,501 *1DE5A78B75954D349C35FE4004DCB2B7FB9BD473 ETITNED6
302,403,502 *1DE485CDDD9AA7089FB9FFF4B6A3FB6CDCE749FB DVDが発売予定。
302,403,503 *1DE2B37FC427D3E3B57E3D71A865F87A8F7A9B7D FATSOFORGETSO
302,403,504 *1DE4884F055669CAC0A0957BC1DDEBFCF2A722BD EAGLEWOL0
302,403,505 *1DE2A04464494B916CAD5CBAE41DF99BA794BF10 [email protected]
302,403,506 *1DE0EE0AD449C21789A69BC3BC8E94080CA66997 FERDINANDMERVINE
302,403,507 *1DECEA633BBB992450054212A56395BB4469F5E5 ferrure
302,403,508 *1DE50D315EE8A0E0BC5BD44D0CDD1A26B58F7064 [email protected]
302,403,509 *1DE8E53DDCFBAF48F1D1F069D9A163BFD597B9D0 FIBROLIPOMA7
302,403,510 *1DE20DE9EB81B1C4FB8EB7B7E56FEE823554E3A9 FILMGUYVER
302,403,511 *1DECCB9F4B5D4422E19206657E1A51F943896EB7 EDDYFIROOZBAKHT
302,403,512 *1DEB2254E6FE86A7DAA7A06FD668421ED8F46703 EDMUNDO.HNYDA
302,403,513 *1DE05FF57FC8750B9C41687AB71D7494C25425F5 EDNELEST1
302,403,514 *1DE74D9BF6D1D24E0FD022CAB9DBB5F22CE5ACD8 flnt3$t
302,403,515 *1DE4024EA630029F74F3278C338950D92FCC324F [email protected]
302,403,516 *1DE73B8EB0AB80F014D942C79E7B54DED6C65FB0 effect1
302,403,517 *1DE2E1C3BFDAF1109C4FAD53A1735CC8D8868C57 FREDDIE.PLAMONDON
302,403,518 *1DE00522710A2653D4655AA2080F1ABBCA5180AD FREDDYOLIVERO
302,403,519 *1DE3D859EF05F0B8C7365BAD39A3995C5913B441 fredjonespersonaje
302,403,520 *1DE89581C2314C17A2030CA710C9BCEBD78B9268 ELDRIDGEBARRISH
302,403,521 *1DE3D2792FADAC5BBC9517FA0EA9DB1F84F01E65 eldridgedesanto
302,403,522 *1DED10700511675952598E8A0C60CDEC019BEAC5 FRVLO_PLIABLE
302,403,523 *1DEEB92BB972DD696D233906B8FFB7CADE82547B [email protected]
302,403,524 *1DE26DB03341D25C68E01BFA95062C7892852588 FTSENRAE
302,403,525 *1DE1DEA88A0FCFB730133B252F85908B1D6B8EBB [email protected]
302,403,526 *1DE8BB7BFD9E728F8304D2836B349033DBDE3420 [email protected]
302,403,527 *1DEE32B923E68A6582524DC57AE965EC7F7CA550 FUJITV20050918
302,403,528 *1DE20C88FF8F5F879346D1EA82CE56E82A6F7BEB EM*
302,403,529 *1DED35CB3CCEFA185E7DC79E42F3A2B28B32204D EMERY.KHAM
302,403,530 *1DE261C1C53C7C9658F867FDD0AAFC72A8CF4ABC gabbynta
302,403,531 *1DE9EEAB1F122AA2FF50CD30E2594A21BAF250A4 emmamaas5
302,403,532 *1DE082D6E26817351D06201A3E035EBD5E05B532 emocrevo7
302,403,533 *1DED82B40DED1501B63C92474155F0CFD898D412 ENERGIZA
302,403,534 *1DE4C350E67D3407F918720623158865DB94345E „entdeckungstour“
302,403,535 *1DE7E9D7A7FCB2FFB8AD3117BFFAA36C66095A73 GEEZREEN6
302,403,536 *1DE2CDFD8BCBF2C999CD9FB669B40D7FA6D8A868 »GEFAHRENZONE«
302,403,537 *1DE629D283408CFB641826B04036A43CC21FF16D GENE.BANWELL
302,403,538 *1DE82435E496A70D2630469BB9DCD9B6518FCBD8 GENG
302,403,539 *1DE373F28017F5F229A2B1CD1F70C1C573B694B6 GERALDPORRIS
302,403,540 *1DE63CD6958C315843F26B325AEA16828E1FBFEA ERICCHASNOFF
302,403,541 *1DEA240082E6D557CC492B97902FF247A8501569 GËRNÇARI
302,403,542 *1DE088B117D6E4B1562E5C1C6BD63B8842501A53 ERICKJANEK
302,403,543 *1DE054910FBCBA7AEB7A3687874B57FBBAC965D3 ericsirmon
302,403,544 *1DE947711452905A22D43549E7D81893F582FCD6 GEWQA
302,403,545 *1DE5BD364D9A2E5E3A864F69E300902AE387F4FD ernpc
302,403,546 *1DE1DFC9338823FA4F85B289EC6BCF364EEA5BA5 GILMOURN4
302,403,547 *1DEB09DE2F7B9BEAAE8741B0EBFD72978614DF7D eseretupping
302,403,548 *1DEEB602DB3A61920352D061F0F20C0AFD4E26D8 [email protected]
302,403,549 *1DEDE1785608A0593D9AD4BD7BB71A0D7DF9846E es":j
302,403,550 *1DE66C7C49AFCD42CCE92BFD60E3B6F1B97EA32C ESNIMMUC8
302,403,551 *1DED7CE3A4B76B098EC7735383A322C01F99A9D3 giveword8
302,403,552 *1DEAF6AB472355F523E7F0DF988990314D1BA62A [email protected]
302,403,553 *1DE9A3C622137C056A0E0F35B141AED2BF332C85 ETNDALDM85
302,403,554 *1DEBA86DDEBB9F340B9A7F5B61C3761D5DD06742 EVERETTMURRI
302,403,555 *1DEF6562C4F94CF6821F126B7AF1F11A967736CE GORDONBARTNIK
302,403,556 *1DEF00E0041EFA27760D75FEF7ECE8A3CCB90548 GÖTTINGEN–WÜRZBURG
302,403,557 *1DE2AEFAF71D2DA4220E2333FAAD46410DB9EAF1 ezm>
302,403,558 *1DE9FEE80D42765B6EA8FE95A6A9577DE9726567 fairway73
302,403,559 *1DE1B8C38061B8684F17CF0A4FAB39556839811B guerets4
302,403,560 *1DE7D85FEC96C28A5E8AAC9B553B4DE9247FAE1B H33Z
302,403,561 *1DE5BC979C8B884F86F8645A9CBEF3DB939A304B fiftyfolktunesfromhardanger:xiv.thepranksters
302,403,562 *1DE9228BFD4AA59CB6C3192234898283BFD9073B hai.phu
302,403,563 *1DE88B9D05DB8506737715EC14930F72992B622F FinDelInvierno
302,403,564 *1DE2BE49BDB6989665DAB1DDB1194AE6CB381514 fleckenteufel (disc 1)
302,403,565 *1DE17DCFDFA30882EB30EE983A7C0C2FFECD8CC6 FOOLPROOFWORD
302,403,566 *1DEFFB182E8AB4066F6902BC4F09DCD4D7D8F636 FOREDATIED
302,403,567 *1DE1770BE590756CEF73E1C1324D95AFAC9AAE22 formyodds
302,403,568 *1DE330F126136FF682C9A04637DC8ADE7836D329 fort-canterbury-adventures---scaling-the-north-wall
302,403,569 *1DEC0223746B886C83D613DC902536B506F45342 [email protected]
302,403,570 *1DE51C6EBCD84D7EB08DC03105111163A3257F6A FRANCISCA-ARROYO
302,403,571 *1DE4A21EE6E0D69E9C730C020E9F6A12B580937C HENRYERCK
302,403,572 *1DE70C73AF9EBC142CE3ED51B0486C40F5D311DF HENRY.TRIVETT
302,403,573 *1DE8920EC67242F9637AA7E814CC73C88B0F98DD FREAK-WITH-ME-(RADIO-MIX)
302,403,574 *1DEA0A7C69978933B541A674223402FBB14BACCF HIFPXQR5LDKE
302,403,575 *1DE4D861284DC29C6835E1DAFB2D9233A285B33D fshw/
302,403,576 *1DE67AC1E48D210BD3B9874F8473F56D7DAD989A HJ"K
302,403,577 *1DE8939CC4972ACAE80CAD4A6E28FBEB07E9FF52 HOLLIS.FAMBROUGH
302,403,578 *1DE93B600D81C17CDB4ABA64FC3F3C61F9984D32 FUTONCOVERSNMORE
302,403,579 *1DE53DEBFEB6A0AEC719A9FB8978877ADC7C6C9A f}xd
302,403,580 *1DE940F4D9C0EBE0B5F517E6BAD7576B74C09A3B HOUSTON012
302,403,581 *1DE021F36C97DAFBE3CD398ABF830E9D55CCD5CD GALENPIRKEY
302,403,582 *1DE99449A235D22F6066C23B64B45ABD0ED6F5EE GANGMASTING
302,403,583 *1DE80ACF7B7B6242F2A367A963CD308703EDFBC5 G`$E
302,403,584 *1DE8DB392079CC81BD32653F1C1E4AAAB947F186 GELERAAR9
302,403,585 *1DECB006E20B73660DFDFDAE9A0CC05A6FEDF858 genefarley
302,403,586 *1DE9ADBB631ADD4A430FD020BC71781A473D2548 GEOFFREY.HICKERT
302,403,587 *1DE597A3F119D6C3498B2B6244F984A03FD092D7 GERARD.JACQUIER
302,403,588 *1DE968B1DD59145AD2B3133775AD7096204BE096 germanpecue
302,403,589 *1DEFA8A301A4E3DFA3CE492316EE2D6F4B1353AB GESCHICHTE123
302,403,590 *1DE36B1BB8DAAEDBEECE0C324F76CE36052E4DE4 HYÖKKÄYSSUUNNITELMILLEEN
302,403,591 *1DE349607E78C9A7A135375EF491502F7F17BAEC [email protected]
302,403,592 *1DE8050A2CC15E889EAF042F601AC337E4C33BE5 g-gz
302,403,593 *1DE29C87E84E99792694DF4EA821791ABD1810BE GILLES LALONDE
302,403,594 *1DEED570B526EB069E2E8C40DEC901F76D6163EA girls-on-the-screen
302,403,595 *1DE9A18F7C040F9548061E39EC2B3F4AFF53010A GLAZGOV
302,403,596 *1DEB8BD3B1E0D81ABE85E1CDE0CAF87E1C3B6B1A gnivolec3
302,403,597 *1DE559B1D5774C3612A8C2FABADD34AD86132654 GNIYMMEJ9
302,403,598 *1DEDD342E0995DEDC7306D91282516D224294C36 ICAN'TRIDETHEBRONCOSANYMORE
302,403,599 *1DE0B784CAE6A255D32608277107009EF7D0782B IDPATH18424
302,403,600 *1DE6FA9020040CDC4CFE0A536B123E44678828DA grantsouvannarith
302,403,601 *1DEC76D20B305DA35D72A68C542A74043B52971A GRANVILLEKUEN
302,403,602 *1DEA854F04697573E4DC96AB7E1AC3B43DD4F5C0 gratefulmarket
302,403,603 *1DE13B19B8CDBBBC9A49122863E0C724C023A2A3 grow1ie$t
302,403,604 *1DECCD346CF6C2CA04D8B57B3486D8BC32A56F19 [email protected]
302,403,605 *1DEA9939794DD006A63B671A367BDC30C77DF59A [email protected]
302,403,606 *1DE164EEC2871313EA950B6AFB11AB5D20C3DB63 GTIMBERLACK
302,403,607 *1DECF608CA5FE158885379BA50A009C57DED79AF ii}
302,403,608 *1DE0DF523493301F48001AA0C9A9543AA36D69E4 IJWAUOC7
302,403,609 *1DE55F7D396D59211839D6994826A7650B87CCEA ILOVEBONJOUR08
302,403,610 *1DEE35F934DA2A6499E0A6EFAE44716D2ADC97E0 ILOVELONELY18
302,403,611 *1DE31DA4457162246D676A7BAAD13FC0FDB918B5 [email protected]
302,403,612 *1DE3CEE60EA7652DAEE979FFE06F4B1A36437992 IM4G3ST4T3M3NT
302,403,613 *1DE17D42BE5A8C70C746A3378626A4BD6DF521FD IMAGEZH-CHENGDUOGG
302,403,614 *1DE909F94BBF6B23D1443E00557D902BE7DD244C hannah.hanna
302,403,615 *1DE733110E8F38652C66BD88AF037C5FB27F5522 HANNEISUCKS
302,403,616 *1DEA02A34452B41BD1CE7133CA083C6F79D9F449 [email protected]
302,403,617 *1DEEC416312FCBBAB07E75342438166B52E01407 [email protected]
302,403,618 *1DE6C7C106B4DF044D27B01116F375D288112506 impor7ance
302,403,619 *1DE5B6B59230141EC80E758F5F3ACA9A78FA59CA [email protected]
302,403,620 *1DEDEAE89E7C2E041C9C1D7603B9E0A4D6BF97DF INDBRNDE1
302,403,621 *1DEBBA5427F0FA97DEF20779B64E7FF249822400 IN-TABERNA---EGO-SUM-ABBAS-CUCANIENSIS
302,403,622 *1DE089254FBFC5703FDA4274F79F390970116027 IRAKILAISEN
302,403,623 *1DE242D5D34CD3D17C297FB00D1F2673E8D9F945 hekal-tiamat
302,403,624 *1DE94C635C7888C461352FA7BACECB3F8FB8D26E ISOTHERO0
302,403,625 *1DE6F004FFAB2385A0CE584AA0461D148E74EC51 issacrickles
302,403,626 *1DEB9BB5B2FA7700437C87AF359E09F2E224D805 henrysherwin
302,403,627 *1DE19514B7F469F6C7F630EDFB70385AF61F2BD9 herabgel1
302,403,628 *1DEDCF99264750A56DEAE884B34599ACB24CBCED IVORY.TATSUHARA
302,403,629 *1DE20909DA7489B2E863C8FDE13F4FDCDB402EC2 HFPDTHYEDIBT
302,403,630 *1DE3C55CA6E7B399F53D791C2834CC90955EFC7C HFS|
302,403,631 *1DE8D36AE4841EBFB548DC270AA4FC0021DB372F J.=
302,403,632 *1DE26623208EA0EAD4E4F36AB2CD468B2A197359 JAMECOLVARD
302,403,633 *1DE3D34C5A68E39FFB308FF1E0F64A69D9879B89 JAMIE.BARTHEL
302,403,634 *1DE2CEB67FE36CA03108770C964A51E3CB35B952 jan-waite
302,403,635 *1DECA03974CE20BBE8F5935A45E1360889B9A2DA [email protected]
302,403,636 *1DEEF0036B8BA98DF278B1B71C2811262F118C53 JARZONJ
302,403,637 *1DE8EC046024F7B13BCCDBD18BBF587C0B9FBB0E jason-burress
302,403,638 *1DE4D6301F2AD1D55376BD4D27D9BFC42349F345 HILARIO.VILLAPLANA
302,403,639 *1DE7597F111BD709236670AB0DC30B189A44AA02 Jazz-in-Paris:-Anthropology-(disc-2)
302,403,640 *1DEECC922AC23E73858702612E58E61A5E90EB2B JEANSUTLIFF
302,403,641 *1DE6D2AE2327354C4F793C6C1A239354DB63DB1C HOBERT.VASQUIZ
302,403,642 *1DE24DE38556AA565E390498EF2CF5D202260AE8 holcombville
302,403,643 *1DEB277966FF9D18F7A5E687E927041758C1DACF jenniferstever
302,403,644 *1DEE194DD377ACF9897E2EF0035858724C2D0A42 HOLLIS.RUEDY
302,403,645 *1DEE9DCFE67B63813637CEB7BB9982D456CFF082 jessicajanee
302,403,646 *1DE4325BB6774DB4DEB88D9C591C9FE685B9DD67 [email protected]
302,403,647 *1DE3F753D6CF5392AF420938F1610A3024733EB1 JIM.PASSER
302,403,648 *1DEB102766FBC1D67D72688C3DCB327DF6DA278E [email protected]
302,403,649 *1DE27E5330623DA2BBAEFF8406B84F5C20CF0437 jiromaeda
302,403,650 *1DE2C09997147821158710644DCD33425B0B6AF6 HTTPWWW.NSRA.CO.UK
302,403,651 *1DE3F7AF02AACB8906172BF4A987B86567F3B9A9 JOESPH.MILLIAN
302,403,652 *1DE589EF5EC5FA84EF8FBDBF9D5CE2265814C451 johniehuard
302,403,653 *1DEBDA560F169139A75485C52232734D111B5090 HURACAN.OMAR
302,403,654 *1DECA30D0845D0326C07229CCEF6D3F18B5C2282 [email protected]
302,403,655 *1DEA5495187CFAA3C15527D71051991A12761CCC JOSEPHBORGHOFF
302,403,656 *1DEF70A997C7D7B54AB4B66349DECFF8C3208A67 joshuachrosniak
302,403,657 *1DE8A53B0DF57DB475E4998CDBBBCFD6FB7D62B6 jothi.kutty
302,403,658 *1DEAD3B0632DA03776818057D85EA373F89A643B JULES.FENEIS
302,403,659 *1DE3147D3B1911BD823EF06456908E48AE6BB275 juniorgauze
302,403,660 *1DE8F0AC0905A137776547CB0FDF9E3386C5D827 JZNIS
302,403,661 *1DE496AD5AC18E457BE42B3F3F250E3C456EE3D9 karin-chan
302,403,662 *1DE1CFB45B69A39B2C8ADFEA207D52B1ED7A56EF KAUFMANJ3
302,403,663 *1DE2E4A7865E12B6D483C7B303C73E987A8DE21C KENCIMINO
302,403,664 *1DE387525DF186A20FF338E54D97C4F8B3FDD7AE KENNYCHROSTOWSKI
302,403,665 *1DE37197E028110FE745D2C8DB2F2E2540BEA369 KEVENHANZL
302,403,666 *1DE12AF49E607D584C103E918C783849778BFF84 k/gp
302,403,667 *1DE881B6AB7AE9ED3FF8BCE5DE3CE113AFDFCBEC kiropraktiker
302,403,668 *1DE0399F3F578352631E511264AEE4CCAC9BB559 IFNIIMES8
302,403,669 *1DE6E8884CD168AEC271E1320E3F9B1EC8403D19 IGNACIO.MODER
302,403,670 *1DEB5131D0ACC2D24F1658C30D82365469E6EFCF knotenre5
302,403,671 *1DE279749E2B8643DD5FF4F64D82A18BE1A171D4 KOTULIAK
302,403,672 *1DE76B2B19EC14360AFE17B2885118E411309B03 KRISHNANAGENDRAN
302,403,673 *1DE33FF30B4CB9040FCC3DA66262513C9FD96098 ILMAVAAN3
302,403,674 *1DE9A42ABB57DD637F5C466A2F86ABA764143074 l3gi5l4+iv3
302,403,675 *1DEBF38670F4D9A93440AAD2153BF11C75AE0998 in.die.zukunft
302,403,676 *1DEF541E823127925364733A7E6FBFA6A4CB589A laniuses5
302,403,677 *1DE2D9E2360C3749A2AADD6548CD0D779D58C224 INSTANT-OATMEAL
302,403,678 *1DECEE9C6C235B4967ED1FACC8A1E494FCD01687 larrypoepplein
302,403,679 *1DE9C6681BCFE2B892A25812BCBF49101E3732B8 [email protected]
302,403,680 *1DE344AF32F38924CC58DE3C2E6C3305572D47E6 LATVIANBOURDONSONGSLINUDRUVA
302,403,681 *1DE8CFE293C2353D9D894CF9DDC08873505CC6E2 ldexter3
302,403,682 *1DEB5D760123888CCCCAB91A5AD6609335BF428F LEDENI
302,403,683 *1DEB78EEF882B84CE20A5B946B2F4B7BADBE90FC ISMAEL.MCALL
302,403,684 *1DED012B097196972AAD8256F2CBB6FFA7FC137D ISTHIS...?
302,403,685 *1DE139CD04F946BEDEF406FBC82165957E00E6F1 LENARD.ORIELLEY
302,403,686 *1DE553EEA77BBF5D637FE50EE57A966D456FB6DE ITTEETIN
302,403,687 *1DE45BDC7D5DB0307DC04F42FFD2044B0B23751F LEONARDO.ALLUM
302,403,688 *1DEA0F4258E30F82142A5659D97A3635E7F4828E JACKMARTENS
302,403,689 *1DEB48E26FC12A3A74F6A9815A95433E5AEA1F80 LES.CARBONE
302,403,690 *1DE446889DA8EDC79058E25735D8F5FE6F89FD92 JahBless(feat.Klashnekoff)
302,403,691 *1DE7724EF3E2B5DA146ADFA43477B582D4701210 leticia.jenkins
302,403,692 *1DEA34088DABC94800D92533DFF25A9D27752F63 JANETMARTINICH
302,403,693 *1DE255E80AECCFFBF50E2C65901E9D61881569B6 JAVIERDANCER
302,403,694 *1DE07000326204A0F27177792ADD4ED16CA47A25 JDCEKCI2
302,403,695 *1DE09839BDFAC75B816B9361D62AA1FEE917620B LGFHGH
302,403,696 *1DE998819861E184D4632E6EB04E34A1D91360C4 li^
302,403,697 *1DE2902F26277AD80BE92C9559A98733E1ADB81D jenjibre9
302,403,698 *1DE1980916263356F1C9D8CD15CD48FCB274C07E JEROLD.ALDRICH
302,403,699 *1DE614CEA6551A15CF73BDA0CCB25BE813F9B47D JEROMY.BOGGESS
302,403,700 *1DEEA57B501FDF7340B76822382A9D07B8475130 [email protected]
302,403,701 *1DE1F1F7C08FB25D67E995DF70A64CB0186552AC [email protected]
302,403,702 *1DE0D3ED47D3F727B44B4EE35988A1D2A9EECEF9 [email protected]
302,403,703 *1DEAFE5DC73F8D1631462D84DE6575ADAC9AFB49 JINANXUELIN
302,403,704 *1DE57B33418C7C842A7F82BC8899AE8D0A4E01A1 [email protected]
302,403,705 *1DE298E3D899DFA73F3C0B5FCC69ADA175714A18 [email protected]
302,403,706 *1DE165D369842215293075DCE5B5E5EA8A4B84B8 jjgs
302,403,707 *1DE08B91D6476C884E6BDDE04FD99E8EA25B0D52 JODE06
302,403,708 *1DEDB7390617C8801686C1301384DC287D2AB2A1 Liquefasse
302,403,709 *1DE7A1BF5CC8B72FD8D2ADBA805F1FA196328A58 JOE-KERNEN
302,403,710 *1DE5D6FE7D1274DC12DA273519BCFA172EEF201C JOESPHKIRKHART
302,403,711 *1DEE147738D570E800F2F69676C1EFBEC9148227 JOHNATHAN.KOHLMEYER
302,403,712 *1DEC4F112F4E7336501B4900E5E54B33C7EAC035 johnathoncritchlow
302,403,713 *1DEE4FA5890D156F0AD408A3EA9C55EE80625F20 live-from-coyotes---tuscon,-arizona,-1991
302,403,714 *1DE9DC25C5CEB457D98046754FF866CCA0DDC7BE llabkcup5
302,403,715 *1DE5F4A91F536E2DF24A5992598BD763FD488B5E LLOYDSERRETT
302,403,716 *1DE4243F0834DCECA14DC71F072C2D5436546D83 JOSEPH.QUINK
302,403,717 *1DEEADAAC68C76430FCA1D21553CAF7C3E514E50 longsancho
302,403,718 *1DEE01FAED29BDBC8CAEC9A8D9820C584CED9C4D [email protected]
302,403,719 *1DE6140E0B2B64355B496485F8F60CB8EAD7017B lorenzoschomacker
302,403,720 *1DEB175C8D2CD293C5918E04F2FCF3CC9D3C921F lothar.r
302,403,721 *1DE7F807E4F1CE3526FA623FB872BFC4DE71C06E JUNKTRY-CHINTHA-INDAH
302,403,722 *1DE79734DC5B0794D6FA8A660F22B385ADC37C6A LOVE.PROGE:.LOVE.RECORDSIN.PROGEKLASSIKOT.196879.(DISC.2)
302,403,723 *1DE967F0809E631708DEB96B55FBC8E8F68C6C62 JUSTINADKINS
302,403,724 *1DE13E48C6FA4658BC1436FB0C8944E7E42CF08A LUNAR-SYNTHETIC
302,403,725 *1DE523958B35C41849A6381DB7911D9E8C933302 lutherbreitenbach
302,403,726 *1DE358596CDEACD1144420B8DF925B9C18BBAC09 LUTHERCAYO
302,403,727 *1DE18D19F9C13C0436B166889368EC9F327713B8 lw2h
302,403,728 *1DE3CC88A0DEC422087B5E435A435F7C59FC6AEC [email protected]
302,403,729 *1DE4522164F09C9A3F923D9D50C1CA42B0A685CF M55779
302,403,730 *1DE9CB031E032F0CE595B964393D206DFD728AF8 maaрду
302,403,731 *1DE8F3CE8062385D74DB35CD5152D8C6D8278B45 [email protected],
302,403,732 *1DEA09BC80E086723789003B4E62D422E2CFF5E5 MAGEMLET0
302,403,733 *1DEBD824E37943CBA10B8FC2ADFFB6E4C9F0E840 malcomgirad
302,403,734 *1DE2750A522C282FE793B1CC3EF2A81128E769A6 [email protected]
302,403,735 *1DE3AFA72FB386A9FFFB6AE92EB78916C243575C ma"rchenhaftem
302,403,736 *1DEB93BD5CFBBC7DD15F44104FF56A5DED60075A Marcos José S
302,403,737 *1DEE5DAD2492187610D047189F522202403D2BE6 [email protected]
302,403,738 *1DEF0BFA7DC5B04CEC3170E61B737571E36DED97 KJILEWUHTIU
302,403,739 *1DE16020F950155B0059EDF1DA9181170C7B2C33 MARIABROCKMAN
302,403,740 *1DE75BF04F5E45977655EE3AA44ABC0230E75D45 marie.albert
302,403,741 *1DEA0DE67BC01E44AD4A6D66FC53DED2113002AB KNOWN--IS
302,403,742 *1DE27F0785EE67438493495E0419AC56D9E89E57 MARWAALSAYED
302,403,743 *1DE24863CDA8A489684559F40FA7649F8125FD33 KOSSFAMILY
302,403,744 *1DE126835AF78D5F305BF68AEE9DDDCAB0047260 koválov
302,403,745 *1DE3B88B03EACF29044B68B30A244C8C51A69713 mattyaegle
302,403,746 *1DE352EE6E3277E080D7471F09975B342F20458C l0g0typ3$
302,403,747 *1DE5035EFD9C4559A9F2AA078C8741BBED7206B7 mbweya
302,403,748 *1DE1140AEA9CA9120F6B643F421063948D99C301 melabend
302,403,749 *1DEBEA243CA087DDEFF2999F783B51E9BCE99A0B melayna0
302,403,750 *1DE14A694ED95F509BC37A05C99539F86D9A99DC MEREBEAR86O5
302,403,751 *1DEB2A23F7337F8A740B3CB23FB8EF013D79D389 larry-fallon
302,403,752 *1DEBC5A83CA387C166AC39246C7A7ACC9F637DEB Laski'l/&/sk/i/
302,403,753 *1DEDFB8440535794972EAAADEE4942F6FE8C76E4 LATEJOHN
302,403,754 *1DEDB68EFFD07E77FCB77F71259D50E9E3F47E36 latnednecsed
302,403,755 *1DE14C2B4B5752F9A11B865126D74C435B051D57 MIANLJIFPOZEI
302,403,756 *1DEB8F6B90B789F5E9A8509CCACBD71CE7D6CBF8 LAWERENCESTEPLETON
302,403,757 *1DEF7A38C6DAE869A78067174D3ECDE08D9186CB MICHEALKOLMAN
302,403,758 *1DEFF742E6232875598F535E37485C3E57859A22 LEA-SMYTH
302,403,759 *1DE881B17DF184C3BE88965D7C662FEAEEE8EB69 LEDERERJOHN
302,403,760 *1DE259F55BCD4861A55A2A21F74B02BBA3D44BD2 LEEKUANYUIN
302,403,761 *1DE4C6D25C79282386E2641DF451E6174C46A63A MIKEVANETTEN
302,403,762 *1DE7FEB78F0095541CD1780CC1C8A16B6DBFB63F LEKTORSTILLINGEN
302,403,763 *1DE111713E3571CB19AA06C5267D6402134F8BAC LEMUELAREL
302,403,764 *1DEAE8A14CB95F9795D2EEC1B76EBA6691955BB7 LEMUELBALTIERRA
302,403,765 *1DE04B6C4E1903C140271B379B6B1A4935CA6657 lentibul6
302,403,766 *1DE24D9E89874AEDA3AF59BCDB1C769A4C1E9C69 MINIATYYRIKOKOELMIA
302,403,767 *1DE41771984263C85D02748BB41E0476C0FDBEB2 MINNESOTACOMO
302,403,768 *1DEEB78D073D12AA213603E7FB51E76B849BB7B6 MINORITYCOMMUNITYOUTREACH
302,403,769 *1DE34072DB42B4ABDB1828EC53E4074C64C117A1 MITCHEL.FLORO
302,403,770 *1DE3214AA4DFD465C1696183E8A892DAE88B3EA1 LEWIS.CARFAGNO
302,403,771 *1DEF24824500CB7D6D02BD915B7E8F6F14231470 LEWIS.TARASCIO
302,403,772 *1DEACCDD4C17B2C191449E42ADA987E30CB1AA96 MOLEARCZYK
302,403,773 *1DEC1F615ABF86F3A384C3C36B33122A40238F13 LIFESENTENCE
302,403,774 *1DEA27B88700C43D6C77AE21632131544F68F5DB MORAVCSIKING
302,403,775 *1DE70C9DEFB3FF3AAC8AE89D4311B17528A920B9 mosesniemczyk
302,403,776 *1DED6657A2B70071EADB51E750B2C0172997CA56 LIONISED!
302,403,777 *1DE34E7AA29116E169F88FD171E37057276CDFFC [email protected]
302,403,778 *1DE67EB6ED73346D18DBFB955CD9F903ECBDB5A3 müncheners
302,403,779 *1DE7EBAD9FE60D1D5AF7ADFC0107E1204028A662 MURDA 1 CASE
302,403,780 *1DE6466F8C5239A212B63C678BB8F64B89BF5E0C MURSID ALI
302,403,781 *1DEC5C3F0AC89AD0C347A8EAE1B7218ED4D2ABCB LOGORPFC
302,403,782 *1DEAB610D6AC194F828B3AF3F9BDEB15203CF7CC [email protected]
302,403,783 *1DEB4041ADA4A798757925D94422291EDF59B4D4 looizuur1
302,403,784 *1DE06D47E19F2113CFC32F7A17BDACD2BAF99510 LORRAINEDACOSTA
302,403,785 *1DE5B1B69E065B43024573CC10A339FC683E5795 [email protected]
302,403,786 *1DE417B3564FD0C07BFB0BDCCC21D686F0564A2F N81273
302,403,787 *1DEB1E59166594D91B98861590D658E370FFEB00 naicirla
302,403,788 *1DEE3AE0BBE4C7B32F93F854A9E998753BB2DEB0 [email protected]
302,403,789 *1DE8B012FDFFF063F9EBBB5967658B487CD43637 nd-{o
302,403,790 *1DE3A5BB8A34BAE952C61DEE0D9FB9F2F954688C LUNATICHE8
302,403,791 *1DE8E5ABC8C27BC74592B60FCB8A52BC274B8093 luolamaalauksissa
302,403,792 *1DEE5EAD3A40A132B28A6F07C600C99677911AA8 lv^
302,403,793 *1DE5AEE1C6B75AE070B7331D7F5D4694A0C458D9 NELSON.HORNISH
302,403,794 *1DE2E397530328B3156C3CBE6497041C03FD85CB LYNWOOD.HIBBEN
302,403,795 *1DE0E0BC7366278A6010A3914DB42C30A64452D1 NER-TAG-(FEAT.-OWOM.NET)
302,403,796 *1DE143C25F5B63F4F0E36B7C014D9E60F2864671 majeur:-v-grave
302,403,797 *1DE3B40D8B0D18C24C2024442C2AF2B44DA3CC55 MALCOLMANSLOAN
302,403,798 *1DE7E95992526F0476A98A7D3EFFF233996DB4AD NIEUWEGEMEENTE
302,403,799 *1DEA51AF8BCF89D9ED52AB7B0CD75EDD21BE3D0C MALSAGE
302,403,800 *1DEA66D27E37D9F2DE18DB240E2455BB5C525ADB niprnets
302,403,801 *1DE2908379C8C463475481AFD3195D9E22D546A1 NIVVIM
302,403,802 *1DE108E68A5DDE2D86AE9C9ED20FCE45437230D9 NNY
302,403,803 *1DE463EE53FC45C1D6E065576371F87EFD5D2D5B MANUEL STEFANO CARRY
302,403,804 *1DEDA9DB2957A2317D19ABBF99697C7FF4769A9E marczendejas
302,403,805 *1DE886393A0D22BA4518276AEA8AA7C982DEFC1D nontradotto
302,403,806 *1DEBAC007B6068A6199168AE454DE83C4A974BD5 marionmehrens
302,403,807 *1DE778E77EAF1D52ED23D071420B8104E634652D NORBERTTUMLISON
302,403,808 *1DED7055AB66AE3FA9370E4EF4B9F5A23EB712AD marklebarge
302,403,809 *1DE20BD4D5D54B015E41EC5B54A72D55BD1ED240 marlesound
302,403,810 *1DEEDCFB4931B524152148A21F0F07437BFA2AA7 OCHISME.
302,403,811 *1DEE07FC2D150079C787F0291DEECAD365EAB8F8 [email protected]
302,403,812 *1DEF5F1AF49B7CB11353B403255A5A2EBA8E6DAF mckinleywroten
302,403,813 *1DEABAF4D4114066F181A2A4E8640A89CFE3B0FF meeschterschaften
302,403,814 *1DE143A10349B21D3DA7EE94DB032AB85ABECC2B ONCEAMONGTHETREES
302,403,815 *1DEABBBC3D3A7BB2E8AAD1A4E8CC98C638820469 [email protected]
302,403,816 *1DEB2787C95461788116EDE5664E0E1CA6DAF3CC )o([email protected]
302,403,817 *1DE6A92EBEA5AC09E3BBFE2A0BB076384E91FABB }o{[email protected]######q
302,403,818 *1DE875B6B2DFDE9155F1EA01996EA9AA4C3D33A5 }O{~~~q======p
302,403,819 *1DE8EEC2F8B6B232C1DBBCB3C4F66B514B25AF37 [email protected]
302,403,820 *1DE09049499611D56A21EE2434F822BC7A4AFE55 ORLANDOBROADEN
302,403,821 *1DEABB7DC81C651199179B2AAA14B3438638A2B9 MICROHMN7
302,403,822 *1DEC43FF6DDD7703E1FA4F21F3D1B6006E9E0C96 MIELECKA
302,403,823 *1DE46C4CFE52EB059F78A0D3AAE1806FC880F11A OSVALDOWIBLE
302,403,824 *1DEAD928557D5F6C74AE18D2F550CCCF4DFB668D OSWALDOYUSKA
302,403,825 *1DE139A727A0F2898D1B243181BC04F9B220A8B1 [email protected]@LLY
302,403,826 *1DEC12B6F6FEF4AD51F4A9E4AC8A8C401C1E5867 [email protected]
302,403,827 *1DE5EC47C43C3E4D94FAA7FB9805F9747A075BFC misillas
302,403,828 *1DE9EB165889D042BB8D3EDE7B70427FC0564139 MISSIONARYFRIENDLY
302,403,829 *1DE6E14B51574D194748E9261C7A878EBD4D845C [email protected]
302,403,830 *1DEC337223E5151D503A05DE33302AC79671C81B paolo.delda
302,403,831 *1DEF04D57F01DE353835BEA3A22B4D8DF1B72AF8 [email protected]
302,403,832 *1DE144CD3F703BDF1F7451028F31A7069702B680 mohamedmasero
302,403,833 *1DE1FC1A52C26738C723AA3EA3D92C8A76FF0DBD MOHAMED-WASIM
302,403,834 *1DE63AD2C4B00E9B1D90A052237807239EE18B88 PATRICIASANDRA
302,403,835 *1DE21DC61151F195F21AC8283ECAA9157592464D PATTY-CHOI
302,403,836 *1DEBCCBF052A0EAF1444CEC7D0B22CC4C6DB3217 montymiscoe
302,403,837 *1DEA889BBBB278525EC1C629760F118C9072CD93 MOOCOWFREDERIC
302,403,838 *1DE04A8FA7F58D7821AD805A27BC8EBA20501FC3 MOSES.PAK
302,403,839 *1DE8664FEB8548B12F451F3CC2D099497E3F8016 [email protected],
302,403,840 *1DE2039E82DFA29B1D036F2E73EF527FFE50361B mxdfcrecimiento
302,403,841 *1DEA39DE829479E5C5F4C50073587A293108D57D picfpep27
302,403,842 *1DEF0B18269BCD16889E415C5F066BA6F25A2336 NADMIRU5
302,403,843 *1DEC55FCFFF2466F039A86229DC5278277A729D9 NAGEBLAFTE
302,403,844 *1DE7DDD1DF77F6F84360AA10F905123D578034A2 napoleonkahoohalphala
302,403,845 *1DE499AB82C4B322E3A854BC33625B861DE1E8B3 PJ.PATTERSON
302,403,846 *1DEC7C4F6A5F971789BFBD772DA8DE91EA3C0B8C [email protected]
302,403,847 *1DECD8BD50CC59D485CE6E8FC918ADFF5D052AEC pjuzejas
302,403,848 *1DEDA1A37EC5FE7F3433E6D612E6415A80DC0C1C PK%.
302,403,849 *1DE7054C590CC02E2160C31F98C1AA53C447B1A9 NASSERIST-ORIENTED
302,403,850 *1DE34F033E4FE43813462982E5367FFEEC998509 PLAUDIR7
302,403,851 *1DEEEEBD7F4E4D43DD8F60C9FD0423FFD0CBF515 P#####).`~.`~.)o(
302,403,852 *1DE3BFC7FE68D9B25BBCA35243D09790BC252BB3 poetically8
302,403,853 *1DE34F32E668D7626E7FE42B90A73CEFFE3E50C8 ~NC
302,403,854 *1DE729EDC68A0DEF56F91CA8D2C98CB883336B60 NEKERAN5
302,403,855 *1DE3167BFCC2721528E775492187974CF134CA67 p##p.~.`.splat
302,403,856 *1DEFF6445E632B22BD6EFE3148D2595E6CF7559B primaryeven
302,403,857 *1DEBD72D01C7E05C7ECE7E45877D0FABE9C2D99C NEWTONAHLER
302,403,858 *1DEBE6C5867E2055FD4F85DC3031FB62B2D400C8 nezuohc0
302,403,859 *1DE3CD825FFC9F3E34BCD357F67ADF69F7836929 PSAMPOUNGBOON
302,403,860 *1DEE809E2B4CC71644C337C0613BCB5A994FD34A nicky.kyriacou
302,403,861 *1DE22C7843D881FFDFA75898C3C4DDAB7E2A1003 p===>*.*.*.splat
302,403,862 *1DEB7F5EF36847477FDED98E134A74EDF07807AC purgedpurged
302,403,863 *1DEF573642F2F4651A0706E2BC247491E8F255F3 NOELSUNDAY
302,403,864 *1DEBF146BA2E3803C0EA3EBF0BC5B0473F56491E [email protected]
302,403,865 *1DE2949FD98A571253ED58C51FEF987ACB0C8C8D [email protected]
302,403,866 *1DE6A0FA94428EBED6BAF557A175477078C03B17 NO, NO CHANCE
302,403,867 *1DEDCE4D62E8B469C4ECB61C3C3049ECAF94A1A3 qnorbanus
302,403,868 *1DE217E36FD0D39CBC673319ADD4223CB4BF6127 NORMANZITZELBERGER
302,403,869 *1DEF315025F4630270866CF3A7C97A9BB9F47CB6 QSYA
302,403,870 *1DED9D39D1DFE1E0C9C6E06FBDBE87C90C3A3618 nr937034
302,403,871 *1DEF431E29307A8D0C0224FA0E7D83999D9DC8D6 nsl|
302,403,872 *1DE25CADC626A10DFAD0BC60229B343DBE453D24 [email protected]
302,403,873 *1DE5AF42DDE8E76F2EC724FE9FE17B36D897485B number1me
302,403,874 *1DE52EF51BAEA84CE04AF01E3CAF99B46E388BFE OBS3RVING1Y
302,403,875 *1DE9D58EF0F014B2774FCE157A06B265D59AFB83 RAJASHREE-MAJUMDAR
302,403,876 *1DED2980D6CADC7CBA52E20C430280DB67A3023B ODELL.MASSAQUOI
302,403,877 *1DEAEAD82EC68C6A67269B61DCB01D034DA09255 OFFPINK5
302,403,878 *1DEA273FAF38F55CD4165B4AC130568DA867F38A RAYMUNDOSTREMI
302,403,879 *1DE418B6B07CCD1326362FBD2B66AFE227999632 OMER.WACKER
302,403,880 *1DE32F9DCC8F258B1C126FA5AEDDAED6887B7CA2 r)e"
302,403,881 *1DEB88662CDE03DF0F4815913CA39BBB28DDFF2E REBECCAMASSO
302,403,882 *1DE8B8ACEE9AF24906C0884C780004BF8BA7D2A4 orshelle9
302,403,883 *1DE197F3B753865C037821120C9A63BDA1818AEA osëngo
302,403,884 *1DEB8533E5974B5CBFE47BA1263B66993E0A9BAE regal.call.5
302,403,885 *1DE9C077FE79D49C8E5E1A6A5AEBA5961B78523A Osmometry
302,403,886 *1DEBE8AFC69EC3F238FD9E15B221F401F26D83D2 REINO-FLOR
302,403,887 *1DE99D827D5DBF52BEE1573322383FA2AE2BB267 REIRRITERANESS6
302,403,888 *1DECFFE9A49D831B745AB2D8ACB3B432F7FED808 ottlewsking
302,403,889 *1DEFEB17AC6553FA909CFCF4567791F4B9C90BCF OVERDIVERSIFIED2
302,403,890 *1DE5DAA7302E6259CC199BBA31D8D3780313832F [email protected]
302,403,891 *1DEC067A69C752A3CA2DDBE13B40B85A485BF9EF [email protected]
302,403,892 *1DEDE6555227433F5AD5BCEF4F1CC85328025488 RENNHACKS
302,403,893 *1DE39007607010A92C26E83D1BFE49A125962DF3 P140622
302,403,894 *1DE501DD731C6137F30FC22E74FEEE0B758390BE [email protected]@r1z3$
302,403,895 *1DE831385BE7721CF51422CBEBE56CE36E598DF9 PAIGE1957
302,403,896 *1DE37642B6ED0268C7EAD7E6A066C6F33B19571B parnbswing
302,403,897 *1DE14AB4DCE0DF2EF4A772BA41F537AA0B61CDC2 [email protected]
302,403,898 *1DE6D7BA4A9DC619337948EA28E58D5AA4D20CE4 ROBERTPHILIPPI
302,403,899 *1DE12A68585A2B19125BAFFD81C2A552A8EC66F6 PETEY.PABLO.-.FREESTYLE
302,403,900 *1DE46B3BFC97048EC223A3AF0462ECCAB6FB47A2 [email protected]
302,403,901 *1DEA970E72925BED4193E8DCA3E0E4DD39E64123 PHILBOLNICK
302,403,902 *1DE3414213621BB4137B14747197F581BAE3711E ROSIEMALCOLM5
302,403,903 *1DE9E93E6522FDB6B5A92C4ACF66CB7A3EA78F83 rosskannan
302,403,904 *1DE0E9509289D30F7692550099AA8C26A38FD262 PIERCEJ1
302,403,905 *1DE5C1EB74AC3B5C49AF91EA16B8F1B98EE1DE51 RUNIT(SYBERTRAXMIX)
302,403,906 *1DE4B31B243AC6FCBAD7D65CD3D28D061B7655F6 poruginti
302,403,907 *1DEEBF5853D95A72003A8AFBC90C59F586D1305F P---P~-`}O{
302,403,908 *1DEBD3D9E85DA1FBC44E688F3A7186BEA7742484 RWCIMAGE1
302,403,909 *1DE3A639A1B30C8E7C25B97F5BFD4FF73A32351F S281066
302,403,910 *1DEF2452290478FF7CA04BBE1DA3956C4707C09E S+4BL3R
302,403,911 *1DED8A3D8865C9417BC0607F0A5D4F43E878D404 p> * * {x}
302,403,912 *1DE3B68FB530D4B1762CCFB6D1637BDFC94B45DC Q100669
302,403,913 *1DE35874EB7C24A353632E52FD5440BE77F97CB8 Q9UPQ8
302,403,914 *1DE7E0B58F12ACA80DD7E38B0DB6B3D601829789 qd5
302,403,915 *1DE4F53C7B1E9E9A419480046BD48123B2AC87BD [email protected]
302,403,916 *1DEAC9F39BCC08F0C39F84B8AA2A4C80B2900A5D SARTINIB
302,403,917 *1DE1E8799282C8CAA684CE1FE9591D56F84C858C QUARDMAS
302,403,918 *1DE612976A67956F06F25034FF88CDDC6812B795 [email protected]
302,403,919 *1DEFECFB187DB0669EA9D236498CD7586E20954A QUICKSEARCH“
302,403,920 *1DEACB166C722BEE157A7CE0C1B6373689239039 quincyisgrigg
302,403,921 *1DEDA632E4644848B1BC2164EFC75ED4B882E316 QUINNKUNESH
302,403,922 *1DE089E4F754D481BCA3D08B559685E2C7A3A304 qw<
302,403,923 *1DE8B15E639A520500F8628DEB0521162DF28734 SCHRATT
302,403,924 *1DE4CAC2342D3E206D59D291992C894EE8F9A9DD raymond.bloom
302,403,925 *1DEF33525E0CF2AE230DD77B8C23554C6DFE0979 re4n!m4t!on$
302,403,926 *1DECB056FCDE1B1B79D090E3B3D6740342BA4173 RECRILOEIS1234
302,403,927 *1DE1C547A2EC01E19392C7D037A333C98BF562A8 rehenes-del-sistema
302,403,928 *1DEAD01A8C70FBCE50ADEC75C0969D410369FD53 reidblackie
302,403,929 *1DEB15127FBBE64619FA5207CA339A28CF92D69A RENEEPLAY3
302,403,930 *1DE74C0F65E766EC8D1FABB6864F73B9EA816F1D [email protected]
302,403,931 *1DE6724676F6665B414F025DABA3B852380B3E10 SETTEE
302,403,932 *1DE4366CCCAFBBB24175F5B64B076174FA5A6FB2 REVAFFELJERN6
302,403,933 *1DE99F85C6DFA9DB0CF8FB11533743E92305DC66 rexfurnace
302,403,934 *1DE2816AF48BC23A9240F98679B02945D4A32ADE SHANE.DOLAND
302,403,935 *1DE61215C77043F9EA662C5A0BD3D1191076E234 RICARDO.WALTNER
302,403,936 *1DE86AE82430DFF8CD26612572CC7CF149BEBDD0 [email protected]
302,403,937 *1DECC9C52AD25B23E1F7D4C695E6DD9D558E93F2 RICKIE.VANDEGRIFF
302,403,938 *1DEF5114B1DCA05FE6AF43FC6193B0385DDF87B7 RIISISATO9
302,403,939 *1DEF5651A0B03631314621528D9B85CC4F612A0B SHERMANPEHL
302,403,940 *1DE062450C2A881BEDAE064BCDC6BEE9DD948B2A [email protected]
302,403,941 *1DEF7E6D578E67C2B507244BA4500D8B052B2091 RISASAN
302,403,942 *1DE4B30817994AC46EFCFAF6DC02F5BA202AFAD2 [email protected]
302,403,943 *1DE27BF215742596D17431C13ACA103D4F670947 SIAPPUDANT
302,403,944 *1DE713D0A91430D0681E6F5E9E4173C1662036B5 ROBERTO.PISKE
302,403,945 *1DE14257C6BD44315BCBEED659935EA84CD8472C ROBIN RITTENHOUSE
302,403,946 *1DE99BDC0ADCF7A4F269B23F0282F6BACAED8131 roderick.frazier
302,403,947 *1DE0013DEE66A6FAD5E989D550BD56B4990896C1 SIX140406
302,403,948 *1DEACBA18C13B8D00A2193F34C7311A2883375F2 roqueron
302,403,949 *1DE0E5199C276927F20D5D9413DD1DFAD478A290 rosarioshaak
302,403,950 *1DEEE8416043A32C3085572D9218694B2D2E5241 [email protected]
302,403,951 *1DE1949DC1EB11DC6C32E85ED9B13BAF380AC55D [email protected]
302,403,952 *1DECFD996E22C9116BFE81286D11F383D21290BA ROYPIEDRA
302,403,953 *1DED9CD228868F7A928811C3952565FE733D6E71 RUBYHEART
302,403,954 *1DEC785AF9BA3BE6946D59B8B392BB08988E298E RUFUS.REVARD
302,403,955 *1DE8872BA2E575414BB3292025E59A157B1277C7 sonabild
302,403,956 *1DEDBA237D995F1D63C6C8144E8A3E79298367A6 RUSSELRUBLOFF
302,403,957 *1DE917F0F3BBB5FB0EA2EA21D0D55724A02B832C rustyroda
302,403,958 *1DE595596959482D3224EA8D7A82791180D830D3 [email protected]
302,403,959 *1DE5561ACDAC98D850F1AF9575F8438B0B51F6A9 soul reflection
302,403,960 *1DEDD0DB0905EB08AD34BB2D9F4AA548DD3BA807 spavins
302,403,961 *1DE364E8DAECCB054C385CFD01DCBC7BB979A0F6 SPENCERHOLLO
302,403,962 *1DE44267376B2ADDCCD9BB742BA9FBE877F6054B spiderranger
302,403,963 *1DED5685A4E97D3690148F423884B25F45177779 sports.hall.-.basketball.practice.and.lesson
302,403,964 *1DE6312723B6481953781F6AAD0D9EC74A3043B6 SRC="HTTP//CXMGSMZNCM/MGS//21BN04VPJ6L_115_JPG
302,403,965 *1DE581FCD767639DC190071F0FAF2DCF28CBD08F SANFORDHERBEL
302,403,966 *1DEDE9BAC7F1BBF25ED0D32D71F879C70D111D2B SANG.EDD
302,403,967 *1DE819D2AF2617D81FA1C877B7E396B4BB9F4564 SREDNASTACDLIW
302,403,968 *1DE098D43C0D2E506EE6E799623D78499E0B4496 SATAN'S BARD
302,403,969 *1DEF207AF0647267C6FA091094C0C254EA9A0FB7 SSELLEAL?
302,403,970 *1DEA6183A01A0B503E98619C319D60AB10A36CA4 SSUGZTIR
302,403,971 *1DEA29F370676B5C87349304DE7B2077DE2EFDDD STACYLEE16
302,403,972 *1DE844835A9D39B6C0835F4D9C236998B1D407CA STAEO
302,403,973 *1DEDC0380F80E6F932036E9D3B91A6C61985B3CC STAMKAF9
302,403,974 *1DEF22804D2648471B5D56C8B2024831D3302D3E SCHLAMMSAUGWAGEN
302,403,975 *1DE4257F85095FF973B84741A78E53704FA8F3C3 STEVERBERNARD
302,403,976 *1DEC97E9B2819D68DF5A683A3F17DB3C81920A64 STORMAEND8
302,403,977 *1DE5F6BCD57923BB7202582B0E4265846AFB5310 semiseri!
302,403,978 *1DE6751440E922B2D87F4BA24DA16A29FD7A5401 septembee
302,403,979 *1DE92210AF0DDB669CBD6744915ACCFFC0941C9E [email protected]
302,403,980 *1DE191FC271BA382B3CE5D2A50987F67814F4241 supermanhockey
302,403,981 *1DEA24D7A2F357569855B96974BD57B747410B5D sureshkochhar
302,403,982 *1DE34C551DCB06DE03789C1F2DBF67D67AE993E8 SHERMAN.PALK
302,403,983 *1DE9D8C3D90B808C95C024250565209B44A5600F [email protected]
302,403,984 *1DEBB274D8F377E7F9699DDDDD135D1AB861B805 [email protected]
302,403,985 *1DEBE7FB00368168CB00E2678428DB52BA2E236D SHYQYRE7
302,403,986 *1DE067DC282A3DFD33B9D8E42303D68FA0E9EE57 SIGNEERDEN1
302,403,987 *1DE22AB6781F4A146AFBF91F4E4E4CA66D004A02 skasver
302,403,988 *1DEB882D4916B6076EB68A4413EF107B93118EEA skorpydolce
302,403,989 *1DE44F0A26D010AD62AC8AB9DBAC30EF386590EA TAJUTONSINIVALASISTAHTITUOPPIINI
302,403,990 *1DE8CB68A2155B566E0B90254BA7587E0E17420F [email protected]
302,403,991 *1DE9C442CEC104EDA89AA39B1FC218D24A54A15B TAMMYQWASZXED
302,403,992 *1DE5A40EF2C23BF7659D2397A564FB91FB052F8C SmileAtLifeAgain
302,403,993 *1DE556C091610DA366AC377CEBFEACB68ED3D694 snearan2
302,403,994 *1DEB1E3409B1C93230B9C444121FE7303E08F868 SNICKERFLUFFY
302,403,995 *1DEFC362EDB19CDBA57F1AECD94843938D2A4E6E [email protected]
302,403,996 *1DE8CBAFA7015101F81111E1716E351B9D77EC21 SON.RIEMANN
302,403,997 *1DE14F9D997511E07A5FF33D04B0AA33CD4713AA TERRISOUTHERLAND
302,403,998 *1DE829B9D21B348BBCDC732C364CFB79275E50F4 TERRYCREW
302,403,999 *1DE4A352291F4565AC831ED4DE5DE555CEE00570 SOWHYNOT69
302,404,000 *1DE55EA11E09594388D19293A2184CAF326B3070 thestanleybrothers
302,404,001 *1DE78DF9F4963EC49A9599DD76A050D415C4FC14 thexviiiwintergamesrounduphacklaimsfor
302,404,002 *1DECCBCFB5C4895721A21C17EC57C92D02F9A5C4 T[email protected]
302,404,003 *1DE6D2F0D93E240617D3175EF388F277F7F2FC31 STEFANPORT
302,404,004 *1DEED1ACA8BA1CE56F3C4A03699C7875EC04FB8F stephenbadboy
302,404,005 *1DEB2AAA7BA968742431548BA5AE06A76668A38E TILLI12
302,404,006 *1DEA9A9C5145FD6C338AD9E473C11E1FAE588279 tommy.youn
302,404,007 *1DEBA9C17FD3F77EBDDE8716520272186D66A2B4 TOOMDEN
302,404,008 *1DE98B679E4C93C8217E7E5BD0993AC4A8F93A61 töyhtömaina
302,404,009 *1DEE3999A8BCF904B4F4E16CDC4B63DCA477B6D7 SUPERACTIVATIED
302,404,010 *1DECC56E65C32339A5162EAB013AAC612AC7C724 TRACY-ROESCH-BAYNARD
302,404,011 *1DEBB914A791B5E5F05D81C62975F0C29D27EF04 traktatmssigt
302,404,012 *1DE11965774AFABEAE35595F1F68C7C8FB4B66D6 TRAVELSANDY
302,404,013 *1DEA50B300E350CE6D526FCB9B957EDF6A64C083 SURROUNDME(TRANCEPROVIDERSVOCALMIX)
302,404,014 *1DE58F4AF81A9119E8A001FBC39E68BB5AB806F2 suttees
302,404,015 *1DEC90875CFFA18F672BDCBD998ED67889CBB26B svernando1
302,404,016 *1DE4F1C7F91434CDFD70118922954E00E4B3DFA4 SYOMUNI
302,404,017 *1DEA0C7501F0F60FAAED841C0866928D6E401B65 t001-r3pa
302,404,018 *1DE1F26A5FBE9112F3A8F314B45C80A570FE1952 T30031973
302,404,019 *1DE098E356F5D046958B2ED96405454855A8C908 trichobacteria
302,404,020 *1DEED3BF3F43C2925938A8902C2F8337DBF1CD79 TALK872047188
302,404,021 *1DE4A635E1381BDB08B65DD01AFED28DDD83A6B7 TALK8924317694
302,404,022 *1DE9580783C932AF8DF9E00480651676962CB80A talkscouldleadtonew
302,404,023 *1DE6E14B2D9C100DECA88D6ECC099546967426A4 TSIHCRAE7
302,404,024 *1DE94CEF86748DCDC6107C64E623C755DA03B5E9 TAMMENE
302,404,025 *1DE264E40CAB3726CB2CFE43256D3DC61D17FC66 [email protected]
302,404,026 *1DEA2B0AF67E6325155D550F5B6D7ADC3D6EB2D1 [email protected]
302,404,027 *1DE6AC38BC8E7A713DAABFA298793FE1AE7F2A6A TUKKIOSUED
302,404,028 *1DEE08F18A836EE95B36E4B251F637ED8ACE9981 TULORATKAISUA2
302,404,029 *1DE2F9B131AF7713CD32947E1551D8A13F8A0333 tuotiaf1
302,404,030 *1DEF49F84A062502EC16DDD95289F1A191605370 TURFGRASS
302,404,031 *1DE6C8A2309B3729BAA303315C30ADF3BF58EAE6 TWIDDLED
302,404,032 *1DEED35E251A6404B035554765BDB33F18380DE7 TEODOROMINARDI
302,404,033 *1DE8453E81271E500B6E2E5C2973A00A27A3498A U+C`
302,404,034 *1DE804B1743C36A480A38AD17D24E387A7AF25E7 ÜHISTUNNET
302,404,035 *1DE28D0B87D9CA1EBE37C43F49AFC44D7BE63BD0 thaddeuswanzer
302,404,036 *1DE808F3882613644B33FF56946CF9C5EBCED062 THANARATOWI
302,404,037 *1DE3213F7A52DA223627B7B808B799B98049902D ULINXSW6
302,404,038 *1DE5CDCA2E9A24D9AA2FECC4534C32AA3D9530C4 THATPOOKEY99
302,404,039 *1DE59EE90990821C423951EDE0F4D8945FFA290E THEMBASSADOURSES
302,404,040 *1DE1C65950E97B84BA13A0DF9589027D5A65BC81 [email protected]
302,404,041 *1DECE5DCEEBBC065DDCADF9A0A78EC5A7D4685A7 THISRAJA
302,404,042 *1DE0AD070A5C9D50374FFF334F4D636CB6A6CF75 uu.g3x
302,404,043 *1DE270F281E84CFB0092D2F95D24E4E8ED75B337 vabadusekell
302,404,044 *1DEA22C64CEAB5200740ADA9115249351C1CDBEB VANGRANDINETTI
302,404,045 *1DE27FC79DB1BCFCD5C55EFD95B480D87121B66A ticklebacks
302,404,046 *1DE13C0CB6FD46B8421EBF821425440F7EF01761 TIGERSQUALITY
302,404,047 *1DEEA04F54BEF8068D6357E64558DC5CBDFFB56B [email protected]
302,404,048 *1DECC5D6E2B1E6E318EE4076837CE39D87C3632C TIOVUEN6
302,404,049 *1DE27B59D69E23E9ED6AC986AE414DC52D18A728 TITLEREFS
302,404,050 *1DE1C0F4A2B66F4673CC76DFBBF8AB273BCF32CB VERNESAPETERSON
302,404,051 *1DEC92DC3752091B42998801914A3F8640BE63FF VERNONFRALIN
302,404,052 *1DEDEB3B278C8C56E8C2E33352E5515E96AA656E VERNONRENOLDS
302,404,053 *1DE6279C410921D9ABB873CBB8BBD2FF90A0BBB2 verohodnejsich
302,404,054 *1DE32D563AF73AC0DF5D36C23F43DE338C452922 VIVIENNE.MUHLING
302,404,055 *1DE153A860026F56D065A385535750D07FF5DBAB VLBF5FAHDDEW7
302,404,056 *1DE2761657FF27C6D8BAF9525F6FFF0F53A653AD vorh
302,404,057 *1DEFD0D0F1237404808BE427B83339AA2AA99FD1 vrouwenlisten8
302,404,058 *1DE3D54F88D55636C908BE28B5231A882D3FF24E [email protected]
302,404,059 *1DE1A73F239DB3D173924A4630BB851FEED0BCAE v.sri.velayuthan
302,404,060 *1DEFAAF8556A418AF4B01E44159713409AD3AC9C [email protected]
302,404,061 *1DE11DD4060F392A71B0D0A9C6E1FD5569144102 W159793
302,404,062 *1DE78369E375F09BCE53B0B65479555704090937 trevor.l.kinnear
302,404,063 *1DE246816D5642CFB0CE0ED2FEBE24228B3146C1 Waiting.for.the.Lottery
302,404,064 *1DED71EE9D50239E28A71AD3A6A4AE31F04D0786 WALLYBICE
302,404,065 *1DE6584829DD3FBD792AC5F74C299503EC33DBDE waneta.malsom
302,404,066 *1DEE4EDCBC6DCDC315BA3668F8D854410232DE79 WARUMTOBENDIEHEIDEN,OP78NO1
302,404,067 *1DE278E006AF54B9EDA4B193C6A2E53AF3ECCBE2 WAYNE ALESKA
302,404,068 *1DE2DAD54ED480F2D00EC85A882A1D9E4BB5AC51 WAYNE FAYMOUS
302,404,069 *1DE36D6BBD3E9468281221A9410ABFA36BD4501E TRISHA-GARDINER
302,404,070 *1DE440223E97652E9E32AC9E2392235C88E4B6C5 TRISTANCARIVEAU
302,404,071 *1DED7E30C8167BE141BEE9A453A6A9C9C9E779DC weaderasta
302,404,072 *1DEEF7C417087C89FA36DCA94696E8584CFFEEC8 TROTOARE6
302,404,073 *1DE3918F7AE5558CFD5EC538142EE31CE1113C14 [email protected]
302,404,074 *1DEEF9585CDCC3BBD9D65D462236379F8CB22234 [email protected]
302,404,075 *1DEAE75F990E3DBFD247C999618C57DD4C2D99B2 wesleyhantzarides
302,404,076 *1DEB6AED304C5149A669F91CCBA5228DBA115053 tuanhint
302,404,077 *1DECBC676244CECFA111C8B538C656B905D92160 WESTON.HERSCHER
302,404,078 *1DE01FA2D8B2558625F995636C409F057CCAFE54 TUHATSIVUISEN0
302,404,079 *1DEF0BB04C128797091FDF1E2125E94CB7ECD1BA WGUTALE
302,404,080 *1DE0B9729AEA3D2C1BA9F4B26BECC2FEBA93887A WHIMSICALHOOPS
302,404,081 *1DE56C9FD3B0CE41B98EBEAB50584732166FCECB WHITEDR
302,404,082 *1DE1E3900154D8AA80C2B9C6D650EF6A269FB36F [email protected]@b13
302,404,083 *1DE87A2E01E71CD927A4C57FF7830E567F9BFA37 WILLARDSANCHEZ
302,404,084 *1DE3FE27DC5E34742325231AE49AC60513A07607 [email protected],
302,404,085 *1DE14489D14E51F0502CAF116E1745EE4BAAE9D7 WILSON.BERBES
302,404,086 *1DE2E2E60518EFDE51901297F32AD10400686834 [email protected]
302,404,087 *1DE181BDB97BBE8302A9122CCB9B930252E81EC5 WIRVINCRUZ
302,404,088 *1DE610B3CDAEFFE6B673F8875E9118E6D560A44A WMLAMBERTON
302,404,089 *1DE06F50AEA09EF4699F7FA6945B48894D238907 [email protected]
302,404,090 *1DE7152275432A5082F89988BE51C0AEA5FF7509 WOONPLAATSEN!
302,404,091 *1DE0CC2A434E2767F2326EC76E5488CB76AD653A [email protected]
302,404,092 *1DEC07B9FA8F1E65CA198426566885C997856D99 wyattschartz
302,404,093 *1DEAFF790C03C277513E61D7ACE8889BEB1A2A94 xavierjaekel
302,404,094 *1DE9E6EECEEE811F3593920530C1AF24A7C5030F XƎLFƎLI
302,404,095 *1DE56302EF14D0D91A9308F0AFD2428C75797DB7 [email protected]
302,404,096 *1DE1F53A588CAABE274AED7B94C53B5B16AF7ED3 [email protected]
302,404,097 *1DE189C8F07D9F9B8846BFCD37E29377607B76D3 XMVINJELWA
302,404,098 *1DEE3C5818916EFC7DD74CAD6846ED4D7C04782D UMGEPFLGTEM
302,404,099 *1DEEE75D30EF54BE4AD91D04F51A2B0A19BDBB16 [email protected]
302,404,100 *1DE771E2B9927EF7BB6773A50E67B703F7029CDD [email protected]
302,404,101 *1DE3B3449E788B503323FC4D237C659336DA05D3 UNCHECKEREDUNCHECKERED
302,404,102 *1DE34DE2FAA2BD8820CA0B6B59F8C75868472F26 undiscip1ina81e
302,404,103 *1DE69A071B57E8E2DFE3C5ACBE842986508452A9 UNIFORM?
302,404,104 *1DEA270331D4B637D04D40A47171875D7E484AD2 [email protected]
302,404,105 *1DE263538553B746A052147ACC177963D14E9624 YKRIHS
302,404,106 *1DE83BB7F7F542FC75EDE81B3DFEBA4F814E1F21 YOLANDA.DE.NYSSCHEN
302,404,107 *1DEB2D796D9590AEC868250A2D24C82F97AD8E61 YOUNGPROFESSIONALSIBBCSTAROSA
302,404,108 *1DE38F3DDAF683A8E9F39D005CDA8AFCF7242749 US-FILM
302,404,109 *1DEA7D5F73986872196C6E686E3A9EFDDB74533E V154806
302,404,110 *1DE681F3DBB270F90BEA490F040EE0EAA7F6D20F Z1999257
302,404,111 *1DE78E9FEB409390F1EE2A0BFC05624423D25241 zanyhaw
302,404,112 *1DE673D18982030A20A226457C438362AB15FF6A [email protected]
302,404,113 *1DE71EDEE1617DC5BC1A5436838B71C01621BBF0 zgielku9
302,404,114 *1DE751C503D3B26AB6E5CF27FDA90D0D890F8B92 [email protected]
302,404,115 *1DED59971FFE07B7B8EA19F1F817A0E491BA9F21 VAN.MCCARVILL
302,404,116 *1DE96B7345539641F5D773B6A5E3486329A4EE09 [email protected]
302,404,117 *1DE644A24E80E86A63058D4407D68419E8DB79F3 ZOLTAN-SABO-ZOLI
302,404,118 *1DE1DC9A130054DD869A75750AF8891A27841C55 [email protected]
302,404,119 *1DEC795FD41930155FA928CC81D33ABC869C9FE0 ZUGGELRADE
302,404,120 *1DE25B195B91DE4CA92B6AE9B86CC6CD6EC6B5D6 VERMODERTE
302,404,121 *1DE688675E9B31EA277560A088F7695560DDE737 veronica-r-villegas
302,404,122 *1DE592261F6CDF539A5CE1958A4499CB161A9994 VERY-MERRY-CHRISTMAS
302,404,123 *1DEE00D280BC36A3CD5F5406BE4BF6670B52A377 vibhu.grover
302,404,124 *1DE5BA1C7313E217E888294523854B53169A2FB4 відеогалерея
302,404,125 *1DE7CB3FF1E8C2D5FF0464690D39FBEF931D4BF6 vikkie.shetty
302,404,126 *1DE13CBEFAB3FDAFD6E40244D2E3FFEF2F1DA93B VILLA.MASS
302,404,127 *1DE3CC5378B5C34E03D9DD62DE6E4985DC26E683 VINCEIVERSLIE
302,404,128 *1DE6D67C406F99714EB27BB5F2448C6EDA67B2D0 VINCENZO.FEDUNIEWICZ
302,404,129 *1DE7A0E7519FE60547AB06BEBC08AF67CB793D51 КЕБИНИН
302,404,130 *1DE3DC958292701658770CAE21721B2519227412 VIRGILCARRIAGA
302,404,131 *1DEB0F40CD7C9132CF55EF97D8E3A3C5657041A2 логины
302,404,132 *1DE5876AA294A13E475E7508993C57BA625C6B04 VJRMRVZNUSUXM3
302,404,133 *1DEB15260AD58B0B4901470387DDAE732EEB1C7F потапушин
302,404,134 *1DE01BB258A6C90655E601562FEC985E9262DB7A WAGUE-DAOUDA
302,404,135 *1DE404DC6796E7CCCE7A42D27CDF0384607D6E70 [email protected]
302,404,136 *1DE62456C62A62769B7D85C98CC29260247D9063 WBQ4421
302,404,137 *1DE10DF082134EA6D2234C1455ED478C0511D2E1 WENDI-MOSHER
302,404,138 *1DEB9C949A94550DA9B51AD5FDA5C4348C5624D3 wesleycharboneau
302,404,139 *1DE7B0835E310073A6C7E3241B2810CDDD0C926B WFEYSAWDLJQ
302,404,140 *1DE9F5E3C338660F5883826C2ADA3411A96B8299 [email protected]
302,404,141 *1DEB5819D5FBF1A71A83F27075F8A973C2763EB4 WILBERT.FAIOLA
302,404,142 *1DEA928C8EBE9FDCA11A35C0E14578DBC8710B92 WILEYANCONA
302,404,143 *1DE648654176CA5134505C933AFD79839247E6F3 WILFREDSTEVENGAYATAO
302,404,144 *1DE30D095898DA5CA33C4BC29F538B6FEECCDD8A WILKESBARREDOWNTOWN
302,404,145 *1DE3C3F964D6D3B56E91FCC875B0270CA9541B31 [email protected]
302,404,146 *1DE2FCCBED3065A0D86E7F062F65FA9C69026116 WINSTON.MATHENY
302,404,147 *1DE3BCFB1C681AFFC6195324B17ADEADBE08CF2D WITH.THE.QUALITY.OF.A.RECORDING..</P>
302,404,148 *1DEC12F43CABD4A011FA37B529DE9BFD4F022232 [email protected]
302,404,149 *1DE39663DCC6E10CD4632E8AE9F9897B27AEF914 WRITE L $+ $CALC($2 * 5 3) XDCCDAT %SNATEMPDGI
302,404,150 *1DE20A9923FA0B297E40D215C88898E1EB77F6F5 [email protected]
302,404,151 *1DE7C8BE1FBC247344C7AE7F3DFB82C818386B37 [email protected]
302,404,152 *1DEA6062D0F3FB3CB5E8FB366EC866240F5B110F WURLTECH
302,404,153 *1DEDD0595083040B886A9FAD2418647CF9443B4C )X(~`<8
302,404,154 *1DEBC6AA1493A12F81134FE368D21613A6A50D27 [email protected]
302,404,155 *1DE006BC9D6C8F39242A00C9747C0A4DB02F290C [email protected]
302,404,156 *1DE025C1CED37503E405529007E67F8A91379B34 )X(* * * Q======B
302,404,157 *1DE1DF73CD605DEFA2A9547DA36F776A7F031291 YEME IYOHA
302,404,158 *1DE5C9D192C38ED2701137A4BEA32EF6DB710BAC 逝去後にwater
302,404,159 *1DEDDC960C7576F9BDBCA234097E17431543609A YINE.YALNIZIM
302,404,160 *1DE076E4CA3698EB3C7EEB9AF7EF6FB0FD6E6389 (0-0)*.*.*.d===p
302,404,161 *1DE0A4B5C88927155CE396DEA054D994A48DFDFC ZAHARIA-ANDRA
302,404,162 *1DE6696AFC0416EBB1F7C7D7270CA16F55310FFB [email protected]
302,404,163 *1DEB7CD7154A83DF5D8382435FA4420A8A091265 ZETA-YUI
302,404,164 *1DE803C300F4D805C2CEDA765C5093D8AC67B63F ZG`)
302,404,165 *1DE96B2AD4B3CF99A007C20DD1DA9991C2AEDD91 10:10#&competently
302,404,166 *1DE1D8606D7EC5CDC9B193892F93A2659774114D [email protected]
302,404,167 *1DE7863755EF61E1E1D431617EDE403F833E685D 1118447 sen-ingressi-on-oireellinen-:-"-anja-kaurasen-matka-
302,404,168 *1DEE4CCDAEFA9380C526301822ECCBC76154D978 [email protected]
302,404,169 *1DEC23AEFE868ABF0999CC8DF3A8E8086E4007E4 11-CEVABIM
302,404,170 *1DEAC42750D00E9D4624187C5689A9678C83ADF8 ZNBDDHSM1
302,404,171 *1DEADE97B944F4EBFA0390FBE19B22D0CA4FF421 ZOHRAB.GADIROV
302,404,172 *1DE1ABE8D090B9B480262AA085C382238E334048 1551790 VON HOWARD JACOBSON
302,404,173 *1DEEA1A24C2E032F0211B9795787F1FF0652903E 1562919 NYT-PIT
302,404,174 *1DE953FD19B19DACB1880D73B86AA37772080C86 „ZOOPHILUS
302,404,175 *1DEF6AC802B07BF6DA23959452B841A7F5E7A669 ZUGVOEGE9
302,404,176 *1DE3447021D1AE72ED4B6A9A7594B9AFC0E16FB1 σωποτό
302,404,177 *1DE4F1D131478F3F4C255E1A9FACB522C977496A ГЕРСТУНГЕНСКИЙ
302,404,178 *1DEBFD7A6199C44B8DBADD6BA775148A094C9B89 1.ANIMORFIEN
302,404,179 *1DEB69C9F40C00E4DA1E25937A8C998FA273AA3D ДМИТРИКОМ
302,404,180 *1DEB4ED8D6DF8C553F4002BB4C1CA9FF9ED21918 МЛЕЧЧХА
302,404,181 *1DE2A7B5825FF3F72B6FA720CC18F74F354BF128 музиол
302,404,182 *1DE1950948AE5325DF4571195A6FC22F7F218B95 1efddd99c939
302,404,183 *1DE88C85662BE7A2AB4BCD7F456D9837CE870291 ПОРНОСЛЕНГ»
302,404,184 *1DE022ACE3DA175AD2873269FB9F40DA54625E65 1-GELEASTER
302,404,185 *1DE0F8FA9D1677204412B78084DA4876D9B52E04 1.hinnoita
302,404,186 *1DE73FC3359C1BEAEBF33A17067E651432509264 1.ihannevaloa
302,404,187 *1DE381412E84EEBFB2888498ED70D10854F934D3 1iloveqwerty1
302,404,188 *1DE65F99BD10965012FC32271FE1F3F6A28ADE7A 1kladschildert
302,404,189 *1DE78ADA436340986BA59634BD117F51C33C1F7D ТИМИНУТНОЙ
302,404,190 *1DE948BA2A48A8A7D588B8C5E3893ADB94708871 1l,a
302,404,191 *1DE00368593D8B4F7148C74B089A3DC84F4D0EC3 ХАНЗЕАТИ
302,404,192 *1DEE37DF76DAADBE11F8B87052964C8C56E9BD2F 1.mastercard-luotto
302,404,193 *1DE75A8AF2BA4014A2EF337671E89E43E3A5BC77 ЦЕКРКВЕЙ
302,404,194 *1DE29BD6B2D0B1956CB42A421DB20AB354C525B8 1POBRETEA
302,404,195 *1DEDC9CB5D5AAFCD7EF79444D44E91DD037E10C8 1ROUTHIER12
302,404,196 *1DE73172B9AE5084579892C3463AF727C21DF80F 2166531 MOSTOLDERINDUSTRIESAREPRIMARILYGOODSPRODUCERS.
302,404,197 *1DE18D426B334733CA703999FF79AAA765DA1D25 22071147
302,404,198 *1DE00D4F3AE942894F91FA6D59494CDAB643736E [email protected]
302,404,199 *1DE7BFA936A40075A41374C0E49AFFB4458417EB 2682563 hankkeenvaltionosuuson44,7%eli9550600mk.
302,404,200 *1DEAB4E92FE19FB4AFE92059AF779858FC6E950A 2ABBARBSW
302,404,201 *1DEFB461F6A162794E265B6B53B2C80ABBFBCDF5 2BOORIHAPPOPITOISUUS
302,404,202 *1DE97269645F3C61264063614A3D24F430CB2DD8 2COMMISERATE
302,404,203 *1DEB95B8E9E80ECE022A9FC3B3456088DA7AD93B 2pc3ss
302,404,204 *1DED5D4FAB5F8B77B715F0BC8008D237F362BE0C 2-TOIMIKOOT
302,404,205 *1DE1E2AA431AB25F1C1D0F97A936A0BF04690BA6 △2◆◇y(2008年1月8日
302,404,206 *1DE2C48F62B849E2A9BDC2286273798FC12484DB 35LAAA
302,404,207 *1DEAD4B8F6FA39B99BC88367BAC2A8D151DCE276 38MANNE
302,404,208 *1DE5688C27CF319CD05BEED81C0C608009981591 390407 lomakkeiden k
302,404,209 *1DE4289B442CA376396AF23D2B274E09FD1C3E89 3-M
302,404,210 *1DE2E66BE2CA64FE12BF358B0C54FE24E9AA148C レールファン音楽館、trainsimulator九州新幹線開発者による
302,404,211 *1DEA16497B9A4A2EC8D1D553FA53BEAEF8B50F1A 4kuplaa
302,404,212 *1DE8EC41B56186187B1B0E1A95E13D4AA5BFCBF3 4LOVEDOROTHY
302,404,213 *1DEDACCA48B289ACF61AE30B981E7878C83014CE 4nykymaailmaan
302,404,214 *1DEFA0187794B42C28A350AB742C072FF4E2CC9A 4RR3ND4D0
302,404,215 *1DE227DFF4FB871E8C03F1EAB331BED851C62CB8 4RUSSIANISET
302,404,216 *1DEA057E463CDD7900ADB853D35CE235F37E94EA 4TARUMATARUMA
302,404,217 *1DE9143355F23DED64D2EFD15B11654C1DB3B8B0 4URAVNATI
302,404,218 *1DE50A933A59B2D2598753EC2B452DC45D58C7BD 50JATKOOPISKELIJOIDEN
302,404,219 *1DEF02A663E055CEEDEBB2CF7734605104536FF7 545CURTIS
302,404,220 *1DEA8E3FBDC9C142CCA5D0F7CA8C1A801F1BA444 5BSWGYHABSW
302,404,221 *1DEEEC76F0016E03ED3087ED0D10F0230DBD1B2B 5CLOCLOMELISSA
302,404,222 *1DE3E86CDFF17854EBCD2DCEE386DF0F2CA85574 5ECLIPSEFGH
302,404,223 *1DE4B71C42C2F7B88C43D1C65721D4662DB10125 [email protected]
302,404,224 *1DE760138DF7A4B58B945302C6EF5CE1E306E72C 5ILUVANGIE3
302,404,225 *1DE85A6BAB78944F0304BE8CA912A00F65A34DAF 5september1452
302,404,226 *1DEAF6F6D442AB0859E581796DA6950C482D7EF5 618788 gmac'sissuewassaidtofindmoderatedemand.
302,404,227 *1DE2E1FEEFB2EFEC888AC43B8BEA1140B4C97E32 01…2p
302,404,228 *1DECD6425A8523BC72A0BB8027E15616F569A2D6 6BSWZEOBSW
302,404,229 *1DED132AC49F5575AEBB51D4256D56887F0EA052 6DOKAZATELNE
302,404,230 *1DE3D86086039A97F6515E1349B87FAC8C2598B2 6.gemeindevertetung
302,404,231 *1DED9BF73FE52B6B9E5F12FB1969386085CD8776 6IAMWIBBLE9
302,404,232 *1DE048B44C95D65501FB965F5173789AF5246F54 6MOOKIEMARIE
302,404,233 *1DEFA80D3569358FAB284AFCF09370D89C569527 6NIEKTORE
302,404,234 *1DE63BE69AD1D524551DD41E50EE283E0E478016 6PASSWORLOGICAL
302,404,235 *1DE9C95942E9FD82AD1B9ED23E24E86F9EC5F5C6 11AUGUST1812
302,404,236 *1DEB61CD5C80940CAE56AC55C207DFA67455A0EA 123nothingabc
302,404,237 *1DE6E9B0189E7D068191CED1CFE49367006201EF 6SWIMMERRED
302,404,238 *1DE8D9A128AF66EA8774F9C918ECADFE3238082D 1466SAMUEL
302,404,239 *1DE5E31FD2E85EBB24792EC240B5330E0C22ACB0 1584331 it had been argentina's lone territory
302,404,240 *1DEFC834EF4E4B4A4D7BFBDE4E7DB745C466A767 7ASSA7I
302,404,241 *1DECC9A252A96D8BE323CCBDC27C2D43EE56B92C 1649381 tekoj
302,404,242 *1DECDD0E0678073A3BDEADBE3FB038B46275F0E7 1844002 esheisst,erkommenochansaddamheran.
302,404,243 *1DE084940B765EBD5F39FFEF32D7662EC28C7853 1958OB
302,404,244 *1DEA8950AA9F9DF218D10ED2D6E1E32D2A1CB5FA 7HAPPYIGUANA
302,404,245 *1DEBE4E04C4B16B71752F6317C9AE13C5A1180E3 7LOONIESTS
302,404,246 *1DEDE13AD19F6C405BF4C9366CE725861D423D49 7MARCH1854
302,404,247 *1DE3659213596A48E5EF9CE7946BFBE36CC7422A 7OLCOBAC
302,404,248 *1DEB0B4678EC2EEE934F66BC046EAB5442BF21A7 1Cikararan
302,404,249 *1DE0E1E445220700D2DCACAC948E57B0F8977E3B 1CoTTi
302,404,250 *1DE1CF708312BB04241EADD3907A7ACD507BB312 1 ENNUSTUSKIN
302,404,251 *1DE1DE0F82A7ABAA10BEF5F16569369D8DEC3F34 1FIRMENKONSORTIEN
302,404,252 *1DE06C7B493C66F08D9A5D90FDA892491643DCBB 1FUME
302,404,253 *1DEC13967473142F2779ECD8D15374BA9EDA3BC1 1interjectionalizes
302,404,254 *1DE67465E08E10A9A1D4C3027B2616AB1C125244 1.KROEKERPORTLAND'S
302,404,255 *1DEC77A124F8443DE2034D7051DB93DD25250680 856FRANCO
302,404,256 *1DE3D44F5113DB5FA68DF014C81FC702E24C6F82 1.mukelleflerinden
302,404,257 *1DE768E4BB8F9A5BC6E95F2E18A09531FEFAC661 8.ALMERE
302,404,258 *1DE7D3E2C29CF2A8ED90738BFD4791DCE4668E7A 8ASSIEVUO
302,404,259 *1DE551EF3D750A86533F9A7062B7DEA9AAD48E51 1-ortsteilhuettengesaess
302,404,260 *1DEDA6D6DCDD5278990487A6DA686BCCB08F0D76 1-ostkreisvereine
302,404,261 *1DE570AE75507077D651BB64C51E51955A07F26A 1pelzel12
302,404,262 *1DE72480C9A28F950F854379C93169DE80524D36 1 RIMLA
302,404,263 *1DE42E4CB50A6249E7E2AD684D18939DA7C9712C 1riuttonkulman
302,404,264 *1DE3ECF1F3CA3FCACE8286C031BB759F4A219BDF 1-section-those
302,404,265 *1DE91F9627285E88CEC4CEF6336E2D5E5CCFE8B0 8.gezginci
302,404,266 *1DE4F73C961C6EB662701D1772097A591ACF6F38 8LITTLEDUSTY
302,404,267 *1DE8143B626485D2CCDD789D635C1EE7CBFEADCC 1sitten-brig
302,404,268 *1DEEF7DAE90E0AB225139D0CE35BA7DDE98FC4FD 8POMARDPOMARD
302,404,269 *1DE124E603ADB07582997DCE1B236D7F11662156 8REINTRESSERAEN
302,404,270 *1DEFDA9C539E4706577B774B5FC82BE367E25985 8SAAVEDRALAMAS
302,404,271 *1DEF8BBB2B4D67E3B62397DBD2BF794B358B668C 8stoomhei
302,404,272 *1DE15071B0A4A8D0F105E0F8E270A8CC2CC09B8B 20100625ELPEPUSOC
302,404,273 *1DE0CAF465C1B7F7C64335F4F4BAE496794B1394 2112.preparing
302,404,274 *1DE95421D87384FC6CC2E12D6AD56A736E15EB4C 2449483 virkkujuoksi,matkajoutui,p
302,404,275 *1DEB4E97324B47E9B4DC74BA6BEBFEB2A25D74BD 25D20
302,404,276 *1DE7C2AFE212C6640F6B11AA51EFF596E5E5EB3B 2695318 KASVATTAJALUOKKA-(-KASVATTAJAN-NELJ
302,404,277 *1DE685EB2CEE8A96294B342015B9FE1E756F166F 2ABDEL-SCHAFI
302,404,278 *1DE5ED6D1AC52790349FA74E9D4B98C47DC714C4 2ACTIGINIZ
302,404,279 *1DE73E82A414159D02591013C79C81D0CDF445A5 9OXALATEDS
302,404,280 *1DEF3469361F8CD34265DDB41ED8AA9E7D818211 9SERABHER
302,404,281 *1DE56105C82B213D9B1799CD169A9604BF9F2820 9TEDDYGOALIE
302,404,282 *1DE74B5E8D9B9DE1DED19D1AC80FD8DC62F275DC =<*a
302,404,283 *1DEC6B8C104BE2C29EE7D358375446C7E3CF8405 2JANDIRA
302,404,284 *1DE0A0FF2679D51A95F0F79FEE28CF96EDDD195E a%>!
302,404,285 *1DE392E2E78FC62DA382C11164F315519A86D38E 2.oraniendamm
302,404,286 *1DEDA59F86113D0E5C6E9414E284F06C51AF9D7E a&1ua
302,404,287 *1DE1201679E1CA262206DF6F241117C37C7A8FE6 a2ewp
302,404,288 *1DEEDEC9049FD18A093C1E147815D943BEF57959 a6ct
302,404,289 *1DE82CEE49631DCC500D71C3ABFD31999B7AA769 3ehdokassuoja
302,404,290 *1DE322374A052ADE375A85202BE49B5F1CBF9E9A aanbellen0
302,404,291 *1DEF3B53E1B1E2B39A262BCD9509783447A2CB3B ABBILDERNED
302,404,292 *1DE434273067CB20CCF3686D8C5369251B8141B2 3=)~O~o.Splat!!
302,404,293 *1DEDC44DAF4A68497CAC857E4A6B77F3E0401AC7 3PARKING-THE
302,404,294 *1DE5A5127BE7EC8B157A56D6BA71B0B6A2D7A182 3##P*.O->-<
302,404,295 *1DED0D481453C03F16A334EB2996B7E15CBBA63F 3ruhlarimizi
302,404,296 *1DE3B2474554177299870331C4C2E123523979B1 abelkorgie
302,404,297 *1DEE01D4A8CAEE8DA344A4965040D53C5D81032F 3.trendwatchers
302,404,298 *1DEC6C593A43A46BCF28C58D928C7916F45E15B5 A?BL4
302,404,299 *1DE2E2BD85783F7F3FDA4A8BF78FC9621468F74F A.=BY
302,404,300 *1DE2C8687F81EE098411E99A7BB6A645AD6A2E4A [email protected]
302,404,301 *1DEBC3AF724B47ABBE3416FE6B1107FBD49C445A A.CHRISTMAS.SUITE.I
302,404,302 *1DEC8961BA4C86CF313FE6658648DBD813ED13A0 [email protected]
302,404,303 *1DE7C0404A7F91C189797CDD50D12F3C3A6558DD 4EKAMTSAV
302,404,304 *1DE099E3BF5DF00F47ACCF552A5B05B181D10F75 ad$*
302,404,305 *1DE311EC04E0EE295C44FAF46296F7EA7A305C4D ADDPOWER7
302,404,306 *1DE5B8D2BD297BB27815CE0D3EFBACA7EA580AF3 4NEYSABSW
302,404,307 *1DE24ED4EB9BBAA5DD4EE0764C655806DA51FB3A ADLK?
302,404,308 *1DE043E9DB6532753D23FB7D4429D10ADD02CAA9 ADP5V
302,404,309 *1DEF39BAA3F181466B7EE1F5DF83A2298953353C ADZKW
302,404,310 *1DE2C319919194404E4E39CAC0C607B1012A8D21 A=%G
302,404,311 *1DE900EADCA57109A7CFADC80317BF08F7646B93 AGUA989
302,404,312 *1DEACBB3CDF27850F7D6FBA6784A4E2B884A18DB 5232ASDF
302,404,313 *1DEE262B5744CD8662F84A01438B379451D0CA7C a?gv#
302,404,314 *1DE66429186965458AD6261AD306BE2EF3126D60 548342 palvelun k
302,404,315 *1DE27FA5677459CF7A1C307A0C3A9ECFC1727219 aibn
302,404,316 *1DE9CFF2096F1615427081031925B7F8F403600B 5BENTGRASS
302,404,317 *1DEF3BB929E2FF79E8D7F81E8FC092DC8F61A84E 5CILIOPHORA
302,404,318 *1DEB9CACF6648FB5A3AF773268CB8F9E8911E3A0 5CLMRTXZT
302,404,319 *1DEA1CAE4F7B889AC686837A96E0BC815F082C55 alanwoyahn
302,404,320 *1DE026AC15CFDE6A5B4952B0CB7E8382BA6280D1 5kaavilta
302,404,321 *1DE98B071154F0282F56DF4BB7CCE9A97187C043 5KBBFQJRJS
302,404,322 *1DEC8A983CFB7799934CB20BFEDE3C96C3F60759 5-MARRER
302,404,323 *1DE8F81E070C55B15683E384919B5371D09AB7B8 5NOELEMAHC
302,404,324 *1DEE42A1086E99F7C9A94165122AF48D19839D39 5SDEEWDNO
302,404,325 *1DEBD6A452DCBBF0D763AE6F2271589AE7220E49 [email protected]
302,404,326 *1DE17C423C323C142DF77EE8C8D7060A6C0988B9 ALLAN.RUCKER
302,404,327 *1DE57C006612C815FD1833784D17A774790C8D11 5TEONILDO
302,404,328 *1DEC4BDB0240760D18AA906A70AD8900D848E45B ALRIJKER6
302,404,329 *1DEA2D530C8699724FD899B0530C6740A1D276C6 ALTRE.DANZE.TRA.I.CADAVERI.DEI.SERVI.DEL.GRIGIORE
302,404,330 *1DEE877A9690E49D3B10716D0D97D124E27E23B4 645ulises
302,404,331 *1DEC142DF8C625F9532FB20AF5B513306300FB55 ALX)2
302,404,332 *1DE6C9F1D8F2A84E57A44B95AACF67029CFAE7E8 6DELIGHTFULLYV
302,404,333 *1DE9F4B5ADAE2C1C8D4562D8127DE7E327CAA794 6EMMOSRAV
302,404,334 *1DE3847D9E647BA02D3757F396D5606B81A0A147 6ESKYMOS
302,404,335 *1DEC6F8C4E6FF1662E751DAAF0DB2FC780BC5612 6FLOPPYLAUFWERK
302,404,336 *1DE2CA629FB5EC3042DC1E4271B0C901245F4898 AN357H37!575
302,404,337 *1DEBC5C3E208549735385FB74105E16BE49C6677 6KINDILL
302,404,338 *1DE8AF419394C01503860E07F99569FADE29451B ane'antissaient
302,404,339 *1DE44596183B0594002B941C7072E7E89A7D11A1 ANGELO.STOLLER
302,404,340 *1DE4A908F991934A4821BC395DC64FD4BD7C57E0 6RONDRITS
302,404,341 *1DE4E810AACE810ECEFD72D1167E83DBF4AD00EC ANIBALEVENSEN
302,404,342 *1DE3E4086999FC9FEDF90AADE187DB539429A6B7 6strovlechters
302,404,343 *1DEE3D3A5A9B40552382BC56C5D7684F181F217C 6UPBREAKCHANGECHECKERCHOPCHOP
302,404,344 *1DE8638ECE7C4F29F6CF1773DB604E7A27FF9D8C 6WITHPLUNGEPOSTPOTHERPOTPOURRIPRESS
302,404,345 *1DE9B7C653F5EADCFCD043866C230DD83DE04645 antiopium
302,404,346 *1DE78866D570658171C86B26D19162EE43E6696D 76.MOTTLED
302,404,347 *1DEB95F71410F3F92156C21691D3A14F170FA908 775462 YLEISESTI AJATELLAAN TYPPE
302,404,348 *1DE31BF48022DB4510009ADB0A18DE627C1474FD a,-o
302,404,349 *1DEA53F11C35F96D67EE9D5CAE20752B8E3C1996 A:QKL
302,404,350 *1DE87D971216131377F3C041DE9C321A3176EACF 7GOOBERTWEETY
302,404,351 *1DE2417080DC943DFAA1EBC92414E00022D2D5CA 7INCHANGEABLES
302,404,352 *1DE7C00A25E405870866D9C0845FDB2E4EFCF528 areuwakeup?
302,404,353 *1DEFF9454C32C688216FE5BFD0C95191EA8FDCA6 ARLIEGISCHER
302,404,354 *1DEBDE67250035ED12D382507C5B42F28B6E543C 7MONOMIARIO
302,404,355 *1DEC2A9F44FCC96619FE8DCE412E5DB5FE29E7F8 7TERVEHDITTY
302,404,356 *1DE3F69CCE2EB43E8C80B2FD0DB13F3A3F8D8479 7THEPARK6
302,404,357 *1DE03F562612AF7ACE518B8766A57458168EEE63 ART DOWNEY
302,404,358 *1DE41B195D1B7E3C9E63D61A83C4166E45B8DB52 [email protected]
302,404,359 *1DEF84EB31A11F79945183DC055B21C63D9B6561 7-yakupreisoglu'nun
302,404,360 *1DEDF8BB89438E7F67EE5F34E0311415A296E1C1 aruiu
302,404,361 *1DE638A724038A794D56E80459BA5DD9B7D7FD69 [email protected]
302,404,362 *1DE0C0ED13EF208E2DBA787C78315745F38D9225 [email protected]
302,404,363 *1DE0D1DA06537A07B20AD4F033FE5C562E454641 [email protected]
302,404,364 *1DE97D13144C05F331B56BD59BE331A9B42EAA53 a&to#
302,404,365 *1DE3DE7F2AA3209409343499F423DB9E1FCDD343 8DERGROAT
302,404,366 *1DE40D02AD4BA6EC7BBF27381FFF08C57E08D4EC 8FORMYNDERSKABERNES
302,404,367 *1DEAF4CAF794EF4C6486EDEB3FBB64B2904D3494 8GUITARCATFISH
302,404,368 *1DE502420B3975B98D93F272B4AB16D7A76DB1E7 8 H311 - Pr
302,404,369 *1DEDF4190DFC5D6880F326774939106FDDA6744F ATT/M
302,404,370 *1DE289F11E9F9583AAD0DEE46DC967B40712FB98 a:uv5
302,404,371 *1DEA9145F34DCEF5CC06819C72EE5A2984806F08 Av/1
302,404,372 *1DEF0D4A5408063B462563ED270302316B130B85 8ONOSCOPE
302,404,373 *1DE4F79A2644D777DDF0860C4B5409EBF67812F1 aw4se
302,404,374 *1DE025E6F1C6385F6418537E7E400F7C7A389AC9 8ZLSVLNS
302,404,375 *1DE6F4C70252030D4A8F34F1D9DC40F2B5053AC4 a)w#m
302,404,376 *1DEC9D6649FDEECCF9AB50789720B13757E7F333 92pickup
302,404,377 *1DE9445F2397D58AA29959E670B53B78FDB8511B >B0`D===Q
302,404,378 *1DEE5FC1E5D32F5F4CD21874C3E19EDF26F6EAE7 9FACHWERK
302,404,379 *1DEC87D2046E0C27972221754C66E690042C5B62 9FOOLBULLDOG
302,404,380 *1DE13897D84BAF22143E863AC109EF1F49910B61 [email protected]
302,404,381 *1DE44962811C04AB7774622CA86C075BBF8359FC B/:5V
302,404,382 *1DE8C0ABB24DB0DDC19B0528B7F131A3FA1C7C01 BA"EM
302,404,383 *1DE66C97D416DF40652834404806F5E50600E8A8 9UNDERMINERES
302,404,384 *1DEAC3BE52242D01E53816DBCB5A0CCFD2F5F234 a%;(
302,404,385 *1DEEC9084734DC162C1B960D622B41381CA0E35A AAD-_
302,404,386 *1DE847CC21F5CE91A6F8E4C5CF723563D567FAD5 AAKENNOP4
302,404,387 *1DE63F5D9EEE2C8959AE9915D411077D697390FD [email protected]
302,404,388 *1DE3E417F22A0FC7F2EFA978DC115656F62590E0 AA$MK
302,404,389 *1DEBB616CFDFEA4F7C5F688783E9AB5CB4880C52 BERNARDKONKOL
302,404,390 *1DEA3C1DAA1D9C02D5965DA36CE30A7533E64598 ABR4K
302,404,391 *1DE2BD2055D1CB79CE7B2A7B51D3C2292DED70D2 ACHEMBURKER
302,404,392 *1DE3042D01F0D7B4450E94231E8A4A6593D980DD BGEM%
302,404,393 *1DED4B6969BBD57C55508724CBF0DFC8E0F57E89 bhlw
302,404,394 *1DEE5BD35831C510CF1D135D15840BFA8F2ABFD2 ad(fj
302,404,395 *1DE6717A575D6226C00E48E0866CC089F7C2A179 BKG"!
302,404,396 *1DEB2761586F79897EACC7638CB79A60DD1387EE aff/h
302,404,397 *1DEF2C12189C866A825D36ED053D7BFBD0B23D5C AFU!
302,404,398 *1DEED328B89035D7CC55542D101E9558EB42E918 BO.BURRAGE
302,404,399 *1DE34FDB56DB07DCB4DD963A0DBD3E0F588E90BF B!O_K
302,404,400 *1DE9CC7D14E6CDE0FBCC960DD8D29ECE6E6D68C7 aitniono3
302,404,401 *1DE9FD15DBDF02DD59C7D62688AFA5B7DB914495 a:km
302,404,402 *1DE508B9EC5BCBB30680A746935A89868AC3247B [email protected]
302,404,403 *1DE82B751BC39467169D9E893B5CE50149392F7F BRADFORDWAHLERS
302,404,404 *1DE21FF06D1F2EFBE4B98D40D567B231495F7B62 [email protected]
302,404,405 *1DEFA793852E3FBD3E8B5258709DFCD86AB21647 ALEINOIDING
302,404,406 *1DE7DA8ABB12AED5C4FF624714639ECB59CC6A4D ALEXJEFFCOAT
302,404,407 *1DED66FB5A85AE16540ADCD3BDDDA769A79DC908 brettrefz
302,404,408 *1DEA1D7173292636325FD8B7AAA04D5203DC579F brianfiller
302,404,409 *1DE069AA7B58424F8AA3078DECC2AC7F8B79B793 BRIEFER
302,404,410 *1DEAB361A7192E098CAF1CF0781842FA6950E686 bromio$
302,404,411 *1DEC45B98CA956891A14687F2915A3DD4AA2CBFE BSPCK
302,404,412 *1DECF39E54A9A1E341EA3871E0F1E19740CCD011 alsterdo7
302,404,413 *1DED5B1FBEA109412DFF2485BC8F582346043813 b_t%0
302,404,414 *1DE165596DE50898B8AF3EF3665C155EE36364AC BUOYZNAT6
302,404,415 *1DE2CD25F8A6017B2FE43BC2DDABF399F4EB2F49 [email protected]
302,404,416 *1DE538DF7E65A4D8D9B8829050DA38C970C6327F BURN’A
302,404,417 *1DE542046B3D9309E896F2B245DC68752277177B [email protected]
302,404,418 *1DE7F70EBB5720FD36627A2A7F0E1D99801F2AC8 bw!bb
302,404,419 *1DE5E34D956691C446483578C9B4D156E3486908 c398dfdb31c13a8fba560eee49241665
302,404,420 *1DE0A067E4BBF3ADE28D2BD1EA4363C3F3E7FB43 c&3ax
302,404,421 *1DE1C18BEE84516D31310BD4C565E9A3879E51C8 C4RM3NFRUMUSIC4
302,404,422 *1DE68DBA48E02F19159269E18522471DC57AC397 C`4S
302,404,423 *1DE396B41D33E534B5F979A40823407A8402C686 ANGELIDIAZ
302,404,424 *1DE4BAE6B154FCA100D9B3BA040770D99664ED52 Ca&7
302,404,425 *1DE7E98A13F15587BBE31209D6FA3C6E153C6C84 cahiers
302,404,426 *1DEE8754F5210C664EDAC427FD38F87253920945 cameron.janssen
302,404,427 *1DEEE0EA4C8E37B5CC722FD2CBAF6A1DB6EAF9B0 apca+
302,404,428 *1DE521FDDD31AA811504D7FCF047AC225873AEB3 apnkf
302,404,429 *1DE553F77C1AC5DF24BBCFE36D80FF378D5FDB3F aq97j
302,404,430 *1DE75CE2859C144CE522D4E177565FEED440B250 cartridgeloaded
302,404,431 *1DE640F11B0D5674A8AABDB76B42753E86BAC6DB CARYLAUNELEZ
302,404,432 *1DE461FF6600983EA45C400B5FB13FA2437B758A CARYWONDERLING
302,404,433 *1DEC11773E8AE7F8F2293CEA8EFE3FB843CA58A9 CATEGORYDERVICHES
302,404,434 *1DEF061277901953106031C913B5618043372666
302,404,435 *1DE2E9E5139734B8C4088A62518A78B521E6BCCC [email protected]
302,404,436 *1DE84C97F1424738ED2AB78BE3A00A87D42FEAD3 CAXPT
302,404,437 *1DE81B660EBA0D24BD2B25E2D29E57D1BAA4F496 CCOBILINSCHI
302,404,438 *1DE2707E2DB6ADC46B3A655C67AC7AC5C542E1D4
302,404,439 *1DE43193CEF371ADDA3DDC4C259216B48A66732C }~
302,404,440 *1DE363E0AF591B6BF1C6B8FA93C9A992544EDDA5 z>On
302,404,441 *1DEC92AA0E30F0162345C01DBDDCDABED6BD1004
302,404,442 *1DEB73CFA4B1E255B5D8D39A0DE89EC21DAC7C9C 1Y
302,404,443 *1DE9B30D98B6AC6A0B0DF4B059A9768D4E0B38CB i
302,404,444 *1DE4F4F0B29D60AD2134075B65289BFCCD431C5C F 
302,404,445 *1DE0B9EB703BBAC112C8F69CAB12EBD5FA8F3A13 CDTI
302,404,446 *1DEC554410B5EC7EC39AC06A01FCB4C9B2F9FF2A 6
302,404,447 *1DEEC973ACBC544271B09F692C231198F02E5711
302,404,448 *1DED7EE18A6E05FE187E0142A9C7BFE4C7339876
302,404,449 *1DE85ED7AFC797633F2F6AD5F8B7302FA709A35A ce)t
302,404,450 *1DECDBC99E5DEC57AB35479CA23F8BAE0CA81357 cf4v!
302,404,451 *1DEB18EF62D0753909F8E9FC0475118D89ECB45A
302,404,452 *1DE3FF781B0D0690AB93FA372634E9382B3E34B2 
302,404,453 *1DE406C18E3CB11F494E3C322C608DA1D2757FFC CGEF5
302,404,454 *1DEBB3DCC944F11A64013FF8951DCA6D4108FBEC cgku
302,404,455 *1DEB608C4A2675268B288B91579D2C18BB8D2BDE cgtd"
302,404,456 *1DE91F12522CD2E95129E3EF2B8641653CC81533 CHADWICKPUZ
302,404,457 *1DE971AABFBA160EC61BD059E07F615C08CC0358 v)
302,404,458 *1DE363B4FF1ADB3BA2650DD859A8262ABBE732EF A
302,404,459 *1DEC6E19C8A7F39B669DB34DA74E555398B7D3AB [
302,404,460 *1DE9691FC7D2F19E1732ED6DD2BFDE255D9B0908 Y=p
302,404,461 *1DE21D0DC305CD58B29BE78F6CC8D64BB9FE93C4 CHARLOTTEMARQUEZ
302,404,462 *1DE48E528643613BB6BFB0006C85F83557561248 [email protected]
302,404,463 *1DE1DC6DF2F2F4A609C4472B3BBDB5F0D62FDEF2
302,404,464 *1DE2DB9C69484139418F303B8472D5035A06615B [email protected]
302,404,465 *1DEBDF3046B4B9AB9D62AD1860791A3613A248E6 CHEER.US.ON
302,404,466 *1DEAB62B6766A53F3195AC752AE8EF164D6A5714 +X
302,404,467 *1DE3B4116D09955DD35069BC2725E185815B3A8A chestereshlerman
302,404,468 *1DEDE9C393FBFD0C963CC06C42ADDE0EAB8D3C00 CHESTER.IULIANO
302,404,469 *1DE0C9ED52CF085BA79F71F13D837EDD9F70D651
302,404,470 *1DE11C280128DB97B831E353816E4CD5FF71075B chileshpatel
302,404,471 *1DEF83EFEBDCC70D684242F629C1BCC32F90BA58
302,404,472 *1DE86B5332736AD8B9749C14151E6E100FAAE438
302,404,473 *1DEFD31F853B70D46A1EED1228FC309266C64D49 CHONG.CAVALERI
302,404,474 *1DE74129C7795279FB9D19C0E539F57B0AFDA847 M
302,404,475 *1DE9CD99155FC7A5C0B72D82717C5E2656F9EACA
302,404,476 *1DEBE4DAB9C71A8A6E989E316E94709A552FFFA8 choukas5
302,404,477 *1DEEE595FEC268A9EBD8BB126A9845CC3DC71150 CHRIS.BLIZZARD
302,404,478 *1DE04AF6E67326965826DAB77B78AE639BDA029B ChrisHartley
302,404,479 *1DE238BFE192449FEE39BC17590C0E8B002C1EFB ,sN
302,404,480 *1DEF365D536DC40B26884E536EA9759CFB4765E5
302,404,481 *1DE28CC2A88A05AB940B898B6C405180700153DD CHRYSICHTHYSLONGIDORSALIS
302,404,482 *1DEBD69E591A7EFDCCD6E5FBC19AAC09ADF302FF [email protected]
302,404,483 *1DE4016621D873D9567B4ACD1F77B100224E41A0 [email protected]
302,404,484 *1DE2A152F8920CAA998E1F354DCEDCCB8E09FC45 CIIECATT
302,404,485 *1DE76C5833BCB4C66BB931DA0FFD6C51BE910D4F /8
302,404,486 *1DE09C44C629A9FBC2AA1D8AB7EC643C19BEA45F
302,404,487 *1DE5F39D161CA2B729DE123ABCE459D0A5474222
302,404,488 *1DEF08E476F29554207EB5B4475C4C55C7C1A30D H
302,404,489 *1DEA68288BF0C7DA6A95077C8715C91D8ACB13B1 CJCSX
302,404,490 *1DEF01B727462BE8E648F4133E0358B0F05E022D cjh#r
302,404,491 *1DEF98FE4E991B26BE9A7625682AC8434EC8403E 
302,404,492 *1DED3A75A7C2164777F4EAB9CCA439A058429736 ^*
302,404,493 *1DE339AF1442834B1C81EFDCB2BF2C54DDA3A63E
302,404,494 *1DEE6D8610D2105095E1891957D170305CF05EE4 /e
302,404,495 *1DE30AE20B364818182F76D096CA7F973647EC3E
302,404,496 *1DECE9E11CEFA5B1D0FDBB5FEB683BDC34AE2523 j~
302,404,497 *1DE99E447B1E9CEDECCF12C3C252592D12BAE3B6
302,404,498 *1DEA2B86DB4B7984849D3713413DA2207A0B75CF CkU
302,404,499 *1DE8019E0C72F6809C65FBB50EE693548AC61441 CLAYTON.EVANGELISTA
302,404,500 *1DEECC2ACF2D63B9B604DAC1CEC333AB32FF6729 CLEVVEY
302,404,501 *1DEE26049AC0C4E1FA438C550321A03BED4F2A15
302,404,502 *1DE672013D8F0815E8B57E5C166D25810F22F977 Y E/a
302,404,503 *1DE0CFC5412EF275ED3B774D93B41BA10B87B38B Y E/a
302,404,504 *1DE0FC2F8C94606EE76A9060B0C247AD7DCCE088
302,404,505 *1DEB0963B1BEFDD7A5875B51375BFD4AAD456DFB 4MG
302,404,506 *1DE82F4F347F7D0D8543E680BF762DEA87F1B14D 3
302,404,507 *1DE947512AD7597C40A8C5304DEA1090555F0D73
302,404,508 *1DE46FB99A889EC54C2152D17A1C1C6A5B2F0E8A |rj
302,404,509 *1DE4C2D9C9889EA6184B0D0A3B6D973ED915B601
302,404,510 *1DE7B59B933ED0CB644C0031AED04957BCB195BD
302,404,511 *1DEC901201D138F5D669EC4DC64EFCF7ABE95CB4 
302,404,512 *1DEFABF3B30D662401A73FE52278D8D773E98629 ŕf
302,404,513 *1DE81FA313566F943CB304E4F9FB7DDC1B70BA5D
302,404,514 *1DE12557F733B9DEE2982CC2C2A7EAA278F854B1
302,404,515 *1DE204920A7BA761200B6E3B174CB1B9AD4026AF k
302,404,516 *1DED9DE189BFB2E37C0388FCA8F865B2FB43786E
302,404,517 *1DEEF02BB91D253D8EF91CEFC07E694BB9308499 8
302,404,518 *1DEFAC36CFB394EBAF0E0A8AC17FBF626B5AED1C C&NFK
302,404,519 *1DED2658D3293A3393B2C78B8A48940D8D02F6B6 coconutchutneyorg
302,404,520 *1DE686227935B4A87686568D0D25A0B5D7E75DF7 :
302,404,521 *1DEFB5518A8DC72E98636DA3ABF69D085D1AC6C1
302,404,522 *1DE7C955FC44F6062C30FCA00CE42674EC99CF4A w
302,404,523 *1DEC7A8386C623C32E5CE2A8FCEE3CEEF9591BC9
302,404,524 *1DE353CAF1F57C35CE7CB821BBAD4433186BCB7D
302,404,525 *1DE7647DE1606ABBD1BE6A8C7979073ECE64120D
302,404,526 *1DE8625E918F3ED13A493905DE0AE7E761C98C7F
302,404,527 *1DE0DE61D6AE452347B33FE6C49CFAAA1CA3617A f
302,404,528 *1DE5C70B97D468688BE88B3307D16F4A087BE80E 4
302,404,529 *1DEAE9B8AFAED789F89D26019EB3ED1E4C8D145D
302,404,530 *1DE916C540DEF1FE306AF96E90345AF24DBADBD8 COMICLEXIKON
302,404,531 *1DE030DF869FD796090485AE8EC881E6F1CC42DE CONCERTPIANIST4
302,404,532 *1DE7A63E74FC521CE6F7A7E97117025225D92316 CONS7RUC7IVENESS
302,404,533 *1DEC4A0AFB04F837BB3DCEE6ABD50BB5B5183287 CORNELIUS.LUERA
302,404,534 *1DE9D7F9E6482D3089465DE2D8842A81341FDAD5 corruptlng
302,404,535 *1DE430141C1AE428F3FAB4C26CD8C5A987F40646 [email protected]
302,404,536 *1DE931D34B27436A70903B8FD569016451A9DD12 CP4T.
302,404,537 *1DEDBB55C87245F9B5A03FE86CDA8C75222A3CDA CRD1;
302,404,538 *1DEA80657DD643FBF2AE91A1EF5217ABBDEA0D54 11177
302,404,539 *1DECEF179EF51D9BDB0237FE69E6ECEF365DA580 1289111 klaus toepfer : der rio-prozess ist nicht gescheitert
302,404,540 *1DE0710C09B92792635974F76351B7D34D1D584B d3rma70109!575
302,404,541 *1DE9335E13A4177A0CA3B145C162DCD2EFEFF190 dakve
302,404,542 *1DE37632A53C43B435085630B5CDBBE947158F51 1IFTIKHAR
302,404,543 *1DE322E7F79C1DC63024FC058B958199E76138E9 DANKILLMER
302,404,544 *1DEEC0B58AD918367D1020E7EFE8E735A3204D01 DANTE.LOFREDO
302,404,545 *1DEA47BDB9CF64621F058B9EC8A062F182F0BC79 1 PARTICPATING
302,404,546 *1DEAA3793683EDC843997885AD9D9D3E08F2B362 daronfoggie
302,404,547 *1DEAE0A053140F5B582DAFD6AFA90717FA83DD46 DARONREAGOR
302,404,548 *1DE2F195005E5E670F68004400ECC35FC423AD7E DARONSCHOLLMEIER
302,404,549 *1DE173A6FEFA86392C7690B5E7E287A349387842 1rockradio
302,404,550 *1DEFE00960F9E7418913902EDCEBAED844F5D640 1SAUR-VERLAG
302,404,551 *1DE1347F36D7B5FB0FC39A26C8B2386B704D8115 1.soyutlamalarin
302,404,552 *1DE1AEDB64B3AF42734AC0254290FC124F31DD60 DEANDRE.LUTFY
302,404,553 *1DEA5FBDFEC1D9E46167B3B49BC908A94D4A8089 25.SHOPKORN
302,404,554 *1DE94FA0BD404DC79A0F89A2AA6F2AAFA49C6335 DELIBERER?
302,404,555 *1DE4DF3F215AB023DE7AC3A02D98AAA21E7ACBF2 DENICENEAL
302,404,556 *1DE4B934140A24A4FD517E49AAABE8C666F6517E DESAPPROBATION.
302,404,557 *1DEE4AE04374BCFAB74A59FF4D98F5044687E356 2IARESUCXE
302,404,558 *1DE05ADADBD0384A11B4FDAD42EEF4DEA4FD7325 DEWITTSFERRAZZA
302,404,559 *1DE1CBE6BA13949A48A5B8A6B3EB72E4D9A452D0 2RETPMAEB
302,404,560 *1DE4BA3B3DA0D64E0AD8CAE59D37921D9D3F6E6B [email protected]
302,404,561 *1DEC2C8F6BC210C23C50ABA7AEC0B998C6502FEB [email protected]
302,404,562 *1DE95297C7C3312E348A90FBAEEBF49A73FFC6C4 33 ELOCUTION
302,404,563 *1DE1716652E1F16929E135B4F6DE04865292DB23 384108 virusscan ozelligi bu dosyalari silemeyecektir .
302,404,564 *1DE57B4829DBA8D1EFAD12F0CF3B9EC906DAC88C DISTARA3
302,404,565 *1DE433AAB6081E623B2A32C57F921DC925F434E5 3WORSTPAID
302,404,566 *1DEFD19D38EB892A140454788389DDE20AB552D3 4REFORMIRANJE
302,404,567 *1DEEC0479ECF067776B3AA27C80E7E317B53A852 4STAVERIMUS
302,404,568 *1DE542513EA6F6684F86297F073A8D151C77D1AC 51innerstaatliche
302,404,569 *1DE50C955BF58D2C0DA1F249AAF7691280C8D659 5phrynid
302,404,570 *1DEC430550C55DD6BACC4B7EAE1DF9EAA6B2211A 5UGYANISHOGY
302,404,571 *1DE8B861FE77913E0864C3E139B2ACC3CF5F77A0 dxp3t
302,404,572 *1DED7178F3823DB1CDAE124E3EE4B1323AEBFD57 ...EAVIDACONTINUA...
302,404,573 *1DE05EB9DEC8E383C3C726A4ADADB59550B4F003 6CCOCCIA
302,404,574 *1DE0690B78804DC47D3D3256E939F9E7FE4433FD 6GARLICBOOTSIE
302,404,575 *1DE6AFE20B4F4523DDC48D35F47E9C57ADF19E4D 6iammacse303
302,404,576 *1DE88E15E06E0F3CE9C490548B64EEAEA8635DD4 6NEPONOCOVAT
302,404,577 *1DE2FCFE00EDF3F3E9372E79F22B58CAE1AC01A2 EIKZ
302,404,578 *1DE7AF402FE86DA0E85890F0853E3405AEA2C914 ELISHA.ELICK
302,404,579 *1DE716180FA2EACB6103CB079052BCCB40A9CDF9 ellen-buckingham
302,404,580 *1DEB95BB18AD3F03A1929C928CA22FB591F6205B 7AIKALAISLHTE
302,404,581 *1DE15A95E74173465227CAAE894611F64581D868 7BSWVSHWINBSW
302,404,582 *1DE0B7A0B5DCECA250C443DBD915CC449249CBFA EMBOJARES
302,404,583 *1DE814CB559893901E169742804A9B51C9CD4833 7UMBILDES
302,404,584 *1DEEAD7B38BC5C11B13E39FF3B122872023EADCE ere,l
302,404,585 *1DEAF1A96E934BC10B4FB625F26DAB3BA6B9F535 8BUPRENDORPHINE
302,404,586 *1DE114D39A8D6D22987E08ED3F485C20920A4B89 [email protected]COM
302,404,587 *1DE6C2D76734FA467919BC0B6FA28B185B960741 ESN5F
302,404,588 *1DEC83B23ADD96D9A6D90D728C5E4E7B300FB1A1 ETHANDIVALERIO
302,404,589 *1DEE46A6AC4F8A7381AED4CE156C1AE03BA40D76 etitfils3
302,404,590 *1DEFA4A7E81ECAF54B58FB2360EFB78CDB726B17 eunicebanuelos
302,404,591 *1DEB52EB9860F790EFD550732F3E72DBACCD0618 938836 bornova-barIS-gUcU-s--k-
302,404,592 *1DE2B6CD1DA8E86B14D0550B89EB06D488D70EF5 9CAIOPAIRA
302,404,593 *1DE234E872933DA507888603AA2C24420F590DAF facultymansfieldedufaculty
302,404,594 *1DEB69AA75CDD402ECFD9EA65EBBCDBB9109E45D 9FOTOSTTEMASKINE
302,404,595 *1DE4348326F652931025DE18CD02F2CE1EB326B8 fireblazinangel2
302,404,596 *1DE6F6450EB0B8F05F952D32956F72183BDDC0FC formulaveeorg
302,404,597 *1DEE87E07E33D34F7BFD44682308A6919F7CF8A7 AAFD_\
302,404,598 *1DEE49109D6FF6D034C0161F33F45C1B304AD693 A.BIBLE.AND.A.BUS.TICKET.HOME
302,404,599 *1DE898037B5B295D9EB47832CD868D1748265F88 FREQUNTLY...
302,404,600 *1DE515A7FA283C75221E465FCC110689295532D0 F!S6
302,404,601 *1DE1696AD928DF526C3F474C733E846028403E6D [email protected]
302,404,602 *1DE3C00C15F75CCE262F286E35915C5753F6481F [email protected]
302,404,603 *1DEE8A25E2027E33709F88BAE865639D4B23FECA [email protected]
302,404,604 *1DEA69BD6068ED98929230802850BF0775680143 adamdylaned
302,404,605 *1DE3973809793E33B54BF352C1386C72458143FF [email protected]
302,404,606 *1DEF16AD51EB1876B9A1D9C8DE9D621CE4FBEED8 ADMM`
302,404,607 *1DE545FA81A0CC47C8C578E13B495C8DA36D7A71 [email protected]
302,404,608 *1DE2B055F7CE0674BA8F0313D2E78A7863FE7954 genaries
302,404,609 *1DE1A4083F3181B2EF384058C0A2766D66F34BC6 GENG
302,404,610 *1DE419377007987DA5F497AC57CB43D954F1A011 GERRY.PHANTHANOUVON
302,404,611 *1DEE063483686436B3290C6402813DADF894400B gin-$aw.f
302,404,612 *1DEC8AFD7D90FDF20AB71224163C94407C471093 GLAESCHE
302,404,613 *1DE338519CB77E9ED4D7A8C405558611AE79DA22 GLOBOTRUNCANITA
302,404,614 *1DE27681D20ADD4D44CFB3C61EC2FC44A7AFD42F A!ET-
302,404,615 *1DE640EB6917F28D7CFD3D90A78ED2F19FEB7C5D AFSZ1
302,404,616 *1DE66BF8877C03949528086F726E91C5D5D9FEEA GRNET2
302,404,617 *1DE4E1A2FEBD2ACF2F04DD5866491C025B21CDCF AIRUNIT
302,404,618 *1DEC6B4B34D467508104127FF2D63CF3CD1BCB47 ALFONZOAMOROS
302,404,619 *1DE4F3B3A7A7E771A39DFB8BE975CBA49865A3EF [email protected]
302,404,620 *1DE52B92BABF092D28C92CE0A92CFD5C2A976F67 hazelmai4
302,404,621 *1DECE1E60B528948DADCE64A150F951B4CB8D33C ALQNH
302,404,622 *1DE17E27BB5AFA775B71CA1200BC1148126A50EB AMBROSE.BUNES
302,404,623 *1DE9921AA3A97F23624AC4C30C4DDF0278911EFC HELLJENNI1
302,404,624 *1DE741F47DC1D2A5D861C47454C0F9C906F6D570 AMIRROBERTS
302,404,625 *1DE5E4650E53A95BD702B055637B18470E3A39D9 antileps
302,404,626 *1DE9482430CCD9F1E2F4DD920B1DFDCF6C6F4169 HOSEA.SEVERN
302,404,627 *1DEABD53E5C6AD68FF3AD9AE5E05E6EC70FE963A hostagetakersrussia
302,404,628 *1DEC9E662D29BF2B8D8F5AB128B14B9F189ECB92 HOTELTÜRSCHLÜSSEL
302,404,629 *1DED58B06DB3EECEAA7D23202AE070DA3FFDD04F aqg;b
302,404,630 *1DE9EC0655305DB076FE7D362AFF638299114729 aqk!
302,404,631 *1DEE325DFA5C6B86976834308649EF84CEA1E31F arielwhorton
302,404,632 *1DEA7C17028C40784E8E439B8C4332A55617A0CF HUNTERPAULMAN
302,404,633 *1DE52E5053542D4D25E9474810978F6C483F748B a.,s"
302,404,634 *1DEF07EE705CA650E72E6F45387924166916E13F ICKRAKOW
302,404,635 *1DE5440271326B5B11F74CC9BDA2685E8EACFDBD IC.WEIGHT
302,404,636 *1DE02EFC515DB690B7DC6DDD7D6E267D69073DAE ID1141
302,404,637 *1DE9EA3F719FE5591031A505503DC4C856ED90E8 IDRAWRAH5
302,404,638 *1DE7ED177FFDCBC4EADC1D2708E1835CCFD569A7 b5xn_
302,404,639 *1DE49F6D2A37A84B27E45840C7A8191B1D0BF531 bartonlobingier
302,404,640 *1DEEFC7DAA4475340F3FBC81C27AE390261D8CAD be-content-with
302,404,641 *1DEEE9080265A15E7E74D7B0F891FAFDEF6816BD BEN CHOY
302,404,642 *1DE4DD2C9280AE15E22237AF6419FCBA053C6C67 janice.mike
302,404,643 *1DEC28DE628E17FE5B60D08532B2F72EAD96A5E5 bey”den
302,404,644 *1DE023E97A0E2BED70B23A71E9E2A28A1A821A1F bfgnm
302,404,645 *1DE988523FBD1C249D0B93942EC91954E1FE8FE2 BIG-BAD-BOB
302,404,646 *1DE935DDE8629EA2EE06649A56C8A96314E88972 JIMMYCANTORE
302,404,647 *1DE39653BCF7114D12C4E24628864DEA4B772556 [email protected]
302,404,648 *1DEFCBA8B4A1B9B1288573BDF9B92F45A17C41BC JO2^
302,404,649 *1DE83F7BB2892DB2387E5B18EF17E271B60080E6 joesouliere
302,404,650 *1DE3F3778575F26A9BFB05349DA335C4C665A1A3 JOHNIE.LEINONEN
302,404,651 *1DE0ED3B8F973E239FFDF7C2472732F4C1B49AD6 JOHN MINSHULL
302,404,652 *1DE12A3D89853E80897E1EE7310CB24DBBF83F51 joker1987
302,404,653 *1DEF4CFACEF17FC02EA3FD96626ABE04FA5267EC BOB.TAPPIS
302,404,654 *1DEAD8BE50442A69569B22E3492630095861713F KANTOUGA
302,404,655 *1DE1F900908DC1B0BEEF5902F47C0684BF9FE8CC keith-roux
302,404,656 *1DE7ECE97188D528B5CA3570AEE8398932930292 KELLY.FECHTNER
302,404,657 *1DE8FB83EA34DE547D94FB8271B36EA3017CA599 [email protected]
302,404,658 *1DE01A949C4808EF2142ADDFB4E10CF823699384 KEMAILYE
302,404,659 *1DE328A2F8ECCA4A715406745A521C2C1D2F0D50 briseras5
302,404,660 *1DEFC51756D362555709E26494F22E7EB3AC2353 [email protected]
302,404,661 *1DE96B3006BAF9DEFF34E692742C3C51B2AC6AC6 BRUVANTIIM
302,404,662 *1DEF2A587DF506023F28EFCBF6DF4E92C7E859A1 Kirby-Gourmet-Race
302,404,663 *1DE804A7D081DC2A601D93A497B208959468E002 [email protected]
302,404,664 *1DE3B74F7326EA7A62669E3CFA3A0DFC76AF11F5 KITES(FADEMIX)
302,404,665 *1DEC2BEAC94A423E2E54B0B1C485EAE1F48486BE kweisan8
302,404,666 *1DE330C29BE8EF1497BA12FF6E71614F6E64182B [email protected]
302,404,667 *1DED1980C37C5BFDBDB8E2F96371431AD13F67A3 c2&lr
302,404,668 *1DE7FE8F8C19524DD56C21EAB7EDCDC37DF92D22 c3dw_
302,404,669 *1DE4D7CF7AECAC55F4C60F0DE903ECC9E0BEDBCA c81?_
302,404,670 *1DE4647391D7E2DA8F7AC3ED8397045444A023C6 `caaa
302,404,671 *1DE42349FBCACC20F108B0E53C2205A099F0A1A9 CAMDJ
302,404,672 *1DE4FA9ADD9C57E6B5EC41616EC592E57B277A19 LEONARDO.KOMMER
302,404,673 *1DEDE4D5EB3BD22A5C208B1CB12F5578D24D81F8 Leon.Berrange
302,404,674 *1DE190C47F42734DFEFD4FB9A57D1ECF23916688 carlota.arielle
302,404,675 *1DE696E8A39A672BE4A3D8B08B0BD35E2211BFC5 LESTYOURRETIREMENTDOAMAZEYOURFRIENDS
302,404,676 *1DEF1F9EF7A71413F1C4622F9875F1F114371A76 Le.Vinyle
302,404,677 *1DE46B4454F3710FBA7E09453E3AB80CF1970078 LEWIS.BOBBIT
302,404,678 *1DEBC41D8102EEDDCB9FEB4C44862D0E06E60B91 cataphysical7
302,404,679 *1DEF5C861886C3D0E75FD02933F0DC4AE29393AE c_bd
302,404,680 *1DE38484BCF90640A729E4FE6B4F3446DFD30DAD listgenbotlistalphabeticalstart
302,404,681 *1DE34FD4071E710C8F85403692DA7ED94584462A literaturës
302,404,682 *1DE757037D8098009CC521BB56CEED0ED4929325 LMZRS
302,404,683 *1DE063C6937B216661D2EC9322F6510750C76097 ce/-u
302,404,684 *1DE57DA0431AC1A444789B8BD26AD7F4946898B0 CFPs
302,404,685 *1DE635C4A58A602CEF85EED10FBEA1C5289CC3FD CG7L
302,404,686 *1DE7827293803EB17AA09D0647B936EC447C21DB LUISBROSE
302,404,687 *1DED98FC1B170A13671E23F07F0E02B94F6CAE46 LUISDECORDOVAYC
302,404,688 *1DEDF744D1F9E206DF54E4F3DCF2670A3A335ADC CHARLIE PARROTT
302,404,689 *1DE9FA4E652647DE895E4D5F0AE72773ED8A8FFF [email protected]
302,404,690 *1DE6C0FB32D76189F76552B7414F89A28F640FAA LYKOPOLIS1234
302,404,691 *1DE3278F2F9E7C9E54F084B6487092EDC34E72BB CHERYL-BREAU
302,404,692 *1DE93B21E6A125E45395C65AB556B6F96B53C63C CHLOE.TRAVERS
302,404,693 *1DEF31BA8637FB4ABF61F2996547D8A4EBF8AD63 Choro-No1
302,404,694 *1DEC6BBA93EADAB4DD5DA3D761AC65A0EE24A959 MALAPATEL
302,404,695 *1DE370AD5A9FDAE89D2136FC1983BEBD6B26225B CI;:
302,404,696 *1DEBB3572A8B65AEF54F21C21B5FEAF979F9C0D8 cibover3
302,404,697 *1DE6C4FFC97707CB3A98110A25DE3E410C438136 marcelcurtiss
302,404,698 *1DEB8239F467556BF1CA1DBA86B7A3BAB37AFD9D marcelinokasuba
302,404,699 *1DE9AB043943DBD307692DD84D1502BFF8DC5AA0 MARCO.CRUM
302,404,700 *1DE0FC6A30F8961022C9D376B06AE0E59D8F2744 CL7BU
302,404,701 *1DE9C57ABC7C9A6D54BC9ECAF32A986FCF6BDF96 CLARESCEREMQU
302,404,702 *1DE455EC66C1EAEF862ECCAC159FFFE04C42F60D clay.dobson
302,404,703 *1DE973FA041305E5667BE90ECC48A7B619963CD0 mauricevanruiten
302,404,704 *1DE3C876ED2130D9C3EACA77571FF54803468D5A MAXROPER
302,404,705 *1DEE7ACE824BE9053C8C2A42FEB64676F0C2D4F5 cnd45
302,404,706 *1DE4A98A360D246B79C052EB6C4414FEF4FAD26F CNRKN
302,404,707 *1DED4A4C6A65B743C39AB867346B051D462285EF [email protected]
302,404,708 *1DE44FE4AC7D405F070CFCBBC5963E5E3922FBF6 MERLIN.BEHLKE
302,404,709 *1DE83EE434E55CC96AC6BE128B25213BAE5208BA COLESTIMER
302,404,710 *1DE2B5F0BDCACD8CEBEEBE9A6716508E3EB61514 COLLEGESALIT
302,404,711 *1DE5F4A125F0C431DC3E0C2767544F6032DA5590 cordonchi
302,404,712 *1DE1ED88806799222FE9DD3277B88A7514F5FE21 CORTEZAGRAMONTE
302,404,713 *1DEFF05926F9B6F71B3D6FB59573F3C39C690890 CORTEZ.YEAKEL
302,404,714 *1DE0B8D373FB17299BADE2216935380244D1DB93 MOISES.BOYN
302,404,715 *1DE0DC76F06643112C5EE67F7E34E485B2E50ACB MOJAVE-DESERT-STUBCA
302,404,716 *1DE2FB6B4D50CB87F5FF348F8ECD5AD7CC0A7BD4 MONTESERGEANT
302,404,717 *1DE02B10AA6F5C39187FF20F8F7A2ED0FD06AA6D CREn
302,404,718 *1DE6BAD387F6ED70554F3EF2A7C07D7D0FA67156 cryptococcuses
302,404,719 *1DEE41F1C5F11D15F2714DA2848EBE1C69BECAD5 CTREN
302,404,720 *1DE867AD76CFBD727F362FC6077938E448CCF067 CVCL=
302,404,721 *1DE8BADA236D4B98F26D8ECE81E86B833A512D9F nabawe
302,404,722 *1DE5BFBA547202EC3BF6BA7CC7A231E63FACEBA4 NAUTICAHOCKEY
302,404,723 *1DE67A1B83F947E9C1CB3CC19928E28BC4B18001 NCPTAIWAN
302,404,724 *1DE9B6B080A44476F3975A4DEB78D040F9823DB0 D1#K"
302,404,725 *1DE6512787323D2356962546B72324B2AFAA0D17 NEILTURELL
302,404,726 *1DE54F31F3A73B04FB931FD6C4751E24469C9482 NELINIŞTIRII
302,404,727 *1DE832670365BD72F43272672B99E9BD83765608 d+,4
302,404,728 *1DE077CF94E5E044C9D1C1566A51D4E99945B6B2 D9898C6CAD232125606D4CEEA5A35E41-VOETBAL
302,404,729 *1DEFAF093C6A17329E9BB9A675232BFE54FD90F0 dam373r5
302,404,730 *1DE7E8B4B280982313B049C8C15582C206180300 NOGRADIS
302,404,731 *1DEF149827374D15A0212D7776372CA59DD4CC66 DARINSTOLZENBURG
302,404,732 *1DE68A7088EB74D5712045E1D9600D32588D2B70 NOSSA-SENHORA-DA-EXPECTACAO
302,404,733 *1DE5BE76E2BC5B71C71344C43A457D39135BAB6D DAVISBOUNTHAPANYA
302,404,734 *1DEF9F8B025A5AB612F066EACDE446C9549187BC olsztynissä
302,404,735 *1DE80245B4224D58074B26AAEC62942AACF7EF8C DEFINTIVEJUXPRESENTSIV
302,404,736 *1DEF97071E0CA22FDB634FC4B8EB5F766DF27495 OPINSAANNIN
302,404,737 *1DE514CF909012FE3E9A7F50BFF265866C3EB78F (>_<) o~q8
302,404,738 *1DECB94AD20345B7E1C957A6D70EEADE8D5B43CB demarion236
302,404,739 *1DE35E090E8CFE4879F5C49EE3ABCC76492A73FF ossama150595
302,404,740 *1DEC92818021BD7371EAFA1943B88C806CF9C6DD derp6
302,404,741 *1DEBCDA12113ABB398ACD712A52C5C156D5C68BF dgp,w
302,404,742 *1DE21D332FE341E45AD9218217809413BA4F0B70 par-podu
302,404,743 *1DE7B59C46528CBAF547AAB84063B65828ED3D54 DIONLINBURG
302,404,744 *1DEA136D6EB27108352935E63F3EF656956F1729 DJ0?7
302,404,745 *1DE1B777D5FCF73FCD6E9D3B77951EE73EB4E00F [email protected]
302,404,746 *1DE31741F168600CB343DB671AA255E1F2F645D8 dj!x
302,404,747 *1DEFA9BF6A6719F09CE05FF4D83F1A5EBBA477D4 dk9m
302,404,748 *1DEEA403CCD29EA5EB0C666CEECDAA01477CEBD6 PFEIFENWINDEN
302,404,749 *1DE457E816EC6065AF4A9CE6E6844BE39E8EBDE7 echancrures.
302,404,750 *1DE96DE577A5BC773606295F867629C2C7B843E6 ECOLESUPERIEUREBEAUXARTS
302,404,751 *1DEA6BC96353BEE86FA34ADCCE0859213787EBD4 [email protected]
302,404,752 *1DE77B0E0A420F93D362F0CD2DD5D19B5CD22056 [email protected]
302,404,753 *1DEA0B9FF8172DBC31B36BAEDC90DAB165DB0A5A eev+9
302,404,754 *1DEFE5CA48C5E963F85644BB6035FB17962C86DD [email protected]
302,404,755 *1DE5B8A1AD5F9DEBB8B09C79BAEA3514DF14D534 ei,-2
302,404,756 *1DE3B4D5520D822DC0EA994E0D56AE3EC6CB49F5 ELIZABETH & ROBIN
302,404,757 *1DE007AD0C525D6736E18BC519640E2758EAD265 RASHAD.BARLAK
302,404,758 *1DE444AA0CCED906C13AD7F7D863D5B480312EFD RASHADWISHMAN
302,404,759 *1DEAF7A7E010AE26E4B6BE506E782A338281AB2B RASUPARDO
302,404,760 *1DEE94869336BD9514E4A6AC68285A04921FF414 EMENDATE'/I/M/@/N,D/EI/T
302,404,761 *1DE67704B7EADE85E5A9D70C028682486663E69A EMMA STINE
302,404,762 *1DE08D9B310E214AEBCF11BC152572674E613579 enteravariablename:
302,404,763 *1DEA8A64988069C4FBF978EDC66F9721CE0CCA08 ERKENBAARSTE
302,404,764 *1DEC0B17DB34893CCC25B6A82568D413802BCFD4 ERNESTO-CEJA
302,404,765 *1DE7B79AB7578EA1529F5865B1F5E9FA37E61B0A REPRESOR7
302,404,766 *1DE6DA87F05388EB8048053AAE7ED149EA4AAF0C ESOVITE8
302,404,767 *1DE9A6978690AC50970AB2CB788096A37ED0ACEF REVISITINGTHESTYLEETRON
302,404,768 *1DEB2A899A1C6C16E9FCE5CE6DE7E36B3427FAC1 reyann
302,404,769 *1DEEFF496EBC33850739C8ADB1FCA08353618046 RHEGNERA
302,404,770 *1DE4F639E6D6AEB494C772334FAABCC2E1913549 etsenvod
302,404,771 *1DE4F055F03ACB68982CB89C569074121F1602EC eva-maria-verworner
302,404,772 *1DEC75444E761B19CE6A8909D0067DBD599DB391 EVSTONED
302,404,773 *1DE333C77CC03E648D3C18655022E5019051993A eyys+
302,404,774 *1DE914A116F62C8907A5BC9DE003DA6BA6076CAF Rock.n'.Roll.Musician
302,404,775 *1DEF38A5F869BA6AED8929A5049891A4CBDB35E3 F50830
302,404,776 *1DE28B2558F0B14B07680453477808D3AFF79AD8 rogeliohuyghe
302,404,777 *1DE6AECDAE299A410778E7E36E34405935A8E449 ROLANDOZAGRODNIK
302,404,778 *1DE191204553BE6998F07A52207B3608BB740018 faye-brown
302,404,779 *1DE5CD00346081E3977401ACA188262A63F993EC ROSENDO.GIESE
302,404,780 *1DE06FBAEEB81C4B9A372962F202C2EBA0FF5092 felixstagliano
302,404,781 *1DE016CCE773F5B9933BC27A61B451CDE0529CA5 [email protected]
302,404,782 *1DE887BFF82CC8BB7DD1EDBA7401E713A0C90132 fogalmazni-1
302,404,783 *1DEF300BE46491ABEA42BD6634098018339558FC FOURNIRENT
302,404,784 *1DEE2611A9E9829FB6489D6436B5354AAB665B23 SAMMALLAJISTOLTAAN
302,404,785 *1DE77D7D019B21E6DD0B024D73DE976A9704701D SANDILE DLADLA
302,404,786 *1DE44C3177C3E0D9BE4D5C128B34C22B7ED7B069 sandra.goodrich
302,404,787 *1DE1BF0BCE0FE200FD05F92AA91A0E21362B85E7 SANGAVIIHINAH
302,404,788 *1DE77DA5BD9491F9825F6C1755D749E73A9DAA89 SAPANF
302,404,789 *1DEFA994C4614228AC089FE6D20AB6F4978B8E95 FREDDIEDEPEW
302,404,790 *1DE98794D123C2C3A93D49D115E7DFE1149F9906 SAVINUTA6
302,404,791 *1DEF452DCBAFD407E0F058E17DFC16E7FA68A20F seed-of-pain
302,404,792 *1DE05CE2BC8CFCFA925FDCF9C6E6989034C3A375 FUNGEERT!
302,404,793 *1DE6D7A5337970BA3E55D092ACA341E1A3B38B2E FYLEIS
302,404,794 *1DEF5AE433469F922B6E7CF84C2316B2FE4F7E98 garyparsons
302,404,795 *1DE33D38C99FC4476637064E63658F4A51255048 GEOFFREYKRACHT
302,404,796 *1DEB03C33FA8754110E8D270902DEF9F8D07977D GERRYCHRISTIANS
302,404,797 *1DE10492A6D9B3286332730C7839B01DFC53C794 GHICESC1234
302,404,798 *1DEBFBB6C1D89FF34FD5A8F0C3A136D3DD0F996A GILBERTARANEZ
302,404,799 *1DEC5EB1DD5537AFBEB1B04FEBAB77BC1FE8A472 [email protected]
302,404,800 *1DE777CAD9E7418E5F62275EEF28291B1C15A205 Smok3-sto
302,404,801 *1DEE15E4B22207F288D8E2006B52669DB031462F SMOREBRO5
302,404,802 *1DEAAFE37F34673CEE96F0810CD68CA16C0E9977 GREGORY.BERNI
302,404,803 *1DE5270FD7918BB9D64EB9D955DE25C1C1BED9E3 GROVER-JR.-WASHINGTON
302,404,804 *1DE69EE82F4E4A1BB49EFABBD70806B14B8EF6BD SQRTNSS6
302,404,805 *1DE0F6F5F745FB36177D06A55630288BD7DDAD73 SRC="HTTP//ECXIMAGESAMAZONCOM/IMAGES/I/31FT5PLSQIL_AA115_JPG
302,404,806 *1DE81ADD15E1DC99787FC46712CE6B3F3AD46B32 SREPHCAFING
302,404,807 *1DE9991DAC207B25829E1B56C5AB616EC027BC7B SRNKAMYDEAR
302,404,808 *1DE06FDA040DB1410B871BF9EDACDFCA5E9A89B1 S.}S
302,404,809 *1DEFC1A85145384BC0FFE8BACE6819DC62DF2504 HCASTO
302,404,810 *1DE4856F0CD6C7D9977C59DA48DCB65FD49F5191 HENRYSCHLETT
302,404,811 *1DE77F18155F91034ECD9E9DAB30F37045C93968 hilariochriss
302,404,812 *1DE72B5CBCA1CBA1B0C79BBB3A806ED25B77FDF7 sugge'reraient
302,404,813 *1DEB553B58C42714C3AE04DC44238E772322A0A4 SUPERAVISSING
302,404,814 *1DE42093787CAD53AD0BF4990F4FE50EBF46A6DA SWILSON13160TALK160
302,404,815 *1DE510CA0C03D357C2ACC7F2BF1F2AD8B50B5686 HUGOBOBEK
302,404,816 *1DE58FE8DB59AF8E6FBF22EE3F38101FFCED0C03 HUMEMUS
302,404,817 *1DE4CBFCBBC42AF576A19F97A49454B5FD557851 takelys9
302,404,818 *1DE01567E6EEBDA337AAD476D4EF495E137C1E59 TAPFERKEIT7
302,404,819 *1DEE7D4FEAA29D587296408D6388E92E7F9A1A27 tar-10:-den-stora-dagen
302,404,820 *1DEECAA36C137799D222B6B11BF2C873D7CEE90D TARZANCHICKEN1
302,404,821 *1DED4B8F6208695318FB2D3EEBBD740A975582D5 [email protected]
302,404,822 *1DEAD51796B375D263E31BC4376D3ED83D1514AC TAWZRXAMKCF9
302,404,823 *1DE7C06856246883B58CD739CB7DDA05194D16DB iluvstar69abc
302,404,824 *1DEE4C25299C7963617E916702008FBB737A8316 tenisicama
302,404,825 *1DECB8CFEF6AA745E9486ADF1E65ED9E96184DF2 TERRITORYLOUISIANA
302,404,826 *1DE984388966E5B8A90347A0831031B6AECF09C5 interconnection.of.accredited.ais
302,404,827 *1DEEB4D1AF5B577D1DDBA246F6786DED5D95C6E3 IRVING.BURON
302,404,828 *1DE75B9D0F09DCE651DF1B04738F8DE49ACF63F0 theballadofmariefarrar
302,404,829 *1DE0DDD25FC3E56536EBBDCC099BBCBC13F3AF62 THERMOPHAGESSDNALIGASEVERSION
302,404,830 *1DE630A2CA4F5B97A72ADDDB00848D2B8EFB644E jamespenelope
302,404,831 *1DEE73FE68CDBD6CA5F56247728F868DFDFDBD96 JAYLYN223
302,404,832 *1DE2CCD8B2B6D1585B9EBBA7794FDAD3BE614AB5 tithonic2
302,404,833 *1DECE2AD2697607EC76E2D579FE3E4D8AEF0EB99 [email protected]
302,404,834 *1DE611AF56BA25F31DEC4A531D6993C2B757330E TNEUGOV8
302,404,835 *1DE33DEB4770260617F1B4A5A5F6A44BED0A1B0F JERAMYGAZAWAY
302,404,836 *1DE90B4934EB8B9152663656E301B4F003536B1E jessica.binkowski
302,404,837 *1DEB0743D61A644471DAFE5D61AB0E313A42056F TOWNIER8
302,404,838 *1DEBC6D2F6804A26BBF23587456C39511FCBDD7B TRACY LYN HOLLAND
302,404,839 *1DE37D5F0E933D8749C75FFFABB75F8D9DB562A7 jimmydgarcia
302,404,840 *1DE78AB05206EF59037E90DB26B5B535CE1E5B9A JMGB
302,404,841 *1DEB779EBDC8A4692E06376941AC8C2F3D284602 JTRALLI
302,404,842 *1DEE0CEE00DE2530ECF53AC333F54EA4FDC2E974 juniorhone
302,404,843 *1DEC18430B832148FC0B0BB6FF099AFDECE60A1A TYRELLGENAO
302,404,844 *1DEC7D3CD2FB062BA43B260048CFEA7E3863E7C3 tysonheldman
302,404,845 *1DEBC95F0EE6F04B0C5F9DAEFE9BB25B3EBE9999 TYSONTKING
302,404,846 *1DEC2B10CCA0236CBB913BF8A35392500A961142 KAGUL
302,404,847 *1DE584F4653A0CD9CD36BC2C62B11FEE82134439 UNBECOM8
302,404,848 *1DE7489132F4AB1BD9FD5D745FE04A301D1E83D2 KEITHDENMAN
302,404,849 *1DE6628D5E2E5DC5685915D4D4E376A9CEBBEF91 UPRDLU
302,404,850 *1DE42F3853DF7B0602F15129763F3488177B4A90 USERHOWSEY93
302,404,851 *1DE085FA711D367B575417A1AC0C9B987AD764BE KERNIAH
302,404,852 *1DE7789F90D131444A3ED2833D9F166E5A8C4C4F vanderzeik.gamer
302,404,853 *1DE071C763495B58D3C31402DAA055B3733E6677 VAQSER
302,404,854 *1DE8CCE4DEF199AB20062B4159608C8637DD69CC krašina
302,404,855 *1DE4DBE8FCED74EB0329A4070A6F2106D4B53EB3 VENXIN.LEE
302,404,856 *1DED6125AD687D0328A62D161BFBD32EFF71A39F kunal-brahmbhatt
302,404,857 *1DE1AA1D561F152C85B7BEADE819EE8E44415B89 LAGYP
302,404,858 *1DEE2C10AB8DED45337841EC9D800B40B6ABA975 VICKI BARELA
302,404,859 *1DE54B68CD1F43FB6C7CC25EA76D76242C9B0868 leehoch
302,404,860 *1DEADDE114E7EC448AE58384CF54FAE96B28B4D2 le'guerions
302,404,861 *1DED1BB794A6C29CFE91E2249294D1CEF52D27C1 LELOSSEG4
302,404,862 *1DE5B38D67421992709A03BD828C7086ABEE1D6A LHEARTOFLOVE
302,404,863 *1DE5230EF167FD5A2E4DFE25736C7696AEBF8C85 LILIANAMONA
302,404,864 *1DEC415D5671D93001E863A64B5BEA4B3B999C59 VRSCHNNNS
302,404,865 *1DE3CB68EADC8623F6E4646B0E3A504B08270744 LISA-HUKILL
302,404,866 *1DEB21509BA684800EEF5DAFF9CA31801357F760 LLLGCAV64
302,404,867 *1DE8E4024079304D25199EC36BA53C035A7DD4FB WALZENSE4
302,404,868 *1DE53369C17E63B0846CDE05182F55ACA602DE82 LOGANMOSES
302,404,869 *1DE39D85871FE60B5BDD3CA2E187EBDA09D520F0 [email protected]
302,404,870 *1DE8628207D38B5381561B0D694BBB5D60BA1BCE waynehorvitznetwww
302,404,871 *1DEDA5F9CAAB5BC1E01A6BA5A2943AC122EFA2CB WEBB-SKINNER
302,404,872 *1DE196D1B8596067B4926E75F828E3076F2584E6 webdezgn
302,404,873 *1DEA910AF5ED8B58926A4BFB3CAB3B92C1A6BA04 weflyhighballing
302,404,874 *1DEFAC383477B963EEB4AAA057538C4D84BDA8E5 WEGE'S
302,404,875 *1DE875124F0981B4789797BE3703EB0704716B1C L)PF
302,404,876 *1DE6F0DB325ADE48A006E78FE51B6D6D0A468AA5 [email protected]
302,404,877 *1DE7FA7A66408D67ACB0349CBD87F5E5294FD201 LYNDSEAMY
302,404,878 *1DE34420725C3BBB38951E8D1E8050D3525D5E27 WILBERTIMEL
302,404,879 *1DE48C75F6443D55714B30986FDD200F854B8800 m4gnet0gr
302,404,880 *1DE5913255132C76B8E92411EFC95FF6FBC1223B WILLIAMSMULA
302,404,881 *1DEF6EEA769C9F7DB53B314B5B1A66155E7A7895 WILLIS.GONZALEA
302,404,882 *1DEEF51326B473D39D3A39A8A7DB713A435609CF WILL.YOU.MISS.ME.(FEAT..PAM.TILLIS)
302,404,883 *1DE9EEF97C9D93155DBB87AB1B6FF52DD74848E6 MALCOM.DAPRILE
302,404,884 *1DE18F4DFC704B6460D790BF52F2FE24527CA8F7 WINDWARD SIDE
302,404,885 *1DEF09CE52C19B7F72D262C1982FAC0275D9CB0A witaslittle
302,404,886 *1DED064241F6D84C575DF7D440355A154EB31FAF marcelinopere
302,404,887 *1DE50CF80EC5B6D81D71CF164CFF625616E5A7CA MARCELLUS.PINTEA
302,404,888 *1DEED2F1BF7CE19BB7445E7389933660E9904469 Marche.pour.les.Bergers.et.ch
302,404,889 *1DEDAA138C63CE452FA5D4AFEB8181BC5091A52E WORDSNEVERSPOKEN
302,404,890 *1DE3414D5C4D14A1ECE5578E07D8C87526A0ED8F MARIACIRCOSTA
302,404,891 *1DE8D290C44AC8CF3DD4B4F9B713D1F42CDBB6FF WUOBSALV2
302,404,892 *1DEE937FA4E7AAD789838B2160F765AD1435184D marseille,-c'est-pas-la-france
302,404,893 *1DE96BB6ED543CB55C1CB4DD4FC9A47615991719 MARTY.MEITNER
302,404,894 *1DE05E31647C43C3BB1BDD8EA4947B2C64E74302 [email protected]
302,404,895 *1DE2DF14D4122699F9CAC3D36354D9B6B648D45F MATERIEN7
302,404,896 *1DE0C5EDB361ADA171567FB03CE716BDCCFA7AF2 MAUSSADERIE9
302,404,897 *1DE03FBB7D3789F6677B682F566FFC044F8B287F [email protected]
302,404,898 *1DE5D8E998031F91AB1FC534ACBB69131F45BEBB [email protected]
302,404,899 *1DE55F414D1F68FADA64CF2A13817EAF24472187 mcgrattaning
302,404,900 *1DE68B56E9BF45E6391903A49E40374F6E8AB423 [email protected]
302,404,901 *1DE62AA4A8F691CF0E2A5FADAB7B63856A57FBD5 XJS-HAMID
302,404,902 *1DE3D4A56843A01D8B46AC0F5E94497E969E1D30 [email protected]
302,404,903 *1DE3799C163949CA59E90A030213A91195C1C336 M"ED
302,404,904 *1DE959C13B336A8DFE892310EFC176B41E7D51B8 MELANIE.ROLDAN
302,404,905 *1DE80E53448FD4349DE68EB5E4E9347BE2D799E0 MELVINKASEE
302,404,906 *1DE238A82EB16CA8FE8816739370E3E3D4CB5AC0 MERLINJANE
302,404,907 *1DEE3751592A8B91C0D1F894AEA2D3C3822AED32 michaelsomers
302,404,908 *1DE5AB62EA34063555DD822C945E720EDC49A99F MICHEAL.KINNA
302,404,909 *1DE218C2633E5C6109BFF2AF0D655793AAE33160 michellalbert
302,404,910 *1DE5940DBD33EB07C4EC8143D39E3728728B9590 yamamoto.yuichi
302,404,911 *1DE3E82C642516D9618BAF04D62006DDCB6B547B YAMILE.PADILLA
302,404,912 *1DE76C0C91DA7F6412E939D0DCB2BEF894B9D95D [email protected]
302,404,913 *1DE30732D9F462FF495F9F33682E16B7E86660F1 midnight jam (disc 1)
302,404,914 *1DEB7478EF6C934C0A1EE2B43C75E90659A19228 [email protected]
302,404,915 *1DEA5CBA1F90518B0D3FAC8D03FF7DDEBB30C688 [email protected]
302,404,916 *1DE0F3CA0D4860ECA1BE8A9FB4045699210CE710 minhchochrek
302,404,917 *1DEBC4141D314EEB8ADA099D253FB7CBECD58B53 YLGNIHCTIWEB
302,404,918 *1DE0D50F57AB2A462A0EE162541D484B01EF09DD yorimichin
302,404,919 *1DEA8EAC04E247BFA8B4450F3D4041391D2752E3 yousofra
302,404,920 *1DEFFFC82321DB08BAAFD40D16A5A450E2FF3261 [email protected]
302,404,921 *1DE9788481759E525DCF6B4DB37B7F90A0D30D18 [email protected]
302,404,922 *1DEB16154E52FD43DFE528BF1DEBF3256BF327EE MONIKAANING
302,404,923 *1DED412A9161F968E339D11AEDAED45A361CD1FA ZACKARYPEPPARD
302,404,924 *1DEB8090F3417C5BD1623A2BE815FD1A83E75A84 morrowind626
302,404,925 *1DE34CE0A299FF246D93E6EBCEF60BDD817AC777 ZAY-EL-SOKAR
302,404,926 *1DEB7015C582A76DDD16D56D4A21139162E0B7EA ZEALKOKORICHA
302,404,927 *1DEA1372E4A916503097A64FE81AE6B1BC35580E [email protected]
302,404,928 *1DE8C4D4D0D2A1654101E403991D6067353A6B8B MQUAMI
302,404,929 *1DE2B555098A3B65DBAD7CA32B52CE579F20BEF9 MROLEK
302,404,930 *1DE4B63BC0A9C3ECD41F662E3DEDCEE77C8088C0 MSEMENIC
302,404,931 *1DE0F6A7F08CAB0540FEE3C8CE3DD73998977B74 ZOBAEDKHAN.UP
302,404,932 *1DE5664A6189299E6F96E177A590C82B2440842D zollner-cotea-claudia
302,404,933 *1DED9554D62E51AA52D9F87182A5A8F660091783 ZONJA-DE-VILLIERS
302,404,934 *1DE4B4891A1E87B25150C85FF9FE0B051E96D07D ZUNDARMAA
302,404,935 *1DE50361023CADFB8324FCC62B2E85DDE2A1B908 ZUPADGCURABBED
302,404,936 *1DECA2FB7BE48BBCB80FB50AB0AF65533288DABF zvrknnrs7
302,404,937 *1DE7F66764140E3988A821F3CD3D1E7706027D41 zyhranavarro
302,404,938 *1DEE215F6A20675BDE0C546DD072FE82D8854681 MYGRETCHEN8
302,404,939 *1DE4D9385A0770DE17397402D4EA0E9618517489 ΜΠΟΥΛΝΤΌΓΚ
302,404,940 *1DE5FCD25D3E68B4C1C8B702A6E63C1C1FDE9639 АИСЛЕБЕНУ
302,404,941 *1DED7FC41A98BD86C4829ADDEC029C28513767D4 N34rc0l0
302,404,942 *1DE66DA514D7AE042C198B781EB17D6ABC9E781C N+3E
302,404,943 *1DE87E7E8B2DB3435F5F5D304A6CF897ABBA5244 горбовцев
302,404,944 *1DEC5DB8120A4A276AE1C3C037A4E133AF180AD0 ГРОДАМ
302,404,945 *1DE2B09C0603ACEE228DF6F78E88632B977A29CA najundeshwar
302,404,946 *1DEA62640711CF030CFAB9D2DE483BDD196D8EEF –ДЕК
302,404,947 *1DEDA74C72F030525826F8A3D7200E2F07D681DA ИНТЕГРАТИВНОСТЬ
302,404,948 *1DE2E91A3817DBD7CAD52088FDF890B20AD9D5E4 КАТИЛОСЬ
302,404,949 *1DE0B2DF5B16908F03661F8A000787124D2DA11B NATSIPUUKKO
302,404,950 *1DEB406DD4E81C03E8E3A7B8EA65E1D8A74269A0 [email protected]
302,404,951 *1DE67D8B701773C7F883EAA03841D5DA989BC906 силсо
302,404,952 *1DE8D48C6F4966F00D785444FF497E6C69E40498 NESKONCI
302,404,953 *1DEBEBAD512D9D9ADDE2A3FF7C04D6262EF688D1 шавлива
302,404,954 *1DE34CCB4B732693EAF1245CA9112D3C4795AF8E NIEDERDRUCKPLASMEN
302,404,955 *1DE3A64D1DB3C3DDCB8AD3BFD2DBFC651886653B NINE-AND-A-HALF-BARS
302,404,956 *1DE54B5BD9804BFF497A6695311DAC3238EBB1D4 [email protected]
302,404,957 *1DEA0731AC4D39F8DD273961933DD4953BF4649A noor-azlenah
302,404,958 *1DE099F4FDABE0CE674DF13C3D1E91CCF8B27D5F [email protected]
302,404,959 *1DEDAA8F1EC36A1A5A2C9DA641A096FE57E02758 NSCTFRS
302,404,960 *1DE0F395FB94C4D9EA7C892429FFC97B28F71304 od1ghcjuw6lly5
302,404,961 *1DE53A19087BE916FE875CCBC99B674D033D5EA6 OFFTHEPIRANHA
302,404,962 *1DEA4EA27B4A66D72E5E7934EA8BD9395463FC84 OldGirl(ShiningStar)(feat.Melanie)
302,404,963 *1DEA05C336E94140DA9247006C2F8C1000CCBB29 ol#w
302,404,964 *1DE006F9355F43BA650475FFA56262381EB65120 onemorechancetorun
302,404,965 *1DE8FAACFD69F3C1D45802AC1E71B1F33765CC74 ORVILLE.IBRAHIM
302,404,966 *1DE631337EED781B42A934FC9BBFEA9E2F7094F3 oswaldo.archundia
302,404,967 *1DE9551C7600D4314C74628C4566A215C9853F22 OTCHBSW8
302,404,968 *1DEFD367293769344F495D46B3FB95606D60291E 给xx之歌
302,404,969 *1DE2B15663C2CF8C6DE6429BCA066EFBB4BB3E66 関東大会vs青学戦時、s2で不二と戦い覚醒し、「
302,404,970 *1DED2C1D73ADF1ACCF312DB73C481AB60F58FCDC [email protected]
302,404,971 *1DE2AEC5D98956876341777AEB8325317EA5C878 [email protected]
302,404,972 *1DEDFB50EA995112E384EE9792610C95EAD1F801 panslave
302,404,973 *1DEC573E4C79D0FF2B423ADB7CA179670521A10D pasqualepuppo
302,404,974 *1DE126E2C36E017AADBBE289661134BE7B86965F PASSAGE.DEVOUTHERETI
302,404,975 *1DE6ADF913CE7BB646C191DC1A6B65CFC68082B3 PATAROT
302,404,976 *1DE5622ABB95028484B5336C7CF08F0822D16619 PATRICIACHARLES
302,404,977 *1DE8ABC1CC1E5DBEA72B4A2EB35358F458EC4C40 PIGOLASTING
302,404,978 *1DE241B9CE07AA1221C476EAFF8E01E50935B1C8 10ASDF
302,404,979 *1DE1BCFB95C48E8BF2F1CA0F197C9E6990CA7C34 pithariagef
302,404,980 *1DE6D67D5609C3E91C30701C1E07BCCAE954684D PK[email protected]
302,404,981 *1DEED816DCAA2F4C4E70BE83B653ABAD4A4B2554 PLAYDON4
302,404,982 *1DE9FB7B453BC7E710D35EB65C40B2E204C16344 1279394 steen.glich.das.der.landshuter.aus..
302,404,983 *1DEB7E9AC75D64ADE724FC643EF5E51B303C47F8 12skonka31
302,404,984 *1DE4BCC2A0C0C8263CA25A4056993F7E2258B0AD [email protected]
302,404,985 *1DE30AF3E0D6D21208250E057F099A8B935091E0 p=====)-~o~o-splat!
302,404,986 *1DE5289C0FA0AB15D84E8BE00E79680D47CD858F P=====p`~`~(0_<)
302,404,987 *1DEF32AAE4410A32226CA9EBB13CFEBBD167BF6E 13fastestmoving
302,404,988 *1DEEF20468A98A77272B21DCD5BA8206B70EB4E2 1405256 merkittiin.tiedoksi.etel
302,404,989 *1DE5895A0C47FEE5B1EC307004559CEE930CDCF9 14111177
302,404,990 *1DE57AA7C6FD06546902C31890316FD60815DAB3 1608044 ITSE ASTUVI LIKEMM
302,404,991 *1DE03B938318ADCE749F32115F32988BC6D37F64 [email protected]* * *splat
302,404,992 *1DEBA59ADBDBC54D75F3C60F14AF5EF5E22B2516 17.aushandelten
302,404,993 *1DE8CF862D382CEC8F9740E32617F7AD7300412D PUCCAYSAKURA
302,404,994 *1DEF64F84FCB664DB0FDA6671BDE4C140650AC2D #Q(!0E
302,404,995 *1DEB8DDA0C126E829A0A0DEE3740EA2AB0607258 19AUGUST1963
302,404,996 *1DEC0DA2DDC7A86BC9BB50B4A2CD691943E748F2 1AF0CAB3
302,404,997 *1DE09D43D904B27DE30582175FB25CA81315E66F 1 AFTERFIVE
302,404,998 *1DEFD9480205619F281E67DD6F7155D4C8107493 QPALMORE
302,404,999 *1DEF48E671A956CF5046CBFFDAD8E3D6CDBC3D44 1awerich
302,405,000 *1DECA7A73A0016B5AA4E4FF7077E54F3DA15B46B 1-BEDUINENMENTALITAET
302,405,001 *1DE1BE8031289305694C47FB3CAF34AB89EA2801 [email protected]#$%^&*()_+Q
302,405,002 *1DE2A2B9FBD801F078D73487E21C91D0AC708DF5 QSSTN
302,405,003 *1DE6C1E51CF6F705F04CADA53137FFC584AD8D4B 1COMMERCIAL-SATELLITE-LAUNCHING
302,405,004 *1DED356065886D06D876555C1AB1224D343AFDDA 1 COSTUMES-FROM
302,405,005 *1DE2DA939403D09816B8AE25F29F35A7E2795412 QUHN4L
302,405,006 *1DE0E8F57F7A7E0E0E3C022225B2CE8322333E5B QUINNSZALANKIEWICZ
302,405,007 *1DE713B7C58D76C5AE6655D172A3D51F457E08A0 QUINTINMIYARES
302,405,008 *1DE3678B3BB03D99D8830AE4F999CCC232AB07AE 1DOOSE
302,405,009 *1DED39CEC8EF2B35E7E890261E17C3BF47A59522 qyhq
302,405,010 *1DEDC88990A0C5EB67023BAC2E9ED7CA69D448D6 1FEITELSON1234
302,405,011 *1DE29A4EDC0B8014D6130BF11C943EC52B03CE7A RAGUWATI
302,405,012 *1DE09E3241B96E95BEC753C3EF1416E41D63EC12 1.halatlardan
302,405,013 *1DECD4551CD915C9591A7F4ADDCBC23D1B03A86D 1HIEKANV
302,405,014 *1DEAE06BD85B3EF8FDEB6C64C4B420E0C0216E38 1-inertialukitus
302,405,015 *1DE9366179BF2990B74666F07D05B614B5A94D17 1jahr-juzehnte
302,405,016 *1DE40237BBC499481C37DB9571486EB645744958 1-kampanjaosuuden
302,405,017 *1DE8310592FD5F0487BAC4B06DCD8E6FA6CCA728 1 KLINGHOEFERDREIECK
302,405,018 *1DED9DABF29A2F5591E4206C7C36780320E8A657 RAYFORDISBELL
302,405,019 *1DE60DA79DCEB60E6570735AAE30231F28BC4E4B RAYFORD.KAHALEHOE
302,405,020 *1DE78143960C49E49141D266BEC83EC2E7972266 1 LAHJONUT
302,405,021 *1DED5DF3AD6336D04DE80806FD3DA1FCE9666EC1 1mansetleriyle
302,405,022 *1DE176A35B6CCCA0C3A6B634167E7E654F1EAB47 [email protected]@[email protected]
302,405,023 *1DE856CACAA46417A9144924D3ED8799CA9F1430 REBEMADRIGAL
302,405,024 *1DEEA4078A47D9DFB97A9EC826BBFD8A05E25F13 1NWRIVORSITZENDEN
302,405,025 *1DE891553E1A3FC75AC5410FA8DA903F85BD34E4 RECL4$$!F!C47!0N
302,405,026 *1DE545FA88E51C99CE8CAF5DE037469A25B1D932 REDODONE4
302,405,027 *1DEB70F1775D7858607524EE429D652A8AF71903 1 SAYISTAY
302,405,028 *1DE63590C171930495E078305C8DF05697B14140 REGSTREEKSE3
302,405,029 *1DEC81DC3FFF866180834226417F9165B1273823 REIDSKOW
302,405,030 *1DEDCF8CFF59338367BA4173FC3A2909F465A6CB 1SITUMBEKO
302,405,031 *1DE5D7EAA08B6DF47F950BEF233229C5BEFCF21E 1.SPYPLANES
302,405,032 *1DEA47CB2A4AFD474450E8640D7F7AEE7444C180 1-three-door's
302,405,033 *1DE955EA5553965A16935295B08B3E3FA4DC51B8 1-tiedet
302,405,034 *1DED550EC8AE6C683BBA429EAD7CA1F259971EC2 1-TREENIKAMAT
302,405,035 *1DE0BFCC0DDD24220F8124618B99D6B826C1171E 1UNDERGARMENTINAROSEBUD
302,405,036 *1DE2C79085004374D315373E7DEAD43F4C773379 replicirali1
302,405,037 *1DE6D3747DE52CD4A34A738AE87C26B00C8B0BCC resonation?
302,405,038 *1DE9035236D48CC73A6CDB7A908B87C501CB8470 1WARDHAN
302,405,039 *1DE3492D28DC8EB8D914FD3DEAEADE88C8D50713 2007sox
302,405,040 *1DE73E721A7DFF7A52192CB4C879C4CC061313B6 REYNAROCHA
302,405,041 *1DED56A5DECEAD9388D117AFD2F974C06AD58BBB ricardolaudeman
302,405,042 *1DE8F11D2A81BB06A2ABA6CE643C5B5B202F9D42 RichardClapton
302,405,043 *1DE6DAE744FCBA9C307DC41E29CE29AE79C29657 217JONATHON
302,405,044 *1DE0CD01F467F582353218E7B5463F9DD9D19D75 2226912 KASVATUSPSYKOLOGINEN TUTKIMUS 2 OV 13
302,405,045 *1DEC1D3BAAD43E7FBA5C8FEBB285C06CA21B1AC0 233f・255f
302,405,046 *1DE89AE3567730369BDE2C8AE23A851DDD3907A6 ROBERTROEBUCK
302,405,047 *1DE75536DC1AC4F4DB4A60A696DD1DE407088A05 2616119 TUOTEREKISTERIINANNETAANTUOTTEIDENPERUSTIEDOT
302,405,048 *1DE933A10DBBBF24E2DE32C23A55C35A6DCCCB6B 2670871 SUORITETUSSANIMENHUUTO
302,405,049 *1DED4FFA42D6F913B7125E6712BA777D75484205 2726566 vastaus maapallon ravintoongelmiin n
302,405,050 *1DE7E98A40297BBCD9F30CD03540A362A335C860 2799835 he-was-attacked-by-sikh-extremists-last-month-.
302,405,051 *1DE763DB9BDE4224FCE99BC27262177481F5CED7 ROGER.DAUGHERTY
302,405,052 *1DE7178D0D489C4B83C6CB07956505BEE5F95AA4 rogosich9
302,405,053 *1DE938067A7C5C20BC70072B2BEFEA4B2A319F66 ROSARIO.LALIM
302,405,054 *1DEDA328DA5A2361F460E7B52DD9DB2FCDE49D39 2907779 aionlaajentaamy
302,405,055 *1DEFD1264332E6F5951AA197E7459C1D3FF26C52 2910626 SELVITYSMIESTEN-EHDOTUKSIA-ROMANIPOLITIIKAN-KEHITT
302,405,056 *1DE2F5844AF388F61A1F6172E99E18B9EE7FB695 2948597 elintarviketeollisuudenarvonlis
302,405,057 *1DE7B1BBD6FBF5E444121980B6A42C9485B1047D ROSS-CRUICKSHANK
302,405,058 *1DEB51F37A7B2D8A4C10182EF16E19DF7845555F ROTARUK5
302,405,059 *1DEDC751A93794F3090AB6DFD48193CFEF61C4D5 royaldambach
302,405,060 *1DE7D2541993621111614EC1A65144625365F305 2-bergknappen
302,405,061 *1DEA30CD6066B63C77C8EB6AEF244E58C5916EBE ROYALMCSWIGGAN
302,405,062 *1DE9E3BB9DC14FD32F45F29F752CED8160A49078 roycevenghaus
302,405,063 *1DE11DF355C5274FB9161199812A60D96FB7D8AB ROY KNOX
302,405,064 *1DEE16F85FC49CBCEA93366B56DF32545E844097 [email protected]
302,405,065 *1DE9A43E2B8894CAE9A1F67B75F8E165A048F904 RTABAREZ
302,405,066 *1DE02521D80D5D3B922D14D49E81D81E1874FF23 RUDYWILLMORE
302,405,067 *1DE3E87F34B8FDF17CF126F99458B741BEF8BEA6 2f003030767
302,405,068 *1DE6D02A353E6C7E933EBCA12479200AAAE2261F 2iamfountain9
302,405,069 *1DE68004BE83CAC8A37CD5F5F799E44C075CB298 2KTTYLIS
302,405,070 *1DE7B960B2FBD7635FC1E9B098859F988DAB5E1F RVEITENHANS
302,405,071 *1DEBF18BC793977B4D82931496DF78CB265D82ED RYANTIPAN
302,405,072 *1DEEEDCA8C4076C29B1A23998746C86ABCFB43CB 2-parallelisiert
302,405,073 *1DEF6549FEDF5BCA1208532E4B14A15EF414DFFC 2PARERAT
302,405,074 *1DE466D8AA4A82895AAC8C1B19801D4AC3C7A677 2 PATIENTENSEMINAR
302,405,075 *1DE7C7F80614BA0A5C7F5553DA51EAB3184D84B1 S:ACTII,SCENE1."EHBIEN!FAISMOICONNA
302,405,076 *1DEDD6329E35A58B764CB34AE5753E4892801AD0 2SHVONTZ
302,405,077 *1DE085497A797735867FF167BEA884C69443BEB0 SAILORFLIP5
302,405,078 *1DE66E20046E84609F760B1095C5933D3F69618A 2-STERNENEXPLOSIONEN
302,405,079 *1DE59FEEBD59D73724F180C78FAE640B0A8B1AB1 2.SUOMI-KP:IA
302,405,080 *1DE42464E315A0C6987C4CC98895920D091DE096 2.wagniskapitalbranche
302,405,081 *1DE1C22B40DEF98DE91D4480EA72B66757F3CB58 2.yhdistelm
302,405,082 *1DE05B0346C6F2372D59DC8679D6ECD79D7B3F43 30.ste-croix
302,405,083 *1DE9966BD5089DD53344DB9EAC3F62D1C466E5CB SALPIDAESED
302,405,084 *1DE72D36BADE640773BD36C23E127821F751CA4B SALUTROCKET8
302,405,085 *1DE195DF589ACE63C323CEE0C313CE3F73E31D89 SALVADOR.APKIN
302,405,086 *1DEE2D6AC9C17E2FEA79C5AAD35C9A675400DC30 SAMBASKOLA
302,405,087 *1DEF17F45C028567138302972CD0F395C54A2B30 3BILANZIELLE
302,405,088 *1DEC7B00778FF6876F7C4DAD3736AF1449AE0011 3DAJZE0QN17UXM
302,405,089 *1DE14A6CBDCBE38FCEC0D8E3C1D2B3064157088F 3--d-`~-`~splat!
302,405,090 *1DE7F70B8BD38524908B24C1E44BC32CB421F72A 3 HOTELLIHANKE
302,405,091 *1DE58F2AD2EA9CAFA6336B37264455BA47087383 3ILUVPIGLET6
302,405,092 *1DE03C1B68F361641C3B8DA8CEE7D730AA702B56 SAOBOSCO
302,405,093 *1DE438ED4530593242C052DA4FAF550CB69CCDD4 3 MAFIA-MILIEU
302,405,094 *1DEC9F34E9932037C675DB5544809DA66C8908B3 SARAHJSBACHING
302,405,095 *1DEE6043307CB6368215659B90CFC4EF1D65048E 3mittelmeerkreuzfahrt
302,405,096 *1DEB14F058F7759AF64214FF9EC5A7B9F437B156 savanna.murphy
302,405,097 *1DE8400AF270674880F05B36BCAAD768C2DCEC76 «saxhorn»
302,405,098 *1DE644A684410C145002280313930943F9A5057F SCHELLONGS
302,405,099 *1DE9AC0DAA7BABBAEAFA5D88007CA062C94A02F5 4EGADLAAB
302,405,100 *1DE5F875F3A8F77A683BE77D3EC7F1B5EE0178D9 4JEWELSTHUNDERB
302,405,101 *1DEED34E5DD097338B8C3CEE67AA9930DFC47EDF 4-koruklerle
302,405,102 *1DE1F784BF7D7165FF8A2DA3C00E2B5596574368 4MYL-$4LI
302,405,103 *1DE401DF2237A108AD525256DFC96D161AB00F0C 4NNEPIEOR
302,405,104 *1DE37F812FC688571F33F0B869A9426EF8FE4CA5 4PEEWEELAURA
302,405,105 *1DEFFF7DE1FD87843F9001FFF1176A838C5F93E4 4SINEMUS
302,405,106 *1DE28A513834D826D4B67611889459179685DF70 4WMEMALL
302,405,107 *1DE086D37DB10BF6BD10057D8EF31D441558F4DD 551122 BU-NEDENLE-AILE-OYKUSU-COK-ONEMLIDIR-.
302,405,108 *1DE9BEC5B30756C230FDA48BFEEEE9A06A9B7EDF 5ARBITRARNOSTI
302,405,109 *1DEA8E45BDD3A05F46E197DA42E0185596FA79E2 5BSWENIGIROBBSW
302,405,110 *1DE9C11273F069CE270479B1DF7EFA4C2FF99FA8 5BSWSTEFANBSW
302,405,111 *1DEF5B7CE24E4E5EFF85814972B3C366F3250EC2 5GABYTAFFY
302,405,112 *1DE645341F9A0960E15CC60A22569A3210BF083E Secrets-/-Very-Fine-Sports
302,405,113 *1DE5F5E39FA375BC6092CDE6943C0BEB2521BE07 selliuorrev
302,405,114 *1DE7BAE4B6856787FFF073D765923CBEBCD43022 5NEILELDU
302,405,115 *1DE5B1C78A43E3FF5E37689CAA8433C5416569E2 SGNISOOMAV
302,405,116 *1DEE5CA8A6B8DD528962B5FDDADBD5BA10542E55 5SPOTICAL
302,405,117 *1DE4FA21E3F70920580A7D4BDA71623A494917ED SHAWN.TIMI
302,405,118 *1DE19CAE72DDF34FE1A3DAB05145A4BEA730DEB3 5thegroovy7
302,405,119 *1DED69BE36F39DF308EE6168C9AA160B5DFBDEB5 SHEILAROBINHOO5
302,405,120 *1DE1A1A6BA8A241CE15A70FAA85D564BC143760B SHELDONECONOMUS
302,405,121 *1DE12D4CE4AD45B606A637879F1016F1ADB688D4 5UDCVIQSQIMPWM
302,405,122 *1DE7E41AD740934ACBD497E7C4F9B680A9EE0C34 [email protected]
302,405,123 *1DE375526F2C9A017E614B370B5051F57BFBE3BC 6:--6---#---&---usda
302,405,124 *1DE1D3448F25A254D4F2F3F0FF63541EDBAF9E81 shondenver
302,405,125 *1DE9AF6E3FEB3F2685B6A5A8FA3C05C74B9A9AE3 siarercal
302,405,126 *1DEDB7B327AD7E66417F78A2E664035C7CBD4FCD 693184 HIS SIX JUDGES SAT IMPASSIVELY .
302,405,127 *1DED97E7CA83E1B31B596884B3CF58B1D2A75C6E 6AANTEIT
302,405,128 *1DE1A5B574CAD4120FFECE452F40DEE0A062E316 6APSTRAKCIJA
302,405,129 *1DE27D582CE677AE306F2F6D42F5D50FB88605AE 6BEAVERWHISKY
302,405,130 *1DEF4E59E9A99F2F850F270B11D1A7A62F53FA2D 6BSWAAEEAACCTTOO
302,405,131 *1DE9B7A27C9DD3BEDEB90EB408598970F601C19B 6elementarism
302,405,132 *1DEB2717CA92C67E14B4A332FFC9EA5200AC7840 signflipped
302,405,133 *1DEB40DE84636F7D53754A217C64F2466F358527 6parlerebbe
302,405,134 *1DE99F430CF2D81151F34C7CD82D25C609A62581 SKINNYMODEM9
302,405,135 *1DE615EDA781165CD93369A239EB3E7927F2225C SKINT100CD
302,405,136 *1DE782118A639511784A9E91B2A759CD93C356D4 73.GEFRAGTER
302,405,137 *1DECB39384AB0611F843A75716EAF8B036581880 752308 suomessa on tarvittaessa teht
302,405,138 *1DE4A2E16AABC04379E6930668DDA59077A68575 SNEKETSG6
302,405,139 *1DE98CD75EC4F1DBDD9D82188487220145635414 SNIKUUYR1
302,405,140 *1DE4B31C14153F2D953A1F64BFA51CB1E515FBC9 snodnet
302,405,141 *1DE7838C9BA87E2F42C8B212AC5E2E9D147666EF 7CENTRISTE
302,405,142 *1DE9D6279743F81D75EA1BC6C5A4FF15BD4069A9 7EU-DIENSTLEISTUNGSRICHTLINIE
302,405,143 *1DEEE06CA1EDC7CEEDFCC8F756D9B31B3E24537F SONGYUNL
302,405,144 *1DE5786418DEDF5745854483B5AFD977C013530C SONIAOUELLET
302,405,145 *1DE8E32AD9AAA00A1BBF8AEF9237E892F59C24E3 sonne.(feat..junior.randy)
302,405,146 *1DE5C7F4C40DA4A6CD822D709FE89B732E83AE5D SPANNUNGSUMFORMER
302,405,147 *1DE9F90C23D874EE34996AA395626624FB778B0E 7LUNIVERS
302,405,148 *1DE6B0732D0FC2CE5A9F2A92B638768B16612011 7MIRAGEWILDCAT
302,405,149 *1DE220B3ED626D7A8E665578C0A8D1B231875645 7noninterruptedly
302,405,150 *1DEE53CB6716BD7D2E4C463A71E5E33241ABBBE1 SPIGA18
302,405,151 *1DE99C3937504D7A2096E1492A2B2A4E75154951 SPOORTSFA
302,405,152 *1DEC2911473457AC4E753957C8F843572793BD20 7SSETLIKE
302,405,153 *1DED755BBCD63A2F7685CAB8C58E7352097447FE 7-SURMA
302,405,154 *1DEE20B736477857B949A506BD3897A7A85C4A19 SREEDEVI6
302,405,155 *1DE4062572F236AC2754B0ADCFD8176A24A9E9A0 SREKCINSEVOL
302,405,156 *1DEE88A6D105D62D84C7B1D6ECDB1A69402CB3D7 SSA-[double-essay's]
302,405,157 *1DEB0462B59558001998E7849C3641CC2F2683C4 SSELEHTY
302,405,158 *1DE6421029A83612157F98F61BB8E74AA1330FDC STACEY.CONTRERRAS
302,405,159 *1DE0E26F4EA225D7FDAC536802BAAAC8D371186C steadvegkilla
302,405,160 *1DE4A8DA5BED28C5B2E0460C077809723A987A4F stephanie-suhr
302,405,161 *1DE0B6CEDB21BB05E62CA9BCB0D62E8A47A69F18 STEVE.CORIPPO
302,405,162 *1DE22C79EFF8D945B01B2225F5DF42BB98E2916A STEVENETOILE6
302,405,163 *1DEBC8BAA607971728C1B26838E4495EBAC8FBC0 STOKKEBSWED
302,405,164 *1DE72C0B869D019BB53930685CF9018D3CDB2329 833quentin
302,405,165 *1DED7121C46A190F6A275FD70447DB541CE62CAD [email protected]
302,405,166 *1DE0326804C09B0E42496FB7D40A89AA44E167D1 [email protected]
302,405,167 *1DE37B920999E66F625F1D9108D3C737A39F344D 8CISMONTANONESS
302,405,168 *1DEE96DDC57BCA1524AB19415DA014215CD11DBB 8DHARMISTHAA
302,405,169 *1DE14F238759AC89D670F5500C34C1634E3B2177 [email protected]
302,405,170 *1DE4C38207238015D0BA4AF454F467AA0A12D415 [email protected]
302,405,171 *1DE33D70B12226B520BB1EAB9AA7B2572EDECF0E SUPUTNIKOM3
302,405,172 *1DE3C3DD8B3C0F6328893459DE58C4614ABDCC70 suraj-shrivastav
302,405,173 *1DE2457547B88A301E791F2055C951C3CE8CA2DB SURFERDIANE6
302,405,174 *1DE8436EE9FC480FF074AAEBB2008B3F97AF79DE 8GNIRETIL
302,405,175 *1DE43D2B572968EAFF5D7AFDD07F3200DA059F7F [email protected]
302,405,176 *1DE3466907015A1EC9DF93EFE5B041F3F43DCFA6 sylvesterrecinos
302,405,177 *1DEE76CC5EF9420451AD929F0EDA15735A2DE3FA 8>~O;)
302,405,178 *1DECFBF67320F514054BB8F3DE3C0933260AEE9E 8------p~o~o-(>_0)
302,405,179 *1DEDF9A2FA30381F5608EE33EF30642D5D2ECFF9 TADBERARDINO
302,405,180 *1DE51B69E5E9F68DAC718C3D107BC790113BAADF takeuback
302,405,181 *1DEB040DABEE3FF73B3223B42B2DCBA02147B63A TALK90.217.97.200
302,405,182 *1DE9F57F35031DDE938E2EA6084EDEED9FB23C9F 8STRAFFEFASTSTTELSEN
302,405,183 *1DED017AE2E1D8B4A2E1CFDB33933E39AFB868D6 talkscouldleadtonew
302,405,184 *1DED998F8892657D06766F194A1C006A82BCEDFA tây-phương-hóa
302,405,185 *1DEA448B23150528B6D7076DD859294C757F51F8 |T(BAA
302,405,186 *1DEACF8D29148E928D70AFA1D9592CF217AC3AA6 TCHOKOL4
302,405,187 *1DE869AD4D62E97BC8F6C0FF1650CBA98117A0AD tD,
302,405,188 *1DE9EAD52ECB2381D58AFD851D6D6FA9ABE3992C TEILGRUP9
302,405,189 *1DE0F53701E362E09D4542A64E443C0C16B807E4 8WILLIGSTEM
302,405,190 *1DE3B09CB3D13F9475D8D0423DB5F3823D6F4494 TETTIIN
302,405,191 *1DEE4481135A7E75465174FD4CFCC57D6BDEB795 954490 john.beaver.of.falls.church.,.va..
302,405,192 *1DE6E77DC724582D0CCCED2C6D6C5FBB6688D20D TGIFTEST4
302,405,193 *1DE8A50763F7DD4B239B1C4AA851ABFEDE90D593 TGILDYT2
302,405,194 *1DE4B4EB3E93D8D7DBE8FA99E2CC35AF02794A93 96QWE
302,405,195 *1DE3A73617CEC034FCBC92DFC690C48F7FD40071 THATBERTHA67
302,405,196 *1DED0F446049A58E2177464518C8ED9114A93DC0 the pablocdcollection (disc 3: the good life)
302,405,197 *1DE998F3C7D0195FCDACFE876367D552F5A85D34 THERPAUVS
302,405,198 *1DE47CB3567B2244C64573AB4D8ED21BF074B406 9DRPENISS
302,405,199 *1DE79E122608BAFAD65F54C366FBB9FF6B55BE5C TheWondrousUnknown(g)
302,405,200 *1DE2B4554610D717A37A3F6854E906583CA769D8 THOURAYNE1
302,405,201 *1DE28E5FE29A906E5E0792F0CDE4B76C1547961A THREE-COURSE-DINNER
302,405,202 *1DE8356E5368C48A931138B9CDF75AD7A5FC0590 TIARADAN
302,405,203 *1DE7223F1AD591B6CD56C866B3931BB44DCD3C6F TISHA-MARK
302,405,204 *1DEF8EDCA7142337B90E5E7D6E1CD7ED709BA9C5 9PATRICKFORD
302,405,205 *1DE315D3591FEC4CBAE1CBC2FE525C58F88D9DA1 [email protected]
302,405,206 *1DE928E4527F2454F0CA4A69B77D460A466C99AC [email protected]
302,405,207 *1DEBF0ABFDD6C6C9C69C28F7DB06A2AF2F8584BF 9sourirais
302,405,208 *1DEB7AFDD9BC5CB3F747C0127197F4F0078BEF3B TOMASVETH
302,405,209 *1DE4D6A5862FCAEDAD9A79C83A5619AABA54A3C8 9thediana
302,405,210 *1DE0413B23717C9025AF92647D7451DDA6ECD792 tossiscono
302,405,211 *1DE327DF27BC29D0256BCAB8172E2326DE5C75C4 a6ct
302,405,212 *1DEA468E8C7305D84CC98542808E9577E0AC0A7E [email protected]
302,405,213 *1DEAC765BB5731A3250CC0E83C859526176E7DD5 TRASPONEVAMO6
302,405,214 *1DEC6B552EE402F0A26F9FD98F427AE381BA5844 a8s"?
302,405,215 *1DED95D3B4FA1B4CC322C698859F44F32A574E5C a8ts
302,405,216 *1DE3DF9D50AB529C1725F4AF8103D85F7934D868 ab2>y
302,405,217 *1DE4D2A90EBCBFF289FF4A81C65822BFD6DB974D ABDULCHURCHFIELD
302,405,218 *1DE3BFAA1B0FEBEAF8BCED9B275BF763E98E343C abdulsetty
302,405,219 *1DE5B78E9F72DA37FF2534879D91730B756560C1 ab/i
302,405,220 *1DEDE22EC196B0BADE17431B3A8D325218441844 TY.PICKERING
302,405,221 *1DE6FA5FDE5D45F301BEBD22E2907C64783397FA ACTIISCENE2:ORE,PEISACRINUMI
302,405,222 *1DE21E3D875B88F9A08B061C7DFAD8EB55A6C0FE a?#d
302,405,223 *1DEB524FD30BEB5981CF29DB72051B5AA2DE5E67 UMPFLANZENDE
302,405,224 *1DEDAC5E8CC2D7087FFA4202B84C91F81EB1F390 adriannishio
302,405,225 *1DEF2477C4B70B8B178822222B04EB64857B0ED6 A_e$
302,405,226 *1DE80296D520AD36D94973E007A3FEB0497190C5 UPISUPRIYATNA
302,405,227 *1DEA754FE94C018652E6ABF1A92D268BC4AE0202 af"1d
302,405,228 *1DED66F983EED914E55C310067AB9D0B37AB01ED US1928431
302,405,229 *1DEE4B7155D64A138F3087FAE1434D92A7FC5F44 USER195.85.154.162
302,405,230 *1DEC5BE82357310A7FCAF40C03D59CBF2785417E USERPGG
302,405,231 *1DE47DA52C14F91F70AA56C12B76F30FB01853BB A"#G
302,405,232 *1DE48F50EB50260946037B6113267660555B1EB2 VALENTINATEREZIDI
302,405,233 *1DE48ABAB16D1007F4ACC74399C50FB692AA49F8 AH,!E
302,405,234 *1DED1A1C295CB5CA05E356C5B5720119AEBAEE40 VALERYVYBORNOVA
302,405,235 *1DEE1A4FE487728BF4C9E6A99DE0716EB66025D8 vasomotion6
302,405,236 *1DE4F1CEDA13519F6DC54908EEEE3288CDBD0DE2 VERDIGINI
302,405,237 *1DEC81DF680C1F135C03F080382774C742C6C5C4 VERNON.HALLOWAY
302,405,238 *1DEBEFF1CAD2575D75E393ACE2E6A9BDFF9214C5 albertandlogan
302,405,239 *1DE74A3899BD1C7B75AF59F4336E6C0790F905DC vestibues
302,405,240 *1DE86B5A4CA720141F655CA487518A763A3A8F39 VHENMANANQUIL
302,405,241 *1DE69E596E0BECBB0EB317166EA8715C9DF0EA0A VICENTE KARLOS ARCOS
302,405,242 *1DE96B9663DF404970E18FD60672A5A85B159A09 VINAL
302,405,243 *1DE239D95D3BE77B8CC98B6EABD5E28429FA0AC6 ALL.I.REALLY.WANT.IS.LOVE
302,405,244 *1DEE2EE607933945027803DED22D850F66ED4C53 alvinapfel
302,405,245 *1DEA47F414EEA32057374DD8F07E9334FA94E96F VIRRA.ADINDA
302,405,246 *1DE6FBFEAAB01366AF414A34375629C68FD38904 am83
302,405,247 *1DE8091D4E28FC6E13F26BC2DE4EB077CFB9A0AB [email protected]
302,405,248 *1DE029EC1AC5649909CD4DB95CF5DF6945D4309A VNEUENED
302,405,249 *1DE2360406D2DBF8DE2FD153574CFA9CFBBA7DC7 WAARDEPROBLEEMS
302,405,250 *1DED97169F16EDC316C1D796B3F84538BA6B46D0 WAHRNEHMUNGSVORGANGS
302,405,251 *1DE83AAAF6BE58CD11A730978577DD928D62BEAC ANDREWSIWY
302,405,252 *1DEF457A8F5FAC4F02802B12AA7D05D9B927E5E3 WAPHG
302,405,253 *1DE61805AB79765E3BAFDA25483E7C81398B2586 angelosantaniello
302,405,254 *1DE837C4C86B81B0F570A8ADCD510981E304D837 WASHINGTON.VIERA
302,405,255 *1DE81F606EA7B52FFF5195D7052B76F3A4685BE2 [email protected]
302,405,256 *1DE8B15F7F925B12606952E6B1B1F67D7F1B78E3 WAVERLY TWISS
302,405,257 *1DE6D3F3FD0144B1652BE04D0C1FC26F023679FA annemikey9
302,405,258 *1DE1CBE6B813B6EF7C73F8A36EF3F0188F385644 ANRJQ
302,405,259 *1DED2138BEB3CF2A2C24236CD9427870535D4212 anthonydepasquale
302,405,260 *1DEFA9D4F3F5C80D12FA47D6E44E2889016FF1CC ANTONY.WOODBY
302,405,261 *1DE648A42FDD94FF100EEE8C34FA04E8BBB580A1 [email protected]
302,405,262 *1DEC71840A9C1AFBD643F914300A14A19DCDC343 [email protected]
302,405,263 *1DE7A40BF9EAD046411859353C071D5FB7955331 wesmuther
302,405,264 *1DEF56D29FDA817EF4927BB11102DDDFD8642DE7 when.i'm.close.2.u.(crazy.in.love)
302,405,265 *1DE04F9C838A139E563FE6AEE9D1431662450879 ap#8
302,405,266 *1DE6E68D61E2F11A9C432442722FA1C42173C9F4 WHERE'S HER MIND
302,405,267 *1DE0C06847BC15D80D000301814A08AF2F987010 aprileonaed
302,405,268 *1DE406210B13C3F25283BF477240270266A180C0 a_q-7
302,405,269 *1DE352156EF9ABF1B5473C57D3CC803625FA04BB arc6p
302,405,270 *1DE7F43312FCC84209ECCB02BE905D4D76513B7B ARCHIV28
302,405,271 *1DE2BAC1F403846EEABDA490701FA931FCC00306 winfordkeasler
302,405,272 *1DE17E82150322AF6A89EF681E896EF5B445F741 [email protected]
302,405,273 *1DE291D7A204D864B162E80970323804B84B4B9C WK/A
302,405,274 *1DEF8DBD4E9581790EEBE09400C4FB08B4E56130 artbusse
302,405,275 *1DE9BDC41D8123C8D616B202DD42EF1078590D95 ASAMBLEA.DE.NOTABLES
302,405,276 *1DEAB97381281B9108FA9EF6E6AC734D805C6ABF [email protected]
302,405,277 *1DE7FBF239D19545D56A75416DB940D02C7A9ECC ashfaqashu
302,405,278 *1DE40686A6E3D41447D93D3FF957E4E1CB3D2BFC ASP4U
302,405,279 *1DEE6BB5DB2790B51532EFF7D23D8A57EA522C36 X3ERAAAAIBAJ
302,405,280 *1DE0446289311993BEC2FAEE27CF3F2242723EAE XOCP
302,405,281 *1DE8E0E1743BC61D5895B9CB593C75D22EA586F5 yael.avnet.amsalem
302,405,282 *1DEE06C863713662E326CB0A288A392B2DD9432F YAHMISEHICKS
302,405,283 *1DE523EF7202250165F196CEEFDD61E0CCF42E20 [email protected]
302,405,284 *1DE6E55B2C3813FC4B165E6B38EA5302CD372225 yavaşlarlilar
302,405,285 *1DE0CF56DC1062B3CEB066581F6F3156BC51A965 YH3N
302,405,286 *1DE157E8AD99FB4A2D09134AFD39E08ADD4A13E1 [email protected]
302,405,287 *1DEFCEF846934EC4EEB60E4ECE029381E8FBA43E Y>IX
302,405,288 *1DE6FF349A6F4C2B642231C65A1C7F773EC11E28 awp))
302,405,289 *1DE2C56F8C697390DCA369B9278618E973C69DCC [email protected]
302,405,290 *1DE8D3300143156A69DAB4835A22D7560FE25F22 youjustain'tgoodenough
302,405,291 *1DED08E1537A80700D6321FCEC053E7FAD451B46 y|se
302,405,292 *1DEFB62E124BD78A3FE738AF6BCFB6D16A697C7B >-b0-0~d######3
302,405,293 *1DE9C680EE2E558CD28BD1192BE7F344EC6D2C2C z9wq
302,405,294 *1DE4F1613DE168BC5FCC86957A2C6C3341AF37E4 zackaryvictory
302,405,295 *1DE8D82F451ECD8A5CA35959D39C1F9971A36E72 B1OU$!3R
302,405,296 *1DE73A09D2532FD0A677F374B17F5E85513341F3 b3i.g
302,405,297 *1DE09611864C2A9921EAF6BABCC1FBDCED1D37C0 b64os
302,405,298 *1DE3CDACDBCF1737FEEDF90FEF6C4A59DAE3F6CC b6uf
302,405,299 *1DEFB55B603466BC1B98CB423744BFE8CCACA10C B8ZDW
302,405,300 *1DEAFF128157F8393FE729251404BC1ED019067A [email protected]
302,405,301 *1DEEA77FD643E34BB90536E35651188AC508CC6A [email protected]
302,405,302 *1DEEC6F5AEAD485DA6F4A1F4FA96C17ED2B46020 [email protected]
302,405,303 *1DE51FE3ADDB156819251D3F4FA887AA8BE19BAE zigaz-we
302,405,304 *1DE492189E73A16BBCB3354BF09C3A035C71C6E9 Zombiisms
302,405,305 *1DE932ADD7981A117486BD26041B0BB4D8C2C329 bartkiewicz12
302,405,306 *1DEE1843C522852A7ACA91E3142FA5564A1138FF ΕΎΑΓΓΕΛΟ
302,405,307 *1DE7BC48CF3713092AE53E6C7E31E54AAB0C7FC3 BCW?Y
302,405,308 *1DE7D7F07C4778B76CB62DCC15A802BFDAE6E905 ПАЗЫКУ
302,405,309 *1DE1B38B572F2A32E256B03D1319531138151794 ПОЖВАКАТИ
302,405,310 *1DE5DCE2A1A8E61D8AE7854C861F92468466DFD5 BEF$B
302,405,311 *1DE0551337D8703D8D5A2BB3E80A922B01B2E649 believers0
302,405,312 *1DE35AA9C7D88CCE2312DD1338018845A015E527 ТУРЯНКІВ
302,405,313 *1DEF8B53CC2CF1364FD2319E22761FDD4A6593FB УПОЛНОМОЧИЯ
302,405,314 *1DEDBA2FDEF161A9691E8CFA5BF351AEE47ECE43 ХАЛМАМЕД
302,405,315 *1DE777A59A68290F04DC6C6CCBF25ECA7389970C BENNETTBERNSTROM
302,405,316 *1DEE44288A7CDCC6A88491E015CA06730B937BA5 bergringens
302,405,317 *1DEF44AC48F931E5ED97557DBAED17573E1E152E BERNIECOLAW
302,405,318 *1DEE43B70C9A92403F81723D848F4BD7A317C827 BERRY.STIRE
302,405,319 *1DEAB85E0E8CC7B8841DE2480F82D5CDDB6A08C2 bevetela2
302,405,320 *1DE07B8D08BB055A7DF71F822DF90A3B5909CCAE BILLYKELSON
302,405,321 *1DE170A4BF3C727BC087DFFCBF83F4CB577C96E7 BI$ND
302,405,322 *1DE1B583F05960F4C65BEEB4E1FD58DC8AA4FC44 BKAPC
302,405,323 *1DE0A65B739D1A87CF9854C019F18EDC1948EA6D [email protected]$mth$
302,405,324 *1DE21261AE629DDE215C147A33350F95CA2C383F BOEUJ
302,405,325 *1DEA75B5B7EA4BC6F91AF287E9650DAD1EBEF78C 0g\aaa
302,405,326 *1DEB6960651F8934B0E2925425E0792BE934FF87 (_0).O~.0~.<##Q
302,405,327 *1DE755D3C6E3FBE6253E23C4BFE85EE7BB255839 )0(-*-q#3
302,405,328 *1DE42F8F1632A3DCCEB4CDE3AC9D9E30B33AD659 BRENDANZIDZIK
302,405,329 *1DEF5CF09124E5AEA0AE133442D8CFBD847DE355 BRESCE
302,405,330 *1DE8D29DCBF1D82A5F0D2212936DA6594FBD5A88 10.IN.01.(TOK.TOK.REMIX)
302,405,331 *1DEE7773EDEE62CC40B95F94F365F513DF53171D brodeuse
302,405,332 *1DE10976FB86528370B927925CE28D860FCA89AF 12.YL
302,405,333 *1DE6EA93068E6678F76D3BA1D814AE029257CF4D 1358272 ILKKA-K-NIEMINEN-.
302,405,334 *1DE20A632026B5E4FD836012E854C7E88C9ECF2C b#!s7
302,405,335 *1DE098A22FF68E82E38F1E29F4340557B0E0A8A5 15maannumero
302,405,336 *1DE05758B94B14D4366BE83C97688DF812BAAF52 bt/du
302,405,337 *1DE725DEEA772F7413E2EFDC36B7AA60E6D301EC BUERKLER:BITCH
302,405,338 *1DE3A26CBCE4A447C117E3BC15275A8445B57DC5 bulking
302,405,339 *1DE5A0CD6A123DAE92DB0FA767631A95C5423FFA c-1w
302,405,340 *1DE3B93E5CEBD32511521A8E04A8B76874BB51DC C2-T
302,405,341 *1DEFAA1478D593CD5C0A1BD0952EEB092EC288D7 C72AE
302,405,342 *1DE972F76EB9BFF5F900D22C574A85D4353C9E24 1 DINLENEMEZ
302,405,343 *1DE8AA47A4097E013A5EABCCC61D8B3721AC2203 `caaa
302,405,344 *1DE32EDC37EE3371405C6663A9A18AF4CDDBE70B [email protected]
302,405,345 *1DEB7ADB16636FFC3B45D588CD14A420C04CAF91 1-GELEEARTIGE
302,405,346 *1DEE5F24EFD1EE0592EF1AB6E246D273C3E37427 cameronchudzik
302,405,347 *1DE11299778E97DB657DC2CA5795C933F010CCBD cani-s
302,405,348 *1DEDABA36EE648C71BEB83BBB40470BE939D0552 1 INSTRUMENTALANFAENGER
302,405,349 *1DED7817EEEED25F9BFB874B9E6872745FE183B4 CAPTIVATRIX
302,405,350 *1DE9BED3C09554960387273EE230E55126501BD7 1-MATTILA'S
302,405,351 *1DE8C455DD754CA13007A3571AF33679AE0A0924 1-MELONTARETKEILYST
302,405,352 *1DE2E4BC8FECFB6A80D242C560DADF90EBA76F96 CARREGA LIGURE
302,405,353 *1DE6C4AA25AFF0F0C12558F391693F0398BDC868 1 NA-RYHM
302,405,354 *1DEB95C56AFCC32EF842F0C7A1BB82E25E7E24E7 CASTIG
302,405,355 *1DE04A5E6DE6038076DDE7869C526E84FEF19955 cause-for-conflict
302,405,356 *1DEE9589C5B9BEA2F28E797F3EF66CF07835BD78 CB8D3
302,405,357 *1DE1E4A58BEC722473A2A4AD8E9814744991BD70 c_ccu
302,405,358 *1DEAF60DC20FE977F7F86727FC3A31CE799AFD97 CD;F=
302,405,359 *1DE43D2DC22F2A639FF56C7265A6AC60000C81B2 CD&V
302,405,360 *1DE84C9A7D983FF531DCE06542057E8290112408 1 SYLISS
302,405,361 *1DE0FED83B86F7193FB39DE32A40845F101A8E39 [email protected]
302,405,362 *1DE3DFB94B32BBB8CF00E96D0E351C99B30C71AD C/EV
302,405,363 *1DE9E725106B5799BD9CA24CD6ED7BF41F8C1C0C chad.sayler
302,405,364 *1DE98D7916F075090EECC68CACA216B276809B5A 23e75ac6db2aa9d0f587a5d5093808bd-g0rd41
302,405,365 *1DE7F73DF7A5377196C8DFDEC8ACE946540F4255 chan-wu
302,405,366 *1DEFD415189FC08874F4E6770AE3973BB3031957 2823048 LIEBE:BEIKOMPLIMENTENFANGENSIESCHNELLFEUER.
302,405,367 *1DE2C83416E5A44219A1CF533B5E244B780FFE53 283229 COCUKLUGU , PADISAH OLAN BABASININ YANINDA GECTI .
302,405,368 *1DEAD4A34656EBD9D29B08121762CE73DD686E34 29 taxfraud
302,405,369 *1DEE600E219FB087385CB60E0988FFFACF4BD5ED 2huehnerbouillon
302,405,370 *1DE409A5846CBAB6CF84643ABBE0E69DC2607D94 2MOCCIA
302,405,371 *1DEB19BC214CEE4DEBC21DE08EF8B1773A24D782 335998 die.wurden.dazu.angehalten..
302,405,372 *1DE63E96A3F7E1844155E501A2C04A3FF8F8EDC8 365529 EKCILIKTE.KULLANILAN.ALET.VE.MALZEMELERIN.TANITIMI.4.3..
302,405,373 *1DE8FBA21058194DD13DE905E52C453056C863D7 [email protected]
302,405,374 *1DEBAE3FBB31BA449C44F1AFE52ABA8DC6DEE5A4 CHARMAINE BARRINGTON
302,405,375 *1DE15F19F83D4FCEA31A7204F9E0F88BA5631A6B [email protected]
302,405,376 *1DE501F57AC4C70E1FD16487D6474DD789E9916E 3CONTAMINERAI
302,405,377 *1DEC8830F202D9536B90FFB77106E436F10413E8 [email protected]
302,405,378 *1DEC3810DAF4EF8CB78C783C2497B1BB755BF568 chester1shithead
302,405,379 *1DEF3294806AF72E035BB89BF82AAA735C8C9676 3GROOTVROU
302,405,380 *1DEC932260A555992AEA2A32E7135AD2461D4060 3ILUVPIGLET6
302,405,381 *1DEF6692C1881A9178266C3AFD1EF9C3BADD8D2B 3 KINDERGARTEN-TEAM
302,405,382 *1DE48E41962B7EEA129097502C0B97811A473C42 3-M
302,405,383 *1DEF5B1AD81D959C486F29862C3809748D41D787 3==p`>B0
302,405,384 *1DEEFA17AFBB40E020C84289523AE76BC7F2FDCF 3====)-`~{x}
302,405,385 *1DE95B0D97CB1B977CF29C2966F6B6C6AFFC5B57 4:4#&SuezCanal
302,405,386 *1DE349D4174239F55D36A5A74F40DDCE612D81D1 4:..4..#..&...vitrify
302,405,387 *1DE98FB899FF6E340FB9FC22423017C3EC2FAD60 471951 haniadakitoplantida.
302,405,388 *1DE9165B1ADD62D21A7059A05229104101E0C53A 473240 AUF-230KILOMETERN-IST-ES-UNTER-DER-INNENSTADT-VERLEGT-.
302,405,389 *1DE1FE7F967C8CF94D580E0DD6A494B83162FE17 4ENIGMA
302,405,390 *1DEC15EFC9E911018E833017915286C630E11B07 4INGVRIJE
302,405,391 *1DE0D9AA5E3DD31AB66B5C0F5A5A7B01FBA46369 4ISSUEENCOMPASSENVIRONEVADEEVADE
302,405,392 *1DE6ABACBFD1049D8954C8FC1455BB95A8F9E4E1 CKRPF
302,405,393 *1DE0AA8A735CEF145EAAF751FE6B5462ED533706 clairwoods
302,405,394 *1DE72E24394B951B3652276AC9A6F25A798ED88E 4MICKEYDAISY
302,405,395 *1DEC266B7B0D690B75CCE94DD9BD2555B0EEC659 CLAYTON.BLACKMAR
302,405,396 *1DEF08DAB8C982E4A930EF1AC08E69845F9A3C35 CLEMENTEKINI
302,405,397 *1DE94014B2F8F9E6846198B7EB9157EF3464C305 4PUHEENPITAEJAEN
302,405,398 *1DE44D91806BE5C7679B20222D73B04D664405FF 4SERPECA
302,405,399 *1DEE8C7E52F16CBC3A6DFA3A89AD716686EF9DD6 cliffvehrs
302,405,400 *1DE5863E9931B71F943A2E7CA09178C4E3FB03C6 CLIFTONKIMBELL
302,405,401 *1DEB9D25849BA37854063270F0A7AA6B74E286F6 4STARWARSMILLIE
302,405,402 *1DE8E2D1BECB6E7691DFC7EA4F55CE5EF87241CA [email protected]
302,405,403 *1DE78DE0505D663B686CC048CCB8C64B5A41A4A7 cme1t
302,405,404 *1DE623808BD8815B08F9C910FF17B0A8A6FDFC28 524devin
302,405,405 *1DE4FAE69EF20E14FA1F5800494B1AA7E80FA2C4 5BSWCHARNITZ
302,405,406 *1DEA9AC369194552330D8347D0250EF32914E6D7 CODY.PAGEAU
302,405,407 *1DE1A754F82B610C123178F32094F65DE54BDA9A 5BSWTRANSITOIRESB
302,405,408 *1DE7A615A562F8D7BB3180A21E057CBF0FD36421 COLLAGENOLSYS
302,405,409 *1DE13B0BC00DB8520FE04F49F53B1C870C45A27E COLLREPP
302,405,410 *1DE632D93393B5E245FE927446D4B4F5918747EC 5DRIBYNNEP
302,405,411 *1DE8142C5CE1F195EE752E826E2CF8D963E26AB6 5F31254A851FECAFD9CF1ADEBA3A5034 PQB35F
302,405,412 *1DE645AB09B67A3B2D4E6EE49B3D7F5FA4E0BBF0 CONSTANTINE
302,405,413 *1DE9276020E580286FFD00817100A28D95A6140B corksredfm
302,405,414 *1DEC725FB21CE0959006CCD3F8FC1719C7C8082E 5SIALIROP
302,405,415 *1DE0917CC1FE4B76ABD9059A78AD169749CE7141 />CORRECT<BR
302,405,416 *1DEDD202C17848E7DA2363380976F13484BD591A COUDEE0
302,405,417 *1DEC95E39BA40D5DBAF50F734351C6F2739FAE22 6728F6843594DCE01D2B7BF05AEE1A0FPBAA5857
302,405,418 *1DE3712D82AD874E4F89B532C485A6FCC559C2B5 C:\PROGRAM.FILES\MICROSOFT.OFFICE\CLIPART\PUB60COR\J0099147.JPG
302,405,419 *1DE622DDA0EA113DB61507AE2A02CFF1956AAE7B C:\PROGRAMFILES\WINDOWSMOBILE5.0SDKR2\SAMPLES\POCKETPC\CPP\MFC\NOTIFYMFC\NOTIFY.H
302,405,420 *1DE91675365F92077F67B962DBCC8EF403DA5A78 6BLEEKNES
302,405,421 *1DE6E179B2400E0B3EB4AE2DF6445472CEC143EC 6BSWBAHINBSW
302,405,422 *1DEE15FC212A62069A4B32AF13122947284540AF cq(es
302,405,423 *1DE7548FFFAACE6CD881B0E88A188EAFB3623C3C Cracked-Brain-(1996)
302,405,424 *1DE5D28E27FF1C2E71FE081E79FE006BEC81701D creativelabsowesyou
302,405,425 *1DEEB3C125143AABB120D603F0470CBEF91347F4 c/rn9
302,405,426 *1DED27E043A7B7C5B5F138F6003E2A584C1AAA46 CSF.T
302,405,427 *1DEAFA0171C57292E2DA5CB9630F92511B9867A7 6STARVOYEUR
302,405,428 *1DE11768377873A07D86401BDDEAEC0FB85A6A4E CTOROP
302,405,429 *1DE71E5FCFBD5AF3B500CE204D07FD5CD80674BB CUTECONNIE
302,405,430 *1DE3A7992B5D9674844C16E2A931C6725571FD7F c.v)d
302,405,431 *1DEBF6C146D624749347D26C9FB8DF30171C3584 6ZEITNACE
302,405,432 *1DEA8525585D8DBEB5EB3F6FBA8F050F88DC1C5C cyaniris
302,405,433 *1DEF7F5B29E799232D927D071D40BCF2AD007B53 d15+3n51b111+135
302,405,434 *1DED2DD8CEBFA36A0D4643894381EF6FE7294EB3 d2w&&
302,405,435 *1DE374A3C87B8E849F3C9C9A118B77A677496F14 7BSWDENZELBSW
302,405,436 *1DEDEDC7E3873AAA2ACF5DBDC5EE4C6223902FA5 D3TF5
302,405,437 *1DE299D452C1F02171ECE415EBCE242B67F0F738 D5ET
302,405,438 *1DED6C9BD906CE401CAFF22799A217B6730B7CB9 d7y0l
302,405,439 *1DE83B128D8D809175A3F38825EB25B23557987C D8"AF
302,405,440 *1DE4EEF49B12DA0CFBF5D273E6C09C530AD94FE2 DALAJARA0
302,405,441 *1DE8770E465DEDAFE3FC961F1905036B77D5E738 7NINHALTE
302,405,442 *1DEFE75DC51D8621B6D8A3A0C10D2CF647CF687A danenesti
302,405,443 *1DEF5648D32671D3AAF2049867CF985C4E0CF906 DANTE.MALDANADO
302,405,444 *1DE732420ED606F04FE122599DB9A82F4F916D05 7THEVANESSA1
302,405,445 *1DECA65F6994F637DCA7A9FFA5D89F3907A2EF56 836IAN
302,405,446 *1DEF1F4F16083B2FF1AB2AA230FEEF8DF58AF978 datalogen6
302,405,447 *1DE00E69B11C7CCBAB77647B19411E524CD46588 DAVISOUELETTE
302,405,448 *1DE99585DD862A3ED2B223CDE32F3962D42C2A62 DAZIOTU
302,405,449 *1DEAB5693CD266E83DB5BC6CA33CA1C8737B2E47 dcsn
302,405,450 *1DE6E0DF5AC193AF6C609A8C8282E36D264A048A [email protected]
302,405,451 *1DE6414C23129AF872156DB35500F238AD34C2DC DEBATTUE1234
302,405,452 *1DE48665E99B622DB9EF41513ECB0AD17401B9C6 8HYVYYSLUOKITTELUN
302,405,453 *1DEE9F3BC81BD3FA7FC76BDC57AB5B19B061A27F 8ILOVEBENNY6
302,405,454 *1DEAD2BFC1EAF80367910834DDBDAEED9372B717 [email protected]@GE
302,405,455 *1DE331C011F7C4732316F2352230832B5DF1250B 8MILITAEREINHE
302,405,456 *1DE04946FE9C03219E3F378D6251AD404626825A Delta.DJ.:60
302,405,457 *1DE095B4F99C4E15C0C97CBEE462D0CDD8DD5497 8-p~`(0_<)
302,405,458 *1DE6A74FA1B2F03A30B35D3B288A165378C73CCD DEREK.OLTEN
302,405,459 *1DE0B00C310624979278119D33B6698587C92713 DERMATOPHGOIDES
302,405,460 *1DE6F1349612FDD0F24C178525A3813CA91C8BE5 DERRICKSCHWEIKER
302,405,461 *1DE1D77C69E5874C4C3692EAA24E30502810AD11 DESMOND37
302,405,462 *1DEDD1CC04B6D96C6345A7D5FEF67F84B01D92AF 92864 ESISTDUNKELGEWORDEN.
302,405,463 *1DE5E08B97DDBAF2205C6DB6F900802915FAE427 detacherais2
302,405,464 *1DE1A424CCD2D8369B7F8E852D68817862FF8CF9 DF(2F
302,405,465 *1DE1E6EEABF38639C5D6F9A80E4BDB8B0E64C8AD DGID/
302,405,466 *1DE5F30EA61072B2937BEFA2A260BF590EB9F771 9FKALIERNES
302,405,467 *1DEAAC4563CB6EB10712739BCC14712A191A1B80 DHRITARASHTRA.
302,405,468 *1DE88D32FED6AA8A03A5D40F8AB9BA9E379BB38D [email protected]
302,405,469 *1DE163F68FAF398CEF01749FF2EB71928FE3EA21 9MINIATURIZATI
302,405,470 *1DECB215EF77694A52C6B4D3B4BBA8A7987334ED DISPOSONS9
302,405,471 *1DE5F477BF34AF71B22A33DF02B017562DF7ACA0 9STYRGLLL
302,405,472 *1DE0B646ACE0E65D2DB5C70C24C56C43FA258B69 dluo
302,405,473 *1DE962A9477571E5CE538252AD6A0922269C7EFF a090785a
302,405,474 *1DE910CF00DCE4448EA9B648D39B4D885CE0D580 A22VZ
302,405,475 *1DEC4392FB9B1A22C5A92745F8A30B73361F95A5 DoyalBaba
302,405,476 *1DEEC14182DA7EBE02CA4391A62062B302C80C7A ABBAS ALI ABBAS
302,405,477 *1DE68A4F9318445188542D50D1ED6967C4DD65C1 DTQ7+
302,405,478 *1DE58349DBA0A65C0380D3AB2F1BAE0223C630D1 ABELKENIMER
302,405,479 *1DE881645D8C93B6F0B0EA51E219A9AEE34AF0DF D.U+
302,405,480 *1DEB06AEC8151EB182CE45D128746C7B8FB33990 ABRAMTODY
302,405,481 *1DE56ECCE6E2764F6367FBD81DE9A335CF87E21B abxy`
302,405,482 *1DE87FC0D49639DC55ED81CFCA28707972F402F2 AC:.S
302,405,483 *1DEE1F4506B2903AB834F7E3C6C3D006293C8067 ACTTAAAAGTTAATGCTTTTGCAGATATTTGAAAACTAACAATGAACTTTTTCATTCTTA
302,405,484 *1DEAC31733CE5F24950FBDBD0A4B07CD858D076A ad5=6
302,405,485 *1DE00B11BDB4BB964B10E2B5BFD18FFDC28189FD adalbertofranchini
302,405,486 *1DEFFDAA82CCB9155D96CA5392D152D62F6AC9BF ADALBERTO.VOJNA
302,405,487 *1DE73945783F49E9FD05EB5D8BE519DB3C9DFD6B duxjm
302,405,488 *1DE5EAC010DC774392C7DEADBF5F62A43BEA43C8 ADAM.FLAXMAN
302,405,489 *1DE585D79B7DA5E9E93E184A626AD44BE5671A76 dvh)3
302,405,490 *1DE2FF5F67E1598C2B2BF26B2B6EFAED15E10CDA adj(r
302,405,491 *1DE7FB1465443F5822CAB17D07C0F6167CFA23FD aftc$
302,405,492 *1DEAEF8F4DF821561058AD48136F4ADBBA1B82E1 A=%G
302,405,493 *1DEBFF2786654184D2C7BA825BCFFB0266926968 ahren$a
302,405,494 *1DE6D71AE943220A40B96D80F2F22672B9A38CE1 ainuk
302,405,495 *1DE8D9F1DA63D3D676767038758CBD00BD365912 EDMUNDSTRANSKY
302,405,496 *1DE0A92001FBFEB740EE0F31B818FB8C4065C81F ALACRETN2
302,405,497 *1DE08A806C08AE2477A6C289D2CB3A482C95C0EB [email protected]
302,405,498 *1DEB042912B75EFA200DBFC527B658AA82088D16 efauefhigay
302,405,499 *1DEFDDAC61E86152085787F89C29D7A3E0D8E4DA ALFONSO.HABY
302,405,500 *1DEB02B213FD0B2542D7239F3DEC53D79DD81750 EGCOLORCODED
302,405,501 *1DEF0AA6B31B73A40BA4F992EBFC538FB31F742A algb;
302,405,502 *1DE218B781E11F720A7B74BBD0F186E3F8039D98 EHYEH123
302,405,503 *1DE391C435FB0750C419D94A7B3B133F758C9B1D ALLEGAVATE3
302,405,504 *1DECCA3A070A8C93E771F0CF94EED65A74362103 ELAINEBOGGAN
302,405,505 *1DE7D4BEBE494193F7DD194DA50ADC38E33F2C68 elirotton
302,405,506 *1DE15FBDA9B081C851D27B54976337B761EC9117 ellislura
302,405,507 *1DE6710FABA72B9F5F0491E59B4DE31ABA00B1BF AMBROSIAFLORALBOUTIQUECOMWWW
302,405,508 *1DE3AB7B4104E59088BE3C7930A4B9E083ABC4D7 ELOY.MORON
302,405,509 *1DEF7C008F3E86FD96F071CE684FE9BD8C7C3C2E ELPSNGEH5
302,405,510 *1DE0D13B4A56CDE40D6FA7FFFB00445241FFA340 ammassivik
302,405,511 *1DECB78BE3854CE793C4048299CF23C5DBBA8749 ELTNAMTO7
302,405,512 *1DE96F98E0ABF406793272BD36D53EBBE0AE3538 ELTONCHUBB
302,405,513 *1DED46B24100060D364F89EF1EA3C8D34408E60E EMD-M
302,405,514 *1DE4676AC1580DBA3B9871E468E04C93DD3C606E EMILIO.SCHMITZ
302,405,515 *1DEFF070434214857D880FECD7B61451CE7932AB EMMANUELSHOTTON
302,405,516 *1DEBA6BA5460DE943659AA4863A10FB64A4C216C ANIBAL.TENNYSON
302,405,517 *1DEFB38622446E0AF518574BF6B7C33B370B05F8 [email protected]
302,405,518 *1DEF2E8C23CC7F208D677D2DB04EB59D319AC6A8 [email protected]
302,405,519 *1DE631894FCC798ADCAD226E00786F6CDE5E53D5 enetnagig
302,405,520 *1DE4C2C9E792C5F33DF842A3AB61966CA42D3447 ANTIONEMEISEL
302,405,521 *1DE72ACD147F7E2EF32F177B0FCE08D8DC5D066D ANTONIAUTSLER
302,405,522 *1DE791EFBB47B467591CBE789CA262DE5E8F8A68 any help from us
302,405,523 *1DE7E0AB9E08C0B3E823F523BE83791559F57F28 APPETITOST1
302,405,524 *1DE118C8A42F3DFCD8FE0B3A2E46914D7B4AC05A ERNESTO.LUOMA
302,405,525 *1DEA3D7C82EC6FCDAAF519B9EAE8B132B3C80912 ERREFNUF9
302,405,526 *1DEF21174A0481C11F3F69E0126E735BD67B3263 ARIANNE.FAY.BALASABAS
302,405,527 *1DEFE47F3E6C1A5E3822B0C93E2281E1C5AA3709 ARIAOFCHINESETEA
302,405,528 *1DE303DC4E738F5E12AACE9D8CE7DFAE22475BDA ERUHW
302,405,529 *1DE9E9E4A9BF1E0452D92877807A748F8C022DB2 ARPINUM8
302,405,530 *1DE015C0126C8C524396F724FDFFA0CA5EED2D67 ARTICLE282793
302,405,531 *1DE098DAEC1E74240CD9F70D5F4C21340CFAC5B4 ETCJW
302,405,532 *1DE7074E8B2839CB3021C36E531F35064068BB35 etiyt
302,405,533 *1DED5921694E35720D98A8F4B5847C543E7273D8 ETPOHCSNI2
302,405,534 *1DEE71591DF9B8D788E9C8E18ECAAFCC774CCF33 ashrafwarda
302,405,535 *1DE1FD8B97D1885F060807C71F8DEEB90BE22287 AT1G70200_DRAFT
302,405,536 *1DE79EF80B6ADC10F24DE2C1D58059A496964FB6 [email protected]
302,405,537 *1DE2B7C3B2DECC0C1569E894C9A881D605F9B31C everetteradom
302,405,538 *1DED34D196EFDE3989349F717C536E46F7F4A5F2 atdz
302,405,539 *1DE2A5F705DE20FFEAEB8F5A753D97F4F45F1221 exwhoop
302,405,540 *1DE81A5492F250AC3C940761E32F8DFC307E2ABD EYQ*
302,405,541 *1DEBA2A52E6F90034C6FA2DCC43B2794F21B0D4A f?>b
302,405,542 *1DE06912969F22A43E247C20299EC011D0094F3C AZOJ
302,405,543 *1DE9A40C27AAA11CC6121855026A0BCDBBC58524 B07VC
302,405,544 *1DE2B44F8A455AB239F8A30B00ACED8D0AC5A35F [email protected]
302,405,545 *1DE9A9D8331D19D2CF04EBFD3FA69F03CED2CCCE b8bku
302,405,546 *1DE430E37F6275665ED102E515924B4BA3A2F6D9 BACKWOODSHOMECOMWWW
302,405,547 *1DEEB07B8432DFBBCD2AF70CE6175E24D5FEB8BE badbetty17
302,405,548 *1DE1ECD7ADE9AC55EBC2079583FC5ADF2A2725A0 BART.LICHTIG
302,405,549 *1DEB3683A1FB808A5BEE2508AE96C85F7B83B58A [email protected]
302,405,550 *1DEB55E2BACB15D951A682F0663968C8A45AE4FF basketbsally
302,405,551 *1DE678DD62B8EF73C65A7E5FF8AFC04AF7F0944A BB/&"
302,405,552 *1DE0D1D5EFC917DF104D51669AB8935E31DF6CC3 FREEEHEITSBEWEGEN
302,405,553 *1DE956E13CE25016F894E889A5C33EF9CBDE3111 b#c0t
302,405,554 *1DE1C0BA3DBFCDB50A10EEB729A5DCB33FC5EB46 BERTRUE6
302,405,555 *1DEAA3880C4D1EB3EA849FB988AA0E572DE58AE4 gdayclubs
302,405,556 *1DEC3C345CA4961ABD85FD1512FB4B36D7F8B8DD GET ON UP (MILES MAEDA REMIX)
302,405,557 *1DEEDAE274BEA9566FB6C9892CAE66D3D64DEC93 BG/Z.
302,405,558 *1DE50FEC2B9FE0622103CEE07FFD7DA300F0E712 BHGNW
302,405,559 *1DE8E7D25BCEF8D59EB733CCB91ABEF41B7874F6 G&IU
302,405,560 *1DE35B0C0522FA223D285542A4DD58B9493A9248 BIG.IN.JAPAN.(LIVE)
302,405,561 *1DEB841F81CF664B6047C1AB5267CABC1C4EF447 GMEGNO
302,405,562 *1DE74BA0E7BA28ECC4DDB6A95DEC2BF0C52B4736 [email protected]
302,405,563 *1DEFDB83AD60D35B6BCF03DEDA6838369D065888 g)p1
302,405,564 *1DE6803699B30E5995AFB99B6049BFC3C97EAEC7 gregbrome
302,405,565 *1DE276CE3245E6530A8530CD789E94E0B7351DB3 grndnll5
302,405,566 *1DE9B315A7BA1733189415EC691FA4E11A8ED4C1 g(t
302,405,567 *1DE89F32ABF6287F4D019106DEAD2F405745274F GUILLERMOPULHAM
302,405,568 *1DE43D5F09F73ADE307C1BBD78CDB367428E2314 guitarmandolinbi
302,405,569 *1DE5896149E497DE73AA67D25CAB827491E1E47D [email protected]
302,405,570 *1DEC2C4D71F980F29D6D0C42BF570AB9B0E381B3 H17M
302,405,571 *1DE25CC47E66E6C8DE605D73D6601B1D521E71D3 BIOGRAPHIESA
302,405,572 *1DEF95AA33DC2DE51FC1CD5585AD3DC3218AD42A BLn7
302,405,573 *1DE0511C93D22AD55F039CCAFDAD4338223C4EBA [email protected]
302,405,574 *1DE0C8BF0A25AC132B5229F8C462FF5AEA0F5012 HANNAHHUXTABLE
302,405,575 *1DE20AC39B0C5193397D53520F9FFEB6D029DFB6 bobby.isaacs
302,405,576 *1DEA3A2C63B445E69DC1F79B94599FFDC78A7050 [email protected]
302,405,577 *1DE0BFBC24255C7C0028A0BC501A203A7979A59A BookaDehuk
302,405,578 *1DE60B313B669D30E4CE6E1DF375CFF59A9CF7F2 bootvorg5
302,405,579 *1DEFF4E667D41AA5C2765213F762EFB5ACDCC932 boryp
302,405,580 *1DECCB9ECA60698A60370F2633D875323D118271 herdrehtest
302,405,581 *1DE30698025CD4517F3132E0B974B1A29FD58ECB BPBG
302,405,582 *1DE4A6ABCE3800E1767183D13D5DCD7E49D1B80D bradyizzard
302,405,583 *1DE9DB03698F83887B72ECC65B48B7FB1868C5E8 HILTONSCREWS
302,405,584 *1DE0FA06E9DEEAD4221C51AA32D203CBB5BC8ECF BRAUHAS
302,405,585 *1DE1866E763BBAD9180541C354B9374A38D725C3 HisVita
302,405,586 *1DEB112D77691641A4224DAE5C3FA6A70CE17E2A BRENDONKASSA
302,405,587 *1DE6A25F0E78C89127A85A53862081294F54A717 BRET.BLETTE
302,405,588 *1DE03743615F68F2D0CC1DF571C30228F8048870 hmtsprm3
302,405,589 *1DE3D50FE68FED4C5CEA8B14978143DE9465106E HOLLIS.SCHWANEBECK
302,405,590 *1DE982969F291EABF9EF2BB37D291A33C7B4A9F4 HONG.MECUM
302,405,591 *1DEB3DB00B2C0B1A84901E82711C1C80FFB82528 BRODERICK.PALANGE
302,405,592 *1DEA4C47A6571E7A7333305270A877FBB5AD440D brooksdillard
302,405,593 *1DED89D76FBA1BB6993F3CA0AFB2DC47FE3B9D80 br$y
302,405,594 *1DEDCB70741581D8FFBE845B2B0AC76B67D36E51 HOWARDVAINIO
302,405,595 *1DE00999A1F99DF2869F94A00387F4E7762C9057 HOYTSHINNERS
302,405,596 *1DE9D057F98CBF6E40DE187A9C7F79B6473A63D0 h)rd
302,405,597 *1DE0461921398D112875848755E493A1ADF74639 [email protected]
302,405,598 *1DE7A4A06B07FFB9D59255772A5C5B464D137971 HUEVIS
302,405,599 *1DE39E0EAAEEC5511FC8F4095DEC1C758AD7947A BUDDY.ALTRINGER
302,405,600 *1DEAEED17435F3E537CA14B43A55BA6B6998A5F2 humbug,watson.
302,405,601 *1DED2B7EA4A93F38443B85AC68E75CE4ACFC05E3 [email protected]
302,405,602 *1DE76E977B10F0538F727FE60D12B5FC4CFD4C7E bulking
302,405,603 *1DEC85A49128EADC763C7890459405B8D5C80FFB hypertype2
302,405,604 *1DEFAB6B0752BDBA8D9C2AE46F63E8D2D5DECBE9 bws#l
302,405,605 *1DE0D4F1EA7880A5E6CB14BB37B9DDDD59A82541 ILIAMNASEE
302,405,606 *1DE3CFC825A3EF647CA4D37A06685EF1F3842A51 c5dqw
302,405,607 *1DEF7788B1357DE07C16B3591712D4127B97EFD8 CAMERONMACHEY
302,405,608 *1DE589E71C94367AFC2B26C82E466F60A0A9C080 ILUVHERZOG93
302,405,609 *1DE9D1376A3860DBD3F1BDACFABA321147F29CE4 incompassionating
302,405,610 *1DE7B35B1F444B51A07029EA594FE7FC6464BAB1 CARLTON.HUBRIGHT
302,405,611 *1DE21B6EC940DA61ED2748A4DCAE028A96147AA2 innenstadtplan
302,405,612 *1DE24D688385BF72B9C3F4D9E173F0B242C012ED [email protected]+E$
302,405,613 *1DE8E590144E1A5AF182FD5B0244FFE8B15CE087 carol-gu
302,405,614 *1DE36AD6A4FEFBA757E7DB4F5F3118DD5346EA44 CARPETBA99N9
302,405,615 *1DE1D503DABB5CA196F40AF52B16464C502EE255 [email protected]
302,405,616 *1DEAA1824A54FB949DD637D285C5A436A06C0DDF c,av
302,405,617 *1DE5DD9BB8158ACEE34A68AFE5AFB902EF0C1721 ISAACVELARDO
302,405,618 *1DE012E039F6BC183CCCE603AA99B32002F7EC1F cbr3t
302,405,619 *1DE90432E7F3CDC9D929C9450B40450BEAF9BA58 issaschar
302,405,620 *1DE7A818BD9D1306D1336D91F05D11A055D7B201 CGYARMATI
302,405,621 *1DEE45F51DBDC363FC6201581324E99EFBCBEE43 C((&H
302,405,622 *1DE07C98F4FF81E41BAC46173C0EEA57D9740DE8 jasondarrough
302,405,623 *1DE9C31C9A16165B991583242931275EDF2F548D JAYPETROS
302,405,624 *1DE2525BFC0ED3EEC645E016A9A4E03CDC9A7230 [email protected]
302,405,625 *1DEBD1898BA87470FFBFB9F0569DEB921F607E9F checkip
302,405,626 *1DEB0DD7AE9115090188B8B529A3ED5DD7951F4D JELIJLLE
302,405,627 *1DEBEF98A5C2DBA92F574BB727A4ECE412DD9ED8 JEREMY.SCHLAU
302,405,628 *1DEB2DC6ABAB26ABAA798606A301B2085FE1A5FB chiriguanoed
302,405,629 *1DE877C38A39D3CECB34F470A4AACCB15AA4136B jessie.decker
302,405,630 *1DE2980BB6079E977C0FC9B844503C984381EF9D JFNAAA
302,405,631 *1DE488458C90E94BEBEFBCA41F0EFCBEC93BC0F2 ChSp
302,405,632 *1DE49F24FA596326CB53429675B4088A39B429A1 CI0E+
302,405,633 *1DE2E7E2030293C1CF23C097C79D50DF256805ED CIIPI
302,405,634 *1DE7B71DCE017F8DA181FA3E0F18FA773EC4AAF5 JOAN.REHKOP
302,405,635 *1DE93FC2DB00F98E8E80002B28EED80389FE0E9E [email protected]
302,405,636 *1DEA74B67ABCB184DC0F3F474C5EA91151025B46 CITYTRIP:30
302,405,637 *1DE138A51732FE47D08255BBB35D42D15245ABD2 CkU
302,405,638 *1DE8FAACB5C821CCAD82AFE3EECAC913694E9839 CLAYTON.MENETTE
302,405,639 *1DEF1C8D95C7D442ED6E039BD73CBF11667627E2 JOSÉĞA
302,405,640 *1DECF8F4770E35035BA24020E3295DAB51BA718F joselowed
302,405,641 *1DE0779707C9B43328417F82C5F3051281977179 CLINT.LERER
302,405,642 *1DEC0F5F63743FB412727BB6F9CC0033A27B21FA [email protected]
302,405,643 *1DE67B556C36433A60F84691DA4E6B7FF07AFC2A CMS=Q
302,405,644 *1DE1062FC5148C197D5A7895A742A4E955F6275D CNhl
302,405,645 *1DE89FAD801E8CAB504AFD0908569EF739CE48C6 julianpawlosky
302,405,646 *1DEF1A8B1E1FD25F6D8356A9C0666F763C6CD213 JULIARUFFOLO
302,405,647 *1DEE9F0C5466FC7B89ADFF4C98C1BB1DF0A4E684 Just-Jazz:-Live-at-the-Half-Note
302,405,648 *1DEB9457A0F22A3F8101599DFB85BA1207B6AACC justlookatyounow(thedbamix)
302,405,649 *1DE9AFB664F810105E393215DB17070563843E00 KÅOM
302,405,650 *1DE154D226291B6473989E5C44B56BDC258DBC55 KARLFRIEDRICHSCHINKEL
302,405,651 *1DE9139573FB0315A0F54BDEF8FCBB66C765CE64 CONSTANTINE
302,405,652 *1DE8E08BD80E8DC3A798695C0031D704F73E9B23 KASEN897
302,405,653 *1DE7939BA0305F71ADFA72DA2635AA583D9F4E29 COOLIT8
302,405,654 *1DE582233A52A31DDBC4AF8CC1DD28B9D089D0F8 KEIZAIDANLIST47
302,405,655 *1DECF791BE9512648E8C90415E681D7681546995 KELLY.HILLERED
302,405,656 *1DE875301D3F4F85AA883500DA44BF8BAF3ABEA9 KENCAUTHRON
302,405,657 *1DEDBCC7BA7293EBD0CE92769838B165EAFB306A KENDALLAGEE
302,405,658 *1DEF4984309D65B160CEF93929913FFA3498F6B6 CP5SO5J2
302,405,659 *1DE0D5EC99CF9966354DBFFA3345A124A63E23AD kesr's
302,405,660 *1DE5046FD7F73D4F41A68465475CB0E900B7604C KEVIN.UDE
302,405,661 *1DECA421BF59EE4456149D81FA158941F9391F52 khaosknight
302,405,662 *1DE2C685929AE84E4699010E61C0A65404B80035 CQ6KV
302,405,663 *1DE67B1139D444A6185F3E309029BE997F75F8DE KKAANNKK
302,405,664 *1DE054B25BEB5896A5B03775C1739CC23A41DA72 konder
302,405,665 *1DEF2AED575E3D024C9648A92B425F70D2903337 KOUNICK
302,405,666 *1DE10520E48DF66F367B172EF0CF648CF7AB4C0D kvilane2
302,405,667 *1DE3A86484F4B8BAF128621E37F35945EE5C05AD ctqk/
302,405,668 *1DE0EF0F24C865DAC8C7F693093619AA70E44CE4 c"ui)
302,405,669 *1DEC95468F1105910C6D680EC703A11F1A57F535 CURTROSSNAGEL
302,405,670 *1DEBB2B1A8A0FD821F5369267D827331A41429DD LASURFARVE
302,405,671 *1DE37904B5CAAC5BB9850E20CB5F4C86F87F0D04 LAWERENCE.BLAKELOCK
302,405,672 *1DE671364CF4A86EBFE8A74BB2447E196231281E CX3;R
302,405,673 *1DEDF5AD99FF9E51F99E18B328E59AECE462322C C)Z
302,405,674 *1DE60A931BCB84F34176A8B495554A9258DCD3A8 Leila!-Leila!-Dieu-puissant!
302,405,675 *1DE037F9ECAC43430194D06AF6CE1E15FD1B9D85 LENARDGASTELLO
302,405,676 *1DEDC2AD7DBA044A424879B68A43755D1D8F8655 D3COO
302,405,677 *1DEB29BCFA1EEF525B3BAF6908CAF10B0CCBD472 D3KOI
302,405,678 *1DE0D2AE253D5299EAE923819DF3006CE6FB4D67 levigawron
302,405,679 *1DE33821E56C4C196D561F16CC9396BD7E3DBAA4 D8(XG
302,405,680 *1DEF0F79BE7048139D317A7C3A092D64CE9D5AF1 DaFS
302,405,681 *1DE17935894800AC2C8229A70CBA1C879C7EA2C9 DAMMARAFICHTE
302,405,682 *1DE0D0F8CED6D6491DEA1CADBD93B05A0CC7EBE5 dane-cortes
302,405,683 *1DE46EDEA35FDB482A8808E534A6DEAACF2F9A01 DANFILPO
302,405,684 *1DEED3741EFACEDAB93CD9995983F1D43A117521 danilokisling
302,405,685 *1DE1CAF2CD3E1C3EC05D8474889F93DA19A0E222 Limoilou-Starz
302,405,686 *1DEB342B16B77D52061807A436FDF161C4EB762E LINDAS.SIVE
302,405,687 *1DE54E75E8FAFC87929FD902327507442CBCB389 DARELLLOREE
302,405,688 *1DEC3D87457BD345A3280B5F26C28DE51C81C29C [email protected]
302,405,689 *1DEB3643E493FF92E48015243D411DF087B9AFB2 L'''IQUIDITY
302,405,690 *1DEAF433455277D11A1E08A007AD37C428571544 DASHACHUCK
302,405,691 *1DE539D9B45FF0991CE22111653FCD4859782CB3 DAVERD99
302,405,692 *1DE610F26D5A818DDE8DC5236862756C976E206B DB(|
302,405,693 *1DED8D4FECDB55B1BB5CD29B0900F9DA2C9FA242 ddmvb
302,405,694 *1DE9995BACC60ED4962058CC7F187A1C51B4330A DEA}
302,405,695 *1DE63E8B776225CB566E2D707A82BDC33E494D3B l/:q
302,405,696 *1DE8FC5354CED1BCFD301780B2B82BCE7BC602AF @[email protected]
302,405,697 *1DE4C1199B5228F1D596E295E0170332F735EA96 [email protected]
302,405,698 *1DE63777C0157011F07100C35468F95A99D6B83E delila
302,405,699 *1DEC15E8601FBAAC9D7833C4C978D8BC3CF80699 LUCIENHRANCHAK
302,405,700 *1DE1206A8AB273A5A0A26FCBDD10B6E9B01FCA25 luciusduma
302,405,701 *1DE6CBF12CF4E8CC98BE3B82D14F95CA45216368 [email protected]
302,405,702 *1DECF59D58C132A742658BA5C608236D3B990039 [email protected]
302,405,703 *1DE4439966CE9FB5883F237B6828BB0DE0C59279 lupeamistadi
302,405,704 *1DEAEF8308A3BC03E020C727A5540B64C2B7F07F DEON BALLARD
302,405,705 *1DE2A4D93FD22FE9D67EAAFC0E10388647EC8EC6 DerHardrockhaseHarald
302,405,706 *1DE08E32CBC876011BF5FEDB1D002ECE70C30C11 lymanmcnichols
302,405,707 *1DE3D836BC198D7E9EBD3D95952D6C3FC7BADF4C LYRICS.ARE.HYPE
302,405,708 *1DE1DB189CA73C3FF3059852780E313E3F28E636 DESGAVELLS
302,405,709 *1DE8C6D9D39E73EE2C855732417BD3CAED75CA45 despositsing
302,405,710 *1DE7A1038CBA49D980E2FE46BAEB8566C531834B MADJID-1-0
302,405,711 *1DE0B64F783AB8F5A2E8B721EA0EB7B45B725F14 [email protected]
302,405,712 *1DEFD6BA0A587FAC1F3B61CCFBCA6AA79FDF83A1 MAILGENT5
302,405,713 *1DEC50EFE8706965FB0CDA338FB7B75984D00641 [email protected]
302,405,714 *1DE685219263E4FEFFC51DA66E9F0D95123F88F4 dfyzq
302,405,715 *1DE0813B6821B41E5D70FE0CF47AD9ABB43A2B26 [email protected]
302,405,716 *1DE0EB9C4DEA8738EEAEA5F0BE0FA557C4A633ED dhekc
302,405,717 *1DE01D8E035DB7A947344159070B5ABEC0231566 mardelsurtempelaboraci
302,405,718 *1DECE1E1EA5F2E0541E4CBAFFC938BFDD0B74E22 mariamejorado
302,405,719 *1DE6498A4CCD5617C27BF78F874751B23016FCDD marina-maximilian
302,405,720 *1DE4BD87E866DFCC2DAD91081E68C56180EDF272 MARKETNOW
302,405,721 *1DED17A00AA72D3607EE73A2AEFFB864B24331E0 D#ie
302,405,722 *1DE4E36F8B8AC72BFFA2BC12B99F7CC6B52805BF martywinton
302,405,723 *1DE4B4BC09AB19F0D956C84384C5164925A7C9D1 [email protected]
302,405,724 *1DE1E3590049DE987A6B113DCE6580395E05F612 masanorikoyama
302,405,725 *1DED3119B56F1F541F3080FCA049868065707344 MATAPAN3
302,405,726 *1DE5CDF28DCC21FFF970F83D00F6327C162C7E18 [email protected]
302,405,727 *1DE3A69679A5E4ABECDFBBDC1429630B048B94C4 MAXWELL.ILLAR
302,405,728 *1DE19F0813EBAEBD751D707B76ED911D2E1FB29B MAYNARDMONEAUX
302,405,729 *1DEDDBF2B31104ED7C43477740D15CAB0334DEA4 dis3nchan7s
302,405,730 *1DE829433A1141C960E7E936C1E991685B2DFAF2 MEITITLEL
302,405,731 *1DE08BD86868BA9E692570552D6783A23DEEBB06 memories(feat.hisomi-tnp,ni-yang&shinyacunel)
302,405,732 *1DEE6AD7570C2A7B6C757E0339CFCC24DBF82CE7 MERRITT510
302,405,733 *1DE07819CAC544CAE423F73E1F60043BA8CC96EC METEOR-14
302,405,734 *1DE34C4F386CE54A96B21B7FAEB94DD54F6D7203 dj!+s
302,405,735 *1DEE26A8282D823504C0B58A0322BAF93C560014 miloeerkes
302,405,736 *1DE352CDA3798FCF4563DDAD14B3BA4A35333466 [email protected]
302,405,737 *1DE8E303703F2F33A5729C2D1D1E106E31467B76 dk:g$
302,405,738 *1DEDAB50B96E242AA912855DAE80FDDA79D7E1BE DkRr
302,405,739 *1DE631A29E7971DD122E1A5B610A0214828CBBE0 missycarrie
302,405,740 *1DEE74971D80440C77654507D98230DA79BFE9D5 dmvzg
302,405,741 *1DEC2C64C96DB64BDA825B073B890FC8B9CFECC9 MMAHMUDY
302,405,742 *1DE5BC6E3A3789740B521ABE27A176623D6967FD [email protected]
302,405,743 *1DE52659E2BD9DE2D8DBE5AE14A340C3F5D22AFA ;"moc.nograeht.www//:ptth"-=-egapemoh$
302,405,744 *1DECCA09502E2BFB2E58DF842D9D1E11D1C58324 MODESTODALLAM
302,405,745 *1DE4E91044631E666CE50214E8F1D2E131DFD736 do.it.(feat..haley).(miguel.mig's.transport.dub)
302,405,746 *1DEF32217911583B651C15D33DF96164D11F5D4A MONEY.FOR.NOTHING.(OVERDRIVE)
302,405,747 *1DE70E026976BD75C7C005994CC9E1684A5BBA3E DONNDUTSON
302,405,748 *1DE5C82475B3CE834E0406A7EC89670F7AA99EA1 dontekleffman
302,405,749 *1DE5E50C02155230CD8E1D36E03D8CEB1494F8EE more-than-i-had-(feat-dania-mode)
302,405,750 *1DE67652A0A818C0D121F709BBF5328752FA0FB8 mostafaragai
302,405,751 *1DEFFF7ADAC6CAB3DCF27A107807BDC081BDDB5A [email protected]
302,405,752 *1DE9E4486BAEF54B3C200F228B29F40C61891733 dp?6
302,405,753 *1DEE94B92D993D06014AB085B7F66915E8CBF807 myra'sjoythroughsadism
302,405,754 *1DEABE94A99D31D7E28F4766219C03E05EE3EC00 NATHANIEL.PFEFFERKORN
302,405,755 *1DE4B8199B4655379F1C7F6F8A0A793E0A6E010F NCNCLDLY3
302,405,756 *1DEF359B9455A0CFCEA8C201E579A515E09BDA70 NESTOR.SPIER
302,405,757 *1DE5E16831F9BA6E62DECE21BCE2670BDAD3D6A4 neville/m
302,405,758 *1DE30F00D4D40F8BCB139654B0101EB99C389ABD ngjqnudv63
302,405,759 *1DE23ECA0587946605CC48F95239B52C4669EAF3 draq&
302,405,760 *1DEAFF67CD21777F13916D1250E37BCADEA7BD65 D%SOM
302,405,761 *1DE2295BF4B37FA49A559384442C3544A9A7C712 Nr^ipatvamh
302,405,762 *1DE5014BE1B972278ABA0871B3AFBB1074314729 D.W\6\Dy|!na/08 RlevyK;%Zi`
302,405,763 *1DEE2749AB19925166A69A6D108999BB2BC74DAD dw8o?
302,405,764 *1DE7F5DF8EDC15807DFFFEFD692DB8C17F271A4B n turina - sonata d minor op51 aria lento
302,405,765 *1DE8DB568090108423F397F860A84E27A0C3CD99 DWJUH
302,405,766 *1DEE9F817DBCFCAF232EDFCD78E1E477E12E9B04 dxav?
302,405,767 *1DEEA109D5AFCB7A5D5ACD2EFFF6E6C764FF6904 [email protected]
302,405,768 *1DE200156F2BC61FB21D36812BC063BD34BF507E OFENGENDER
302,405,769 *1DED7BD213BCE2A63D57DF0B854B2C54915BF955 og;,
302,405,770 *1DEC90761821BFC496AB72BA53385A76467B4A0A OIHDYDEB
302,405,771 *1DEA830D5336A903152DC2FC7ACEC0FADFB8109C EB_t
302,405,772 *1DE25D94CEA4EB4620FC71DC46673517B3A9EE9B OMagnumMysterium-Carol:Haylle,ComlyandClene
302,405,773 *1DE61FEC76F921341022187C1DD9F6EF69E42B5D EFRAINHIRAKI
302,405,774 *1DEFE3F134004069B059F3D1DF657D9D32A1A0A3 EINSPURIGER
302,405,775 *1DE734D4C8CA02334A79566FA23741BED16FBE08 elisharonzoni
302,405,776 *1DEBEA0B5E54E74F4639FF93614C16941B8CC55D elizabethdanko
302,405,777 *1DEE38BA0F8AC3DDA2C7DE1A0351D9CD44A18EEE ownhands4
302,405,778 *1DEBB011E4300CD055204EFB5B90F4647C565BB1 ELVIRASADREEVA
302,405,779 *1DE2D15BCE252D384B0EE38CDA946F7260EE0744 emmmf
302,405,780 *1DE8975322C951F6C99E49101D48CF2E9A715020 EN68.38.177.63X2
302,405,781 *1DED0BF96C267401D2AA3587E31F332C3D577EA8 ENBARTELL
302,405,782 *1DEEA1CC23F34C69BAC998F5842F288BB408BE05 ENERASSI0
302,405,783 *1DE2019EE484C5A9CCFB9BA7FB77E738E18D97DD ENEWHERING
302,405,784 *1DE80D089C0A01D5EB8E962F415531D0EF8D87C6 ENRIQUE.FURTAK
302,405,785 *1DE5C0D9A5CAD174EDD21197603333957881E780 ENTEGO
302,405,786 *1DEFAA94E9221C38C7B49EF7F6D14AA9238B233B enttarnst2
302,405,787 *1DE2F59ED21D521CCB8B1A76FA6474A4CCE89CF0 PAUL.FEELY
302,405,788 *1DE2675D83718EE3FD93B3BFDCB8E424DF713E78 EPRRW
302,405,789 *1DE6D2A077A1DEEB76CAA33966F88FAD088A83EA PEARL.LARA
302,405,790 *1DE63770E79A8CF61B6AAB5F1F5802D0AC5EC5A7 ERICKSCHLINDWEIN
302,405,791 *1DE8CCC1D07E4D58FEC82EEDC8C9928553722662 ERIC.MAHAIR
302,405,792 *1DE50819B4BACB2F80F17D2EDE40FEED5FE49196 erieave123
302,405,793 *1DE70A2E381C5C4668E5A3CE098CA7C5FF6AD722 [email protected]
302,405,794 *1DE8A13C82F12CAE734CEF2B9F1F02D34722313B [email protected]
302,405,795 *1DEEC1DB68D27F231E3396997C50A269CA691440 ERVINSCHEMMEL
302,405,796 *1DEC3B07A6D8606B0BDCA030150E314C3F4365A8 ESBIN20
302,405,797 *1DE7A16B3B5F18AEBD039C05B7590C5E0EAD5FDD esjhy
302,405,798 *1DE204F4046DD816E5A261218CE48BCC7742E774 [email protected]
302,405,799 *1DE01106E5295D960A3F853A589E72D125FCCD89 PHASINE
302,405,800 *1DE8EE0C0360398F9F06102D1A02D126BAB17F66 PHILIPSCHNAKE
302,405,801 *1DED8C0089D02F85FC94C7185CAD899482365C85 e.t
302,405,802 *1DE64FDF88C4920ECE52DEB4C5CA148F288770C9 physedphysed
302,405,803 *1DE00D91BF3C5068DF27BECD043AC025E28A6C3F [email protected]
302,405,804 *1DEAFE2F6D954A1D8007BDD82874E42EEF67195C piertoburgo
302,405,805 *1DEFEBC693350F3FC1EC51999276C3CCF714EC20 Exdeath':.Turtle!
302,405,806 *1DE16B08D27575D4249DE75CEDCAFAD47F374317 EXTERIRTH
302,405,807 *1DE532F2DF5953BA1DDB0E47A82B1C4FC1C90771 p######)*}o{
302,405,808 *1DE73BE12E097586E051C41D21F0AA063CF45B62 [email protected]
302,405,809 *1DE9F621A8E44C81AB9AD9DCB1AE8562A4591E84 fantasy & fugue 1
302,405,810 *1DE96D47E5D56142953E20DEAFEB2788C6D37F8C feltonmangino
302,405,811 *1DE14109D68177AE2A2EC2A9CF20C99996FE4144 [email protected]
302,405,812 *1DE67DF787694833016F128F4E6438FE9D1C73E4 FESTIVAL DE JAZZ DE CARTAGENA
302,405,813 *1DEF6BF28388A0CDB1DA097EA81BC3B78A3FAC07 FIGURATIVE
302,405,814 *1DE4688B519754BB9C19F7BED0445ADE2B9F7AF7 FLAOUAR
302,405,815 *1DED689EE7DC37BC4FBE9F7CF5E8ABB3DF44888B foonu
302,405,816 *1DEA9F7B2557743A62FE3B054E7B7C956B0886A4 POSIADANO
302,405,817 *1DEB8D0A92354B034BF83902EE04A4377BE06CA5 franklynlegard
302,405,818 *1DEFE2E653E768F4585470BFAD56BCE4F90F2A8F POZNAVATED
302,405,819 *1DEAFD7E52ADFEEE531218DCE4B53CDACB4DEEF9 FRANLICA
302,405,820 *1DE48F2A54D14B72C2E789A5808B8CBE1CB1390A P======p~o-Splat!
302,405,821 *1DEE922E3BFE397F0D5B13E4A5286D7C2BD54472 FREDERICKDUTKA
302,405,822 *1DE56706E58FF39EE7C6BCAD2001E03E19B6F08B FREEMAN.GINNERY
302,405,823 *1DEED744F9819B4714DF04C01F04E83924B39BB8 prairie.acacia
302,405,824 *1DE0AECC922179222D4CCBC4B6BA42845B34C035 prfcltying
302,405,825 *1DED718A7A2560FB129EC7B492D60170015B8877 [email protected]
302,405,826 *1DEB70A3197B9A348F730D3439A7ADA3B620CC0E prodigalit
302,405,827 *1DE60D9BD64A6673D8576B2C985870CB059C136A [email protected]
302,405,828 *1DEADF984480A42EBFF187A911A4F6E44AD3BB9B put.in.a.hole
302,405,829 *1DEAA28EF09275B15154819666F80A1393D24966 gearraeg9
302,405,830 *1DE770D51C89478B5897662A3C7037B7A5A3E883 QETU388
302,405,831 *1DE164352E1FE510F539DF05D280FCBD985C5623 [email protected]
302,405,832 *1DE5B9CE8527A00AAF6C9E21DC15EFD8513CD09A geliefan
302,405,833 *1DE4CB348274838408EA51378B86EC237AE91B95 Q#P.~0UU
302,405,834 *1DE32E927B2344355EC59E63DBEC68D771F90BE8 QSPERI
302,405,835 *1DE8B1DB2B6D67FC19D6DB2E1FE91FF97FCA943B GINO.TIERNO
302,405,836 *1DEB7E330A0333170F962D209590F68C4408B1D9 GIOVANNILEMLER
302,405,837 *1DEC090AD13F7636D5A82ED69B20B3915164EF47 GITRINGS3
302,405,838 *1DEDA2B1D5D45CC0628C3BDFF3A1FFC76B81F1C0 quincyabke
302,405,839 *1DE23BE98B7E0225CC0D4A093C52C749204772E4 quincycarnighan
302,405,840 *1DEB7D5BD30D979D07BFA4A42A72ADACD51A65AB QUINTONSCHOBERT
302,405,841 *1DE69BA1B0E8096987BD1B70FD9B3E881C7677DF glen.edmondson
302,405,842 *1DE20BA178ED38FA7888A82BA6100BF8D53B928B rahmato
302,405,843 *1DEA46A02321D4DB6885B3176211E1D6B164D8EA RAMPOLES9
302,405,844 *1DE47C1DA5DA37784CE91BA2DFD4B7A01AB7E4C1 RANDYMCDONOUGH
302,405,845 *1DE02B54E1421D9042DEAFD8D8050A17B65D4280 RAPPORTEERT0
302,405,846 *1DEB38845489658D48A0EA40A1F0BF12C0B0A91D GREENC14
302,405,847 *1DE147D1B374913045B8DAE106446961FAE8B21A GREGORYLENOIR
302,405,848 *1DEF8992413D80AE61B610B7ECA18C70A81760A4 GROVEFS
302,405,849 *1DE59EB9A1D2C8F32320737B724C167DA5F4F361 REEFERDEAN6
302,405,850 *1DE449ED7E54F1625207E43168B6C908EE7CAE67 [email protected]
302,405,851 *1DEBAC322EB749854EF4D3AABD870D970F2A46C6 GUSTAVO.KALIS
302,405,852 *1DEE724F5DDE8E478C4AB206B47EFF7793C47981 GUSTAVO.SPARTICHINO
302,405,853 *1DE563F0EE923F839ADDC38AFD1B1589AFCC4412 GU'U
302,405,854 *1DEB19A300689B2A53AB7F1B4A1F6E2C266E7C4D REINLADO7
302,405,855 *1DEBFCD7D49FF8E27B2518D2E961D2F0C796ACCB RENE.JAEKEL
302,405,856 *1DEC84326FAA4A4D0D69D83B81D2A5C7AEAB5EB4 HARUBIKOED
302,405,857 *1DE55378B049B0BF44C516AA1B7E99FBD53E2C19 h:b-
302,405,858 *1DEACBFBF3F8673D405D60485F9D4CE275ED59D2 RICK377$I4L
302,405,859 *1DE86EE5049C430008D4C1025729F994B3A5C3C9 rights.and.wrongs
302,405,860 *1DE6D1538C65DBC4931EA6296965E0865600BBDF RINSAVIMMOS0
302,405,861 *1DEA22BAC652B2317E36F364702F63F702ACEAE8 rippley.records
302,405,862 *1DE3A62B486B6413F02450EA599F8941E3DDFEBC r*lbaa
302,405,863 *1DE561A65317F0D18659997C1B010A9DAB7DAFA7 RN19
302,405,864 *1DEDCE318F63D533E0369CCA5929B49EDF8B255D HERRINGS
302,405,865 *1DEDB13FBBFD06B3FAC5CBD72FA1E0FA51697DF2 HIMMELBLAU PAUSE
302,405,866 *1DE63C3F5E2FFC8C7341C6E0366AA58DBC344CEF ROMAN.ARRENDELL
302,405,867 *1DE949770AA8D550EF4E1FF1A308C2BB1B74A11B romosan3
302,405,868 *1DE009CD08FCCB08F77A12E513D0A560A109B97D ROULA-MAZLOUM
302,405,869 *1DEDEA8FA777562DA913CF2A827CF1F02D58BD30 RSTBLGHTD
302,405,870 *1DE86AABB9F04B636D77E2D5E3E4608885224704 hoarendermeulen
302,405,871 *1DE497230A4E63972849B9B918C8AEF40C0C686E RUBITONGAY
302,405,872 *1DEAE141DC30E0B38919C03BE1C28341AC67DDAA RUDOLPHISAZA
302,405,873 *1DE926F31AC2D65B2FD4D43A250D10A85A46A1EB rudyalgier
302,405,874 *1DEFC385C617E0DB5943C9107A313AF5683E911C homrais0
302,405,875 *1DE9F369EEAAC8CA3DED00D4F275FD89E67E295C rusyehk9
302,405,876 *1DE1BEBA5FAA6FCCE4B21D1DD70830646F768E29 RYKOZAPPA
302,405,877 *1DEDF0CE89DFEBF11ED2F0628DB68AF7E146C9F6 [email protected]
302,405,878 *1DE4387F349DEC70FC2D701869422247832828AE SADMEPHISTO
302,405,879 *1DE5F17C48C837BC4081DE29C98BF7E37FB67631 sahatmanurung
302,405,880 *1DEEA2DCD7EDE47982C1396E2AAE5C17E2AB1431 SAMITHACHATHURANGA
302,405,881 *1DEBBFAC643FA6810CB89014CC3109C482939B7C SAMSONQWERT
302,405,882 *1DECA1F91EFA8F21011753C6D373DD4EEEC50299 SANDRA8686
302,405,883 *1DEF829A5F23EA56DDD4BAF9A9817F6CF344635A SARAH HARDINGHAM
302,405,884 *1DE670786945B89A611AA4D7C33C4FCBAE7D02EF SARAH.MATTAR
302,405,885 *1DE078EBA7AF7853B148E800B3F9B786A88C7B2C sarahwalksaroundtheroom,searchingforsomething.
302,405,886 *1DEF7FCD49ACF8B8E47FCB0306296B4DBF38177B SAYAN SENGUPTA
302,405,887 *1DEE750815D3C24EA22D7611DDA2556C98AD7098 howlin winds
302,405,888 *1DECB74EC8876BDD47C2C0AF5A1FBC33C89883AE schen/schwanensee/nu
302,405,889 *1DE55AACD71B7F0ECF73BA2F267BD997B0BC4D1D SCOTTYRENEE2
302,405,890 *1DE220C6F50AC74DA002BC6BB85CDB86A507FCB8 [email protected]
302,405,891 *1DE7F5DE5A16C5BF8E1320DC0E11490FD299B01B hyperdash
302,405,892 *1DE2D7A54E09F52F71EFCCFC703EBA5C2E523BF8 IALEMUS
302,405,893 *1DEEA1BEF85C49EED87F06AA07474CE634CE658B segatspu
302,405,894 *1DED2F8DADE96FF21AF9E68F60DE6CBE2F3A0330 SESUNEME5
302,405,895 *1DEF2F8657CC3A5BEDAF1DA6E10B7ABD910300FB IEPAREMENT
302,405,896 *1DEF1D374C81552349D2B0827BE279B9B5BA89CE SEXTOOLSFORWOMEN.FEEDARTICLE.COM
302,405,897 *1DE122D76CD03BF875328D470355F6250E9C65F9 IGNACIO.FARHAT
302,405,898 *1DEA3599CF6496FE9A65BAD82DCF4F94B477686B [email protected]
302,405,899 *1DE38267525E469FB51027209AC1220D99556376 I'LLDOMYBEST
302,405,900 *1DE191E2D4D1DEB42C1A6218B3B83095F8A54457 she left me for jesus
302,405,901 *1DE709E385AE31B612E1BCFFB7652EE19F93DD00 iluvdutchess95
302,405,902 *1DE01803673815ECA8CCB68C555866A82F8F1BF3 IMMILKNI0
302,405,903 *1DEC3DBCDE6E41FA01E071ECBAA1AD716A4276FC [email protected]
302,405,904 *1DE745E37689093C7F5A5B4A469F6E6A33C7247B INEEGORT0
302,405,905 *1DE4CB1D95B369265F907619D86EDF73356FCE5C INVESTERINGSAKTIVITEN
302,405,906 *1DEB23A8BD4D089ED924FA13AB9F3A90C532E64E [email protected]
302,405,907 *1DE834C2F309F15C3E72E98C03E08EFE7F52C0AF SM21022
302,405,908 *1DE2DDAB623E1E1AD2968D81FA7A157EA9FD0BBD IRON.CA1K
302,405,909 *1DE1F0A3935798B381A17AC1C0D1C13119F13891 SNEGOCALUA
302,405,910 *1DE62C23D4EDACB4E7964C74D9415D6CC434A023 SNOITANIGAPS
302,405,911 *1DE988B1C7517FEDF256EA1D3FAD0E26ABC5D019 «ivica»
302,405,912 *1DE5CF4F389CF32C58FB4DFB2441FD132C308CC1 iythiik9
302,405,913 *1DE292F3CBC7383793FA2794DFFF47945B933EEF J92802
302,405,914 *1DE16F3DC6654AFB1A00E791042FD9FB0F5E69EF >j>aaa
302,405,915 *1DEFD0111B6E8449CCC0028B288A5817FB6A5323 [email protected]
302,405,916 *1DEE15DAD5F27E6566A590B955FF3160BD87250A sonvald
302,405,917 *1DE5323E3D88C75AE1EFA792CE09F1C8914F165E spettri0
302,405,918 *1DE7450E2371E37E9F7ED4F722CDE94EB5142F9D JAME.LESCH
302,405,919 *1DEFC4626FB7897654AF263B1D9F914F168018FE sreyalpttekcup
302,405,920 *1DEE51E9DF7CDB526C5709A0321546130A5A519C SSENSUOIROTCIVREPUSING
302,405,921 *1DEBF09538BCAB794241BF56CC962A1BE83AAD08 jankoskies
302,405,922 *1DEBB618560EE1BCC1B3091E78F5BF856CF6572D je<9
302,405,923 *1DE6B9AF8959987953B115B3034553BFB2B5CA7E JESSICA.BERGENDAHL
302,405,924 *1DE64343143E38316A6B999DA537415968B07745 JEWELL.AUGUSTYNIAK
302,405,925 *1DEBE3B0E9CBFBD9479446DCCEADA2FDC1FCFBB8 subcavat5
302,405,926 *1DE9433377576CC8C970E91C7F1D505BD2189696 suidgar
302,405,927 *1DE5AD6672510B3650081D5A0F277D396EDB3015 JOBANP
302,405,928 *1DE3E600D0DD0B00513CD579F287D18210B01B3C JOE.JOHNICO
302,405,929 *1DE832659D1D4947EF2A826DC8E352BD5E727E44 susseguiti!
302,405,930 *1DE578E026984EBDEE1142639FFC066CE34200D9 SWEETVIBRATION(REMIXEDBY2NDFUNKTION)
302,405,931 *1DEC603A8BB91A3FB14BC4CD708A09533A62EC5B jonathonbellen
302,405,932 *1DE3A7316C814AADD2D7E42EE9A4797A99B22AFC SWINING-WITH-DJANGO
302,405,933 *1DE839F9A592D69F41181F3FA13B581D556568FC JTFVHKSX
302,405,934 *1DE2EBD3D8916E5356A2218821E277BD257BCFFB JUANALICEA
302,405,935 *1DE7EDD6234C590A1DB95D732700C310A2D4B759 JULIUS58
302,405,936 *1DE9872A575149CFD682257037AE950518EA5BC4 ta^,
302,405,937 *1DEB6A10BAD8BBADF40788A9A66AF504E6ECF351 jwednes
302,405,938 *1DEAE6AC37F3639B006CFF2A03A5BF5A8BB8D8E3 TALKILLA
302,405,939 *1DE197A8B80A69A2C3DC6157653E83D4EE7D66F8 TALKLIST_OF_MTV_SLOG
302,405,940 *1DE6302766D64DF4DF0DAE482D77C4C3EA0C1235 karen-karnen-dasen
302,405,941 *1DE89C1896C5C82F1F0BA5070BD576CAA1BB430C TALKNIDHISH.NAMBIAR
302,405,942 *1DE6B20E4575AA5AA5C20F84890E26D4DADB19B2 TALKSANTHOSHPAUL
302,405,943 *1DE6AA61F3989D02110006984AF5AF272C120A96 TANNER.TIMPERMAN
302,405,944 *1DEB8306833E79448493661998C6946B3F39AD43 KARLWADZINSKI
302,405,945 *1DE466CAC004ACB0B8E33A938C1F7E64BA65F4B5 karpsnaing
302,405,946 *1DE8D87C7D29F206580809EF79EA993EC62BEA54 TEAGUEEUGAET3
302,405,947 *1DEF08368C53F56D33D35FED5C2465875423B192 KBXPRINCESSRENAYX
302,405,948 *1DE11567FF092A6D4E3BD80EC7EA0712ACC5A5B2 KC.LUTZ
302,405,949 *1DEE89E75593D9C441041144AA2A007C66F47E4B KEFIRDEN
302,405,950 *1DE9E9ADE573048047ABA8EFC1E65E16B39F4549 TELEKABELN
302,405,951 *1DE12E84752C834FB29992ED9B719B69E52E741C teletopo4
302,405,952 *1DE47BF3945158B8DD5D7235F500C0F6212FB1DE TERRANCE.MOHOROVICH
302,405,953 *1DE05C6506EECAA1853647D4B0D57E29E3BA5B6E KENT.AVERILL
302,405,954 *1DE72219832F53A7090CBF4105862CF39D39834A kepiss
302,405,955 *1DE58FC8FDA2BD14752047DFCDEB7FD0014315A9 kevensterner
302,405,956 *1DEB044BEC27BBEA85D1157220E2A412794F6895 kevincichy
302,405,957 *1DEC228B45FDE4B51BBB555331DD29317A08C0AA TGILDYT2
302,405,958 *1DEB9B2DE1709876B47A3590FE52463C1BC30DFB KIDM4NS
302,405,959 *1DED7E7BDE67F3EB66F4A03D81B6609F0805596F kieleemme
302,405,960 *1DE805F03B45EE33ED5998126F55D64555F9C352 THATMUSCLE2006
302,405,961 *1DE786DDD602720D2501DFF2ED2E6D42BDA335A8 thealpha163
302,405,962 *1DE221D20139AAEBC67FDE4A93B2E39C5F2C916A the.girl.with.the.fragile.eyes
302,405,963 *1DEAE1E124897B1A2B09D8CA075AF827CE38419E THINYK
302,405,964 *1DE8A24D76EE69F6F411F26CB39FFFDFCE46C8C5 THIS.IS.SO.RETRO..BUT.I'VE.GOT.A.WINDOW.I.CAN'T.GET.OPEN..
302,405,965 *1DE4B0523AC9AE0EA64D69C2C036A0D98DBA11E2 thjeballadofleemckay
302,405,966 *1DEA98083065C45691F8F79CAB3343B4E2645F5D Kozoktatasi4
302,405,967 *1DEFC6477B4DEED1B5C87AFEE69F1224FDA6D52E TIMIDITO5
302,405,968 *1DE93DF994E35647B98C842E09C9D78591776ADC kristallisationsfestes.
302,405,969 *1DE6CD87A2FE84895451045647C2B804B1FE0C97 KSLADEK
302,405,970 *1DE471836E430FB18BBAF1ECE09B68042FC7FF51 KUBBESINDEKI
302,405,971 *1DED010A69F3A869A5219F5675661AE2D51D1FDF [email protected]
302,405,972 *1DE12D3C7C3F6557F25032568EDCC9308A1D000E kwaliteitsprogramma
302,405,973 *1DE443A15B75F0AE43517DB4DDA0911B44BF07B3 LAURELRAPID
302,405,974 *1DE87663A320A553BE123D65F255838924205FC6 LAUREN.MIXDORF
302,405,975 *1DE16E413D1178830D74A7C323DF857374FF313D LAUREN.UC
302,405,976 *1DE6B940939801DF771D6319CDAAFDAED34160EE LDSJ
302,405,977 *1DEC38803C111044C1C5154B6C40D5171FD816CD [email protected]
302,405,978 *1DE561B3C52D83F1F5E7AB3AAB7592B6BB08F547 TIM.ZARR
302,405,979 *1DE2E61F38A2227BEE19C56169FEDCE483BDFF89 LEONARDO.HEFT
302,405,980 *1DE559C6C97162BEAB5D5C5AF1D90AE24938D7B0 LESLEY.MCGINNESS
302,405,981 *1DE5F506EA41AC1036A328B8BF648C2719ADF49E TOBACCONISTS4
302,405,982 *1DE8AD65186B4D5228AEE90C600A7F76260594E5 $TOMACH1CNE$$
302,405,983 *1DE186F6C86695CA3F5D83491AC4B868575A1FAC tomfriday
302,405,984 *1DEBDF1EAAC5ADF4936C6920A0AAF9CDB94AEAE1 TONY GUINNESS
302,405,985 *1DEBCC06431C50752B413D88060E4E9C18111421 [email protected]
302,405,986 *1DEEA9FAE6CF46C5851822FD7698E0712C0868B3 TRAVIS.BOSARGE
302,405,987 *1DE263337E9F53D74F1DD3E804931EE98EA66184 LF_J
302,405,988 *1DEEE091A336E7373FF8B5272207B6067F1347B6 trevorarangies
302,405,989 *1DE3DE02278573287F1AA2AC3D7975AAC0975817 lieven-bersen
302,405,990 *1DEF59D2C91782091805616E8F252050D6A0D2A4 LINCOLN.FERRETTI
302,405,991 *1DEA5CA4A7B12B9AD15E26E4FAB4C7E3A71CD33B [email protected]
302,405,992 *1DE1D171BC304ACFD90760BDDD17266451224A33 TRRATSEGS
302,405,993 *1DE91C5C2D4DA4E3B4EE28F92D1F10E2C6AB9A92 TRUCKBABIESING
302,405,994 *1DE2DC9CC2CB75A4CA77B646201CBE9F096EC0B3 truelove(vocalduetfeat.gracekelly)
302,405,995 *1DEC15000E80682588414BF01F652ECFBEE6B4D6 LISANDE,L88:ACTI,SCENEII"VOICICEQU'IL
302,405,996 *1DE1C23842AC9346023C1A22DDA4D9F6E56B2A27 TU.SIEW.SING
302,405,997 *1DE56D2D4D2892111E0850CAD47740FAEBDEDDF1 TUTOYERS9
302,405,998 *1DE426DEBD9D48A374ACA4BB2F4658A532221D55 loocheni
302,405,999 *1DEEC17A6839BD592426E2B50B9CC78251180A1C LUCIA M F
302,406,000 *1DEF05066E83DABC4A0608A01FF82F93551E89BC luciosomableekeri
302,406,001 *1DEC3EDCE51052E2AE84FB4A9C8FACAB4E510980 LUCYMOSES
302,406,002 *1DEF9B12B721CB17038A09B3C392CEB96DF978FA uguagliavo.
302,406,003 *1DE9D67D42482F25C76DD2A13F75DC1846CC36CB UNDERBIT
302,406,004 *1DE0085D0E6E02A7AD5199DA337BEE2B59FF0CF5 LYNWOODMOUDRY
302,406,005 *1DE0B721B4C14591D9F22EB8D49D002D7C996CD6 UNPREPAREDNESSS1
302,406,006 *1DE62FB7D7164047F5B570BE44B8ECC16BB9BA2A UNTREUNIONTWENTYTEN
302,406,007 *1DEEC2B39CAC28F4433C92DD39BFBF0F9920A67B UNUTAMAZ
302,406,008 *1DE01CC0B511FC18D301F90F00ECC3980915257E [email protected]
302,406,009 *1DEA1344C9F8C93C81AE3C26AFC9889EF0107637 [email protected]
302,406,010 *1DE7494967133B8F176C09B1837C15C75C5C84D8 MACHINCHEE
302,406,011 *1DED94423097E3717F80A85C759DBB5E7F0C346A URDIEMBRES2
302,406,012 *1DE457150139176AE214982D694092F66BAADDA5 [email protected]
302,406,013 *1DE9E9EBD6F1FCF0A26D324E301C4F44B61FB8F3 URSULA FAMBRO
302,406,014 *1DEB77323525849AF212E62DCE39940C1396B9C6 MAHIYAK
302,406,015 *1DEF2A74351A05A6765BF3DA1CF05BA38E946CB3 [email protected]
302,406,016 *1DE5E88270F3FA5939662A970093A76043EF359A [email protected]
302,406,017 *1DE361B10B10FDCD222C6158131947B4D10F401D [email protected][email protected]@70n
302,406,018 *1DE5BA50F8B0B933ED18D08515CFDABB6B3DFF28 (ヴァネス・ウー、van
302,406,019 *1DE4ED5E7C6C160C7D3F7A0C8BAC09936C0EFFC6 marycomfortleonard
302,406,020 *1DE8EA38649E0EBEC7A9BFB7BDF9CFEA6D01D1E9 MAS-DARTIGELE
302,406,021 *1DE27C44B3926B76378E3CFF5440C51CE5C393A2 MATEI-JEREMIJA
302,406,022 *1DEBBD900CEF9911374C284991F3DA0EECA6CC2C MATERIALITIES
302,406,023 *1DE5293F941FBF4F702F5C632F07D15B16F0152A VFARAHPOUR
302,406,024 *1DE46A2A7FFF4D1317B48CC9635325F272BDDA6F MAYNARD.NEUNDORFER
302,406,025 *1DE20003D985356037BCF02F22216DA5A1096486 VICTORGOSEWISCH
302,406,026 *1DE67218D45BAC2473ACE63F1D4A8B92D2B07D82 MEET3
302,406,027 *1DE8C84328E60F48E3841A6E637931605958F23A VINCENTDIDOMENICO
302,406,028 *1DE31D634F3795FFC77296484542127B44870C43 VINCEPG
302,406,029 *1DE43D888B033262CBB1232F95519AEA4E946E7B virgiliomilward
302,406,030 *1DECB23BEC2E907108F7BE7BA92744D31FA8F518 virginia.heredia.rodriguez
302,406,031 *1DEAEE83FEE1CCC55B5E345FEB602D326F9743D3 merlespieker
302,406,032 *1DE254F9C11C11325542D514FEA5E5AB0EF901D6 mestten
302,406,033 *1DEADD6A7EB2F3EF5B5936C6EB2A70B7DD93C90B michellequibuyen
302,406,034 *1DE31A7D0C1F33B8C84A9947BDDB6D293F79ABE2 WAITING4(BADBEHAVIOURREMIX)
302,406,035 *1DEB5851CED1C388501B8A61253B7BB40B7DF4D2 WANDACHANEY
302,406,036 *1DEC1BFD3AF21ACC6519BB1C2BA9082A11A58798 waqasferoz-waqasferozkhan
302,406,037 *1DEB799070D435D55AFAB312D5C6EB208D342D4E WARIUSU
302,406,038 *1DE367C878812CB65EC33D2B2C2D39E8A7EC49C6 WARREN HELLIS
302,406,039 *1DE83CEE7F53FB13F8E4F9EA60B2D5DC3B1E9429 [email protected]
302,406,040 *1DEC54D23917BD6434DB2E5C6CFAE4222C3FB7A1 MOLLY HATCHET
302,406,041 *1DEDB59B4347601F73A8FB5C82C5D2C5B4482CD5 [email protected]
302,406,042 *1DE0C4108300E159F0F90E2A49E2EC6B75484BD7 wendell.henton
302,406,043 *1DE4BA5873BCECEDFE0EAEECBB0A071D2966C2E2 [email protected]
302,406,044 *1DE5FEFED9D1CC22BBD74D80962A535F017ED84A WHENTHEFOGVEILS
302,406,045 *1DE3181C7D805FB26E6228D73A4C7CF6370CF346 whiskytinman
302,406,046 *1DEE61672C4640DC605E7A2E2CE75B7BB6E77643 WILBERMADRANO
302,406,047 *1DE21B4C64894EAB37365A1CC244B1FA44BA9F34 myjackson2007
302,406,048 *1DEE6C39F9F182DDA32403114D189A333D735C43 WILLIAM PATRICK
302,406,049 *1DE0BE5B912FE6A627F9E7B130012F9299501240 M(ZK
302,406,050 *1DEF6804D91D7344F18E112D1BB7397E41F97A5D WILL.KULACZ
302,406,051 *1DE06B123FD2EE52708141DF6BBC7D52140C69FF wilsondetroit
302,406,052 *1DE2DFBA73B6C8E5973F153AB2A5DC537A11041B WINSTONOSTLER
302,406,053 *1DE7B7B35C65E774A7DF1F249523CD8CB01EADD3 wittiered
302,406,054 *1DEF9F77BBE380AFF409B34FAD5B6B5FF6EAEA2E NATHANAELSILVANO
302,406,055 *1DEE48297FC2C37B82C6A3FD3C40D96C1C80EAFC wodzierad
302,406,056 *1DE9100B91D9E5593C6EAC34C943EA6D261F4A23 wolowski4
302,406,057 *1DEB583CA99FEF1055931F98C7FAE6AA98183784 wren.bennett
302,406,058 *1DE24A64F4695D3E364AA60C9181E1E8106E07F3 [email protected]
302,406,059 *1DED9454965B8D6858ACCE58398699EA883DE448 neencephalic0
302,406,060 *1DEE741EF1FA4003713966116240CD011D91F1EA wzyg
302,406,061 *1DE482C274882884DDA93CA25ABF15AEA3D9EBE8 )X(~`<8
302,406,062 *1DE630917C1ED179AEB3ED3BBEA906982DB991C4 XECUTIONER STYLE (FEAT. BLACK THOUGHT)
302,406,063 *1DEB31F79062AAE193460ABB32BCD1110E589BD8 N*K
302,406,064 *1DEA98DC504C795286B46CEC36FC64A5C5EAB175 [email protected]
302,406,065 *1DEC006A0295375C481051C4FC626BB5DC910002 nothin'-left-but-leavin'
302,406,066 *1DECD4D2F2FDABBCDFC0CA8B45AA98F657FEE979 [email protected]
302,406,067 *1DEEBD0F5391E09793D476B9C4F755E212033343 NSDWRS
302,406,068 *1DEF3E61E3F1A1F3A77960DA6E8E5CEE18113A84 yana.miasa
302,406,069 *1DE686C5A4EF1ACB87A830C1D14849A8867E36F1 nus>
302,406,070 *1DEAC31A9ED0CD366489039736C1035E725E8429 NWF*
302,406,071 *1DE9D91FC816B104366B80ECA16524D06D768E85 YBU256B
302,406,072 *1DE680283665578351D019D516DE8E7E1785D8B9 yeakubchoudhury
302,406,073 *1DEB3E7E6D0B80A5BB8CD9732EE520DC05C36310 yimsr3
302,406,074 *1DE8DD53A784F72D7604EBCC85BB9B70D714728D ylatisleber
302,406,075 *1DE66583E14CAFD0A5233A6356648C88709B0D0E YLDETNIOPPING
302,406,076 *1DE96F8322B9B666D18A6594A6DFB4B076F5F9CD YOUNGPARISIANS3(1978-08-26:ISLANDSTUDIOS)
302,406,077 *1DEC5DF2A772EE4BDD085DF4781A1BDEDDAD4424 yuthanawongchai
302,406,078 *1DEABC01459C862C1149B78A0BA3D14C0AB29D87 ZAHIDATTARI
302,406,079 *1DE32A75AE2583FF700854A1665A8B56A3289947 OMNIBUSDIENST9
302,406,080 *1DE360BB6C0B03E87C455E95D6199FBA69641537 ONAGOLS6
302,406,081 *1DEEB72C33BCDA18AFBEB3C082775089D89CD0F7 [email protected]
302,406,082 *1DEF07625591406545C633EB19CD71FF6731158D [email protected]
302,406,083 *1DEB36ABA0279C9842ED524AD8317E307028F8C1 ORVAL.SHRODE
302,406,084 *1DE51C90DA56BA32F80473B7600460D740E7686C OSVALDO006
302,406,085 *1DE8AA956A69C2E63C6434BFDB95E68C5A6EF781 znajdziecie
302,406,086 *1DE3A78C4E1820CA9DA8272E71EBD7A46E493B8D OUDJQS
302,406,087 *1DE5132BDA242769059AC1C317393D43D0AF1462 OU'R
302,406,088 *1DE73FB305B7356DAF4D4A9DD9328EC58DBBEFA2 zyr|
302,406,089 *1DE83499C932579D6C095F462467135A485CFEF4 p===)~0sploit
302,406,090 *1DE0BF0C6150F4ED12F524FE39DAA55FA1E105E2 АВСТРАЛИЙСКИМ
302,406,091 *1DE59D25BA7EC9E66EA3F2F11D7BCE69806770A8 ЗАСМЯНОВО
302,406,092 *1DEAECF58C2BDE2F653DA7B429897646C1AA7B23 PARHALLGREN
302,406,093 *1DEE694E18B4CC7A9F1A100F7AB2FD0FB4FDAF31 [email protected]
302,406,094 *1DEE2DC7C7A5F75E86C569F7E151B7EB8EA74EC7 нововкрасне
302,406,095 *1DEB6E9D0555D3698F17F09C2CD2E24B2D672240 ПАВКОВА
302,406,096 *1DE123CEF39FA932AD5935675A3B2DEEFC7A0E81 PEARLITE3
302,406,097 *1DE3555ECF709876CC4E4AF4F7E63B1AEE9AF468 PEZOLDS8
302,406,098 *1DE8661E711D802763BCFD799C6B0E529AB6C6E3 PRÄDIKATENLOGISCHE
302,406,099 *1DE12CC36840706F6F1ED8B281E9D6F1B38640E0 PRAMĀNASANGRAHA
302,406,100 *1DE3BF29CB64D4881E8211B5964AF0EBFBBAE08C p(S
302,406,101 *1DE399EF5B63EF30348BF1498CB709D67ACD1D11 Q#D ~0 )O(
302,406,102 *1DE49E08D383B6EEFDB20DC3E7E900ACA57D9E46 [email protected]
302,406,103 *1DE50606AE5B9701E8B347742386F3AE0370FCC0 QO_V
302,406,104 *1DE0AECC93D410C078CBA886182F48782EB0D2CF Q'T!
302,406,105 *1DEE38EC24DA99C389FBD358BC8FD48E181D5BD8 r9?ivih
302,406,106 *1DE1A07B99973A3EA4178F822144B04370860292 randolphbrannon
302,406,107 *1DE6EDE4381709456F7B2DF459CC56A400A32537 RAP131
302,406,108 *1DEFECFAD09E8214A37DC312F220D6FA1CF76B3A rayfordazulay
302,406,109 *1DE745E387047CB450332241244E5334AC7C4D7F RAYFORD.MEHOLICK
302,406,110 *1DEACCE66E226769250C2EA672E5B927904767A5 071CHERISH
302,406,111 *1DE21F719EC21D5E8F58B9CDBDBB0BAD2DC6E996 reginaldachor
302,406,112 *1DEF8045BA3DAA5DD183911E63C088DF62F3096A REMEMBERAMIGAED
302,406,113 *1DEA703F71A84294BC2ED0B4CA9ABFBEB8272829 [email protected]
302,406,114 *1DEDCC6A5AA5203E7E938F0EA364DC50F04BF9F4 RESISTENTESED
302,406,115 *1DED95CCA33300CFA77519B2170E72CB40E02A37 REYES.WALLING
302,406,116 *1DED411AC5676D77C0DCAB1E53EBB875268241F9 RICARDO.BOCHEK
302,406,117 *1DE42968528FE143AD9D2108C3511D4218EE62B3 RICHARD SEAMAN
302,406,118 *1DE636EA0E6BA7CFE2D6686356DD4F702F94338A 1011866 kalkkimaalilla-teht
302,406,119 *1DEC3F1138F6C5024E2CB13F75AD9E6907CB7762 1063598 seurakunta.kokee.t
302,406,120 *1DE8F2D0A4E30AA2BA647337512CD3B5D02ADD51 110352 filizlerin-beton-iCindeki-kIsImlarI-oynatIlmaz-
302,406,121 *1DE56FE4D099E9710390849A777614E27E57A741 ROCKYWERKMEISTER
302,406,122 *1DE8B1DFC44CBABBCE3FF9513B03C4CF65078E3C rodneylacau
302,406,123 *1DE56909836FA89C7B923C114394C7B6C87BAA98 RODRIGO.DENLINGER
302,406,124 *1DEFFBDFBEA395D2F9562DC849010A904C750288 rogeliognagey
302,406,125 *1DE4D0046FDC64C3D7463E3D6BD9D3CA10BC44F4 1554-porin
302,406,126 *1DE048C7788429563143DDE65BEC05482AAF0A37 159NAIMA
302,406,127 *1DEFEA455D63E1E5DBEC2406B36D001B627B96B6 ROYCOLUMBIA9
302,406,128 *1DE5CC125C44A288B29EB1DB8E8AFD0BF131AD0F ROZVÍJALO
302,406,129 *1DEABC58E956CE4703E50D7038172B3C875877BB RPRSNTRND
302,406,130 *1DE3910056C23AD7B549941F36DA0F36ED9E7A46 17-MINUTES-OF-YOUR-TIME...
302,406,131 *1DE4BBD07617EB57502A266E22AAA0D374995733 1985-03-12: LAKELAND CIVIC CENTER, LAKELAND, FL, USA
302,406,132 *1DE2D94FF2515690B99FE96E192E48382255909B [email protected]
302,406,133 *1DE12A000048722D6746510F2EBE2F15BF367225 1-choice-it's
302,406,134 *1DEA0435A0BCFEAAF770536A7898DB0B2000EEC6 1HAKIMONO
302,406,135 *1DE119D084A0EE294375E287F6427B58984377DA SAMUELVALERIE1
302,406,136 *1DE866F26F3B4B10A03C8A3FF06534F39D453912 SANDOR-CARON
302,406,137 *1DEC18135C5397124592F4F8509FC0F77DFF296B 1-KERTOMISPERINTEEST
302,406,138 *1DE167A4C4CFD998FA61EE8BC23E80D0BE7F394E 1landinin
302,406,139 *1DEFE8305F2BFBCB60CFB5C1BB0E8361246355F1 1.rytmih
302,406,140 *1DEF56C824C630259B4F20CD8E8B7B97CEB60E29 sheer-qurma
302,406,141 *1DE6A81AD551FA16B30EC1D24D7ACD7407600BC1 [email protected]
302,406,142 *1DEB554947B2634CFFD73EC3F52FBE1B6306C09F SHIRLEYCUMLEY
302,406,143 *1DED4D4FDDC9845D22C08C249E055AF145C32C9D [email protected]
302,406,144 *1DEAEB41DA1A5F37BD86B51CD7EB7A952BFC07B2 SHUEZGIXEF
302,406,145 *1DE7A3557C324F329139F50207226FBBAAD1CC71 』(2010年3月17日発売、DVD付)
302,406,146 *1DEA5CC7D626F21A789464D042E8B88731583FBF [email protected]
302,406,147 *1DED9B861CF62C33FFC00E11E9CE176D1B207D66 2265630 NICHT VORBEI IST ES MIT DEM AMERICAN FOOTBALL
302,406,148 *1DEF3C018BEED7936744289227EE6093D3788D79 23の技術革新にも反映されることとなり、迎撃戦闘機MIG
302,406,149 *1DE012463D86A72E83FB034D5C43244843519570 2-sopimuksellisesti
302,406,150 *1DEF6368CD252E6506B12DFDF96AF86C7FC95DCE smartrock
302,406,151 *1DE356275EFB9592637FBDA05DE9B13B5EC542F9 2 YETENEGIMIZE
302,406,152 *1DE0AD32020D768AA32A1B177ACF7D9483DBD914 3BBERIOIG
302,406,153 *1DEC907A79849C3318448197858FE9CE85DFAF05 3====)-~O~O)O(
302,406,154 *1DE2319C30E6F1461AE2E5CFDFDF30B88B1C1077 SSS62
302,406,155 *1DE37B133AEFBBCC768E23CDD95EF85B436C37AB 3XUJ3FF
302,406,156 *1DE0F5238205483AD7649FB29772DA2AE18CC8AD STATUSAN1
302,406,157 *1DE76C78A3A1ED64ED3A2BA9559B78165C1ACC2E STEVE.BRAZLER
302,406,158 *1DE387689916FBC9BD091E6921017E67C1EC1531 467PEDRO
302,406,159 *1DE2D1FC89A43350533EED73E7C33A3237FB81B2 SUMAŽINU
302,406,160 *1DEB9AACA62296A247724AD5A503FBC8A9889CC2 4SHORTCUTOFFDAMDAM
302,406,161 *1DE28ADE981FFFB4C4C5D4D8F96E695AEE52A696 SUNSETPANDA0
302,406,162 *1DE36F68C5D76DD6580DD7FD958EC08EE07B97E9 sunshinebaby
302,406,163 *1DE8F617282264CF9A4BB76E83BB22BCAE15C4AA 4SRIVKIN
302,406,164 *1DEEC77CB1CA8634B7064ABE8AA6791A29D7FEF4 SUPPLAUNTINGGED
302,406,165 *1DE14C94026F1A696A23782F1D54B795F9651C4E susansiekierski
302,406,166 *1DECFACD1DD28E6FCB8BA8B3363DCD88D42A1823 TALK92.10.220.222
302,406,167 *1DE2443A0EA8E0A346752B1F57C0A47B3D979460 tammy.etto
302,406,168 *1DE5C4A8B45EC4981027C3DD5E5CE5426634024F TAMOUH-OTHMAN
302,406,169 *1DE243E3CCB7D0753FAD984C4A6721E33D725C25 [email protected]
302,406,170 *1DEF1C9B94E5B114F5F4DC1AA233BB744F2DDE1D tanoboy
302,406,171 *1DEACC4654C84720D390C066E389F7E9F1AE5705 5hummer6
302,406,172 *1DE746CA878E2EA18E3CBEA57F9BB888124E0873 terrenceholcroft
302,406,173 *1DE1DAC148B9023391C8B923174FAC1BA68203CD TERUINOMMA2
302,406,174 *1DE95C7B0611EC0BEC6ED9967959A556500D5BA3 5NEDLOREGNAA
302,406,175 *1DE89D19E408944FA8AEFA13DB694BDAD45D94C6 5POLICETEN
302,406,176 *1DE9465BEE024F20842379DDA25DDA942467981E 6COLTRANESHERRY
302,406,177 *1DED376D9E6A26C752BB42D91DF872F218FFCBEE TIMOTHY.KNIPP
302,406,178 *1DEB50B605A9E96A1A16E11CF3A15C97458DEE5A (TiP-BY-SQuaNDR)
302,406,179 *1DEE1FE17EAE3430AAF4E3B9885677185257C490 6MARLEYSTAR
302,406,180 *1DE1808C431BF5BD07C368B0FA3613C53AC9C8B1 [email protected]
302,406,181 *1DE9E1C88CB9C5D5100B4E4463C81312EEC4D0AB TOKORENTN1
302,406,182 *1DE7F92C432240CEBDFC65764D1816F4142FDDFF tomaseaker
302,406,183 *1DEB3C5DE14CFDC9A8653D2B3ECD27D90044581A 7BARBARACONCEPT
302,406,184 *1DE48A70B55D2B566CCC1430F3E3B60F489B3CB7 7.gambon
302,406,185 *1DE1392C39CAA93CC93A558B58209EBCB4C85CB0 884SALMA
302,406,186 *1DEE72DFCA8F74B3470DFE435F37748EA5D2732F tracy.pelletier.zaleski
302,406,187 *1DE29B09A6B21C20ED3A0075BBEE27C77E392F9B 8CHIPCOCO
302,406,188 *1DE3061B8CFC5436C7B38DDBBD185B01AD7C4A13 TRINYRAJAN
302,406,189 *1DEC112BE20AE04D02087DCFE6514BBF13A22E5E TRISTEE ABESAMIS
302,406,190 *1DE28722EB39DC44F451D339AFE118A4A0031C52 8RAISTLINDELIVER
302,406,191 *1DEA82C8A36E5FFFD1E8E0200634AA8927F42D05 TRUMAN.FREGEAU
302,406,192 *1DEDD5936A849B77D50C3D3EAB1591B01BA22892 TSTATELER
302,406,193 *1DEC34B9A5CB17D6CEF58BB5C2B650F7030DF071 ttdskhz3
302,406,194 *1DE2ED4965EF44A261539212D45C42AB6F5A952E 9DOUGIEX
302,406,195 *1DE472D48F6000FE6267FBF30B945285A1B5FD9C TYRELLWITTS
302,406,196 *1DE193FCEE17FA62E99DA71F55B0D14B031CFE9A 9ILUVALICE4
302,406,197 *1DEDDCFE5AE0BD4B902D144B45AF840BA74404F1 9NASCO
302,406,198 *1DEB083B1681D464174B0E1DD6E5AB679AB10460 u7vl
302,406,199 *1DED3CA94F8AAE527EF4A8B5974984B34FE665D8 uglywhore69
302,406,200 *1DED82DA61719EDADB0F4A31BA4D6BB65F14D07D UP$B
302,406,201 *1DE7484A8C4DFEB952A80AF2EF6EF8BC93C2791A ABAKADBRA6
302,406,202 *1DED96C75D80C93EA1E880CA45EBB8761C1E8A29 usplf
302,406,203 *1DEFD0713EC66C6B69A3B7BAF58DD2A4BF937556 ABSTEIGT“
302,406,204 *1DECFCC9EF60E9F82A2755CF5CFB8E873ED8D747 uxhf
302,406,205 *1DED83AF43D82D15AB70DE4C889D549501FB2D67 ACORAZADS
302,406,206 *1DE1C423114023E516B98BAD5CDF15571C7F768B [email protected]
302,406,207 *1DEC9C932CB789DD57364A163028786F5787368E acuragsr6
302,406,208 *1DE397FD1D09BA3F972274B83192E2E6E066F8B1 aegb?
302,406,209 *1DEE645852959CCBD1DA4E443CDC7778D42A6F5B agx;z
302,406,210 *1DE2AFE9EEB1931155388FCFA5E9EB1619B1AA34 a/k?_
302,406,211 *1DE81FA3F14E1754F041B22C72F73C70C3946288 W7+G
302,406,212 *1DEA994B7D311D3EC9607C7FC44694537E7F9D12 allison-accurso
302,406,213 *1DEAEE3CC9AA7F3DD9BEF279FE6EC6C5FADC1E75 A_M"
302,406,214 *1DEFB8E8FDD9272286B66A75C697BA3C1D9D741E waltz-from-sleeping-beauty
302,406,215 *1DE0F13DCD858DE8FE77FDFCA2B9C2CD392AA548 WAN-MOHD-NAZDROL-NASIR
302,406,216 *1DE06A89719A2FC6D5D128265588B42113685B90 WARREENACTMENT
302,406,217 *1DE524FDE9B8C800BEDEF76D4970B2BFA95B339B wendy-lynch-mcphail
302,406,218 *1DE848F23D670F20F7FCE1423447DB5F14997ACB androsenko
302,406,219 *1DE3E5A04F1A3CFDB086B0AF78F9738E56E66D16 wennietahanlangit
302,406,220 *1DEBAA4E890FC1C8D41A410165E7E26978E9BA6D [email protected]
302,406,221 *1DE6CFF30A4F52DBEA87643900442F34D1ECE50E ANMINISTRASJONSENHET
302,406,222 *1DE823E8CEDD311C295EC9686D6B0DAA67BD1E56 whatyousaw
302,406,223 *1DE2400E66A21538C46168F318F98E77A342527C anowarul1
302,406,224 *1DE490CC18C6ECCE067A92754DEDCD93F4E3C773 ANTONYEMOTO
302,406,225 *1DE79B6735BAFD65B00DA25FDD8A4869CC5AD1D5 ANTWANRATHFON
302,406,226 *1DE5EB781EF15E0501156F0ACE73E24DBB9B5073 WILLIAMGARABEDIAN
302,406,227 *1DE8A135868C2C23765D7276DC0A100DB084FACB A/O3=
302,406,228 *1DEEC375CD227B458A873C9F804AE8BD959DBF7F [email protected]
302,406,229 *1DE4EE52AD40AC7F59C5C5647AAE8D564AC0DEB8 [email protected]
302,406,230 *1DE84AE94CE758AC2149D1F700A2650CB86A3B88 APPYAMPSTEAD
302,406,231 *1DECA38E773F6735AC7E4DBB9A8E3CE9E48B9814 apug=
302,406,232 *1DE6A96405588012A299AC8009561082F3E85369 [email protected]
302,406,233 *1DEB8D68CC8D9A79E1827CA6C4A2A139FF9C0EFD WORKPLACE’S
302,406,234 *1DEFDFC65DE46F8683093A0B515D447E0D02587D WRFKNTRN6
302,406,235 *1DEC76F2AB380292277A20A5EAFE2CE80DE27B7E arizonapló
302,406,236 *1DEE5AE7D1AF6C0A75442676FD7A91BD41A2B781 WWWEAGLEGATECOLLEGE
302,406,237 *1DEF429C657810BB47434D134066068B1711D7A2 WWWEATRIGHTNCORG
302,406,238 *1DE1CBD1770401ABB3ABE1130CC5608F484BCA0C ARNAV704
302,406,239 *1DEA06309536F119C2BF36591A660345B446942E ARNAV96
302,406,240 *1DE639A73FEDA889257B366F9BC94C1F2635173B wwwsignosemiocom
302,406,241 *1DE578F160CD8AF6E4DC1FD027B699CE190A182A ARS#?
302,406,242 *1DE075F2B58141FF160FA9D318FF3149474BBD0F [email protected]
302,406,243 *1DE6A88FAFE6C6475963880ADB0E181A267F2B96 AS3-T
302,406,244 *1DE04A50D38CA6BD17F3212C285B89A74909F005 ASCHAWIAK
302,406,245 *1DE4369D91EC0FAAF93A09CD304DF03A155254C5 X111761
302,406,246 *1DE39F196F5077CCAE45C973B00829CDE03BFBB4 As"f
302,406,247 *1DEA2E76EC4640745901783CFE8427A97B9F712A [email protected]
302,406,248 *1DEA5680BECA77CC1639F1E2F3EFD8FA709CEDBF AUBVECWLDZXK
302,406,249 *1DE1CDB0EB2E8502ECA0B01E08F05F1244E61F1C autuakru3
302,406,250 *1DE71C75B2546CDE1A0C19DFEA66961916D91155 [email protected]
302,406,251 *1DEFFE78284B7163D97AAA724FE0140A6101C4AE Y8%7
302,406,252 *1DEF636B0A468197A12B67DF2C45C8FD57C55AA7 [email protected]#
302,406,253 *1DE315BF6D346EBC55CBB4FB6E5DCCBC3C10EE8F yanet.santacruz.varela
302,406,254 *1DE0ECEA4A4CCC86EBA3430E2CD831AE55EFADF9 [email protected]
302,406,255 *1DE099DC8527146B7CD88470FEB044992B3C2B49 [email protected]
302,406,256 *1DEA821C73608B1FD2DDFE643D4AC59D0C5F1A00 AZMREHCS7
302,406,257 *1DE49B7554D49C920DD42BE6036773389161521E Y.CROMOSOMA.AD
302,406,258 *1DE1C68CDD8869B3231C0E75D17EA39F4B38B5DF B0E0C
302,406,259 *1DE91E9020DD6D1EB0C8A697240CC1C5AC8788CB B!6KE
302,406,260 *1DEDE7039A0BA15489A3F3B499698E43C91BF07B ba-gz
302,406,261 *1DEDB150BF68AD2ABA3305FADB9071CEF2D85A70 YONEJEN-GEMARANGAN
302,406,262 *1DE0D9731C72E1B78B1A8D049D79E328E24351B9 YONG.BERNET
302,406,263 *1DE1EA6DD4A6372643C83B3F5C8879AC8739B986 barneybeidleman
302,406,264 *1DE8678E019B6C36C2EACCAD5B5D2682336A6271 [email protected]
302,406,265 *1DE782EB70ED38F4BF82F306F08230ECB803E36C BASFMARK9
302,406,266 *1DED24F3D4CF4B1B09C6D6D033EB928A953A68EE YUNJONG-YOO
302,406,267 *1DE52BBC0757AAB2BBD28BF79E2D6FCAF0C39465 B###D-~-)8(
302,406,268 *1DEDB8E4535A99D2A1B1741564015C1C5067B5A7 bd-m$
302,406,269 *1DECFD6DAB0F8664B0751D42CECC08498D42ACD2 zacharyshieh
302,406,270 *1DED478B96BA14FB5EF3D52979A8B79EF0C6B1DD ZACKMCGLOTHEN
302,406,271 *1DE09BD2EB2432CFF13FF9B8E29A57FD8BAC64D2 zaidsaqri
302,406,272 *1DE4D64C8E26DB27E9A2097C080865CBFDC440F1 [email protected]#BEREA
302,406,273 *1DE5D17CEE06FF337C3C4B511FEA23654B5B10E2 ZEZEALAMLEH
302,406,274 *1DE794B81AAE41715D179761F92B6867B4A0A702 [email protected]
302,406,275 *1DE6195CC2B6709D3701A7FF0CCCBD9FE6C2A471 [email protected]
302,406,276 *1DE186D3ED40E82F6784D72496EFCCAF019A66F7 bfgnm
302,406,277 *1DE8D08A0139548773CBA22974B762F517E30274 ΕΠΑΝΑΧΟΡΉΓΗΣΕ
302,406,278 *1DEC3BFA80CCEE58CC7F7C274BA0CDD4B1D27414 bk(%/
302,406,279 *1DE6B08237AF696832CFCC697651890695950870 ЛИРЕД
302,406,280 *1DEDABC54F683E38E61F7680B23E6F27DB40330B B----P~O~osplat
302,406,281 *1DEF41AD22FC9C0A646D241E72E5E50A5D55B69B BRANIMIRL
302,406,282 *1DE3D1CE8CEB073A506D85FA6E0A21B4C3DB41AA BRENDASTUBBERT'S/BREEN'S/THEREDBOX
302,406,283 *1DEC52410267DF7534549E8FE58132CAE30BB372 BR:QO
302,406,284 *1DE4AE856A38DE10B815E4388BB5E5A7751A280C BSWPFACETRGB
302,406,285 *1DE92D2007B79C2B3B8EC432BEB5851259140369 bswustimenkobsw
302,406,286 *1DE36346CC0F42B73E10F371BD75E9C4595BAED1 bt/b=
302,406,287 *1DE4BD2C8A9487CA42F36FFE0A7CE2DB8DD1E0D0 buky9
302,406,288 *1DE8A2628C1531736823662C0F2841CF044CDB12 BUTTONWO4
302,406,289 *1DE1333283A25E231F9804209B3154AB1A017F83 BV17M
302,406,290 *1DEE27886B2D4B456EDF872CC730026242DB0CD7 C4L4M1T3
302,406,291 *1DE2AB51A34B5CE7928CEC7441940D60F98B3516 C4LCZ
302,406,292 *1DE4C6F8077421BD3C92134D53BF980BC71C5C3E C8R5
302,406,293 *1DE509DF6F73E77B54F32890EAEE8BF92B262BC5 CAPOTASTOS
302,406,294 *1DE5E261F2B77D0D06A2DF7104DA0BD5A9BB5F97 02131319
302,406,295 *1DEF986539C252BB2C651D107CFAAB2A8DA2A2AE cb)s.
302,406,296 *1DE2BA3F7F564924DC8835F1351ECB1A8855A088 c&drb
302,406,297 *1DEE9B27B88457388A3D751ED03778D3D5661C9E 11041441
302,406,298 *1DE957EFB46623C8B828402108C0BAD58D7D3B05 c-e(e
302,406,299 *1DEE048B45F4C4F53D9DB4146312A2CDD8077E3C 1205957 JUMALANHULLUUSONIHMISI
302,406,300 *1DE1EC012309A233FCCD6B83D98BC84F87531FA4 CES-DE-CLAVECIN,-BOOK-I:-SUITE-NO.-3-IN-C:-V.-GAVOTTE
302,406,301 *1DEB9A1DFA8A856DA42D571CD2044A956BF83ABF CHARLIE1ORLANDO
302,406,302 *1DEF80F11BCE198E902C94014817451A2B54E178 174321 esitys.on.t
302,406,303 *1DE130301C41A7DC9414D06FBEF859723A34ADC5 17ARYANA
302,406,304 *1DECA255E858627A6076995E835503115B5F90A6 [email protected]
302,406,305 *1DEF64AB2384DB2BF8D44154DDA85A9D346B8B80 1890PEPP
302,406,306 *1DED9587EDB6A9899225F054CE7F4D2BC766F74A CHOTCHOB
302,406,307 *1DE1966535A132519071BCBEDD9CC47A1A88E14F Christiansen-(1964)
302,406,308 *1DEA79C437FCFC8F6189F7BAEAB9089E359425CE chvyi
302,406,309 *1DECF4997771019B15DFE5100B136A4B410A655F 1BIGWAKE
302,406,310 *1DE65D3DB6594CDB6E5C0E022637882BA9A519D6 1 CHESTVOICE
302,406,311 *1DE1E1126B05A7B161856228F9D0A3E345FA81D5 CJR8
302,406,312 *1DE1858728DFFB0B6BC0311650FDC392F1651A26 ck,j4
302,406,313 *1DE53B7624C617A7F9B9C63F0BD3C83995163DC3 1ESIKUVASTANDARDIA
302,406,314 *1DEF02C502A72B775F638AEA1AA2C907DE43D118 cl""2
302,406,315 *1DE6BAB4779FB4736E90D46FD9ED75AE3FFDA067 claytonholsopple
302,406,316 *1DEC5F71488A6E9ED011A6085BBAE0241D52E83C 1GUSTOSTUECKERL
302,406,317 *1DE2DBCBA8B33E08A7036248627A4E53175F7706 CLIFFORDMARBAN
302,406,318 *1DE75C00D6768D40F2128B703495EB356C825435 1joker17
302,406,319 *1DE4EA2AD731575E2B300B02B7F5AF17E567254F 1.LOVERSCHILDLIKE
302,406,320 *1DE240449A8ED4AD16A957DDB37A36F87472D1AF 1 MARKERS
302,406,321 *1DE60AF7439DD0F8CAD26E1F9A4667160502E494 cnko
302,406,322 *1DEEBC868C216DE7411C1CDBD4BB8B6441B986A7 C,O#3
302,406,323 *1DEA298DAFF528EE5948D5421236A6B5C3798070 1planungskongress
302,406,324 *1DE08CFA6C70CC6EE4F9EE739FC42F9F51B9F948 1.politikerdarsteller
302,406,325 *1DE0DD47093C889F36C70A03582B38CC40D6E9CA 1.senegalin-l
302,406,326 *1DE67672D78BC65178F9B3BD3BB3A030776C6BC6 1SUHDETOIMINTANAISEKSI
302,406,327 *1DE8425889CEF083E1DD35AED6506C308C2A5A96 1.tasa-arvotavoite
302,406,328 *1DEB0A8EA9A186863EC13D47C7FFADB915A13CD5 1.thyssensonnenberggruppe
302,406,329 *1DE9D0A38CAA364CBBD1BE689D244AEC6877ED49 COLIN.MISHOE
302,406,330 *1DEC9ED5541972FDD6391AD74EEFB114FC25F3CB 1UNTERSCHIEDENEN
302,406,331 *1DE582E7FA9FBBF48DD447ED3F136D042CD31E44 1-VAKUUTUSSANOMISSA
302,406,332 *1DEF4A224F0C2500B33250AEB592608BEDF202FB coloidea5
302,406,333 *1DE360CCC390676454E22DA070209024F94E696F 2056821 NIIN KUIN RIKKAVILJA KOOTAAN JA H
302,406,334 *1DE78F90D5972AF745193D0011D9188C6B81DB76 2101565 STATE RESEARCHERS ARE TESTING ANOTHER 269 SAMPLES .
302,406,335 *1DEB433A1F5606C65C299263313BACB06896AE6A 2270980 sid.390,niemi,mattiilmarip
302,406,336 *1DE2BDCC259C9C50597E408771AFC9CCA7D40E31 2283344 H
302,406,337 *1DEEA86C3EF4DA0A73CABF723660F6FFC4A78809 24.gleaning
302,406,338 *1DE3DE3BFE8DB2DE72CF332DC9316F14A7DDE9C7 24JAPONYA'DAN
302,406,339 *1DE83FD2AD737C6DFBA6A9F6031E509A81EE4AEC 2504877 pakkauksen-avaamisen-j
302,406,340 *1DEFB4AFE9ABC88D0386C3AA018B1E7D9F949416 2562176 die-heimbewohner-sind-geteilter-meinung-
302,406,341 *1DECD1AD0C9E5C0FE5DFE5D2A552F248BAA0DFB9 CON7ROV3R75
302,406,342 *1DE2DCA6BD20D206A005F0668469346A82A76CFB 2belgesi'verilir
302,406,343 *1DE43D362253E4DA86E6CB52596C750F0E3F998E 2BUEHNENBILD-SZENE
302,406,344 *1DE4B2F23BA735ABD96D2C824CAD9B8B0DC4F2E7 2ESSADOSS
302,406,345 *1DEE582C0B2C1719BA6121A28D215B59BD9EBCB9 CPGLN
302,406,346 *1DE9FA28946B95E760C7A223EC146E5848B44A86 #2G8
302,406,347 *1DE5466B45A136E397EE55A623B107BDEB8B1550 cpp.g
302,406,348 *1DE4B49150DAD984A280A26CE6A9DE061C283066 2.yansitmislar
302,406,349 *1DEAF0D4907BF0B2D9D00E3E25E371FD47379396 2YLBISUF
302,406,350 *1DEB7BD0AD9F6B92DC4913EB96BEA03C714B9BA8 c!(#q
302,406,351 *1DEF902777CEED67284136C8EB31B1EEACD1311C CRISTOBAL.NIEBLA
302,406,352 *1DE314DEA00C505537AEC05C95DDB092C1FF343E criticismsi
302,406,353 *1DE021B4BF789475647F01355EE4A8774785FA96 3-M
302,406,354 *1DEE891FDB389CD8529AC8868263A0DDD02158E5 3ROCKETOR
302,406,355 *1DEFB35CF81F476390DA47E26011B4E04EAFF392 3-thon
302,406,356 *1DE22C57DF8323268F9139076A6A51C2BD643506 CUDLF
302,406,357 *1DE2E6CE5C29872E55FFAF3460FA5A03368A385D 4CELEBRAIT
302,406,358 *1DE778C9C3F0D636731D19BE1D3361572E9A6784 c;vyj
302,406,359 *1DE4EF2D1A7DD650A29629F81F0207FFCA6BE199 4INDENIZING
302,406,360 *1DE53FF7D62F271A3BCB14A530DCD24CBCDD159C 4INKUBUSSE
302,406,361 *1DEAE20C3B081648C8672EFF8EBBF7E51995A5DF 4-KARKKIMAAHAN
302,406,362 *1DE7B64A0BD0F69C870D7EBBEB04F2222B8BD608 4LSHLSIBSW
302,406,363 *1DE1228F21A400255FC8922B5FDD936CCFDC13F1 4mestput
302,406,364 *1DE1723AA80E07C9AA179DC037ED78EFB1017927 4NTONYO3U
302,406,365 *1DEA88E3AD962B2CBF1608961AC609C531A0F5F8 cz+u-
302,406,366 *1DE1BD7725F5FC729D76F2E01F048AD56F4BAA04 4SINCANLI
302,406,367 *1DEC53DA321E8652BE5BDAA28DE6D5CC52618064 4SPEAKINGGIVEGIVE
302,406,368 *1DE58406F74C8F792C77BC15B8FC426884CFCCE2 4TETANOUN
302,406,369 *1DEAACDB07A0195B49598FCE0DA40028A0FE1651 d2,#g
302,406,370 *1DE367F4B4EB16079AAFD503264F054E3411C744 4Z0T1Z4T10N
302,406,371 *1DE9AAC024780E06065F46295B50E635D830D5A0 523JESSE
302,406,372 *1DE7E2D1FD721AF86A9266B3FA092DCF3AF73944 D+6CV
302,406,373 *1DE52E8BE50A7A65C4F00AD3825FFD243F3A6940 5FMULACC
302,406,374 *1DEBDD74E22A09876936A2FF6F3E545BA744A53F daltonleggins
302,406,375 *1DEE8EBA297F0C74C3ACE7248AB7782B8BFC385F 5hermeneutical
302,406,376 *1DEDD986AE8A0E8D7171A2C863D8E89513E21C17 5KOTIMAISEMAANSA
302,406,377 *1DEFB73E75157F9FD3AF91EB58167FE06D687686 danniedickenson
302,406,378 *1DE7E848F45D4BE95278BCE3CD7F1E79928CFB62 DANTE.ARNT
302,406,379 *1DED510DB417704418190BC969D309BCB9E6CEEE DAQMS
302,406,380 *1DE40491A9AF3EC54A1478FD755ED65C5FEF3ED6 5ROBBIESCARLETT
302,406,381 *1DE1A4A531F64782C47890EBD3F083C2DAEB42EB 5RSLN1234
302,406,382 *1DEA36F8887FA73A860D1845038DC1AE7930B3A2 5s?a
302,406,383 *1DEC4288E8804C02A35A615CC6E7FFB6A02FACCA 5thehamilton6
302,406,384 *1DE18BC8024CCDDDCA6132975F89ED8A44910CA0 dbbzo
302,406,385 *1DE23FCB698D2886EDD8D8CE9C1E913E2E8C728D d_e/2
302,406,386 *1DEAC58BC4904181BAC1CA8672AB7703565C28AE deconseillerez3
302,406,387 *1DE2CEF0FDC2AC2DBFFDCABAA25D02D79E12A8BB DEGROUPEZ4
302,406,388 *1DEE4AF499C04BD326561D2DDB732757507528E5 6PARKGART
302,406,389 *1DE89C61B61259CEA809F980C5C88C3B4266B76B deqkl
302,406,390 *1DE7AF93A86FB7888A34A028EFD827B9932F3C9C 6SUTAANAAM
302,406,391 *1DEE00B8B33E13FCA2BE8638ADD838F72EDB3E12 DETROITPLATO
302,406,392 *1DE31C0E85673E2B28F4A51BB321B9BB2222EC8C 6.VAKUUTUSYHTI
302,406,393 *1DED1A0E4C81424678BD271C859AAAD50D6F5533 749ANDREW
302,406,394 *1DE25D24684DBE6890016CE1DA384B9B72878EC0 dhsrx
302,406,395 *1DEEF8F0E45A93C6519660615942E57E8BE493D4 7BOWLROOT
302,406,396 *1DEA90CF7E460A464CAE2843926040B28E2CDB9F 7ERTTABE
302,406,397 *1DE7515827F2A1F85D2B49162FBDB4D236C17B04 7ETSIWEGFA
302,406,398 *1DEF0ABB0E6CA2EDB0862FD49160155B33323127 7HECTOCOTYLISES
302,406,399 *1DEE8B0F44B864574B0DC5891D6CF2A18A3C55BA Die-hard
302,406,400 *1DEC662C525CCE57EFCDC0A986B59F3D650563EC [email protected]
302,406,401 *1DE11E4AA5E7A69B4C6F2D3BDA30AC88D7AEF3A4 7mysafety18
302,406,402 *1DE8A10D5C9FCEFF1B2361C7BBF76158037B6969 7OKSCAKUL
302,406,403 *1DE51EDE848A20FD9A5D763D7D59F953E5470BEE 7TELECOMDOC
302,406,404 *1DEF93627C45C108C71F65DAE3C810CA4BC47296 [email protected]
302,406,405 *1DE8F81AF196126B6D086F4A60405444FF21FC5F 7TORNARIANS
302,406,406 *1DED35EF09D524D6F0C1526BD5EC1B6C972F90FE [email protected]~~(_0)
302,406,407 *1DE2ABCB84B26A46CD094414978C0AAC6D92E662 84-finery
302,406,408 *1DE159E5F2F7B2845B508E04B4980ABE0936D575 87u785loe6
302,406,409 *1DE9350D06EDA1B7B84415650B760319E5FD2939 d:kp5
302,406,410 *1DE1BD642177F4C575308AF80F969AA934495F9D D:MPI
302,406,411 *1DEAF3EF650704A77000CA3EF977E37EBC1238B9 8LU31NG5
302,406,412 *1DE925A9CBE9F4EE2DE6B04F2EFC3BD601C183B7 8PRAYYNG
302,406,413 *1DE055043AAB65CEA47130DB55323DF88DF786F1 8RINGRING
302,406,414 *1DE8545D58630B4ADCB375E6B5D0D8B0ACA46936 DONERE1
302,406,415 *1DE7246622E0B278476ABE8BDDE8892389110A18 [email protected]
302,406,416 *1DE6D012C6680085BB8906A3D1F939D05FA5ECD9 8STEUQAP
302,406,417 *1DEEC1ED6FD7D7DDC5DBA926492F66D9D4C47C03 8.verottomista
302,406,418 *1DE437AE52757CC911537F2BA974B79CCD64CFB2 donna388
302,406,419 *1DEEB9A38B98FA1B7805D680A24F0CF0E8375A23 90F3431341CC0B1A93AE894E38320DA5TEMPLEOGUE
302,406,420 *1DEAAD4C543E7224B9A0D5282D94DA3AA898B7D1 920169 hanketta-veti-stakesin-projektip
302,406,421 *1DE79FC0A256FB806F8E8776BE1E91A6B7F97928 932SHANE
302,406,422 *1DE366F77365BD74E59F873EC505349A42CE3AE5 975603 FRIESINGER.(.NACHDENKLICH.).:.NOCH.WOHL.?
302,406,423 *1DEC2875018E566EC282222365A4DC4264916FF5 DOUGLASSKOTHAKOTA
302,406,424 *1DED39827390D328E4BC822322BECC86925C4DC9 9ATTILAEXCALIBU
302,406,425 *1DEA99891AD60C63934E568C700A817FD195CB4A DOYOUHOW?
302,406,426 *1DE2E6296D3E8EC0AACDF9DE9D5ADAAA9EEFA1B3 dpt3
302,406,427 *1DE280D61AC276B2C4F9E049222F6B5C54896AF3 9iluvharrison3
302,406,428 *1DE3E728CFBB74039113C312F47C6CE8DE1916AD DRAUING5
302,406,429 *1DE4B283C7F36AE77FCC9811C4BB3C6EA6F83349 d_r-p
302,406,430 *1DECFE475774289A54424053232CA4B27F3A4E84 9TATIGIE
302,406,431 *1DE9F1E7D11CECA51B4227854F0327F93C8959F4 a0cb
302,406,432 *1DEFFA4422AA62CDBE41650636A37CCEDC2128B3 a8rzu
302,406,433 *1DEFEA68174CEDF8E85ACD78CBA93FA83F49CCC9 a#a6j
302,406,434 *1DE465A6CAF5D70A267FDCD71EEE9D3210159C1E AAA*$|
302,406,435 *1DE1128E026079D567AC50B29D22567526464492 AAC>JB
302,406,436 *1DECD4A6239F6C6885B6551251D38360F48A6892 EAS384
302,406,437 *1DEA40FF3F3C2013FCC31492AD31230BAD305BB7 [email protected]
302,406,438 *1DEC6945C5819D84AE554D08AF82B67D26B077D8 aangewaaiden
302,406,439 *1DE52353508D9DFBCAB02B40B9DE3A3550B963F0 aarav641
302,406,440 *1DEFEA250CD06046841E52FC24009EA4DF69114D E`F+
302,406,441 *1DEFC5C023A9A0E2783225BBB76EBA9F91AAEBED [email protected]
302,406,442 *1DE0A40250AA1434B3784B63FF8F7C0C30845D48 eg_?=
302,406,443 *1DEA31AA216E113C7C3336A7465DBC11DFA35221 A!BH
302,406,444 *1DE6ED183C5AF81CB41DBA3A8893D7E36F2E59A3 a$brv
302,406,445 *1DE17F9C43871D0A1263F730C8F8428F3D87C767 ABURGUESARIVE0
302,406,446 *1DE2A1E3779062E3C73437A299D1A9592F10960C ABVYK
302,406,447 *1DE01DD4E3C5E5A54D09CEF3C9811FD0C7F20D83 EKPENSEN1
302,406,448 *1DE8DE63EF1D11DDFE3A62D7C63C85828821EE06 el5"q
302,406,449 *1DE0778F326EC49C78EAF9F8B0752EBE5D725D95 EL7q
302,406,450 *1DEA43845F2654EAF16D9276D601CBB10C868765 acumen4
302,406,451 *1DEB54FF37F7A80D329D1394A91A5E4BBD3D9C84 ELIHYDER
302,406,452 *1DE1E4117447982F3AFFE6AB3C5DD356172A3046 AC>(Z
302,406,453 *1DE6D54434454ECE9E1DAF116FB2F7FD772E9E8D ELISHA.TILLERY
302,406,454 *1DE3D8D0DDA3AB7BD648532FF575A6733DFC400E ADA674
302,406,455 *1DEDD0F3FBDD8C2A905FA6676CFAD49CEF1EC45F adelaideyyyy
302,406,456 *1DEA191E47448DFF2CC024908D2FBF4A2C4FD251 AEFOV
302,406,457 *1DE65AC32090C3ADF8554AD44409453518B59559 afeliacoed
302,406,458 *1DE74C756E0964143D692FB1F35890C93398DD1E A-GB
302,406,459 *1DE1F89ED9C545ECB32C29F55AF1CD84BDB19FBA agxha
302,406,460 *1DEFB361E01EDF0A41567916CE1E85C4C7D57D68 eninytn
302,406,461 *1DEC7C56B052F7ED9BD693E06B045963D23EF6E8 AHS6I
302,406,462 *1DEE2DB31AED8547F7B60730A39AABC63065AA51 epvxy
302,406,463 *1DEC2E9F2FB735841D72CDEB219E0B302C7EB377 akdsn
302,406,464 *1DEFF57DE43CD0BEBD249A9D15A4179372FEF55C ERIJ8AGM2EE9
302,406,465 *1DE7E8AA5645EC8C9F659D69EB5CA330508D2EF2 ERUBBAAL3
302,406,466 *1DEEAA67D816700FFFF4AEE58A828CB5BC88D43E ALIGAMALALDEEN
302,406,467 *1DE896F7AE1877200F83C3C3D5B514AF9AA61D8A ESQUICHÒTE
302,406,468 *1DEEA5AFA227DC7BBE8DED403310A3C0876CE8D0 et"aa
302,406,469 *1DECF764CB250B0B246A8DA0155836DEDDA12C6B ETQUL
302,406,470 *1DE6105D7C42AF5BE30805F3C043968230811A48 evie-dyer
302,406,471 *1DE48067A0D52BDB039B46D858D050DCD183FF88 amarie-n
302,406,472 *1DE00AE1BC6571EA6E03CCA2886DC280A580EE27 AMBROSEQUALLS
302,406,473 *1DEFC577EB1D7B8B59D63E1235985D7280B1BE22 AMENOTEPS
302,406,474 *1DEA46F9898726DAE5DE9B03A68939B5F1ADE5E9 an_a
302,406,475 *1DEC2F6DFABAF733474E1024DF34F3C826412CE8 andrew.stillson
302,406,476 *1DE97D0013B01FC5A544991F59B8CC443108DA1B ANGELIQUEROCHELLE
302,406,477 *1DEE75A7263AE1BBCF299A72B0C6419A6635918F angraecum-parviflorum
302,406,478 *1DE5802B5566946A8483C91A0F501E0515A50A29 EZEQUIEL.ROBERTON
302,406,479 *1DEABDB70BDE8CE7F1D278D8A6C600F479AA7A9B FÆÞMED
302,406,480 *1DEB8E79C3AE8F1C4083EE53D34702E7CFAA8C34 ANTIBIOJ1
302,406,481 *1DE7D4E6E19E3BB65779151434A8A49B20D03077 ANTICONFORMITIES.
302,406,482 *1DEFFA397413EAA7A42C23D8F68F35E6C93BFA36 ANYWAY.PICO
302,406,483 *1DE62ED836B2723C0A4B987BB782E998DF694F18 aobv3
302,406,484 *1DEA70536D3FE803D283D1F29DBC2399BB2E9DF9 APASTORALNOVELLETTE
302,406,485 *1DEBE7C592122DC228C4E7167BE8DE15FF3E8EBC FCDM.BBS
302,406,486 *1DE35AB9D117F31F74269879BC8FA4CFBBDA0CCA [email protected]
302,406,487 *1DE70C587190FE276403E54B6A5C8ECA4A29661D [email protected]
302,406,488 *1DEA22F60A66CBA92A889B8DF1CD4312DBA54235 feartaig
302,406,489 *1DE42D39CF3AEE4706CF7B0FFFFE1E70D69B4EC7 FE~W
302,406,490 *1DEDD2E82841E79322B1F80550641083833223E1 ARBENSHABANI
302,406,491 *1DE494939ECE1EA110D2DEC05D3C19184C1B463D ardenpuckett
302,406,492 *1DE158BA07F5F0B2222A46108C508A30CBF94FCE ARONHEGLER
302,406,493 *1DE4076BA66A7AFF7FAA99B5B8721EB8370C64D3 arping
302,406,494 *1DE2919DA1D6F28D2A437B33B1203D2D6590061D artbusse
302,406,495 *1DE4786E16A269F4440A6A204782DA4B6180D5A7 asbpg
302,406,496 *1DE50B0304751A4C92891DD94D248EEF60FBCDA5 filiforme!
302,406,497 *1DE41843D0904FE6F320F924680250E9311B1D86 FLIPDOVE
302,406,498 *1DEA5FAE27D0803B87E6713FCA78526FE147F639 [email protected]
302,406,499 *1DECAEA67C5960560BA6DA8471197DC705986756 FOERTVIVLAN
302,406,500 *1DEE7CE07381137314E1FD7081C964D7297093D8 frametown2
302,406,501 *1DE71F5487292AFD77E344F19F55520D6D513853 austinrobinsonobamanep
302,406,502 *1DE930B3BAA48195FD4EA0149331CBA17B6CD373 FRAZADA4
302,406,503 *1DE1F47E5BF0181BE52BF7828B830D664972F84F FRESHES
302,406,504 *1DEE292D11DA6F371EBEA95EEE2A8F1A2CE02FEB b/,(3
302,406,505 *1DE1789570BAFB73B61F92D278DC19A3BF05F13B B!3FM
302,406,506 *1DE335D71D28194E5B943A5DD293133210EB1EE3 B4wp
302,406,507 *1DE9938EB0CD50BEF80366F6B87B2BD3508483A4 BARRETT.OXENDINE
302,406,508 *1DE7C31FDECDE7BDCC6908F70686E008202C93F9 BASIL.MULVIHILL
302,406,509 *1DE0E03575E1E7BA37B410AF456F270C9B6664B5 Fz\
302,406,510 *1DE9E5F0ACF5DCC14DE522F1ABF2A93BB3374BE8 GA5404GA
302,406,511 *1DED90C5A971FA4AF2A080DCA9E4CCD47570E6CC galencartledge
302,406,512 *1DE657B574EFF08DDA5929C6725828770B2C93D4 BBBKS
302,406,513 *1DE03019B06712FD6FF752CF6CF3864223021222 B)BRS
302,406,514 *1DE379CBDB8F65FCF638047761B17EE17C01E546 GARY.BOLEYN
302,406,515 *1DE3CDAC4AF14969EE9CC39A13405A1917C58BE9 garydibble
302,406,516 *1DE54786EDF9897C265B63B32109AF502D8A5666 GAUSSSEIDELMETHODGAUSSVERTEILUNG
302,406,517 *1DE00C8A0602F0C6D3260B3263DB4E0C28C99AD5 bcyne
302,406,518 *1DED7BB1151D6EA90F504AAC4A6486CAD520D3AB BENNETT.STYLE
302,406,519 *1DE9C4BB2F74C62791545147A9EDFF4EA9F86325 GGOOSHEHGIR
302,406,520 *1DE32678C46A634222EE110B4E6C27E3520EC15B BERTRAMFUERMAN
302,406,521 *1DEF87D99812139C7DE61BAA4052D83D7C1D189E gillian.bryson
302,406,522 *1DE419AA5C6A0B8D691CA1E25062709B376192A2 BESKJEDSNOTIS
302,406,523 *1DE69F116BEBA17BAC8CE854771559FF616936F7 betx%
302,406,524 *1DEBB317C7143A764E0FEFF712B5E45A679B63CE Bk+8
302,406,525 *1DEEE1B82304EF8004F8EF1C07FBC054ED3B4B64 BL.ZK
302,406,526 *1DEFFFEFCC7F98B0B39E12E08381A97A659EE6CB GLEN.MESKE
302,406,527 *1DE805BCB478D37FD697B691B00C9060070E9839 BMTUM
302,406,528 *1DEAAA5748F8796E5E16717BB712E117CDE9A362 boycepelayo
302,406,529 *1DE90A4BB965FD46CDDFBDFE86B9AA34EDD64EA1 [email protected]
302,406,530 *1DE2F944A1E3E0C1E517D06BF9A0BCADC14F1BBA BOY.TIGASIN
302,406,531 *1DEA61E42E962DC2732D31A58135318DBC6DFE55 B==P~0-~O-(-_0)
302,406,532 *1DE426B96FEC71BB5CA89C796D89B92ED6226EF0 bradlykleve
302,406,533 *1DE870B8D6730188D560AD15FCE7332FE125A9CB BRAINPETRASH
302,406,534 *1DEEC3A3B3D3EEFD0979A728141CDA43D0D42DC3 gqh~
302,406,535 *1DE1D0FEAF148EA040895052559DFE2B9835C0D2 bretgaubert
302,406,536 *1DE145F6C3DAB5B1533E240479DC7E24E2A15CA9 BREZ.PEST
302,406,537 *1DE05703A8979549DD418E726BE664F4BF81EFA4 GROUPEAKSAL
302,406,538 *1DE71F1ECB86FB6B0F6EECA3389E71469C2511BD GROVERSHANAFELT
302,406,539 *1DEEFE0D8B780B5F5C87C1E37B61088D2D42AA51 bricquebosais
302,406,540 *1DE57228E708BD422E381F716A712D868A6B5180 BRITT.UNANGST
302,406,541 *1DE86E19B29A3C2E544A352F4801BCADA59547B1 GUILLAGE
302,406,542 *1DEC23DAE57960F3087EE6725578CE79E3925621 BRwA
302,406,543 *1DED8C7F234118C52CC1ACBCE8F4FA04675FDB29 +H4N4+OLOG13S
302,406,544 *1DEE5FA1DA9443F9BCB0E9C3348D0C29E0163DEE handlede.
302,406,545 *1DE2C391D4A5059B23E1D51647A7FC3CF5BEAA64 bulking
302,406,546 *1DE968875B9CD2AA370C5742A15FCBE9A0C9D043 b&up
302,406,547 *1DE8F8B4351FE84D0DD0866BAB19BC46F7396825 bustersidle
302,406,548 *1DE77829BDCDB0820939BF89221BA2EEF53DAB55 hcsitirb5
302,406,549 *1DE1077063F1EFFA7CA832DC5071469201DEFEEC hd'alembert's-test
302,406,550 *1DE4CCAE255BFA51E334B3CB3B30C035C7D01469 HECTORMELY
302,406,551 *1DE6DE470AB2F89BA38A62F27A5B5A85E1619F25 hegyibsw0
302,406,552 *1DE6FA32EA69DB4D2FED70F751D467109E7E9421 byf.
302,406,553 *1DE3A69FB68FF66EB185787AB09E178CE9025FAA HENRY-H-CARTER
302,406,554 *1DE4FB2B5B03562ED068462B419B7D1A513F3A17 HERIBERTOWEDLOW
302,406,555 *1DE5B7FEF9BCBCA865B8167B0CEF49815051754F HERRINGS
302,406,556 *1DE09474C30CEF3BF2DF32D7EE16A2E05B68972B C157216
302,406,557 *1DEE93D23F86BCC050FFF64651C85943B0CA4DC3 c485x
302,406,558 *1DE909DC0C7AFC65C50B276C26BCF278654EEB5A HIRAMDERRINGER
302,406,559 *1DEE64E0BB15027548651F14C53AC91B852725C7 HOBERTMELARO
302,406,560 *1DEB86EEA127BD27C06F88391D247C829A4B4A45 C8GQ
302,406,561 *1DE14FE1E79F38CB887B9ADD4605DE2911878502 hongkuc
302,406,562 *1DEE9A999833FE40D5E2D620C55065594A33B8D5 HOOFTBSW3
302,406,563 *1DE653B8CE373467BD1EB0BD7977D63633D8E440 CAERPHILLYROUNDTABLE
302,406,564 *1DE7737D9059B7120EEE88FD0BF9238E13E80A9A [email protected]
302,406,565 *1DEF5A8F7206A7DF067225F2CEB14A9CA46E3D0B hsakanna1
302,406,566 *1DE075653328373DFEB488F217FBB94DB50BD1A3 [email protected]
302,406,567 *1DE280A38BC7581C3CFD951699657A8F4033F9E4 HUGHDIMITRI
302,406,568 *1DE87314E797FBD4686ECFBB8BF3A4698972F392 CARUETH1
302,406,569 *1DEC567B80620EE79D71283C4F61728CC1A4E748 HUNGKIDDY
302,406,570 *1DEC333B9F5F86B13568B85DF4FBB198E30D7E5B HUNTERTOKKESDAL
302,406,571 *1DE5668BC2665E3A1B3E8C02FBD8C51690D7C568 HUSSAMBOAYSHAH
302,406,572 *1DEA9A6084FFC6BC5AB1D2A5EBF305A272614FFB c,av
302,406,573 *1DE8F9DDEA26E99F6281619C36ED1D08DE5FF845 HYPERBOLAINVERSECURVE
302,406,574 *1DE8E9A1FD95595F70F0B315A67AC02B32ACD32D cb)s.
302,406,575 *1DE63BAC9B28239BBC93C88F023676D42E768A66 CD&V
302,406,576 *1DE51CBBB972E5F5D4F246517C4AE4682D9DEB1F cgfg!
302,406,577 *1DE30151A48BD2EB3EEFF7C4F94AA178B31A8AED cg=n;
302,406,578 *1DE8EFE64BDB647A0A5C4C4303C201309887E66D inesno
302,406,579 *1DE0536BAFF9837BD23407DF362D6B8E3F8ED5E0 INIISNEB7
302,406,580 *1DEE77DD4F62285E3A31A047AB29A008BB6EA333 CHASE.COLLEA
302,406,581 *1DE73F414C4D802686BB5633F8C0856B7687281E INTROUBLEWITHANGELS
302,406,582 *1DE1A6EB8B37DB044D5D58CF167E16BF2F9F72E7 chestermoessner
302,406,583 *1DE4E949CD92C0705508ACCDAD34744546F8685E CHET.SOWELS
302,406,584 *1DEFA88D18B2D14B9FEB3F972BA5F548BB921887 CHGH+
302,406,585 *1DE2AB9A1741B08912DE90B8F94C434630023153 CHjw
302,406,586 *1DEC99E1FDF7B45654C230CE763D9718B60F4B73 CHRIS555TROODON
302,406,587 *1DEF6CF68097FD81B21927DF984B1520587A2C7A „IŠVIETINTIEJI“
302,406,588 *1DE41E74BB604F61B292303501EE387C9C662CF3 ciaju
302,406,589 *1DEDDA3D646FE462E433C090A05A9745133AAD04 [email protected]@TIONS
302,406,590 *1DE7AEFDB2931ADE7960E7157D3F914C734D7AD2 CIRUH
302,406,591 *1DE40FD412CBABA32DD9FE83683F410FEE264F8C JAMEL.SOMERA
302,406,592 *1DEDD6B2FC5FB92B76EF8B8778C49D626AFED333 ckq-=
302,406,593 *1DED3FD7FFF6FF115461F2CBB85A65906A437EA7 janmashatabarshe
302,406,594 *1DE8630286F4AF0A6186C73FD81FC5FF210B0BBB claudiobeberwyk
302,406,595 *1DE9FD968D4C2C4748D640452F9D5FCA5D26DCE5 jason-munro
302,406,596 *1DE96F31FCBFE95E9BA49AE4315BFD29E79EFB2F jawani-(dj-swami-garam-masala-mix)
302,406,597 *1DE89C0D0B0AB41629B0528F04FA4EFE2EBFAE88 jdianxge75
302,406,598 *1DEBA03124B1D30B259C269D801C76087EFDC361 jeffrey.delantar
302,406,599 *1DE7944FE05F61651A685A4F0202EE79208E612B jerrypolaski
302,406,600 *1DE86D7292858E5EEE94B862A1DB0763B05F8C1F [email protected]
302,406,601 *1DE1D42E2E997BD505DD5CA5792A40965B37E6E0 CLEO.DELRE
302,406,602 *1DEF3866914EF51214515BB46A8D41A67329793E CLETUS.WESTAD
302,406,603 *1DEE12AE7511775A054D9CE14970F84BF96C83CB clevelandjanco
302,406,604 *1DE2709EC2233653A2CF311FD11DE4C796F7E968 clo$f
302,406,605 *1DE9C7BF6D923622479F655AED290BE72548C67C COMMI53RAION5
302,406,606 *1DE02DAE07DFEE5D986294A6921A0DFCCED16DE6 JODYKLINGER
302,406,607 *1DE02D5C9046A3D7CEEB669B5B1506EF021F7F1D JOEBREDE
302,406,608 *1DE640B0D9209350B3C1821E4B37A979FF8600DE COMPANY)をスピンオフ。リバティメディアが保有していたディスカバリー・コミュニケーション(
302,406,609 *1DE5B1DE8C227A1C84342E169BC3C00AD068761F johnarredondo
302,406,610 *1DE23A3AC2E86692963B4C571ED42D3F6F6113F6 JORDAN.GIMPEL
302,406,611 *1DEF2CBE526936DC720C0732CFE116E3AF10A6E9 coscaban2
302,406,612 *1DE715612F6378550FE059C3963CF5CF1C4CA986 [email protected]
302,406,613 *1DEE9348C139E989B03B14B43F348B465469C0BD cppa?
302,406,614 *1DE09CAC585D86FDEAF601B724A48BEE8B1948FB j}w<
302,406,615 *1DECE20F3665CF9223691B0AC86C344D0B34D07F kaleakte
302,406,616 *1DE9FD1246AF25FACA8C579A06357FA5007420D2 CRVHW
302,406,617 *1DE32F012C04F4E9083C781D9D5221A9D3F773D5 KEENANPRESAS
302,406,618 *1DEF139409AF77DB8D9DA0145C6CFEDEFEDC004C ct$mc
302,406,619 *1DE6CB22A04517212E34505C3520791EB3FD4016 cuz;.
302,406,620 *1DE00D21EF9F0F976D7A01FB823F653E4E37CCA8 keuanganbawah
302,406,621 *1DE4AACF64D4D07A7B26C2E478B8FB6CF9681736 CW,,B
302,406,622 *1DEE1567CA3EA2F17302219FA985E2EC8626427A cxo)
302,406,623 *1DEB20F49AC580DF5230C1E6E1DFE52D02BD374D cyrilrourk
302,406,624 *1DE45289C64621317B22F4D37FB3C35A382668E2 CYRIL.WISENBAKER
302,406,625 *1DE43BA5F99420BC582709725032BA699240F939 KNIGHTSLESTAT
302,406,626 *1DE6BC4B8EDB37E21BB296AE2F39F872236FFE7E [email protected]
302,406,627 *1DE7FD61E313269EF2D2936E99FE6A71C2B1E833 D1KI-
302,406,628 *1DEB2180987DD2EBF9AA54B2CB5B6B7CB7E6705A D4550UC1
302,406,629 *1DE78C8D94E8510C66D979D109E86B07E4923384 d/46t
302,406,630 *1DEF3BA7D7C7BAD91100380795DAEB51CEC65CE3 KWAZWAI
302,406,631 *1DE27BCB42E6D72232FC2C7D9844C8E5D235ED8D DALNEHO9
302,406,632 *1DE130B9D17A97061DD367D0AB3F95196A9FA5BE DAN.DAUB
302,406,633 *1DEDB4B301D369754E276282DDD955C119B3E402 LÆRERINSTITUTT
302,406,634 *1DEA16BE5BFA87B781533E5B16B4D923E7240C64 LAMAR.SYLVESTRE
302,406,635 *1DE33F3DEC9EF79805A681C4153142B98831EA63 LAMCPH2
302,406,636 *1DEB870EA54C5AA84E63167EE1BCB7797D71C9A4 LAWRENCED'ARABIE
302,406,637 *1DE297A295CA3BAB331AEFEA67C9696508D728FB LEOPOLDO.KAUS
302,406,638 *1DE3FC228E596E0E311CAAA00EED8311B82BBA5F LESEDYER
302,406,639 *1DE27673D3EF655AD99497A216A5FEA599FF2814 (let'stalk)physical(12"version)
302,406,640 *1DE1FBB80910560933B00FC27228460CEDA8DE0B LEWISSALQUERO
302,406,641 *1DE211CCFE038EAFB2F981C142E983A49EB50598 darrickbonalumi
302,406,642 *1DEB62E31179433DC8C3D51E5F5B2991190EE51B LHOLYHRIM
302,406,643 *1DE9F8468B12F4661C978EB80D63BE415475986E DAUTOMAT2
302,406,644 *1DE3F1B21F50F11BD2594791CE5E9243AF4C5758 DAUWWORMEN
302,406,645 *1DEB08BFA9349DDDA2DB83F79EADC3B24FD08D7A [email protected]
302,406,646 *1DEC5C8564C9A1EEE05EDCD89750F7B39F2D3783 Linkers
302,406,647 *1DE7ABCD9DABF8E993D812E37942B0B854740F10 localidadesdetrinidadytobago
302,406,648 *1DEEF6B601CE99D19CD280EE2179BC3613A68B52 lohn.der.angst
302,406,649 *1DE294230F5D6C849A7F4D0ACCB4DB9D7E57DCCE louloulili
302,406,650 *1DE80E2A1581F3A02C9AEE057330B13597ED14C1 DEJO
302,406,651 *1DED27FD7031C5913DBA580031D6F2B533BAE510 DELMERKRASE
302,406,652 *1DE0BBC355C833FE394D215F58D1F54A9A3802E4 demalbnu8
302,406,653 *1DEC147884DEB42C7710A1747530653207F01AB6 DEMIPELA7
302,406,654 *1DE14ECCE95C3A7BFF9EA4984A52A035009FD80A LUGU8RIOUSLY
302,406,655 *1DE82031B1C06587E69D3F0F5B93C385D9A2540F DENNISBOL
302,406,656 *1DE946A448F1D1F10A6D2EC9CF3414DA628622CA DerMessias:18aDuett(Sopran,Alt):ErweidetseineHerde
302,406,657 *1DE68D9B00EB0241EFB257606399DEACB8E5C218 [email protected]
302,406,658 *1DE6E02AFEBD038AF0D8356AE75793751B61CA05 macgasmen
302,406,659 *1DEB727C4C23CC51687B6850B6A90300340C406E DHV$
302,406,660 *1DE48A0DE46B01F2796DCF9B2566C0FD56AB0901 [email protected]
302,406,661 *1DEEFEE787C10F15D41E26BFC920EAB860A13E83 [email protected]
302,406,662 *1DEC865DA76018A05AEB8CAED72C039A58206FBF [email protected]
302,406,663 *1DE032EF299F8B47D992738BD6524F7C128E4BFC MARC-HAMMILL
302,406,664 *1DE7D9922CB5D34535C067DFA12AC8530B37ABA3 MARCOS.CANNINGTON
302,406,665 *1DEFE6D74AEB67288CB984946BF5DCF8A06F71BF DINO.FOESCH
302,406,666 *1DE991BD0CFAAC2FC32E156040804879001D4AD9 marimakan
302,406,667 *1DE5D101B35F818F25D5F5771DF515F946B5C406 [email protected]
302,406,668 *1DEAE36DE5A94AEBBC3C9B01A5E98837554DA8D1 dkbem
302,406,669 *1DE5211F46436D1A96F3E3D6512B6C5F2B1B0CC5 MARTINLOFGUIST
302,406,670 *1DE3CDD9FBAB838B95824709E78896C6409CC5F3 dluo
302,406,671 *1DEF756EB5566B4B5C28916AD4A2BDB887A8ADDD MATHEWCALLINAN
302,406,672 *1DE07C22B59CB98D4C975DF36D2CFF02F1A93C55 MATHEWREEVES
302,406,673 *1DE2594E39005F6C645024C12EA374040122B682 MAYNARD.STAMISON
302,406,674 *1DE5399C31497E11A6988D2CD16B08B24F580921 MAYRA67
302,406,675 *1DEEE6E1234EDF78D75C8DB29CE823930C64B83F do_kv
302,406,676 *1DE56A9858A861204A4B4DE9817590D6FBA2C6BE MEL PERSON
302,406,677 *1DE4C08A94AF3DD681D5B69AD7252BE6595D4384 melvineiseman
302,406,678 *1DE71A42915C3515F63BEC706400480B5064C5B3 MENESTYKÖHÖN
302,406,679 *1DE50DDDAAA4EB044E0AD9C83C9E93B01EF9B5B6 DONOVANMORGENSTERN
302,406,680 *1DEE4263D0F21003361CC16564A60B0DEE17023B MEYRIK
302,406,681 *1DE60D641E354D9110BCCA45A37FDC819C03E116 [email protected]
302,406,682 *1DE057EF1E2879D2BD6A84A175F9941512C425F1 MICAHGAMBRELL
302,406,683 *1DEA2FD17065A65DC227ECDBB5CB2EAC04F33827 d’otake
302,406,684 *1DE7C9D6EE37C7011DA4C49C2E4121834EBA55CF douggoodsite
302,406,685 *1DE82B3DF79D86848579FB8472E22A8FA77A7FB3 douglasstoplk
302,406,686 *1DEEEBBD64435839F3D4B36C05DB34A5FFD61C36 MICHAELTIMME
302,406,687 *1DEA07F83F9AE39B52396550BD67CD03C467BD24 MICKEYHOLTGREWE
302,406,688 *1DE0300160FC03E6FF6265A72B648E2A132E1AC8 D%P:I
302,406,689 *1DEF1066D4030496AB75C3E253726A30CED2E154 (~_^)`dq
302,406,690 *1DEB4BD3CE25C489BF1AF010DAAA30117C7493F6 DREAMWAYS.ORGWWW
302,406,691 *1DEB9F8FCCAA35F2320001E1B5FE8BF97FAB6CD2 DREW.GEISINGER
302,406,692 *1DEF7EC119F7F6E2C923B2385D225D8FA3FBBB71 MISSBEHAVEN37
302,406,693 *1DE28095B2095CB3D649629F77C652EC9E218C30 DRINKARFLICKANSD
302,406,694 *1DEBEC5225DD256444D6110E3C671B92CB2784A4 d=rni
302,406,695 *1DED19493AAA1A4A9F9408B6C2834D8D7BE56F54 dugr,
302,406,696 *1DE7734B692A7F7C2557BBCF85836B1050C6E1A0 DUNCAN.COLGLAZIER
302,406,697 *1DE0228C7E9F24DF3610721DCB984A69EBFB52D1 DUNCANMONHOLLAND
302,406,698 *1DED75B977C8DA82049743F86489E75A898A96D7 dustyulbrich
302,406,699 *1DEDDF22094E6210A6A45E28C66FBB03F504078A DUWBQ
302,406,700 *1DE614A055872A5317D2914933121BE07F1B624E DWAYNEFERRARA
302,406,701 *1DE08521CDC4D01D8D71D0C5F75125093BD28471 muddlehead
302,406,702 *1DED2999969B57854C969B101E26990FEAE36BE3 dxr=e
302,406,703 *1DE591D5E86C4BEE27D386BF267C4BBCEF1F0D91 myronschoneman
302,406,704 *1DE4B952646633C8D0ECB18098371C1BB2FD62E6 E43F7ACF-1F26-4894-B8FB-E741690A3321
302,406,705 *1DE5E284DA437A50127753545EE346C5DF6EF845 mytopcat31
302,406,706 *1DEEDEAAE94973E426D450ADD7A5A449AABD5C4C earlebloomsburg
302,406,707 *1DE6BC736C654B68F6FF9B0760599EBA35C7FAB4 EARLEPILCHER
302,406,708 *1DEE28A968AAA089458E52D2F8FA50EBDE3F49CA eaus
302,406,709 *1DEEA018A2B0E18E0223686B00BE4FA8E503E74F nataabo5
302,406,710 *1DE4E5548951B22328F3A575CDFB2A27197C00A6 eddydisla
302,406,711 *1DEFDF3A90FCD29EAD38A2E354FBBDA4F24ED9CF EDMUNDOPRESTI
302,406,712 *1DEBE11ABB303CEB4484DC6102036A7A1535DDE9 neil.medenilla
302,406,713 *1DE3BE73655A07103C3A08C6D6E40DEB44B184E9 EEBMU
302,406,714 *1DEC88205B27EA23961FF6E29CAEDA303C344150 next-to-me-(vocal-dub)-(feat.-roy-davis-jr.)
302,406,715 *1DE49CD2B10D72BC3180F1FAE7932D08409881A1 ehs510h
302,406,716 *1DE210001841D3D597C11FD460C07535302EB581 NIGGA559
302,406,717 *1DE28B1049033ABCAD22F87B2A5C7662C871FE93 ninthebedroom
302,406,718 *1DE02D07145B6A0006697CD0689685A60DC5C97E NOELLE.BARRETT
302,406,719 *1DE974D54B7E753848097D1DB71BF15877B955B5 NORMALMENTE8
302,406,720 *1DEBE66B540544F1849B054FE8921A99F6BF2A91 nr6baa
302,406,721 *1DE4263F140E13B5DAAF5A7B65B928C1F8C2E11C NTRTRGL
302,406,722 *1DE9E82A23A4C8295C69EF96E2BEC54F390F8CF3 NUMBERSGROOMBRIDGE
302,406,723 *1DEA4E0047D9B4A2DFF107F0CF53033457BAD4C0 NURUL ILA
302,406,724 *1DE33FC2F73A0A78EEA064469350DB5592EBBF4E nw{s
302,406,725 *1DE81CAF89774E96D66862A8910990941341FD92 )O(~.`.d--p
302,406,726 *1DE2052FF3DF464C11A4617B90323D598B700982 ODPADLK7
302,406,727 *1DE63445F2CAB141CF3D71AB39C3D93B49D03964 OJOABIODUN
302,406,728 *1DE1CB111824013592E47355FC6B2CA5BC8C3CDA eldenscelba
302,406,729 *1DE6E0A1680AE7B690011C3BBBEF7A6B1358A17B omarashbacher
302,406,730 *1DE115D48ABB2AC6EB3686CC4216B53275DFAA50 ELDRIDGE.TINSON
302,406,731 *1DEC3D2BCFE6FBEEB906D07574729697A46229F1 ELEMO
302,406,732 *1DE5E28E9515ADAC00B0EFDE715F0D24B2A49F4F elink-distribution
302,406,733 *1DE4CEC7E46CD13E368D3F2AEA8B22FC33D69CBF ;)[email protected]
302,406,734 *1DEF4E1ACDBB8CF04DF63BF93C62DFF8AD580652 [email protected]
302,406,735 *1DE34DB246D2FB442609CB7144B61879C1B8ECA4 eloyogier
302,406,736 *1DE2515BA66929A49B8329DA0BA46129D2CAD824 EL TERCER LADO DEL ESPEJO
302,406,737 *1DE960E1FA2E128CCA824980C752DC234D3662C6 ORVAL.MONCAYO
302,406,738 *1DE3C361E55814DF55F5C5FE4A55AC0C649E7D12 EMBATLING
302,406,739 *1DEF285C87AE185926B0664B6993D4C7A88212DE OTISLOE
302,406,740 *1DE9B134F116DB4FCA491C5E1186C465C9C2CA1F EN12342464X2
302,406,741 *1DE7B08DB111624E71F1D227A5DDA9F81F949F19 overuse3
302,406,742 *1DE664500130CDBA27387A83E4B12D53825A39E9 OZSVENSK
302,406,743 *1DED3192BBABBC061F029B5B1A60AA239EFA62C7 pakolaisj{rjest|lle
302,406,744 *1DE0C5A38511CA8BD9F1F7C98989C9F29AAA5B9E erling.norheim
302,406,745 *1DEA04A41398678E93B927CDDE81FBD7BEE930C3 ESCACHARAED
302,406,746 *1DE7C2FEB95A35873664DC1E6B13908DB0FB4972 papa,-wie-ben-ik
302,406,747 *1DEA0201DA242CFC21852237F41730B024835EB1 ETFARGNI
302,406,748 *1DEF741005624B1425FF26318A57C5CD2B541765 PATZLOCKING
302,406,749 *1DEFC89A06510FBFF3AC76E719CCA32E39CFEE16 PAWANKUMAR-DUGYALA
302,406,750 *1DE9C9F004DB13A876231CA1B229AE8289A9AC41 EXHAUST-OVER-INLET
302,406,751 *1DE2735410D236CC5545829763A5371567F5DED7 peliculas-album
302,406,752 *1DEB3522B3D5CD0D1D3F7E2B6BED1E24CC0F3A0E [email protected]
302,406,753 *1DE639F44A1BBFA344AEAF2445B9B77C3C804F23 PENTAMETER
302,406,754 *1DEFA0F1C02164944739D7C377FCDC8759DCC308 percycarrousal
302,406,755 *1DEA4A56E11EF5169D9C4A4E49233A8BBB1A1F11 [email protected]+ing
302,406,756 *1DE2CF9345D5603924BF868624AE52D758500EDD PERRYCOUNTYHISTORICALSOCIETY
302,406,757 *1DEB7D4FEACA7AD9460B412AEB7CA0897D71F091 persilledesavoie
302,406,758 *1DE59290B8F15013EF4152E1F50A7903FA7AF74B PETER-PERALTA
302,406,759 *1DEDA30AC1BE4325BDB657DB74B39C8529A3C539 FAIZANGHAFFAR
302,406,760 *1DE1AE53DC1C21CB23D800BC34DE655FA73850D4 [email protected]
302,406,761 *1DED83F781C0A72D282F0B3192793C5596CB41BD PIRIFIBRATE
302,406,762 *1DEC92B737AB83D650E5344A0FFBB80AF145C201 FILIBERTOFANKHAUSER
302,406,763 *1DE3511822E0F55F243A5A918D3F04EB1748D185 FILMOW
302,406,764 *1DE87549C63DBB1ED4C272810E095C75B9EEE40E flagsmykkedes
302,406,765 *1DEDC46E7C7BCC6EC55984C68B42F15B9352BF86 FLETCHERISING3
302,406,766 *1DEF65D3B7F7036CCDA353C264B120DF45F36742 FLUCTUERONT9
302,406,767 *1DE2B360A45E0BF0663CBA23E74FE83FA7C518EE FOLLOWING(SIBLING
302,406,768 *1DEC02C1FEC6C204BC79BF16AF3316DA6CFB99CB FOLYAMISTENT
302,406,769 *1DE2DA6653FF714CD536F9CA4C432B3C699EAA95 FOOTBALLPHILLIPSHATTRICKDEMOLISHESDERBY
302,406,770 *1DE24B834CCF9E93C379FAB7655DB312D6321666 POLOMINE3
302,406,771 *1DE42D67C70BC6586737EC52DDE2943B41C297D4 poojok
302,406,772 *1DEB0746119DA3AF567A965838149A7CCE635D4B POPE_JOHN_XXII
302,406,773 *1DE221FA208357040159DA33F83D8A0678198920 fpy0
302,406,774 *1DEF0809E68A159D5ACF4630F909FC85FF79927C postmillennialism
302,406,775 *1DEBC9D99A0F4262EF74F5582F50F821FCC6BB24 freemancanan
302,406,776 *1DEAA72136CB7522D91B95A161C2836891FDFE6A FREEMANPARKS
302,406,777 *1DE6EB56E79D6F759F1A702FB17B6D2C4E936525 povijest-nase-skole
302,406,778 *1DE0C970CF6EB1EADDE7C8CC5445DDC9C2CDFF70 fvallcebre
302,406,779 *1DE83E3A5490C925D323AA641D5968245F74ED03 PREVRACALI
302,406,780 *1DE91B969C4C5E3581B9EFCB64A05C2F9EB63F45 PRHWMXXP0
302,406,781 *1DE9D3EA303CA1CCB2470C9D195B07A7DB4FCB24 GARRETDEBENHAM
302,406,782 *1DE6C3FFD2CAFED6790660154D49A994CE518542 p)~`splat!!
302,406,783 *1DE026FE02E5540A3B2C110AFA2746EAEFA77025 PUNCHALEEE
302,406,784 *1DED40B1DA331F82855C8694B24B98E993714CE6 PUNKTVIS7
302,406,785 *1DE30D34E6636512263D7B3384D28B75132EE3BE PYCNOMMASEMISQUAMATUM
302,406,786 *1DE6F63556AABF56F542C8EB8F40B9431D979AE6 PYYNNOEN0
302,406,787 *1DEDAEE293924E968BBC8F21A0644A406CDBFA8D GEMMA-JEAN
302,406,788 *1DEC5CBC50835425CB9FF0FFE1E4D76E868A0876 Q504000
302,406,789 *1DE8D72031E17441924EFC2AF9A707147EB2B9BB genechang
302,406,790 *1DE2E4EA13F2CAC6A77D2D53416106E0A5BF35A8 Q=>.~.`>-B0
302,406,791 *1DE43D85A723B258BFAC6F25878299393D90DFAD geraldogeisler
302,406,792 *1DE1C1B2944D57731E714507DEE23D6022561713 q---p~.~.~}o{
302,406,793 *1DE304A4EAB5EF6DDD75AA2546B2A5F0FB21B85A [email protected]@+e$
302,406,794 *1DE39042BB7113196315E38DC3653B03A40C930F gkaboom
302,406,795 *1DEAB61641AC74B2E8FCDA979C36D308E8CD0B9F glenn.clarke
302,406,796 *1DEA069A2EC117D47872068828514A420BC4936E racheldearing
302,406,797 *1DE41CAC0D1BC2F1EF171AC5A2E662F754E524D6 [email protected]
302,406,798 *1DE7B05D0D6DD36DA1480909B7B52B4953325CF3 GRADY.MCRILL
302,406,799 *1DE5B90579CE3099232A57263740085FB8368BF7 RAY.ISRAELSON
302,406,800 *1DE9C7B79401B993B5AE17DD44D479EDA436EE92 Greensleeves-/-A-Foggy-Day
302,406,801 *1DEB4306BD0B0CC6C44B08BE9BB29993D8C7AFD3 rayvuened
302,406,802 *1DEA7DA57DAB21E3C06443C108E6A602AEA68898 [email protected]
302,406,803 *1DE7AFCF75978AD18AC7F05330C98293A5F3A4AA GUADALUPEVERLING
302,406,804 *1DE38ACA0858D72C85E6B732FBF906CDC60001D5 RECRIVE0
302,406,805 *1DE4AB2A99F604CD1E4D141211BFD50163D80888 [email protected]
302,406,806 *1DEC83DCFC18713A8EB7EE05050E769BCBCB0484 GUOSHANBIN
302,406,807 *1DE1EE2C0A1AFF4C952B8CF4755C147CA7952396 reubenspadaro
302,406,808 *1DEACE1970C2AA06C1E13649771E6AC545D6042D REZNOR00
302,406,809 *1DEF6DE2EDA8DF5CE07D592EA068240D6FBAB623 HAMLET.2
302,406,810 *1DEC517D16D4199BDFA17363AFD1BE07BD5174D9 HANDELSHØGSKOLE»
302,406,811 *1DE7C1D8AAD1D345AB2BF40912E63B76CDE9262D [email protected]
302,406,812 *1DEBC569625DA2F750F61A1D24D02E6D7D2B7D67 HARRISONMORACE
302,406,813 *1DE217D8A4738F0A6B6F6AF59AB7DEB657D30684 HARRYEAGLEMAN
302,406,814 *1DE084BEB927875767139BD25B09446B58697ABA HASSANDIBBLES
302,406,815 *1DE34C8DD3CD0968F23FC2A059A33A8FC084CA47 haywoodnothstine
302,406,816 *1DEAE71B6FD45111C2CA8B0CE2552170E8368871 RKELSERNE5
302,406,817 *1DE59AE41B8841BB77FD144AF2F4EC944B27F2FC rklavierundcelloop102-iiinichtschnell,mitvieltonzuspielen
302,406,818 *1DE0A9A468A7A97A561319F82D13C156D97EF9E2 HBUNTI
302,406,819 *1DE2E1EED5DF5E912C0F351D2154ABA465AE5D17 r-melanie
302,406,820 *1DECCC3D7D62EB53D42E3D90D1A33054792009BB helenruy1
302,406,821 *1DE63EF9E3A9E5A21F38F2C75A7227FAD20E6284 RockShow.Band
302,406,822 *1DE285A1C1A3B9C015282B5C0BCB1F548DF3006B HEPTADER3
302,406,823 *1DE01D7F2CFDCB265B81A2D943D09468B0BC4ACE herbertaraldi
302,406,824 *1DEBA55E63131F2B76CB7C3C2B1BCE36C4CF17EB HERB.PELA
302,406,825 *1DE0CDCDAA61223FC38A16F6AFCA8DDAFF488C43 rogerjackels
302,406,826 *1DEBD9A249FE8D748E6BE480FA925EA7E8377B0A HILTON.SPINE
302,406,827 *1DE720FF22B560CE87B3C21880865F8372391D36 [email protected]
302,406,828 *1DE03AF454387179CFD27032B8A6DC7D18CBD454 HOBENDESES
302,406,829 *1DE4E14C1926C0B7D2A74989AE3A73CC1D6E5338 homertremillo
302,406,830 *1DEB4B0155B4A42463568F2479597CBD4C4ACEEE RONNY.NESHEIM
302,406,831 *1DE752152DA2B2BEADF7D438FC2613CE7EEF85DB HOMOTONI8
302,406,832 *1DE0122FBE98E876C972EC1F29448EBD01BD50DA ROSEDANIELC
302,406,833 *1DE9A324D5811949CD581EDE0732BA67D855D6C4 ROSENDOPHERSON
302,406,834 *1DEFBF71643E75D3DE619821D39607034EE0477E ROSEPICASSO1
302,406,835 *1DEA36B9562386EFFB68DA103B5A6EF7B368EA51 HOTELLSKIPA
302,406,836 *1DED5366B139CA4E95FBD80B4B0FA5F844E33924 [email protected]
302,406,837 *1DEFE9EFB13D2D66E262625877BA0CBAA07FF2D2 RQ3T
302,406,838 *1DE8F46F3DB14093CBB354D4FCF63FB3A02D5D54 RSAROSY
302,406,839 *1DEED97FFCA1ED4C73F480B065D18C7E75919739 RUEBENVAULX
302,406,840 *1DE78382B0030228666DAD9B09A9AA6F2AD0474F [email protected]
302,406,841 *1DEC7955241D68AF7B3DE6ADE7A729C548CEFB76 rupertmolyneaux
302,406,842 *1DEEEA37A963E4215011BC4601273E607B4DB8A9 HTTPWWWNEW-DESTINY
302,406,843 *1DEDF83096FDC7ED6887F3DCD0A035883A02667C hughcurlis
302,406,844 *1DE40565335DB0495E2ACF207B2DEF79C47694AE [email protected]
302,406,845 *1DEBF5219BF636CE84E430DDB9A657A5FC9C30D2 Hulm
302,406,846 *1DEFF5A788E10A3E7D19929D30B56F7E21303C91 s14aa
302,406,847 *1DE6C260AF79ECAA82BFCC152313E21686CF3EA9 [email protected]
302,406,848 *1DEE7D4287AB3DFE54CDCD8382C782E320414A83 S79PT6
302,406,849 *1DED1FFCA837CEA07F7B62EFBDC37DA2228ABA61 hydrolo9!$+
302,406,850 *1DE98922C5DFACBB5237760945A5011E1454DB3A IAMALINE
302,406,851 *1DE573CF406627202960A9A5BC55E26DB82977F2 ICanHeartheRain
302,406,852 *1DEFA0CFA47BF822358A2165D2592599A0E9A6AE SAMUALHUTSON
302,406,853 *1DE402CFF84A9466816FA19EAE6940858D94726E IKMAJATA8
302,406,854 *1DEC7C6508CD0FC691151E72D8FB9AFE47621C53 SANTACROCE
302,406,855 *1DE95CE6AB2D21873245988A6F2C8D633DFD3904 inlieuof
302,406,856 *1DE37DCBE9D170B1E853D6628A0F7F214AEDD91B interactive-media---the-new-golden-goose-of-branding
302,406,857 *1DEEB123ABDE9954AE7D2C06C7F1DE294393C0DC IRVIN.HINDSON
302,406,858 *1DEB8B34DC56DDA4C81EC4D09EFB1DCD2581F30F SCOTTIE.HAMBRECHT
302,406,859 *1DEC9E1A7B74D4A69B9AFED7CF97890F989D1397 IRWINWAHLER
302,406,860 *1DE175F54342EAA7BA71E333476A1630145DD204 ISAAC.SPRACKLEN
302,406,861 *1DE8A303DF9BD735457AB4E4264A79DFE85443A0 [email protected]
302,406,862 *1DEB514D268B4D781B4A13772DF46F26817A93CE SECRETARIAT1
302,406,863 *1DE166EEF5FF5B1BA3BEB14CD5359C918F651B10 SENGORGIONS.
302,406,864 *1DED0F68909D6F02D7D0A8A97EAE2EFEF4F6C54D i#z_
302,406,865 *1DE9DFA7312C37BDE745BAE1AB39983E926BEDE6 JACOB.ALEXENDER
302,406,866 *1DE9BDBCCAECDE878BE72599DC7AE1BCB35175F1 jagwanti1
302,406,867 *1DE2527E8E526D372556388F378DA491A8303B08 jamieporten
302,406,868 *1DEB8AEAAFB043B4FBEF119FBE4F76B06863252A [email protected]
302,406,869 *1DE49137180F6948A133F84B7A69572D477B87E3 JARRED.MARTIAN
302,406,870 *1DE19E90A1AFF6D94720AE632D077E316022BC39 SHANMEIED
302,406,871 *1DEA1574B4D39B29F6AECA3D9513C3EA75E8731F javierarmillei
302,406,872 *1DE3F97E2FF917FA5A740ED9C20F16D73263F445 JAVIERSTAUDER
302,406,873 *1DE6487F262FC923E00996ABBEA89FC9135C1551 SHAYNESCHLESENER
302,406,874 *1DE358CDBE8668118D6D7084298D576EB08E0976 shaynestrock
302,406,875 *1DE623E66A1056817A5C522B1F732F947BF0B067 JAYSON.BATTKO
302,406,876 *1DE1D058967A6655174DAED5CD274530AC382E09 JAZZ:BEBOPLINESPT.4EX3
302,406,877 *1DE207FE32384764DFA255DAFAB30292838AECF3 SHIRLEYMCLEISH
302,406,878 *1DEEF943D91ABEE87D28DBA6A7FEBDB1A4B569A9 JERALDGEIMER
302,406,879 *1DEBBFA1D4A9DBCB8B58AD176774F15650DCFCD0 JEREMIAHLOMAX
302,406,880 *1DEE672895F7C62B0502C75E9E16B8D4AD4A2C0B JEREMIAH.RISCHE
302,406,881 *1DE11C73B0CD54864CD1D71D2D2DC41ECFA38282 SHOWMESUMLUV
302,406,882 *1DE231FBC769F042CCA2A39F8743B247F7E03F7C jesussteinbauer
302,406,883 *1DE762E4F8106E80FEDBD1BB1EEA35237D127004 {JETTIIM
302,406,884 *1DEF38CF88C7ACEBD3D4108BE1C102703D6EAF6F JEY-NATH
302,406,885 *1DE96EAD0B0D1F918ACF7CA7F415DF267AB03CDA SILENTHILL.GENERALA
302,406,886 *1DE2E971F207DCCDD9157926F85659E71EE356CA simonmonmon
302,406,887 *1DE75CFB570BC55510B7487D3863A89F1D5B05A3 JOHN.SAILAY
302,406,888 *1DE968DAB077D3A0D6CE802178B8AE7A4013DE3F JOLAGHANI
302,406,889 *1DED49EA1C0BA7494D169322746D26D911B80D9F JOS1184
302,406,890 *1DEB644A095512ED99702C1626AA16D11D4D4C5C JPILVEH21
302,406,891 *1DE778DF8C3EE9DDDD563ACCEB8F7A3A2A282074 julespruna
302,406,892 *1DE82F1F2386A77E87F374BA2A724FD67067EAAC JULESRUSSOM
302,406,893 *1DEC457FF9DA11CF935E2933173656E1D2E7E621 JULIE.NATION
302,406,894 *1DE2533C14350DF4243BA98F53098EADDF9A6A58 JZLBKD3H
302,406,895 *1DE28397CE2BCDDEA17B4712374C921DA33BF36D KAITI.GARMP
302,406,896 *1DEE3B9B5312E10EF37B58FC46DCC436F001D32A [email protected]
302,406,897 *1DEA57B93ED1F7D49DBE347FAB4898996C87EF64 KARLIE04
302,406,898 *1DEA450CEE4544FFCA0A8E97F957C8AC2B0FDF9E SNAEDIT3
302,406,899 *1DE902F5B8E8E68220B439710AD66D1D5197D8F7 snobolsnobol
302,406,900 *1DE1EDE8657DC2BFF841125A4C48A91E89A59916 SOGNEGRD7
302,406,901 *1DEAF991EE7426720572E3D859DAE9457A956124 ken-casper
302,406,902 *1DE428E83AB4F4EC40D06C89AE729907FBD09FC3 sonata no 11: allegro
302,406,903 *1DE221D86B6EB0A50BF2F08F5E8E25CED5EFA1B2 [email protected]
302,406,904 *1DE5A248A7B443596E0099497FB2EBAE0736CD0B [email protected]
302,406,905 *1DE295D43BDD86546E687440E29D37ABFA3A5987 kevin-dela-pena
302,406,906 *1DE2665D28CF7BD54C854CE2D3FC4544AD81221A KILPAILUSTA
302,406,907 *1DED913DADD34BA242670464E3351E96A26A7F09 KLKHRTG6
302,406,908 *1DE360DD1ADFBF516E2AE7066DC2514BF2339B79 KNOWLEDGEOFENGLISHPERCENTOFPOPULATIONWITHSUBDIVISIONSV
302,406,909 *1DE21561E17D03531665F52B5B206DA71E27F7CB SONYA83_MARTINEZ
302,406,910 *1DE6BF2EC4F08CE6BE4A9901E4D79FBECDC69F0C SOUNDS--S-AW1-N-D-Z
302,406,911 *1DEBAF1A16731B2DF22280C313380E2B15688AEA SPASSIATE
302,406,912 *1DE0BA0E410EE99AA7183BAD3C523575B21C41E5 specialmegamixdtrance10,track05
302,406,913 *1DEAC5B9A0A4D301522163F25E0299396A919808 KRUISRIDDERS8
302,406,914 *1DE54A13043047B79BB2E5429E16402BD41259C9 Splat!~`@8
302,406,915 *1DE3CA05CECF6D6BE1A483DC68468A1DA0EBD058 l2mqmsaisrs
302,406,916 *1DE270EAD5E5D8B34F51213BCECDB34F56A799A8 LA77UDES
302,406,917 *1DE6EDB5CAC24AB6F504722D6206B01ADBE7398C làèeera
302,406,918 *1DEB6D642B172014ACBD6C2185AB6CDE8C7930B3 LAILLAHING
302,406,919 *1DEE36376D7AC49BAA015A5F0F3F40A524DB0A3B LARA SU
302,406,920 *1DEB06E4C1E01989DD262F8A3559617F39EF9FF9 STAMPOULTZISBSW
302,406,921 *1DEB27BD606AF1F7779D86434FE781BDC790AA82 [email protected]
302,406,922 *1DE0FAE87618F2673AACFA690469E450770529AE Le.Cid:.Pleurez,.mes.yeux.(Air.de.Chim
302,406,923 *1DECFFF2CDED4BB7AD93E246A6F2C3904951481B LENARD.BELTZ
302,406,924 *1DEBF96FF5BF0BC295159C6E2E881D237EFF828C lenardparlato
302,406,925 *1DEF22261D4DE29DDD97874D129A3F1C742BC21E lepoltron
302,406,926 *1DE2E22DB2A4E588EB87C09FC134455438E174C4 STEFANONDO
302,406,927 *1DE231EA8B3E3B3EE4BDAD19FC52110E68B130D8 STEMPELMUSTERN
302,406,928 *1DEAAF26B4315E291913963E891644609E9725E3 Let.Me.See.U.Pop.It.(instrumental)
302,406,929 *1DEA1509F81F2491143464255922A423C93C0F6D STEVEMASTERS6
302,406,930 *1DEAEB6BB1FEA046FF2C260C7B9E7BA271414040 [email protected]
302,406,931 *1DE58576ABFEB92CFC09687203B549D3DCA2071B [email protected]
302,406,932 *1DE9F8BA70ABA15F245797CDEA874E01FF69EDE0 [email protected]
302,406,933 *1DEE02933B885FD91A9BFFFA37EE043B3CE6DC3E LILAGONA
302,406,934 *1DE21ECB58424925B9FF22E6047F45F0E4833B6F LIMEHOUSE7
302,406,935 *1DEBE2F5086D301E2002A7064AEB9FFAE97412FE strotztes
302,406,936 *1DEF71E0984321775628059AA7EAF031312F6165 LISTASHATIBI
302,406,937 *1DE89E8780CB27103EF904E568EA8E5B1584AFAB LIZ TOSCANO
302,406,938 *1DEDB37724C41C3ADDE7573C512C5CAD10C85F3F LLOYDOOLEY
302,406,939 *1DE511313868407CC686E18E712203A0AB1DB6F6 LOFÄDOMSÖD
302,406,940 *1DE332D873F7CEBC89630381D61A9D9DD8CFBA51 LOH-WEI-JIAN
302,406,941 *1DECA77337A498EC85437EA3EB720599851DA470 LOLLERN2
302,406,942 *1DE86CC6027EBF497349541E1C945E25DB8DC2BE lopezponce
302,406,943 *1DE79F5E78DA0BB725A476557551DB5070C4E23B LOWELL.FILES
302,406,944 *1DE415BFF2416BAE3A9CAC86DABC7266D2F0CD02 lphbtcl2
302,406,945 *1DEDF7EF4B58897EE9EF2CE62AD9AB8684866AAA [email protected]
302,406,946 *1DE9E7D1532DC985A4F4346EFB020CB5D06EC302 LUIGI.IACOBELLIS
302,406,947 *1DE3F6BE6C580B35CA626BF02E045666053A77A6 [email protected]
302,406,948 *1DE7CE971C1504F2B994116EBF947FE11B7471C0 LURWICK9
302,406,949 *1DEF41D4B8651A44FC22D5DE47F02DFD93114D9A LYMAN.MALINAK
302,406,950 *1DE2497EAA09AAAD11FEABCDF97AEA6863AEA81A LYNDON.FINWALL
302,406,951 *1DEB6B8AE88547E7C0A5583CE98337E002B2EF8C [email protected]
302,406,952 *1DEDC885C601A714633E0043BAAA98BE562965DC MACKILLME
302,406,953 *1DE2A1B6FB3106DE8371CDB87FB96C29958EDE66 malikmacculloch
302,406,954 *1DE31264948289DA4E411EF35B3D6E471CF40789 susan-husa
302,406,955 *1DEC6EE57A8BA5C0E9A2FD6D698478E74D30CA52 SUSANSTRAWBER3
302,406,956 *1DEBF34A367F1490213FA18A7D0E46EA0506A568 sushan-kotian
302,406,957 *1DE013C16316E262B8134BBD56740AFF6012B651 [email protected]
302,406,958 *1DE30B0AA754CC26E764A33D5D06DC5CB83ACDF7 [email protected]
302,406,959 *1DEA1A39D7DF0C344FB266B7D571ABD63AB5C079 MANNENWE1
302,406,960 *1DEAF5C117956D9DA9557355494A8860AF5D426B MANUELMIRCHANDANI
302,406,961 *1DEFF8FF0AD792FC385391FE692E8DA783DF1C60 [email protected]
302,406,962 *1DE3163E7DB20532AF92BE802B76689A5CB693AD suttees
302,406,963 *1DE05F3DFEA344A38EC3608C59DAE571F623AE03 Marc.Winter
302,406,964 *1DE4E81AC17D4F1602BAA661D2A70D58065DEDCC margaritosearl
302,406,965 *1DE725EA5B1EA5330D952DC15FFA86C95EB949AE sylvia-yelton
302,406,966 *1DE8A2086180EC0640EC4E67F9E0FC4398652688 symmetrize5
302,406,967 *1DE8581953B63F193D76250CED4F8BA8E524032F tab–urile
302,406,968 *1DE4D7B458909A1DD43859E89ED1C0C8718237FA MASTERMIDGET1
302,406,969 *1DE97D14FEA3DBE910E724FC10C33051C85838C1 TALKCITALFO
302,406,970 *1DE834BF08A222A50CB22D6FD03A5C1DB25BA040 TALKJAMES_D._MARTIN
302,406,971 *1DEF7F54AC5F5494EAAA4E9532D2C6FCA347B35D TALKWILLIE_WILSON_BA
302,406,972 *1DE03D4AF4558EE3E6B1F3A9EEFCE759C447F96D TALSPRODUKSJONEN
302,406,973 *1DECC0137138996F1FD0E010F9A8193EE3F4DF50 [email protected]
302,406,974 *1DED62913D4D769E0E8EF81CAF22387D6B3BC5D1 tanyamaxwell
302,406,975 *1DE419D76F3005620332BF701E3AF78729C00B3B MAWS0
302,406,976 *1DEEC62E64DFD07FD6690488995286A6EF09886E MCKINLEY.CHAMBERLIN
302,406,977 *1DE2810D9AE1D6594A728FC4947F82ACD6C0D300 MEG3280UBFEZILT_TE3K
302,406,978 *1DE461E2035E67B282DE10D4E4975A8EA3565A3B MELISSACUADRADO
302,406,979 *1DE4A9BED59C273A517DA48345F3A4C85052574F MERGECONDENSEDELETE
302,406,980 *1DE29B9858AFF51FDE9ABD37195C87F56B204161 TELOIVACCEBER
302,406,981 *1DEE05650AA930DC3971B88660C156F776B5E0CF messier
302,406,982 *1DE4CCE50FB28313042B1F4250DEE3E06096B27D [email protected]
302,406,983 *1DEF0B585A1D526696EC9F236DD59BB4A94E1DB3 [email protected]
302,406,984 *1DEF2FD5502B170D1DAF1F9217145BBB6FDDE25C MICHAEL STUTLER
302,406,985 *1DEA176DC1B7452024734D7BAC29B676A5B9C88E TFVKBB
302,406,986 *1DEC926B0DFD780B49B769C970480F2B3F641E9E TGS8
302,406,987 *1DE7AB0C843E925BB4AA64A214B21AA435289A9A middy3
302,406,988 *1DE0F1365FD9EAA188FC743FD95063D067CB1EB6 mikefoshee
302,406,989 *1DEE78493C0B9E3A901C094F68DF3BF96326AA15 THE-GIVING-SEA
302,406,990 *1DEB45278D3BAB051003C29E681EF3FE9D88F922 MIQUELTHOMURE
302,406,991 *1DE631B60A4CB4EFFD0909DB5467335C01D5B8C4 THEWALDEN2009
302,406,992 *1DE711223C05E317935CB10D36825531452F7E47 THINGSISHOULDHAVESAID
302,406,993 *1DEAEE4EFC95A9B88F55366221F7EB7A7B0025EC mizz96
302,406,994 *1DE57198399EFEF1454ED9A2B5F78CEBC6C83D44 mmibrochurecover
302,406,995 *1DE564837BC35BC5B880CA91B0E10FE7E087366C mohab-abdo
302,406,996 *1DE910BAABA86F38839C52B29321390F7B0E4EE6 MOHD RIPIN
302,406,997 *1DE5A67EE56D50CA28C3D4E95336F647E05B3F3A mon-home
302,406,998 *1DE33970252FC4362DDE486F3CA35997C94D7E98 TIPC4RT$
302,406,999 *1DE234B74818EAC4EA7D1590CA355C931D246FEB morganhenjes
302,407,000 *1DE5F5359CFA4681FBD80582540EC5D705E5D356 TNACALNE7
302,407,001 *1DE3920DB8E92220DEA8EAC9041BB41BE1E9BBC3 MOVEMENTS: 10
302,407,002 *1DEB78A1458ABE766EA5A736D4766997437DC285 [email protected]
302,407,003 *1DE2D4C3E53D997A63CCD0C7CD6EE3BB5A291ADA muliplan
302,407,004 *1DEEEE641A20F8E849D7D5CAD8C581BB52A5DD83 TOSHIYA1048
302,407,005 *1DE9A1D9DE268BDFF292C5F5B8EB0EC7245ACAF4 [email protected]
302,407,006 *1DE9F4FDBA39119D6E16FB15632AF1CC71D89D46 MYLESSTOPP
302,407,007 *1DE818912908B1224CBD99688615170AB234A86E MYMARIE77
302,407,008 *1DEE7A4A0537EE07F6A1092B31A412CAA1C1098C myronreyburn
302,407,009 *1DEDA0211A6CB6C8BBEA07236F0ED929C1B7F041 [email protected]
302,407,010 *1DE42A7E50EEEA1506F8A0E35246BA3A308FE488 N:${
302,407,011 *1DEFF312E228D980B89692457572F991D7BE2FC5 TRANSMISSIONSOMASIM
302,407,012 *1DEA9263B34CAE73A141F7941359BAA6F0338609 TREASA-EGGMANN-LEWIS
302,407,013 *1DEFBE3CE487C55B1EC7A3348A0CB5E02EA2014E nakakalipad
302,407,014 *1DE1AF3D0E6775B8E7F32BD3D8EB7FC914896303 natalie-abraham
302,407,015 *1DE991D2867B5A8917422561235EE44D46BFA164 TrioPieceforpiano,cello&clarinetinFminor,Op83No5
302,407,016 *1DEED649940F718A0D9DC31E06C16788B248109E nazorna3
302,407,017 *1DED75924B1134F6DDB211A6E5AA7FB37B3C5644 NEHA-BAJORIA
302,407,018 *1DE8A2A61836EE9BB54085C10DD353A663406060 TROMBETA0
302,407,019 *1DEEF2FD0995829E6CFB49CCCBF1B985789B26FE TTMTTIVL1
302,407,020 *1DE73E88825CB338850C6E95600E45178196D0C8 <TT>$PATTERN</TT>ISALSOTHEEMPTYSTRING.
302,407,021 *1DEAF3F56EF88C640C525FDBC1B0B490F982C5A7 TWOPUTT2
302,407,022 *1DEA87CD24FCA94AEDA099B750636DC5DC6C3060 TYCOOMEY
302,407,023 *1DE19B5C69EF074A8D70BFA0FC94957FDF85FB3A TYPOGRAPHICO-EDITRIC
302,407,024 *1DEABEBDD7C7D786A2C34526CFC29619CF4A8ED8 nickolasmalarkey
302,407,025 *1DEEA8B0A4BF55C3FCBD3AA812576A4F21966CA4 nickynoo2007
302,407,026 *1DEDE4B5D7B83C0EC56FE38F2B0A4997AEFE82A3 u74q
302,407,027 *1DE69140DC9EE3FF2E6965F85F5D33FED3F01176 UCKONS SYUKIE RAMENIN
302,407,028 *1DED36E2523E30F7D2F13D99A9D979D5A1AF3E6D UDCVCKT39
302,407,029 *1DEB5EA5B3853EAE885FDCE21B435A3EF52CBDFF UDOVOLLAND
302,407,030 *1DE83C04B3C91B76FA86C0ED0E75FE86234B145F NONESURIENTLIES
302,407,031 *1DE07C6F44B3AFF60DEDD165B32C456ABD73294A UNCOMPASSIONATING0
302,407,032 *1DE17FE32F9826809DC139DB1A29B246F9D46980 UNDERBALANCERS1
302,407,033 *1DE47B22EBFE423EF50D7752473CCE718447B54B UNDERNEOMENE7
302,407,034 *1DE196D440D28BBD52933542E84DFB8F7258F643 NSVVRBETING
302,407,035 *1DE7EBA523B647799F004B27B4F2DC4CA0D3C7C3 NUMBERS.MONGEON
302,407,036 *1DE7204B6DDA56A104F1B177656A89176EE3CDCC UPLFSYR
302,407,037 *1DE576911A47957CC266ABBA6810769690EEC31E OFFICEIATEFL.HU
302,407,038 *1DEAD390430BBA7211A6A87E0D8220C1C6BEBAFF OGUTZMORE
302,407,039 *1DE070989A1A761858A94F4B59F5EC0BC9D1EBB4 olenprosonic
302,407,040 *1DEBFF6BC0E7E184E708610305F85630A860FDC4 OLIN.GERYCH
302,407,041 *1DED28381055C2AD14719584F62B0FDEBD5CBE08 onateguipuzcoa
302,407,042 *1DECD6D70FA12CF86A70D6D711B3670B9112FD67 onderhaning
302,407,043 *1DE9ED9F33AB6DE2E900D9CFF0CF9AB432AA6ADA orenweckhorst
302,407,044 *1DED6DEEFF6EB0FC73B4C60CF02C1EB9B4BF99F9 OS-METALEIROS-TAMB
302,407,045 *1DE0BF448F7F21D69917D11C719E5F9B584659F8 USA-for-USA
302,407,046 *1DE65103F0021BC2A5B6F270176C92B2CE581FDE USERSOCKPUPPETRUS
302,407,047 *1DEED69DC31EA2621EA72796DA8FD3586036320C otvorenijom
302,407,048 *1DEF043D87A4F532941BFC982B344CA3E20E42B7 OVERA8OUND1NG
302,407,049 *1DE71DB08B926A3C4DA8A988F38A6EA1C6B3B1DB OZKONDER
302,407,050 *1DE681E46973A6AF2A149287CA536FFEA4CC35BF P{\(
302,407,051 *1DEE21A638C7506A7484E852BB5C7E10AA4633A8 [email protected]~(>_<)
302,407,052 *1DE081CF5E62EBCF1DDB32DECBD2322E2F6F68CE [email protected]
302,407,053 *1DE909E9AE4B7B208393DF497484204FA3CDC0C0 <P>Allocatestorageforforthcomingoperation
302,407,054 *1DED54D7F6B8990E1906A70F1868FDD15DAC7FF0 PAMPERIZE
302,407,055 *1DE8ED402CCE3EDE099356458D36817D50587136 PANTONEBASED
302,407,056 *1DEC5717B694A9C95F44A0EDD0A26394AD365444 PARTIYANING
302,407,057 *1DEED99B3FB29699A019B6626D6942EF66930B66 VATIK
302,407,058 *1DEEACCF6DD8EF16453AB82239987BC84CCD6BED VAUGHN.KINZER
302,407,059 *1DEA20A48C46B5ACE090DC11C2B4A9A7A3DD57DD VBERWINDENN
302,407,060 *1DE539D3B2E117257B04A95AC08B90FE462AE977 VC$7
302,407,061 *1DE4838CE0140438548F2DD614FFFFC1C7E61F6E p====D~o(_0)
302,407,062 *1DEEDE6B7A7010444920601686640B3E3C48E5B1 vermout5
302,407,063 *1DE09BF9411B1EEE0F9F0585DB38CEE3739092BB VERTRAUTER9
302,407,064 *1DEDEE81835657E3F298924883337A8D1CBA4807 vickiebeel
302,407,065 *1DE1FF4D043549A8775D3E6033618C150CBFDA0F VICTORIA NDIOKHO
302,407,066 *1DE75AE8236081E79CCF495733220AC6953C9627 vietnaminis
302,407,067 *1DE4AAF3EBAC45090F65C12D95F9BADB4BCE832F vincelee1
302,407,068 *1DEA4FCC10D2AA860644B4DFF29F42E6BDFDA893 vincezachter
302,407,069 *1DE262F4C2010452CA32F956D4684DE54E01C904 perryjabbie
302,407,070 *1DEAE87C56CDC58FA195DEF6A9B717D1B9023BD3 PERSANS6
302,407,071 *1DEC39DE4B54687DC08C328B7D5F65E91214E7A8 VIXON-WEGWORTH
302,407,072 *1DE00F32254BCBF73BCD12A284F32483DEACACE5 VOLLUMETERED
302,407,073 *1DEC34B498759A3E206A629FCC0B932F5334CF00 voniceirenelarsen
302,407,074 *1DEB19E6C7F99DC3B43E3678E8C96FEC8A32CD07 vres-purpurines-me-font-penser-au-galbe-de-tes-hanches
302,407,075 *1DE455EE08166930A5B9F30542AA7417BEC61D35 VYHOLEN8
302,407,076 *1DE78D12FE65618AE94356805AFA57175FF62284 WALKERBLAICH
302,407,077 *1DED0C0A46F13605BAD4BACFA3089BA2F5FF7756 wallaceblancato
302,407,078 *1DE882836282BA904EA212397EF800D75B0FDAC4 wanna.bees.(feat..pliz.of.big.bad.wolfs)
302,407,079 *1DE0993AB128DA2E391DEAFF3EAB826D326DD3BD watauting
302,407,080 *1DEF5DF5EA6B2CBC637E53563BE1B0C69B44653D philipcondron
302,407,081 *1DE4B469B36995DB5E0885666B46EF5CC6309D87 pil0t.br3
302,407,082 *1DEA412964C88D509097CE1DC791CBEFD42D25E1 P#@.*.}O{
302,407,083 *1DE793130E3ED79E6D8EFE093F67347A7F27F0D7 werwetweyweu123
302,407,084 *1DEC10DD95AF2D8575519BCC5FDCFF2767DACFD8 pommeler7
302,407,085 *1DEE39E5A8F5072C8662EA0600B29E927EDFEE11 WHYANO
302,407,086 *1DE53AD667801645BC2CE7968CD86C898970AEC6 WILBUR.BALZA
302,407,087 *1DE0D9C5B122C618FA74253D6326438B705C2641 PRADLEY
302,407,088 *1DE8C5799F81F84541A1C50461C44A5377979E59 WILFREDMILLSON
302,407,089 *1DE641D68A554DC8343B02F60849C72CE3459667 PRAY TO THE GODS. WE'LL BE MEETING THEM SOON." - SINBAD
302,407,090 *1DE649B5E76509CC8EC2C5AA3D9A429438D63841 WILFREDOKINGRY
302,407,091 *1DE19FCE0BE11C16C9757B124FF5B26D594386DB WILL.BACIO
302,407,092 *1DEA13D3BA3F1540F873989324BA8BB653828780 WILL-HAVE-YOU-AS-SOUNDLY-SWINGED-FOR-THIS,--YOU
302,407,093 *1DE03E970E30A0AEDC4814CFAE53FCAA36827FE6 WILLIAM.FAIRCHILD
302,407,094 *1DE71B968BAD988ACDF1572B2AF0237F0C70D8E5 WILLMANCAMPOS
302,407,095 *1DE869063E6D937992136D3F68F79F989C471ECF PRINCEBRENTSON
302,407,096 *1DEF876A30623EE932F028BAD9BC0F38B01EEF69 PRINCEDAFFERN
302,407,097 *1DE6BF22E44A0C58A434030CEB269AC44C11C864 WISDOW89
302,407,098 *1DEBBCA79DE782CF8919CB5ED061AF35052F923C [email protected]
302,407,099 *1DE329BF6B937BDFEEBC3F91E6885FFEE5C310EE WTC–RAI–OVERAMSTEL–VAN
302,407,100 *1DE9BF42C0F723504F5EE88743CF8D33BB597928 WWW.GOMONTREAL.COM
302,407,101 *1DE36E98DAA171F285EDAF2122DF7B85BE937CF3 RAL_MONDES
302,407,102 *1DE50F3EC1B28CC6077F344D236EB5341A1097C6 [email protected]
302,407,103 *1DE4C85707FAF2E74BA6DE4BEF0D7302C73EC850 W痴女黒人狩り
302,407,104 *1DE765BD4FA9B3811812A93C2FFF6E2325B0E124 rantsandrefinementsblogspotcomrantsandrefinements
302,407,105 *1DE7BD265606145BA0667348636BFE91B21999A2 xa<aa
302,407,106 *1DE22D8B9374CB86EF0C643597E4938D33C0DB51 RAW CUT
302,407,107 *1DEBA492BC9A4A861D3762F6F6D088AAE1C0FC8A xiaotymarmolejo
302,407,108 *1DED34FEEC1C723BD9EC96112BD4D19D9BC77EC1 [email protected]
302,407,109 *1DE37C81712CA8ABF97245C58823C44F199E1FCB READERCHRISSY
302,407,110 *1DE685029180CDA249656119B7216872C315DD57 [email protected]
302,407,111 *1DE2AE6705976BF0F85732A149476115A549B642 REALROCKNROLLAS
302,407,112 *1DEF0CB3E64268B4A8D3DF735418981AE7425985 RECEPTUALS7
302,407,113 *1DE9A0F9AF970C83881FDB3B563150CB640AD3E3 RECREATIEVED
302,407,114 *1DE2097B659DF93F5F5D99D4926700024C1DCFF0 REEFERINDIANS
302,407,115 *1DEEA4C0E7BF9744B1B7ED3D82E6B513F17A071F )x([email protected]
302,407,116 *1DE75DC71774EDDDAEEF8C8D26F6F6D601965886 reg15ter1ng
302,407,117 *1DE3C0243082810357B4D28517FFD1AE95E34C49 Y5SABD8ISCKC
302,407,118 *1DE12E51FD43171CB86C91D968D3C685F26DADA1 reinaldomcdonel
302,407,119 *1DEE31EE7C5054E64B73410A489BAF1124CDB859 remaintenance3
302,407,120 *1DE105ADF11EBFF9CA6B254230DAAA966DB03181 yatheendradev-mannakoddathsujith
302,407,121 *1DE43B341451869712F8596F94ED731817BC783D [email protected]
302,407,122 *1DE9C296B2554221D6E2F74DC846D8CDF8B25BF0 YOMAMAFUCKYOUS
302,407,123 *1DED1A83061EBBD4DF7D1A611FF109B4491116E9 REVJIVREIS2
302,407,124 *1DEBA343F991FECCB5A19D7203248D012C3CD9B8 REXLLAMS
302,407,125 *1DEB7E71C327349CA11297D78AFA193B954A7A37 REZULTANTEI
302,407,126 *1DE316C4E3D6EBFCC411B09280A10FAFB67D44F6 yornanmunging
302,407,127 *1DE83167289891C3E821D20FA56D6CFEBCE7205E YPJYRQAJRW4C
302,407,128 *1DEFB626F6554ABFDDEC542A37156FA03FA854D4 rickiescherbarth
302,407,129 *1DE0D4688BAE2AF6A3393B908B8767BDF28F5130 rickymcmurdo
302,407,130 *1DE9F35BB7B47D519BDA4DDCC4767072198C8E40 RIGOBERTO.WIMBERLEY
302,407,131 *1DEDC4636CA0B32BC95011D73EB27DB3FA56429F ROBBIESIMMERMAN
302,407,132 *1DE198D73833FB51F4F3BC22A91912B64DBAD5A4 zachariahblacknall
302,407,133 *1DE7B6DB1747477803E151D3A61057D81309C7A5 zacharypillion
302,407,134 *1DE7024D4BC17319BC009239C19F4FBC178EA8A4 zacharywithy
302,407,135 *1DEC49410814E05369F90D612BC842AD33D8BD67 ROBTLEMA
302,407,136 *1DE13A393571C972CDB8811F0B81334F321FE95B ZACK.OGLESBY
302,407,137 *1DE756801804AA4F8AB7BD413B8B1901F6C96BDB ZAHMERB
302,407,138 *1DE998032AF3FA61BE35563020B4FF9E2C4220AA zane-m-neal
302,407,139 *1DE405B7CC4ED727E1A48722AC617BEF0678F532 RODNEY.SMIALEK
302,407,140 *1DEA7D030F590914C51B7A844F5284743E61C32B ZANE.SERRELL
302,407,141 *1DE7A03AADBB636D7F99B95BC3A49759B3C1E54E RODOLFOAURAND
302,407,142 *1DE5ACF9D638377CA342552157F0C8473755237B zarenhof
302,407,143 *1DE56A41373361237D17EFB03A289CEA4617E2F5 ROGER MUCKEY
302,407,144 *1DEC343FFD0B591B72D69702B8627E08E671D202 ZEALOT_WILDSTORM
302,407,145 *1DE38E9F14D9AC8CF665380486C8C59FDE3527C5 ROLANDOKALTEFLEITER
302,407,146 *1DE333FAE07885E9F8D24F6F62F71FEB85CDA187 [email protected]
302,407,147 *1DEADCA1E7420A5E545112AB9F8D88C5FC087750 ROMMEL CRICHLOW
302,407,148 *1DEF77053808DF978B700E27C1C63A5B73A64AFD RONLECHEL
302,407,149 *1DEE59D6891C426A8E5C1A03561D7D9295DD7DB2 RON.MCELHENNEY
302,407,150 *1DE1987A0B4972E4390F34CFCBEC0711D1485C59 RONQUIMSON
302,407,151 *1DEDC63D7192DBA49858D7075A58D49C1E0E515F [email protected]
302,407,152 *1DE0C43ECAF9C54019A5963FD95C48B2DD591196 ROSEBUDSAMMIE
302,407,153 *1DE1445D79495429EECADFC19B2FA6B5419F4F20 [email protected]
302,407,154 *1DE76F5A0CD2F45357B675A6F7462ACA847D3663 ZHUZHANYIN
302,407,155 *1DE2E5356B6600B6927E5B57DBA595275DAE73F9 [email protected]
302,407,156 *1DEF6842D519D01537F79AA6D5DB5A3F698D50D6 、rpgツクール関連のフリーゲームとしては高い人気を誇る。
302,407,157 *1DE3BEB4012828B889AE36B9155CD8D21677C43E ZKQH
302,407,158 *1DE24EE1FF27A695ACCEC55EAA653BAF962E153C RUBEN.LASHLEE
302,407,159 *1DE35A17D2E363A24B10D2E4B731A3AB091F2340 zongkor.vang
302,407,160 *1DE23C5D102FAC8DD67DDAC065C0DBEAA15B0D6D RUDOLPHMORKEN
302,407,161 *1DE489833D7FA53F1742488D8CE79C5CDE46CC75 Z!PM
302,407,162 *1DEB424FAFA73874E4CD6D98537868C69CD80D11 Runnin'.From.the.Police
302,407,163 *1DEFF854C8DF5C42ED0828C3AF51ED51A4FA9C30 RUSHABH.GANATRA
302,407,164 *1DE758A4E0878DA8A315C458C5F5EB5DBA447EFB ZWAARDLELIEN0
302,407,165 *1DE176ED5B763B5C73CD3D0DE7929FE9AC30653B SAMMYMCEACHIN
302,407,166 *1DE8451BBC514FBB11D7929EF13EEB8E07C372AF SANDYKALT
302,407,167 *1DE1C61F1471A023D358BADCC1DAE4C29228612A [email protected]
302,407,168 *1DEABAD4230813A6CAED13ABAD17FF29A09FA879 SAVANTAGERAIS.
302,407,169 *1DE47E20396F57E3653212B94507D7489FE68B14 SCALARS،
302,407,170 *1DEFA6E882E1394B7DF3A1BE893017EB81866646 ДИШАЛО
302,407,171 *1DE8DCAB02B0F7CFCBFC3208C6077E7742B6BEBE SCHOPT4
302,407,172 *1DE07957354201A855AD0619735F14EA2F6D44DE једанасетој
302,407,173 *1DEFAF1A4874E1A98968C618FE8C9BABEED01AC5 SCOTTYSTARKE
302,407,174 *1DE92CABDA037C4CBB3BE5647EE0F72CE7318F88 „КОННИКЪТ“
302,407,175 *1DE094391F86C4B16E5FE9DF8039D4CB3099CFBE ЛИМФОИДНОМУ
302,407,176 *1DE9857B66576FF4C3EFD7163589B7F032B48732 S DE PERDONAR
302,407,177 *1DE015223D07AD3ECC795FF89EEA4B82B3D5A8D3 s.d'Or
302,407,178 *1DEB3B30558A2D16376525DB3BC65DA222E71699 НАПРЕТ
302,407,179 *1DE2ECB9E7B7FC78EF6F27462D8CD7E14DC85A93 [email protected]
302,407,180 *1DE16120514DBBC5290C319EE7030FD7537B7056 SECURITIESMATERIAL0
302,407,181 *1DE9B385F1572352112F28BF70AB899E783AD39E синаногава
302,407,182 *1DE9C8585B0C61432875E882ECBCC2EB30486505 ТЕЛЕДВИЖЕНИЙ
302,407,183 *1DE2DFD380C3C807FE4168CBDB61F8FEA1D54578 [email protected]
302,407,184 *1DE90C795EF6EF64FC4FD9DDF184389D3C3AC1BE SESUOERENEV
302,407,185 *1DE127CB4101F8570FB37F25197BF6FC9FFB9334 SEVENRACOON0
302,407,186 *1DE98FE62A672FB67D59D80119841754CC3007CA さんにはお世話になりっぱなしで、これくらいしかお礼ができません。些少ではございますが、tomos
302,407,187 *1DEC48FE1CFEB3A9B312074D32CED636414EF0CF SHATRUGHENAED
302,407,188 *1DE1C969AEECF9363EAAC2FDF5FB4499E8F57C48 SHELLEYPENILLA
302,407,189 *1DEF37A9B89CE1895F154610D4BB360754D2D4F6 SHERWOODSTALLION
302,407,190 *1DE3E850479AA48A3450A867784F5D0B99E1AC62 SHOOTIN.FOR.A.LIVIN
302,407,191 *1DEF2FE4BEB129196BFB0C6BF0C2139141D27B75 SIDCREMER
302,407,192 *1DE5B5561CFEF870FAE524E3A04D3F5EF701404C SKAEGGES4
302,407,193 *1DE55A3C1277818642E8F683FA6EB7BF7928599B SLEEPING THROUGH MY STORM
302,407,194 *1DE310A4CD638DA66C9492E6C5302FFBFF1644F9 SNOWBALVINCENT
302,407,195 *1DEE2023AC5DAD58BA44C4AE17B7EA052A58A929 [email protected]
302,407,196 *1DE077B58EB8BB3E18CADF64D54BE9006DFEAD68 [email protected]
302,407,197 *1DEE76A8297154C798663A5E9A08D0D52180D799 SPARGOSES0
302,407,198 *1DE63B10496203F58A3A97431DF610D1DC4660F5 spavins
302,407,199 *1DE003119447BA80CAA8C0D0F15C3BD01C69E8A8 [email protected]
302,407,200 *1DEAA6973FC6AC7F6AA6A40C30922E0168DC60FE s/s
302,407,201 *1DE8A685707232EA3E89DFD481C8282C7034722B STANFORDSIMPLICIANO
302,407,202 *1DE3A58C872B09D1269F069AC921788B3E464FA5 STEPHANLAJOIE
302,407,203 *1DE7AC6290FFE4D6B0CBFF48BD9F5DA08C8BDA2A STERLING.ONSUREZ
302,407,204 *1DE9E19F20BF9AEABD652DA77BD0F8D3063C426F STEVERBERNARD
302,407,205 *1DE02F7BA78DBBB147591117B966A35A76AEB7F7 06a0554
302,407,206 *1DE98C0120F415AF3762E6EF4F107EEDBEF77BAD SULETRAHS
302,407,207 *1DE9CA6879C207D63C87626D9B0614D064D53EFD [email protected]
302,407,208 *1DE1AEEB0F0285167157C843C2E710C23DE69981 SUNSHINPACKARDED
302,407,209 *1DE4CAC31150C6277956D8546FAA3992C4C78DD4 SUOREGIROM
302,407,210 *1DE4DDA4667091F0F79CE9098C324881297EFE98 1001213 kuubanmatkallesuositellaanmy
302,407,211 *1DE9F36AFC56BA18A38ABA76C2815F211A4E8828 104.studentische
302,407,212 *1DE831EECDC43FF605CAB53BDC2C52F628D76037 1072578 DUFVA OLI KUVAAMON OMISTAJA . 19061908 DUFVA N
302,407,213 *1DEB9E4F4B5E57F34D8347F90F903045FBD81835 1118833 sehr.lange.sogar..
302,407,214 *1DE4C85902E712C8C6391C9063E0A0977B8AA2DA susan1225
302,407,215 *1DE6C588C7B9B78C501FEC08F0A2D3D6D25117DA SWEETVIBRATION(REMIXEDBY2NDFUNKTION)
302,407,216 *1DE2BC779D9E233C2D22A2C733AE55F3AE6BCBAE SYDNEY.HOMESTEAD
302,407,217 *1DE7AFF05E37E20D9A3FA14DB71CEBD881D51515 SYLVIE PATENAUDE
302,407,218 *1DE7545E5ECC64B245E27EED5AEFA4D9FCC3FF7F 1565169 enkeli kertoi , mit
302,407,219 *1DECC949844BE6D0DF4C7CF9D529359FA1282C79 „SУГСГО“
302,407,220 *1DEFD112D4FC1970C09FE82738EF1B5C05BF335C 16september1868
302,407,221 *1DE36A53CFD083282F64E838739C44E0F44EBEC1 17081013
302,407,222 *1DE45A444CB266437643551F2F1CF9FB05D6D998 TAKEMAKA4
302,407,223 *1DED5B58F6B0261BE2EDE5BD022EE3EDCCDE7E8C 1830189 iso-9001:2000--laatusertifikaatti-yhdess
302,407,224 *1DE79DE978DEF016C8095919AD0398F6F6F78C1E 19041317
302,407,225 *1DE7F87C2F88006E8AC5A6D61C128F0548618AA9 198.YARDS
302,407,226 *1DE3519D2447B28C74334C391A6D4FFE67DD1019 19ghz
302,407,227 *1DEF10E36BBA4EA632460D077DF958FB10D6A754 1BALAJEWA
302,407,228 *1DEA5F30A1136BD9429B36486FF95785CC004781 tannersterling
302,407,229 *1DE5D3B00662C4B3BB495CC1ABB461DBA511CB56 [email protected]
302,407,230 *1DE90380AA78B6B8866744F2EBCEF08E646105C4 1-devadasis
302,407,231 *1DE1B0AFC322892CCAEDC2530A35A83284E6E50E TECHCOUGARED
302,407,232 *1DEBB83F4335F544C741895EB55FD2AB54567BEF [email protected]
302,407,233 *1DE3304CFF97C2BDEED5139CF02CFD0A9F9F5556 1.HANDANI'LERIN
302,407,234 *1DEB6BB99C7E4DB8C580EDC2D56EE6DBF82ABD87 1-harmanIna
302,407,235 *1DEE4ADC74AE33D8C0FF8DC4B533315EED9EF80F 1.KOKOUSKUTSUTAVASTA
302,407,236 *1DEFC54AD714B6FDA7573315DFAA77F7CB099A67 1 LARATO
302,407,237 *1DE47887FD8749C31FEF068C5A17E876AEEFD3B9 t>f4
302,407,238 *1DEFFB0EB407D2DE7A0DBAAF8DB67BC1E958B1A3 thadbarnes
302,407,239 *1DE63D6CBC652EFDF5758FB4902F4CD870AA8ABD thatcorky24
302,407,240 *1DE1E0EE107AAAC81B6EE101A22D3D439066460B 1POMOJENTIEHEN
302,407,241 *1DE398FF810EDBF752D2E315653659EFACA7031B 1.PRIMIZGAESTE
302,407,242 *1DE79A9F61A56F485DDD95F370A3F4FE212316A0 the.cattle.call.(2)
302,407,243 *1DE5CABDC3AC363327509487047FA3D6F35D0399 The-Doo-Wop-Box,-Volume-II:-101-More-Vocal-Group-Gems-(disc-2)
302,407,244 *1DEEF79144EF1961DF293E6592BF8278F0F7A6A2 1.SCHUSSWAFFENPRESSE
302,407,245 *1DE339DE1ACB310CE27F071A8574130BC29F7F26 THEFROG666
302,407,246 *1DEAA73C364D57FD0DB7019427AEEEF89F79B121 THEMEMORIALALBUM
302,407,247 *1DE80CE107E096A242DB242E439061F5C5E84BD1 1thetigger5
302,407,248 *1DEAC51B580CB04073725E5C821E691AD4A3079B 1.USVAISTA
302,407,249 *1DEA84C426CBCCD4F5A8215B570AF8DC81342FE6 THERMISCH/A
302,407,250 *1DEFFB193D74120CE50B55F9E9C0D2F2FFB65F61 THISSWAYOFMOTIONED
302,407,251 *1DE5BB97B8E7003EDC715E18CE79D6A663CAA834 [email protected]
302,407,252 *1DE53B9D008B7B15A795CFC31ECD3B5597E600A7 TIARVINE
302,407,253 *1DE8881D38DF205C3A797B13F3DE808BCB5E6181 24041293
302,407,254 *1DE3D2FF6DB2B20C1B92342EF91BE5535AFCE364 TINKERBASIL3
302,407,255 *1DE6D9D09B7D167D8298D1CE7654BA204BEC1C66 tirumakudalunarasip
302,407,256 *1DEC4CAA1EC05D1AFCBE1F5FF371DA43AC56D957 2758031 JULISTUSTY
302,407,257 *1DED8B1FBD173964A9447984EC90FAE6CC57AE60 2816510 PAKETTI-.,.PERHE-.,.RYHM
302,407,258 *1DE61536D294ECAB03CFB7EAE6207E34E182ABFA T`%O
302,407,259 *1DEEAC1B3DFA1FCF8A5ADBBEA0A5840BFE36F3FF toddmoistner
302,407,260 *1DEBD7DE9A4101F294C8D9A6E9EDD74DDD75FAEF tomioka
302,407,261 *1DE139FC7061D96FF3DBDD18168D9CB2350E921B TOMMYCHARITIED
302,407,262 *1DED255D10FB1F319907571FBA02C43E8E15BF6C tommysunderman
302,407,263 *1DEC9A76D845C3A61CACA83A9F9287DE91A65911 2gnatsnap
302,407,264 *1DEC3A2EBE3F0659B344D12420E398D4A3EB9430 tony.spina
302,407,265 *1DEB2DC58B4F85F524A8247A261168FA37B183D5 2-PISTOOLIAMMUNNAN
302,407,266 *1DE37D18415DCD12B176526B6BD2222A4CEF0823 2PRZYSZLI
302,407,267 *1DE43AB6AAF34D8F9A317A74D2AED6548B7AA1D8 TRACY SHEARER BERTELLE
302,407,268 *1DE8486BFD2A6F87C0CE8180C61BC9F9086DF169 tranaicarr
302,407,269 *1DEC354DD1F5B7B12C258BA265950FFC72C39D16 2.yaptiracagim
302,407,270 *1DEAB19F2B948392020C8D380BFC870D3728EBE8 3>~0 ~o Splat
302,407,271 *1DEB23CFE6E52B6ECEE4EE2A0A890F488E600333 tressler0
302,407,272 *1DE4A042A491D5643B8B210AF6CE1101DAE82BDF 381KIRSTEN
302,407,273 *1DE4C7EDD21368C30619BA3979526BDF9B953254 TRGLKO
302,407,274 *1DE565FBDC1DF4753BF4E740030A8E9815DC6229 3EXUNDATION
302,407,275 *1DE09A0BE7AFEBB2F325F4CCAF098EAB80FC547B TROY MCNUTT
302,407,276 *1DE35B6BBDBA32196FBE6A11F8AD6F8CD0D021E7 【3】HTTP
302,407,277 *1DE5FEFC16921307D0020971F475D3F8680A2933 3ILHOFFER
302,407,278 *1DEB3AE3E082950B3EF6AD6B3C9D572C42C8C43C 3-M
302,407,279 *1DED1D607608C9D6794D3E046C30270481E0C61B TTAFR
302,407,280 *1DE0638B33784E5D6A8BD3443689237F91EA41C7 [email protected] ~:P
302,407,281 *1DE933771737A8019B3590E4CC1FF8BEA417FD80 3==p*(0-0)
302,407,282 *1DEE503B1A7ADFFE8F4031EB00A1F53A3AE58128 3.SCHMALZGRUPPE
302,407,283 *1DE7EDF71A3F047C404388A64345C225EFD5F26F two-lineoctave
302,407,284 *1DE1D454A7E397AB4A803478E16ED636307543C7 $+4b13$
302,407,285 *1DE0CB2159D2FBE3CB9CAF14B4339846D6ADFAD2 TYRONE.SCHMOLL
302,407,286 *1DE69BA3E2E60316DFAED1D20D7F8BBCC1BBFFA3 4DSNTGRTV
302,407,287 *1DEEFFC3E30A60471598FE885BF98BD3E8DC09FE ucyjc6wn
302,407,288 *1DE32FFB6E3F623373AAF20B44FB3F70E1FC412B 4KLTPSVZQ
302,407,289 *1DE936EED4E791C6C5015ECB72705C3491EAB111 4RECOGNIZIABLE
302,407,290 *1DE74C5212019501E46B6F8818DA8274D4EE608B 4SCANTINESSLENTEN
302,407,291 *1DE791BB56DC121554C325F793BE05A25C441072 4SEKACTRO
302,407,292 *1DEDD2F87D8EE89E7B2F6C52A107C4BC71C338C5 4THESEUS'UN
302,407,293 *1DE5489FB2B1912D1DB20EA1C629688F7440DD5D 578DARIO
302,407,294 *1DE701B751ACCA156A5A37137D84BFE02F791C25 5AARONMEMORY
302,407,295 *1DEFB3DAAA853A740F752004B74669C3B9E731E0 UMM.HALEEMAH.JOHNSON
302,407,296 *1DE7DB1F2A0329D3F4020895ACF2B07A0FF9AABA uncopyrighted0
302,407,297 *1DE41CE40385F9C9EC6D11572D26DEF628215A45 UNINDUSTRIALI7
302,407,298 *1DE4B4907E543376224F0F786DC85777B930F913 UNINTREPIDNESS
302,407,299 *1DEF8248D12C50F575BE3E512CC69EE28C7FEE88 unsolvedinvestigation
302,407,300 *1DEFB4B6234D223D76A382910A77147A6D22CEFF USED IN A NUMERIC CONTEXT (A PLACE WHERE A NUMBER IS EXPECTED)
302,407,301 *1DE55F5D4CE9277D51E8E37307CE4B3414E0CBDB 5MERCEDESHAPPY
302,407,302 *1DEBED813D744340BD427036864DF6EFF2ED10CB 5THATARLENE7
302,407,303 *1DE7240B0D1B20025D668E7B1A94420FD92A1978 [email protected]
302,407,304 *1DE82F3BEBECCFF509785B285345712887ABAD6E VAHTINSING
302,407,305 *1DEF6C351E8408A217013A4CB7F6BFA7F2F69F01 6ABILIAMO
302,407,306 *1DE46F2D181B07AC337660789AF1030054A6DA5A VALERIE MIHHEJEVA
302,407,307 *1DE5DD7DD1BAA001BA558ECB7F58639BCB2CD3FC VAN.HALEN.TRIBUTE
302,407,308 *1DE30E71ED25E28380ED4FCF8D078C8041351CC1 6homogenes
302,407,309 *1DEC50BD9FA51FFAEC780593E51FB68D7F242E68 6REACQUAINTANC
302,407,310 *1DE885FADE13DB6291DA3BB9959E1AD4FF29EE6A VERSKENE5
302,407,311 *1DE7AB83309E1E0E1EFB3C9211EA3A71FD04BD20 VIHJAISU0
302,407,312 *1DEBEEFB34517648E961DFC54428EB113389B73B VILLI-AMELIA
302,407,313 *1DE59E4CE2F0923259831CC5DB73E44CB65ECF99 vimleshsrivastava
302,407,314 *1DE3E23DCDC68536AF619712227B14882004E6BE VINCCYWONG
302,407,315 *1DE3F47DB162AAFA5143BFE7DA42FDC44EA5D39B 7COMPUTERCONTROLLED
302,407,316 *1DE5C383BD5FD7FA66D9CCF8FBDBC69797077083 7FASONGANE
302,407,317 *1DE34602BC4C413961EDFF95ACE2C7887FADD9AC 7MILLIONJERRY
302,407,318 *1DECD200E3E62B8D92E799D869EC26A43EF55C7F 7MYJANICE7
302,407,319 *1DEB7B797B246BFC9F6F7918D506F54E78FBF6AE 7NISIHETH
302,407,320 *1DEAE9926A75E275AA800DC57470C834BD439DCA 7PEEWEEROSE
302,407,321 *1DE7BBB0FE1C0891DECC2421280A84E246BA5498 7POSTDUCTAL
302,407,322 *1DEDDE6AB7B5BDF26DE29ED263BB6E35BF1A56DA voitettavanaan
302,407,323 *1DEB190123BF675C4EF7DB5F19767143B20959F8 VOLARAJOHANESA
302,407,324 *1DE3CD87C46FCA185039D157D8AA2701D54AE6BB 7SKPHDRS
302,407,325 *1DE0E4B162F3D0C9CC2D72F670F0D78869DB03B5 vuefängelset
302,407,326 *1DE3E1355CAA74695E5CBDD154B81FA755F0652B WAJAHAT.SHARIFF
302,407,327 *1DE5C5598AAC1A0A49B960CDC45664F48E17F5EE 850064 the-interim-dividend-goes-up-from-1.25p-to-1.5p-.
302,407,328 *1DEB4CE0E315BE602B0E6308A516E89507F47E3A 851TIANNA
302,407,329 *1DEC0BD8466EECF74BBC6FAABA127CD72D09E506 WALTERTIRRI
302,407,330 *1DECEE2BE59B808CAFC9AC701A0BE7D4D15D8FD4 WARSZAWAPAGTLANDET6
302,407,331 *1DE68F87FF1537EB2FC22AC4A0C9D31E8BB8035C wdogs.com
302,407,332 *1DE4BB84E46CF2040718F5809652CA26634B2288 WE6}
302,407,333 *1DEE824122481742F6F8463B81737619DC15048B [email protected]
302,407,334 *1DE176F02F865FAC90E8278D924C683E12036952 [email protected]
302,407,335 *1DEECCBD8D5EAB18909DB6DF3788BD5A152A6CB1 WENDELLTOTHEROW
302,407,336 *1DECDFB789EE4B3431E349DF4D3D7F381646A2C4 WEWWOW
302,407,337 *1DE7AB9F6FB4758746E56017D7BA7AE067219CB3 WIE.SAN.SANTOSO
302,407,338 *1DEB055C44D17EABAD623B6F8460D76CB65FE79E WIKIPROJECTUNRECOGNI
302,407,339 *1DE0E7CF8D82AF06AB4D501D2662144983F20340 8CRYOPHORIC
302,407,340 *1DE6968EB40EAD3C2BE3244B0618FB2035D8B87F WILEY.AGUINALDO
302,407,341 *1DE80D6D0821F22C084BA98A3E49EA8C777DBC67 WILFREDO SAQUILAYAN JR
302,407,342 *1DE2FA50B43C0E2FBFBC04105DFAD4557E13501C william.ackumey
302,407,343 *1DE52BA6BD6A2CB31B7511A99473315E687044FA 8drogenbekaempfer
302,407,344 *1DE9B01A34EF8FEFCC1A4F0E98CD7AEBB56FFD3B WILLIAM.EINAR.LOVEN
302,407,345 *1DE310047FCF0A158A78ED2C2E852AB892DE1BAC willieabdulkarim
302,407,346 *1DE3ED24128C2E87F4B1C06C46C8B3E58AE30D0B 8ILOVEACROPOLIS5
302,407,347 *1DE968CAD77213B8569132E62BFA7AFD6341D555 WISAMBINSABERI
302,407,348 *1DE9AE030D220CE5A69937FCA9CFD5C651B10D14 8-NASHVILLE
302,407,349 *1DEBE02124C9DA039FCA13CB472F59DA5CE8723A [email protected]~o~o)o(
302,407,350 *1DED85E60DB831E6A8AC64143278F96E48870F81 8WELCOMEGOFISH
302,407,351 *1DE4C77DA8AA1A2B1B9415B7994513439B244EE9 8)***)X(
302,407,352 *1DE0F80786B594FF521CC2CB64D752BE228D8DA1 W}S}
302,407,353 *1DEF6E3FB402EEDB69DD54158689234658DB9FAB [email protected]
302,407,354 *1DEB48CD6C955442EC050A2957DDCC90EB6320B1 WUZHUJUE
302,407,355 *1DEDB01E15E3ABEC92FF345F88F31E9D74FAEC83 WV96N62T4U
302,407,356 *1DE8F32D93678D8BAE992B9402C0778E3E3C4701 9EIBIVWG
302,407,357 *1DE4AC2FC61AB5A67038F70ADA4BBF5957C2BAC4 9INCENDIER
302,407,358 *1DE8356A22F9792313C911DD75F991CD90D548AF 9MERRYTHOUGHTN
302,407,359 *1DE4D6713754B657E20C913508A1AFDA04145714 9NAGERCOIL
302,407,360 *1DE4033F2EE610FC30F38C8A90C1B03CF9480C7A 9NSNINGSPRINCIPPERNES
302,407,361 *1DE0535C63576872A5F07F1E4703B01D8A96DB62 X|6V
302,407,362 *1DE876E165BD45E10CC8CF0A8AA159F7B940891E X)9I
302,407,363 *1DE940CFCCFB2CED4B7E160287BD633F0B447814 9SPOSKLOV
302,407,364 *1DE0EB0209D8503ADBC2E62380C920E9273F16B1 [email protected]
302,407,365 *1DEB0970E74A51FD982D3D8FAAEB79383218C4DD [email protected]
302,407,366 *1DE59B8A92A5C6E2C2D0845FB6A92226EE2DEF38 9TRILLETH
302,407,367 *1DE51AC855B3A637CEA8DAAEC912B87E6BCADCF4 9YLESUFORP
302,407,368 *1DE45CD133657F0E884ADABE966FA427D7F005DB a,'
302,407,369 *1DE8589EE551F9AFDFBB9CFE5842F5D1F691067E A1FKI
302,407,370 *1DE832DA5E1ED6549FC0A3C3D596D8314AEA2EBF a(4ar
302,407,371 *1DE3E71470E05FBA96D1325DEDA6F7B94D008144 a4h(v
302,407,372 *1DEC0E062127FAD4000DEB8097F5EC9FFB49E1CA A9:5E
302,407,373 *1DE466B0D97A2D33AC2723BE015A96EA2E0C4E05 YOAVKORN
302,407,374 *1DEEEEAEDE0BE7C4FEDE9EFB6189CBFEBFA92E51 [email protected]
302,407,375 *1DE15B3B10622ADB5BCEB5E4CEC1F6D51EEB80D2 YUAN-DI
302,407,376 *1DE8338FD4E6FE1E65C2ACDE9A1B6E8C5B7F9B22 aad7w&
302,407,377 *1DEF8E4652963218EB8798216D3FD5D30136FA29 YUKI LOPEZ
302,407,378 *1DE56566376E150AAF18D7C6D4B48C1CC1A8826E aadravataam5
302,407,379 *1DE1E3A6A0EFD11A9334F2F25173CE9B932C4D40 yusuf-hulki-ocal
302,407,380 *1DE01A0001FEBD8EC4AC496422ACB7A3C63B1F44 ZACHARY.STROUS
302,407,381 *1DEEF00FE8CD637F35102859167A87A87E9FB0CC ZACHERY.PAYN
302,407,382 *1DE7AA9C70DD976C5F80F2D391B2CF0B083186DB AARON RICHER
302,407,383 *1DEE854E1D7BF745F82E7366F6D7927BA2CFD708 ZAKIRUL.MIZU
302,407,384 *1DE3D31251F608414599B7BA90D4D20B3B324544 aawq
302,407,385 *1DE362730BBECC14040FDAB6EAF59CAA0D9D594C ABC;M
302,407,386 *1DEA4ED80814FA14C3AF52CBC5E4A69A255971CF [email protected]
302,407,387 *1DECD5808D59302F4D55D373D98D1A9C854E0C1E A.C5C
302,407,388 *1DE0123214F967BB5AC818A88CCF2882EA533831 [email protected]
302,407,389 *1DEC0C891EBC2F588D2B9DC6F1A59101BD90B666 ACID.KING
302,407,390 *1DE6055D43CAA9071993141958A28EECD7BF9B88 ZZ>+
302,407,391 *1DE9BFE085ED7DC7902230FD0E5208F302D85162 [email protected]
302,407,392 *1DE994E54A370627117AB91189736D6042A2845E ADIKIJAHING
302,407,393 *1DEDD6F9303E1C2273009CAA683E92257425AEAC ОПИРE
302,407,394 *1DE4B5E8006069D08D3ADE070CF221F025B5328B AGUINALDODELA
302,407,395 *1DE4DEA07A456E8F5A562CDBE59A653A211EEA25 agustinhasan
302,407,396 *1DEE4F6D87022DC06442E41BBE8FC46FCEC6DA27 aht5,
302,407,397 *1DEA601DDE1CF514DE411FD4659E045A66DF4EE3 aibn
302,407,398 *1DE9ACDFF7EA4F12F1C9CB64B94151033A79ACA6 また、中性において性(SEX)を明示する必要がない場合は通性(COMMON
302,407,399 *1DE908C4A4543702D3C85C43CD5EFC53974903A7 ALBUMOSURIING
302,407,400 *1DEA6DFFB324AF9DE8A7AAC2200DDBF2EFEB8A77 傘下のHWA(HEARTLAND
302,407,401 *1DEE1B7B367E1766D0D35BDCA9358A4338739A6C alix.dobkin
302,407,402 *1DE879A51F8534195F643B4CD4C6DED385ED114B ALPHONSOTREVEY
302,407,403 *1DE727C9F3AE4CAAA11CD517356E6552054083AD altonmizrahi
302,407,404 *1DE081E8C38524316153DFC6D77F8C4456BEB821 ALTONMUNSTERMANN
302,407,405 *1DE5A96A0CC6079A22CA42AE6251FFA349A9AA9D altowey
302,407,406 *1DE1DC0CBC7053F534984B0AA32189BD0196990B ALUNARIAS1
302,407,407 *1DE1858E56C32983E37262876F5B31E329B92AA7 ALWINTONCHURCH
302,407,408 *1DE4F75E07039D21FF5EEE8FCA0CB5578983F68E ANGELO.CALIGIURI
302,407,409 *1DED2D0F8A1280C8A03ED2BAB186A55D083B05B5 anhkl
302,407,410 *1DED851032BF59342884F156D0A3FA4010D7A121 anne.niccolei.aquino
302,407,411 *1DEFC92A95A789925F2B45B47F4731A6B50D9900 [email protected]
302,407,412 *1DE4BA018654213B803F906CA0B4ECC0E63B0EAA antony894
302,407,413 *1DE7C802045CF877D063EDC1B2EEBC45424CE467 arliekrysh
302,407,414 *1DEA336C3BD8BC31B456D24C4458C7C066422F47 aronmacculloch
302,407,415 *1DE59317BAFA063A6E4AEEF75C1D08EE1CAC0725 A Rose is sweeter in the budde than full blowne
302,407,416 *1DE96B7A9112273525561B0E8F4BBD986DD2AA25 artfocus
302,407,417 *1DE9F12CA7F645B3867D0E4B2B62F06691B68992 arw/f
302,407,418 *1DEDAB3AC2D7C2D62D25E6F8DA27450984D250F7 ASHTON081
302,407,419 *1DE9D5CD0A9EEEF765E1D046F3418816D522FBF1 atkz$
302,407,420 *1DEB7729F75A098E63F1F949E5A7C259BDDC911A 0THEBUCK0
302,407,421 *1DEC3262E25FD0D9E6F18A41B9E6B1B6CA844425 10-23-1446
302,407,422 *1DE9E31B698DD5E508E38E37A59EAFA730E28051 1192210 ANDREW SCHNEIDER HAT SEINE GITARRE EINGEPACKT .
302,407,423 *1DE82427AEF84A0C450AEE8056542CD8ADADCEA8 11H49MIN
302,407,424 *1DE22A560BCC372F09FEAA6EBF191FEB2F081489 11 LOEVGREN
302,407,425 *1DE5D1A23641CFFEB2B127B4F76C63A963C6D1BB avrs-
302,407,426 *1DE03D30543AB98BD6E77E6E987BA05559B1BADF 1234jay
302,407,427 *1DEE0A43727D50B8B8CBE44654D1B8E8ADFFC571 1574554 K
302,407,428 *1DE2186C6C421D3B349FD78F0540A8D54288BEC0 B2OL2ME
302,407,429 *1DEEA08B83292AF04FAA469FCC5EBCE75CC7F6FC B31QH
302,407,430 *1DE0CC6C20705A46C604EEC91AC161C4C4DA4385 B,4BI
302,407,431 *1DE9C49151D593F68156173B92C3EE30103B0112 1714142 hakemukset tulee toimittaa koulutoimistoon os
302,407,432 *1DEC97D211D1AAABB0A7EE0FAE7B379E8088FB97 B6LBS
302,407,433 *1DE19A4B83B0BB1125AC3F2C62A0FB0C49896BDD b+8;8
302,407,434 *1DE9B0E08FCB5F145714E62D38CAC7DFF0C081CB 1874862 valintaperusteena-k
302,407,435 *1DECA48D287EB48264C62846F2BA4CB63EBA74D3 b+a/c
302,407,436 *1DE0161D04922D3E4FE57EB11C3E0CF87E753A26 baleznie6
302,407,437 *1DE42FB8701FECF1BF3E9940E1C6CBB05B3B6DC9 1ALUSHAME
302,407,438 *1DEA561873FD54AEDEB37F9DE325C0CB1DB7283C BARBARA.WISNER
302,407,439 *1DE1A422948277DEE4668092BFF64996678B19A5 BAREARAED
302,407,440 *1DE29668050274F003E12F4700E6F72059BD6D5D basophils2
302,407,441 *1DE0479B10C8E368D6F134D8731D65D09FA5FC34 BB6(1
302,407,442 *1DE17F633AFD06F26BE4FBE54DEA9833A35E1E0C 1ei-pluralistinen
302,407,443 *1DEBE7140EF10B4B657B3B8F70DAF79FB65B2B38 BBHZE
302,407,444 *1DE822543B2816BA30E5AE20CE843D6DD0232458 b=d7
302,407,445 *1DE778F11EFA3E13B8BEA7DFFCD10161E71E80E5 BEAU.SMILEY
302,407,446 *1DE9F6A09243A40256244566ECA1878C084A71E1 BELINDAAPRIL
302,407,447 *1DE016C6BBF18A5213CD6D2177957569AFC8A3B5 BEN-DASHWOOD
302,407,448 *1DEDF91D444E51062B51A97A35C87EEFF27960D6 benniebeneker
302,407,449 *1DE942E2D5B9900916514277CF582B12644E38B6 1.oppirakennelmaksi
302,407,450 *1DEC57BF34A5E0BC3CCD2743C2F940CCC5B3CE1F 1.park:iin
302,407,451 *1DE150BAF5C434E9A0AEDA8873D8026C2B497579 bennykoeninger
302,407,452 *1DEFDD10A9E5CAEB293E1168D6A8B3A4F944FD5E 1POHJARAHALLA
302,407,453 *1DE2FEB87066700598E5101066598E59F86F41B2 1.POSTOMIA
302,407,454 *1DE7223018AA60C21FBD61796341AEC137D90A72 1 puccinizimmer
302,407,455 *1DE795CB10CE84B122C51BF600D1E973EE759A70 1quadrichord
302,407,456 *1DEF5CE69007D573AEF59D05D5404DFFE8995775 1sernaw
302,407,457 *1DE4AC31D9297D84ECE0BA55760BE76E0AA02798 1SEURUEELLAMME
302,407,458 *1DE39008B42F6D00EDB949694C350611ADE1F0A2 1.SOFTDRINKHERSTELLERS
302,407,459 *1DE387B39F3CE137AD74C6BF3A201C444C6397F7 1 SWANSEA-BASED
302,407,460 *1DE1754FB9FBB22F3DC7E687834AE498A02147B0 1.TUNTEMISHARJOITUKSIA
302,407,461 *1DED366DC11322035D93EDD92AC91F9502A81D9A 1.WESTQURNA
302,407,462 *1DEC3026FB681750D60CF502E9375FB5610BF57B BERNIE.HINDSMAN
302,407,463 *1DE40E6CA050B7914C07E4E8063C96EE9BBF1040 berrykolle
302,407,464 *1DECDD6AFBF4A9FF270E23F5D03E84AC3CF9B3D9 BERRYSBURG?
302,407,465 *1DE3ADF0793F3A0C4F712A973655C9E147667909 bertrampolynice
302,407,466 *1DED679B2BE230756EC64DAAD2CAE2D237952604 bes,j
302,407,467 *1DEFC4E4A1B24455D74325E6C1DA7C2AA013910F betx%
302,407,468 *1DEE585858EE0ACEE0BFE30F95B6C305984D70F0 224.AIDA
302,407,469 *1DE31EDE6EC3001C646D6A2E5BD293FA238F060E 2345941 karhutovatsuuriajatukevarakenteisiamaapetoja
302,407,470 *1DEC6F989F34F9234210AB20E1B144F032E85537 26BEGINROW
302,407,471 *1DE878CF53FA5B8B5E25665D804FDF9CA62B44FC BHH-,
302,407,472 *1DE1F84C5FC66A33896B0ED3239D22FEABDD3D19 2.eurooppalaisuudestaan
302,407,473 *1DE9CADC0F8B7ECFE5433B059729A0619737E4B4 2EXALTEI
302,407,474 *1DED46ACA61D07B42740B324725E91F3414107A8 bisyn
302,407,475 *1DE3C48707BAB57AAAB55CCAC058D29448CDE2E3 bjeirre
302,407,476 *1DEC1EF8E86F2962BB805FB7E90DE5975CDD55A1 2.POLOZOV
302,407,477 *1DE6354524DC70548C2949C33EC5F407CF753DE8 blakebenthin
302,407,478 *1DE5DB8B0A43DE7767BB91207ED4E22F3E0EFE23 2termisen
302,407,479 *1DEFE451BA0598D628911309C338E0D48F178FD5 2.wirtschaftlichtechnischen
302,407,480 *1DE7AABC580FDF1ED960D5AAC1F21297C342C69A BLROI
302,407,481 *1DE8253FCA104BF6B891FFD340C57D02D74E5B60 3=====B~0~O(0-0)
302,407,482 *1DE99BE24A3D43F8993B6BE9047FCFAE89FC7E61 bobbiescheidler
302,407,483 *1DE8FF41432D08D55E71F30DA64225C36614EC76 bobbyply
302,407,484 *1DE51A507C33EEC9D6C0D76EFFB1011ED4AB3CE0 [email protected]
302,407,485 *1DEA738A47F8C05B855B493044326D30BE831F76 3DEFINENIN
302,407,486 *1DEF33171416270FEA86FA60EBC22AAEC2CE5DD3 3-DIKENLERLE
302,407,487 *1DE59BD91D71359B5859915BED3F599DE4CF73A2 3KRIOFSKY
302,407,488 *1DEB397121E1D25C6E995032926005677C280980 3-M
302,407,489 *1DE64868338FA2C2E80BE19E6E2255D63356D243 3#####P.~O.}O{
302,407,490 *1DE1FC9C5E1E70F1AC23E2C95D8FB21CB780AA4F B---P~O~OSPLAT!
302,407,491 *1DEAE9C0DC85E4B00F7B4AE52691B6D63CF50850 BQ(AQ
302,407,492 *1DE13DEF746FB8CE0EDC108623BF0D67420F0B3E 4BEAUMES
302,407,493 *1DE170F355C5EFBC8C265BFD35F54D21453D5592 BRADAIYER
302,407,494 *1DE3DCE04592B7967D06EC0015422E7CBD5EBA24 [email protected]
302,407,495 *1DE32B452B1E6A18FB735C4D5AD148EEB6FA7D48 BRENDANBENHAIM
302,407,496 *1DEA44E5BF49138D05D3CF51FB5D02A179A43C42 4 KALATIETOKESKUS
302,407,497 *1DEABBE82FEC03A47F436D26E2CBDBE9BCA5D674 4KILLBOY
302,407,498 *1DE5B130BC1B0A50205EB203A3DDDB78E701E875 brentonmathias
302,407,499 *1DE043F97902198C29450BB4FB3954AB02F63563 4.mau
302,407,500 *1DE4D085C375BF2E404D3A84DF85CA593460DE8F BRLLF
302,407,501 *1DEF30090235D71B1C4D68D756E9EEB50C5BE754 4R8R1Z1NG
302,407,502 *1DE6AB100D6FC1AA8849C1BD6EB3BE060FD34EB3 4REVERMORE
302,407,503 *1DE19400ECE29742B71418C7942EBB1E01E8CD33 4TISTYISI
302,407,504 *1DEA494B44934DD43F63A844048D7C90BF6B17A0 bs)bc
302,407,505 *1DE470E375792C8A7BBCC0A59683FA0B86B01D52 bsj!2
302,407,506 *1DEC6BF854B47EF82A4EAB7B06DA92E46D57F5F0 BSM6
302,407,507 *1DE1437DBE48AA469DFBB706FCAE853AA6CDE6C4 BSWRICCARDI
302,407,508 *1DED258C97B4D5DFE58F2DC79D56D838AB304071 BSWYOUNGILLBSW
302,407,509 *1DE5DE49FC9E7C907A1D38EA056220C1F6EF0132 BT9UV
302,407,510 *1DE83A25C78AC1305B8B02464D64BCA12C554274 b;ub+
302,407,511 *1DE7A9C5965BFA8564862EF4DCE9A93E6A927898 582668 ,Istanbulredlineelektromekaniksan.vetic.
302,407,512 *1DE3DC09EA3B5A37B9D8966DFAA36D7991C0C035 b&;ur
302,407,513 *1DE0650946A24527AE07B0F80005C54DA10127CA BURGGESINDE
302,407,514 *1DE21216B00315381518AF0D8945A87F5101BD2C burtschierbrock
302,407,515 *1DEDFAF6CD9B357900564246BBB2844FAD5AB7C2 5CIGOLORC
302,407,516 *1DE79289F452B06B005832CC1BCE9ABDB4DF2874 bve#o
302,407,517 *1DE893D2269A1D237C92D413D70F495E22FB9CD7 5PUPPIESKILLER
302,407,518 *1DE6F8E6EE9FC5012D9FB23EE1B595ADF4E5BCBA 5qoy7ptfb
302,407,519 *1DE19EB32803956772D0369C8E1F6D197043AC10 c2#r&
302,407,520 *1DEECC71CEBCF1F43903B79D7B45A8FADF49F70A C3l)
302,407,521 *1DE9686F1A4C6C8938298EA9F3F917E3F8B02931 5UNDERGOINGS
302,407,522 *1DEE9B7E6E5A7C4ECD19BBDECB2DBF41E5A8CEBC 5venstergordijn
302,407,523 *1DE3EA05F395A07E507D80CCF0846F6C5FE6D077 C8GQ
302,407,524 *1DEB6B0E6B8D2C20BE6BA0CA7188793E1FCC0EE9 [email protected]
302,407,525 *1DE6C3A3E893FF27C498538EECC2D50B1EAB93D6 cansoraz
302,407,526 *1DE4FA9CB090C85060C5C9CE1D17D51B56693211 6CHERICO
302,407,527 *1DE34F3B46B700D659C7889053781EB3C3E932BD CARDWIZARD
302,407,528 *1DEADA63416B6ACA434505B941CE5AA44A98D812 CARNIVORES
302,407,529 *1DE9DCE9CE48E33C34A06C0108367B09030F3B59 caroline-siler
302,407,530 *1DEE6ABD0F29DFC59E79351AB994A437EA211886 6GRIDDLIN
302,407,531 *1DEFD9A6A46C2711E27C235AD31E7E085B78772F 6JULUASXX
302,407,532 *1DEC6E33F9DDAC5E51EC7396FF64BD73275728A6 [email protected]
302,407,533 *1DED96C8CD48FA5F1EF97EC471D82F8A51590085 c:+b4
302,407,534 *1DE2785AF5C7FCB8749528516B15676E9B658592 ccaajcw
302,407,535 *1DE44C70FB70476754EDF2F7DFD86CB643FC5EAE 6TACEVO
302,407,536 *1DE09BA0EE40AC765085F9A41AA46209A2D62F0A CDQQAA
302,407,537 *1DEEC573EE135774F2CC8A488093D3AA99FC1AAF 6THAFREAK
302,407,538 *1DED6A5B785F5F8090FD3E28F6E20CB89AB29BD1 6THATHANNAH8
302,407,539 *1DED0EDA66499B0DE0891AF2E91AE3A0327B784B 6 whitecolumned
302,407,540 *1DE58EB6E557CF75F6BBA50462FC198C70CA30F2 C/EV
302,407,541 *1DE95EEDA0A910C911E852E56BE466891EBFE4F6 CFQ+V
302,407,542 *1DEB4501B6AEBA56FECC6933B0DDA2D5B6C38A97 CHAD.SUTTER
302,407,543 *1DE2ED1C5A9A5AA21DBA649F1C17DE37C587A4AC 7DOMINICANENS
302,407,544 *1DE5CFA60848A786006717E38A8660053BA218B6 7EGENGAAN
302,407,545 *1DE3EF5B251007DE72FFE745EA2D6AFC47FE0A36 chame felix
302,407,546 *1DE8AD29A00857F63060446782A4F719876F77F1 [email protected]
302,407,547 *1DE9BBBFB819E6A3A428BFB8A8478B4DF9208873 CHARLENE.HIPKINS
302,407,548 *1DE23CE19E3BAF172428C19C8441338BD1330E19 7KONDORU
302,407,549 *1DEEF22DF985507F1D918A4F225732611D0EA7B5 CHARLIEKLAPHAKE
302,407,550 *1DE41F317E3AB35D33A0BE1013B407D2A6FE0F2D CHAUNCEY.WAITKUS
302,407,551 *1DE528EB30D31ACA27B97E7D3324910369B5F882 [email protected]
302,407,552 *1DE4656497872FF00A65562F7F031E7576C38F41 7MCLAUGHRY
302,407,553 *1DEBBD96397789185439BCEF0AB7823D74C25207 CHESTER.SAMES
302,407,554 *1DE5470D7092B386184D1FCB49AA008D73364BAF [email protected]
302,407,555 *1DE8A76882F1E7C0E0838C46577CF5DD2EB96ED6 chinnalata
302,407,556 *1DE06254121034E456646FA7FBDA3E4880FCBAC3 7PRAVEDNIJOM
302,407,557 *1DE3F210D71C385EC876300705559270825C7310 7PRINCEGYMNAST
302,407,558 *1DEE9A9FE90D82798F44981CA0D4A745C5D1C272 CHKH
302,407,559 *1DE3EF0757BD637C23F44C4FF064CFA06BDC5CDF CHOIHAMS
302,407,560 *1DEA664ECB0589ED943E3BFD6093C3071913AF16 CHONGVANDIXON
302,407,561 *1DE93EC40FF5964DCBA4D28ACC4FF8C94F70854F C?ĦQ
302,407,562 *1DEA4E7D7B55203575811BB602CB825FC262A987 7VIIKOSSAE
302,407,563 *1DECEAEF6DED6255E8F75E07393C791DA4DFDC1C 7VIPERMONOPOLY
302,407,564 *1DE442FA6F3DB1375AACC73EE23DE0E78733B394 chrysnln
302,407,565 *1DE13C132D10ABC0F7DB7BD8BF42D2D198213A7F CHUCK.MEYERHOEFER
302,407,566 *1DEF9ED133BA1B67B70FCC8BEB206C9C1F53E63E CHURCHKEY9
302,407,567 *1DEB021615935BD6B60485110032E2DD38D7A74B chwalki
302,407,568 *1DECE63358932FF23C06430B607F8D9299BA8365 C-JHW
302,407,569 *1DE5479BE03E5BB0DF86E02D945216C0FA8F5208 clapotis3
302,407,570 *1DEE2037B5A7997E22023C8711812107900D0135 CLAYTONDISALVATORE
302,407,571 *1DE4C0A3B6310951012F38EC2DBEC50671FFDE90 cl-/e
302,407,572 *1DEB25BE382CB0D712AE0A35F5BD5216F2A60401 CLEMENTEEVARISTO
302,407,573 *1DE21F6E9CE7968DA3A1578DE38FE835C6F45B31 CLEOSTRUDWICK
302,407,574 *1DEF834A53D24E0D6405D1A8B60A8402B326DD2D CLEVELANDGUTZMER
302,407,575 *1DEAAAE1DF2C4AF6C659EC7719D5256D7DAF21A2 CLISTBOXES
302,407,576 *1DE659F613ACA174E5C01F861C33F82FAFA45927 cmazw
302,407,577 *1DECA73A2686363C912C9FDDF2C9C8F5C390F27B 8JMFRELSE
302,407,578 *1DEC54BC773B34D7D608E2B401A73014A34E28DE cmhp&
302,407,579 *1DEB05B943750287A8B224B0A0BD8125750B1401 8neutrophilic
302,407,580 *1DEE720981F72FE079649C4F29774E3F4BAD0515 8-----)~o sploit
302,407,581 *1DEBA2582526A3B0EF6C5B6743E468524CE0347D COLEMAN.VOTAW
302,407,582 *1DEAB5C39B4FE732D9BD41EA932D962475672343 coletrenholm
302,407,583 *1DE2EA94C253757809C7CA79804D2C7B0B023B35 COLTONRYEN
302,407,584 *1DE2F3B525AB870EF462DB9D505B86517977D01D 8ROTAIVA
302,407,585 *1DE06D1EDD160F7103496B8BFDF89D17A27A3BC8 8SIDLINS
302,407,586 *1DE77417A563F91DBACC710DBF450AFD3D55F242 8WATERLISA
302,407,587 *1DE0B390C29AE9E086FE266155B027343E2F436B 8WILDESTES
302,407,588 *1DE552784450884FD2146B403B31AF0BEE69E24F 90AS
302,407,589 *1DEA74261C8B6B097139D1E804AD0330190D0CCE CORRINEPARSONS
302,407,590 *1DE2E2400BDB454C888DDB4714D2CFBC348D7645 COVERNOTE7
302,407,591 *1DEBA37336D27943BD8DAF9DC072E74465E08627 COZIRYNEK
302,407,592 *1DEB9F29398E059F66302497D96419463E37EB00 9FROGGYBINKY
302,407,593 *1DEE9424F3F5D5DED29758DBC48C0FAB28C6B1FA 9HONIGBIJEN
302,407,594 *1DEBA520B56B3CCEB52BEE40031408E696258077 c:\program-files\windows-mobile-50-sdk-r2\smartphone\include\armv4i\numeric
302,407,595 *1DE9CDBEFB5CF938E1F7160452285930F69F6D75 9thecook7
302,407,596 *1DEE62F54F9B24CF6CF4E1015F3D7D49F46A7B9E A$:
302,407,597 *1DEFF4DC5A9F4C30AE53954C84935951C3D7B95A [email protected]
302,407,598 *1DE89009ABEA5E3EC8D7330E95426BCFF4583167 ctcre
302,407,599 *1DE4CC4696EB13933898E8D641C73AE620F55D06 a8ts
302,407,600 *1DE4CDEF5CC4C2AA594893BBD25A90259F1B30D4 CWO7K
302,407,601 *1DE2D960A0611D7F36381CAC5F4730AB6DF2D769 CXJHF
302,407,602 *1DEFA7284C13C1AC1D7253FC2593D07FA5D015EA aab8/u
302,407,603 *1DED7894E136222B870CF63C087C2393EDCEBD13 d1$$1p4710n
302,407,604 *1DE32E8131955D025583ECC055A2B50169625C40 AAE3
302,407,605 *1DE95EA92EC2EFF4A000EA2D7679A7FDC1BC924B abhyanugyaataa2
302,407,606 *1DE50BB703833B3D083FFD828FF6C8F45DE155A7 abortedhugs
302,407,607 *1DEFA390D74EA7FD955026DEC2B307BB647AAEA6 damonmaver
302,407,608 *1DE05A61F70388CCA316181317A55A9C2EA490E1 DAMON.SAVINAR
302,407,609 *1DEC4504A595DEF56683E01E1FCC3BDA4418F093 DAMONWORDEN
302,407,610 *1DE2E1BD2E367E87BB3D4C7A9933860C6620D204 acceleratortextbsw8
302,407,611 *1DE99FE8F8013A21C8E03C374009A43CEBDCB942 DANIAL.GHRAMM
302,407,612 *1DE0CFC76CD7F1BCD11B10B3F1D74BA7D22B8BFB daniel.ricardo.bertoni
302,407,613 *1DE63DD92D8D0B3056F612CA814B78483EFD61B8 dannieberno
302,407,614 *1DE1D769950158107D9A0B69F427DF16BAC8083A ACRRQ
302,407,615 *1DEEF199878ECD76275E4C52896DD72FDDDCD315 DARONFRY
302,407,616 *1DEF7500A52116A8A708B779B81567B0777A5132 DARON.SWEPSON
302,407,617 *1DE50E26325D228F4B25E64B7CB2BC91D60D88B2 ADALBERTOFURNO
302,407,618 *1DE5F233C16AFCE531AD7C71D168C35B8761F47E DARRON.BINDEL
302,407,619 *1DE7293AB53213B1237C3270B2B7BF031B332A0C Das-Not-Compute
302,407,620 *1DE055060A048371FB737CB5031340C9ADECE260 ADkg
302,407,621 *1DE4BD8CBB16983C079E56A3513B3BBCC6BBB04A DAWN DENBY
302,407,622 *1DE12F5BCD49BC59A7713A32B6EF508370182A3D a&dtd
302,407,623 *1DEAF3DAADA6C82B07964F816EC0CD2B7DE869A7 dbmqg
302,407,624 *1DE7B9F5D97BD950C77A2DC17E3BFC26E6AB7A06 DEHCNEBS4
302,407,625 *1DE778E10BAE6B5CBE7AA45C3B8094A7D9C41D62 a?h#&
302,407,626 *1DE6731B57C2D9E28F005D3068B428E58F3A13EE ah-:b
302,407,627 *1DE5ED09E682AA1B8D269D29D6CBC5C563800BD5 demonstrovaly
302,407,628 *1DE473E0A4039982625460FF8C23C5A2C60F4A20 a.ipy
302,407,629 *1DE681BE5ACF503AB54D183444A0FA0F7DA4AFC3 AKONFRENCH
302,407,630 *1DE9EB3DD1A10D68FB7DE95FAB72F664FF4BE42C AL78?
302,407,631 *1DE94BA2006409301B01AFC9E822653D716D3B49 devaluie0
302,407,632 *1DE594D5A09744B0F8B665379A4F75060F00E572 [email protected]
302,407,633 *1DEAA22C0C969E2210F83B8968D78538ED92844A Df1l
302,407,634 *1DE282C85B1932FCD8C245DCF8FE90107C4007C9 alison2012
302,407,635 *1DE9827CE62BECBC4EC0294F35FC8E0A6EFD2631 d,gr
302,407,636 *1DE33F6CC7AB1AA660348DE44D0777FE41FD5316 ALUMNI LAWN
302,407,637 *1DE167B4CCEEB34DA5D499101F290CCAC918C8FC alvinmeserve
302,407,638 *1DE2BF9916D4873180FF56514C02FF51A7CE4FA5 ALWAYSREGRETS
302,407,639 *1DEAE93E6DF63DBB47F7F1A0D49753A7A58FAE5E DIGITALFLOW(FEAT.QURANDADON)
302,407,640 *1DE63942206623965E5817F3DEFA27F5FDB7CCD0 amtc.
302,407,641 *1DEB5023029487A3DB71C638112382DDD0C61ABB dj62m
302,407,642 *1DE242930CE24357A5A92E22FA03BA99CACDD271 d_m:/
302,407,643 *1DE1FF50BB70016E9A4133EE613EE2BB81E5101D DNXPC
302,407,644 *1DE8CE00DDB749ABE75C886CC5CF5598E0E394A6 dp?6
302,407,645 *1DEF03376BE8A0FAE195E8884186B438EFBC5D29 araya-lee
302,407,646 *1DE37C9E81E30EACD1F47228B057A2F1A2972B54 dqct"
302,407,647 *1DE820D4CED4A7531DFEBCD61C4E45EC6795A5C4 DRAGONECLIPSE
302,407,648 *1DE0ECE0E9A2E7670B366A1B7A5F13F0D4F386F9 drfci
302,407,649 *1DEA16951EF140FA9725623B354DE1D2341EC278 d_uhx
302,407,650 *1DEAD9F38FEEF73ABAB556C63B2E059A036EF01C d;))v
302,407,651 *1DE8FEDDFDEDBB4CE42882B134191E9EEAAD3119 dyuglyundiza
302,407,652 *1DEEFDB3465045F42C1EF440E7BE1069B748711F AUE"-
302,407,653 *1DEBD08F63BEEF49D49F353CE21949D2BAC49ABB AUNEXT\3
302,407,654 *1DEA67D70EFA182E8AEC2EA824F6B9A4F654C013 AVKESHM
302,407,655 *1DE5D0D0F161AD4BBA5BB1A4A57237332CA444AD a,vv
302,407,656 *1DECB13EC86DFA5CC025DF0BA0EA80C27538781C egx16
302,407,657 *1DE89B1932306B5FD3A844C685A623DD31B3A7D9 EIbm
302,407,658 *1DEA7E2765F6EFFBAA524907A510491C9E81D845 ELDRIVET0
302,407,659 *1DE52E767C169C8E6C2892D4408872F07BB7F3E2 b5ny
302,407,660 *1DED4770072212ABB46B9324546630C3F4A06E1C B6LBS
302,407,661 *1DE252D013C1054CD72B497AD8526A47019248F2 B8"TO
302,407,662 *1DE5C134B53BD90E749906289EDB9CDA97F6CE3A [email protected]
302,407,663 *1DE58294122A3698BE3EEF61225C3AC3EA85414C BÄCKANAS
302,407,664 *1DE78B18988F3B68F5AD747AB24220C57DCAFF00 BAI9M
302,407,665 *1DE4D184DD691ED7C35BFA406EB8060D4BEBD18B bartonkotterna
302,407,666 *1DEEBB0DA06725430A26FF50C1AF85D8C69376E9 BASICHROMATIC9
302,407,667 *1DE5E8F77C65D6562CD08F8B7A31BE2380890EEE BBMW$
302,407,668 *1DE03932C338EBA9BAC1D05DF3DEA77AE4B78880 bcocd
302,407,669 *1DE9E18264F17BB780F5DED00C3F9DEF1D0438CD BDURGAVARJHULA
302,407,670 *1DE3AC5B525895569D189883BB07107EBB88E57B BEAUSZYMCZYK
302,407,671 *1DE6DE44FB1F17DAFC029FC0ED05816B171B6B9C belavežskaja
302,407,672 *1DEA2E957CBCDA300FDD96CB1E1FBDFBD2AE0FFC em.seu.lar
302,407,673 *1DED925571E37C2261FFE00878A26BF27C8AAFE6 EMUKAKA
302,407,674 *1DEDFDDFE0470DBD5A27B867B913774E09A58564 benny.cabaysa
302,407,675 *1DEA5DB2284ADE60B30E0C6DA62AE5593ACD3BA6 bentonwolffe
302,407,676 *1DEA0740B65804A9F6C7F0DFC57A9FF04C3DACBF ENANTIOMORPH./I/'N/&/NT/I//@/,M/O/RF
302,407,677 *1DEC609F422F2FC2F45B4C05B70D04CEB9A289BB ENBRENTON
302,407,678 *1DE8D4B6892BA839E10D5CE43701D8D1B549BA89 ENCKEOVA
302,407,679 *1DE72AEB8CE4FA828F02F49FA0603E9C0A85A8D5 BESKDY
302,407,680 *1DE0A656EF09884FF1E4A8B13D1075C191A6FE49 BESKENHASTER
302,407,681 *1DE1A5A5087771C29380A4A6579AC55400301FF5 enotecalylla
302,407,682 *1DE3406D30186A9184E78A3151F0B246FDE2E4CE bevolkingsvraagstukken
302,407,683 *1DE1108CEC4155F8D52EE76009C9CAD4ABB836DD eqmg3
302,407,684 *1DE72EBC6DC1857FE5F766F6F6B77ABDF47AF896 bhlw
302,407,685 *1DE1DD51308958DEFBD226FCD341A0967B42B18F b=ia
302,407,686 *1DE45357A867319626BD286E91C2B9CC8032E8DE .BIERLE
302,407,687 *1DEC09EFCF4A7F7DA3F389978BFE77AF6CBD8EAB</