List database


<
# MySQL hash MySQL password
12,420,001 *015071839AC81D23AC90D625321D8FE12155CA3C [email protected]
12,420,002 *01505D960ED5FF00590FC0C5B8B117DB6D3D8B17 [email protected]
12,420,003 *015F58DEC18B0F2D5F692DE0449C0D00A1B9A124 ALEX1SOCCER
12,420,004 *0158E5E73416B7CF3B137C2A2E87892FDA72C93F [email protected]
12,420,005 *01521776EFB22FED83A9514F9E3DEB3F5DB9E138 ALEX49_24
12,420,006 *0152B007F9F975564558B2BF22BCCD0490A47B53 Alex49b:electric
12,420,007 *0152C99AB3D59BDF888BA61637905AD5E037AA96 [email protected]
12,420,008 *0155F597B6BBA5B1A6E89CC0C7046E43AD8DA3B3 [email protected]
12,420,009 *015EF28C4E6E906F1CCCDF102CFFAC6878AB883C alex.akima
12,420,010 *01505B02FA163BEE8E12D7B096A2D948AB10C75A alexaly666
12,420,011 *0153AEDE7ACC3A2F20FCA845F0FC3826B30CE589 ALEXANDAIDALY
12,420,012 *0155D52EBD1DD1CCC70B4B626FADD390249AEBDD Alexandeclipper
12,420,013 *015A180C8DF0FA9BBDF93E1A175B4984C308BE16 alexander1931
12,420,014 *015C2DA1F45554AF4873240EF023E8DBDD85DA2A ALEXANDER53
12,420,015 *015422BFEBC1DAD174E95C103F94370E98DE7DE4 alexander.blaeser
12,420,016 *015D96B5B555D82538628B8AC00E2B881DC81D25 alexander.boulton
12,420,017 *0154409FC1C3A20856E31F5C918D5A66D968FB17 alexander.brawer
12,420,018 *015AE5E315CB1AB1CD5D96B7AD545C6E79AB8081 alexanderbritton
12,420,019 *01502A236839DE7E38F12741CFE228B0693866C3 alexander.colopy
12,420,020 *0152AFC052133564B7F30F256683079C85CE44EF alexander.denyes
12,420,021 *01526B7D4649DC902873F98D1D5A1AD28B7A7934 alexander.edelson
12,420,022 *0155FBF58BD8EA44D2FEB601B53F9072C4A7A19F alexander.ellinger
12,420,023 *01557325727F99D24554F021CFBFAF1412537513 alexander.fesh
12,420,024 *0153287821C1CBA002CE5A0844518F15D74E45A3 alexander.fetrow
12,420,025 *0155523498BAB80528F378C722C3219EB888CF44 alexander.fournier
12,420,026 *015A1E026198DEE802C87359563BFB01DFFB907F alexander.gersch
12,420,027 *01538258FDFCB9494C443353A676D4FE963E611B alexander_godfrey
12,420,028 *015E43A26824843D0E29C96CD62C8782A891114F alexander.haslinger
12,420,029 *01558978948667716865AB810EDDAD7E33FC5BD9 alexander.helem
12,420,030 *01553A06D22DAA5B70024EE9C000A03BB24BCFDB alexander.hickock
12,420,031 *015A142A2537978882ADFD279389230C977B56C7 alexander.hilser
12,420,032 *0155D0E229508D228095444DE6EC2CC6B5406530 alexanderkellett
12,420,033 *0156EE65C93FAB16F536C9187AFF83D59EB3938B alexander.koff
12,420,034 *0152FEF6FB2CAB28B89927BB98F02480A5586712 alexander.kytle
12,420,035 *0153C84050030F08BF1C89781297E28B72AC2789 alexander.laguerre
12,420,036 *015B10F909C17F039D1B2D83E78CA0EBAA1CF3E3 alexander.loskill
12,420,037 *015494951422A688760E40FAC4849E4153F5D556 alexander maciver
12,420,038 *015B7F0EEFBE5CD7BA2A04B4D189CF63E81227CB alexander malter
12,420,039 *0158B6D61FEF60D6820AAF0611F0BC277BCC672B AlexanderNevsky,Op.78:IV.Arise,RussianPeople
12,420,040 *015BAAAC569EBFA1B3F5639B312C74BC224AFEC4 alexander.novi
12,420,041 *01544BD399B1355B94A59FD43C1064C4386A4DF9 alexander.paretti
12,420,042 *0154D653881C1AF00846B7944F6C48602332571F alexander.pascorell
12,420,043 *0156D21FE6C249DD9DB1D4D1DB6D6A2654DE9BBB alexander.polite
12,420,044 *015D1B899D53001DC4C7C07A1FCF15CCBCC89E4F alexander.reynero
12,420,045 *015BB170C73B1DE3A4D8D1305B4F37C25D308C64 alexander.sahsman
12,420,046 *015C38BD48A162DBBB55AC76856BB7F872326E4D alexandershugaev
12,420,047 *0158B8922BCEE121B99F432B18DF0897BBE339C6 alexander.tinlin
12,420,048 *015090F3FE327089F9F04A0F9CDEC54645544655 alexander.westray
12,420,049 *0151673FC5976B424742F567B6DF2E9CCA6342F1 alexandra497
12,420,050 *015AABB04D2709A47421AEEFA5342296ADC58A2B alexandra alvarado
12,420,051 *0153DCB6D25C23E16A5E2162C7A56E2124EFF869 alexandramarcu4
12,420,052 *015EC94D2209152C04E28CAE9E6B2EC14ED3CEF9 alexandraminor
12,420,053 *015A55601257A2F1D4E103D94E163A83AAC613C6 alexandra neris
12,420,054 *0152BC0BF4B22EAC0B07A8C0215356D2FCE4D614 alexandraroscoe
12,420,055 *015209F85D4144B3C72955C295BACF6322AC1488 alexandrashasmine
12,420,056 *01509C936140321D0F2F94B1CC194C9862567A45 Alexandrbbing
12,420,057 *015A1F03617ECA7D7B7C3B7053A83A3826F0DCAD alexandrecomtois
12,420,058 *0155DD22F6270F71D032884EA3540EFB66CDDC72 alexandre_lomaia
12,420,059 *015F3FC24BEBADA842D4E196FE324DDD36316733 alexandria…
12,420,060 *015126122BCBB4ADB7BF47249E6517948BA024E7 alexandria cleveland
12,420,061 *015D0790D6D013A452DF1EC9945471E127C72050 alexandria villanueva
12,420,062 *015A4D325505B27814F2CE046035270090B47568 alExandriNa
12,420,063 *015A15FEC4212B9C56E6894832BD7B4CC5235CDB aleXANDRiNA
12,420,064 *015C2FC8232DFF33AC32775425470BC486C5FC18 ALEXANDROUPOLIS4
12,420,065 *0157F4FF62ED16FE3E7DA610DF096E1D5508B12E alexaroxxy71212
12,420,066 *0151E8971878C13AAD6684BED1B2DE3C40927043 ALEXAVY123
12,420,067 *01564F6D6EF4D9F8EB2E941F2349593084143137 [email protected]
12,420,068 *01550E2FA3178B521C54E6108714CB51C0FBE34B alexbasil8
12,420,069 *0159817915C9BA0389649A713CE9D5FC7CDC9045 alex.bednorz
12,420,070 *0157BC1DB539A45953424F2FF2BB8D6988D2D3C2 alex.bills
12,420,071 *015295C3E867EBDC76E606A0E530F065675A7F79 Alexboyds
12,420,072 *0157281E9940F0FED6AE6CC6C39AE500B640A813 alex.buckle
12,420,073 *015BA54E4FAA3C58F3ACEAB3C0CDA44187E7A220 alexcabales
12,420,074 *0154B79026EBF85CC0651A6A8DCC7326684C80A3 alex cardin
12,420,075 *0157A6D0D2DE45416784B0B6B2742EC46398DF93 alex.codde
12,420,076 *015A6A91EB73AB236EA7EC231504AD23D11825C8 alex.cowns
12,420,077 *015ADAF26D51BBF6B73ED996778FAF7B5727EE7C AlexCox
12,420,078 *01545CBD62B8FE9468B42BE4FE6D820F820AF9A1 alexcunningham
12,420,079 *0154C7F65749D85620023C431B3015E50CFDB8DF alexdeath6
12,420,080 *0157F74080ACC0586BFCB5175D06CB2C4D0434B2 alex depalma
12,420,081 *0158956A7AF7269AE3D513555B05013429100CA0 alexdesertroad
12,420,082 *01552FED053044DD6F8F4F5660D39DBDCCBBC879 alex.dewitz
12,420,083 *0152CEC770434E00E46E58FC4588E35526F87522 alex.dobry
12,420,084 *0152CAAE7C276A6E30E8493953B8511EEB739A7B alex durland
12,420,085 *015609DD41F3CEA20E04E2C251ADA4182C815234 ALEXDYJ
12,420,086 *0154EA25823E9CA280A0A5E116DBAB27B55557AA alexeikovalev
12,420,087 *015472AF2FDB3233C7A745200FF106248F8228CD alexeygorbunov
12,420,088 *01569AFF94991EF5FDE4899A1910D74D08EA8555 Alexey.Sopikov
12,420,089 *0159224311621B45353E3ED4CDE388980482538A alex fakih
12,420,090 *01562524252FED499FFDB6A2B5DDFCCA890000C1 alex.feldkamp
12,420,091 *0152E3C1492CD5FB14260EE97FB1A9C1B06448DB alex.fogelquist
12,420,092 *0153947493F301585350DCE55EEC9DE1A964CAA1 Alexforever
12,420,093 *0155118CE66E2605A9FC0D02E96985B9363DB44A alex.friedenthal
12,420,094 *015141F6E9166A20CCE341D1D11BA67D5096B7EC alexfrisina
12,420,095 *015582956435854B3672B65242DE7208E2F8094B alex.gallante
12,420,096 *015EE0B8ED0D96FE2F05DB6CCEFAD50601228203 alex.golemba
12,420,097 *015DB674430403067844BDED85E33B443CA24820 alex.gorychka
12,420,098 *015C1AC3CF011C56FFEDA11B2524AC19E656FCE2 alexhitz
12,420,099 *015FDCD9505D2DE347B008218FCF4034834006F0 alexia buttigieg
12,420,100 *0150AF059E3FC590B20CCED2448C0B4DE4ED1DCA alexico1234
12,420,101 *0152BDA3EF185653BFEB66EE4778932C3BA86130 alexis.allyn
12,420,102 *015229BD549A0282F8F2093443BB39270CF6E8E8 alexis.baldon
12,420,103 *0159803B6662A657FD55AE2FFB2F710FD9BA6DF2 alexis.beaufort
12,420,104 *015F13645980E9B30ACFE0D7AC3659E50B2ED439 alexis.bigus
12,420,105 *01530953846B3C646C1290135E51233B2C159188 alexis.dainack
12,420,106 *015BA52630F58A917C8CA1AA8B4B830F69915BFD alexis.demarzio
12,420,107 *015CE931712971983F385EDD479D2310445349B4 alexis.eide
12,420,108 *0150B646A2438E73895F2851A67B88D2D8CFC71F alexis.eugene
12,420,109 *015CA745CDF15283EE17D6CD02F5BEF4BF7FEB8B alexis.gaietto
12,420,110 *0151712573591DD709E40A9DF1F7DB543A849A10 alexis.gremminger
12,420,111 *015965CEF589F17263C8B9FD71121ACD85326E35 alexis.gurrero
12,420,112 *0159D32D00854AED8DA8F455184AF284E262B5D0 alexis.hare
12,420,113 *0155E06CF6545C7C27E7BD6C4EF77112C1BB7DFC alexis.jarrett
12,420,114 *01537E228CB827083B3407DFCC3895B4921DB56C [email protected]
12,420,115 *015D3F655ED9EABF999BC889EA3274FBD1D88AF9 alexismanansala
12,420,116 *015ACCC2FE9D095118E0786D763B4E2AF1DB7134 ALEXISONFIREEUROPEAN
12,420,117 *0156100ECF4D6644EA26848AB86D50F352E3A9BF alexis.pachew
12,420,118 *015A32E8C59EDCD1EF0FEE492A183F22195DA2DC alexis.pompey
12,420,119 *0155DD7283CD305252B8712459D3C4B73603A4E7 alexis.revere
12,420,120 *0157D11FCB237331FBF770BDDF4D92DA15014CDF alexis.riebow
12,420,121 *0159A1465967F2466E10C532B0A152B84ADA0964 alexisshorter
12,420,122 *0150C4CEA39AC0EBE6628A6B01FE8D71B2D916D9 alexis.terron
12,420,123 *015941EE3879947E550B999AD536E1B5F324A633 alexis.verser
12,420,124 *01508DAEEFF7BBDF994963064E964E96C23EEF87 ALEXISWILLIE
12,420,125 *0153B391CB139D8B14B9D8440E3D2999F59E8492 alexis.zolman
12,420,126 *0152FF0AB3F83CEDC8B1105A83DA88A8D70C566C alexithymia9
12,420,127 *0159680F5BF6978D78D116A28ECC9F1CA43D6D7A alex.jana
12,420,128 *015A1044A4D7D648011B7202C99B25A07C88255C alex j benn
12,420,129 *0153094EC4539A1B4C0E6142DC5D8EEE3EA9950B [email protected]
12,420,130 *015EFA2E8D69EC94932B72D0F10E7DDBF1294D97 alex kapinos
12,420,131 *015FF5DA7F00EA0301206180C0EB3F8E9A7B0963 alexkaren0
12,420,132 *015C83DFE5A50AC86E40F0D5F766B175E2EC2ACD alex khusid
12,420,133 *0154B62D08B3F5E3B5400BE666E0EB8AB95B9BD0 alex.laszlo
12,420,134 *015AA6C66C42E002048EBB4719A1155A85B58001 alex.malinovsky
12,420,135 *0151D1E57939966B9AC0303C05E97AAAECF35B43 alex.martinov
12,420,136 *01564FBF740C16C68C3251299B85D44C05E2113D Alexmine0
12,420,137 *015A9AAFEDCCD244111FBAC44332416F5D2D1D08 alexmusics
12,420,138 *015B3C97A29873DAFF0EE5F510FA053E8F216732 alexolaesjosesilva
12,420,139 *015BE0C8EF1512162CBA269F9A0D413C770D6046 alex.pandiani
12,420,140 *015FFBBA77790AA7CB0E196D23DDDBD0F6B7474A [email protected]
12,420,141 *01595CA40370ECA24B8CC9621221FD41D5BBBB39 Alexporting
12,420,142 *015F95A092417D3363B220BFCB6A537C21D70E8B alex redden
12,420,143 *01568E370F73D64E122B4B6D2BCF097097591F45 alex rojas
12,420,144 *015BFA9BFB31EBE40A858A7AED5672BDB7B95A27 alex.sanderman
12,420,145 *0153BB9A2CAC648D7C9D8AE1E8883E16DBA570D0 alex scholte
12,420,146 *0157B5B3029E723AE05CD87708C6AFB85D171155 alex.schwadron
12,420,147 *0156483BD3B06BD1CAFD8C2B6CBE0227A8B56164 ALEX-SHANGHAI
12,420,148 *015FD0D508AE772A13B7127017F46B97B19DA838 alexsheers
12,420,149 *015E0F6432442316F8D7905A135F568ECBDDBC6B alex.sivyer
12,420,150 *0159174C0D1A6EE207DC9F3A223431A943C441CE ALEXSUCKS
12,420,151 *015233A375A8B1AD162D2652D26851BD1D48E24F ALEX TEQIERO
12,420,152 *015A3FEAC9B7EF97075F6435DA9A2B507B522547 alexus monet
12,420,153 *01527A76DD2FC39FC23B1B4EF5ACCAC3855DF7C9 alexutzaangell123
12,420,154 *01544C7E845510858026738B2BA9D89E4EC2DD9B alexutzasssa1234
12,420,155 *0158E73DC0B8FE592D92BF27CD04A4BF5D3359C0 ALEXXMEYER'-'REX
12,420,156 *0155E1A1175D1969552F234DCE305EBC6BAE76D1 AleXxX
12,420,157 *0158EAE62B7B9D9B487711999FBB32937E2C29A2 alex yildirim
12,420,158 *015E884722B5B19F6740C721305D20FF9E39C2C4 ALEXYS0125
12,420,159 *01587B874825D267741B4B2242F3CEABE261AA1F alex zammit
12,420,160 *015AB00083507900017533E70C2C60C5011B843C Alexzander058
12,420,161 *015F811E5076213DCB887DC09F655D0940FA8417 alexzjohnson.xt.pl
12,420,162 *015722F24B017F6C07795750FEBB6E6BED453840 ALEXZUTRA
12,420,163 *015AEB399060B520D5475D7575EECBC714EAD2B5 [email protected]
12,420,164 *01552E04C78208E7D24F9571C6716DFD8DD7AABA A"LF
12,420,165 *01530DF2657375B796449AAAB19227205360E2A1 alf700
12,420,166 *01503C7B313AEC3EA93EF9D9A00EA63BABBE69AC Alfalit
12,420,167 *015AE8F2941D4C0848720AED3A23A666E1087560 al.familia
12,420,168 *015F9485F2C8AC042FDB4EC5897944AEFC2E2A11 [email protected]
12,420,169 *015C0CD0007A8A707CDC365C0BBB2BFEF4C69141 AL-FARES
12,420,170 *0156977A982C210C3DFE952FE65EA47C97F212A9 alfazemavam1
12,420,171 *01540CC5F3F42279DD23C8076583F7767152131A alfedina3
12,420,172 *015E7004CA0FDB9EC009063B6E53B2785936B6BF Alffuoss6
12,420,173 *015631FE73FD7A5DBCFD9551834048306ECF82C0 alffusonar
12,420,174 *01561B958EC52DF8540CF008EF8087C46D34E7A3 ALFG(
12,420,175 *015E3D9B3C6D2D8DB8844A52E6D369BF3868E445 Alfiera
12,420,176 *01524985179CCCD7EE9EF015CEB2DE856C17E08F Alfilmes3
12,420,177 *01513C0583A4B2640A27715F8FFD0438AA9F1C3E AL/fK
12,420,178 *01572E19C28B0A1578E7EA2022794775316C603E Alfneurgging
12,420,179 *0158DFF31247479B5BDDC8C17D23F4EE53B6E3A9 alfonco4
12,420,180 *01563091BFD8AD5507F946A12A19507C9986FBDE alfonso.adeyemo
12,420,181 *015DEC2B18C5606742A383856155340AE4A5C628 alfonso.baptist
12,420,182 *01539AB0CF11A44ED726A75B3F71AF886F9C8AC6 alfonso.bryne
12,420,183 *015C0EB4F669AEFAAC73A27C09887E3854DF0371 alfonso.busenius
12,420,184 *0153B1C40A14A8C54758C3A1C76E1A5C73473E03 alfonso.chiarelli
12,420,185 *0158754DCB9765D16CB29EB9B63F16EDE16C2F77 alfonso.clothier
12,420,186 *01539584CD4225B2297DA8EEE92750CE1DD6B0F4 alfonso.derousse
12,420,187 *01531E8BA8C7F7E54125661A9CCDE0264659CE8E alfonso.dewyse
12,420,188 *0156B47C63B7AA0D29E1A570FC1CD379E8A9673B alfonso.duwhite
12,420,189 *01501659B21DF4DC6E998E9EA4E3CAFB260084BE alfonso.eilertson
12,420,190 *01521ADEEB7C6C034EC2943E4BC338465DEABC7F alfonso.halstrom
12,420,191 *015FF3C9255AC7B062ADD897DF7C356A193F4E07 alfonso.hosier
12,420,192 *01508E501242A053120EB93C52053C1E40CE2494 alfonso.kama
12,420,193 *015158BD82A6F3F0252BD00452EA0D27D637FF8A alfonso.keels
12,420,194 *0152AE07659A4626DDEF3BA4E53E4C91EFDA67C1 alfonso.keliihoomalu
12,420,195 *01549588F1C985026FA9BA625DF43EC7D3B764CB alfonso.lanzafame
12,420,196 *01563442A444F1403AED74CD0E1011C8A1234400 alfonso.lyson
12,420,197 *015FC7A7C4FA3EA29DFD78B39A4347ABDD775D75 alfonso.mitchan
12,420,198 *015BB616E2E19655D0DD4855AF74FE043F2BBDDB alfonso.montfort
12,420,199 *015EBD325C7478D7C4D36840EA7C0AA675D11AD0 alfonso.ney
12,420,200 *0150F913474DDECF2E0ED29D2D559E68D764ED15 alfonso.pasey
12,420,201 *015D79465475BABF6E9D1FB4640D9526F568B80F alfonso.pein
12,420,202 *0153B33BDFFF5A16DD71E27982004D17F5759371 alfonso.pressley
12,420,203 *015721F3252187280485C5A8259E86F82E29BC7B alfonso.raterman
12,420,204 *015D86062A249A20DC0C2CE2DC238013BB4AA907 alfonso.sixsmith
12,420,205 *01573CD7CB84DA28058A8907FF3D493D924EC4B0 alfonso.vanvuren
12,420,206 *015F0D81DE78367E573A82E85FE02F6ADF981EF1 alfonzo.besson
12,420,207 *015A3770E1F5A0BA13F406ED0055058151016FDD alfonzo.delarme
12,420,208 *0154F39BFB43389B809A9336655B97A32D0B3B0C alfonzo.desormo
12,420,209 *0158D304F86EC6833EBE56ECE6EDE8167168134F alfonzo.dirienzo
12,420,210 *01521459D47B5610211DCCFE9E2D5198D2F80AA2 alfonzo.fader
12,420,211 *01542FEFB3B4C660BB07A1A755D115D22E8C2A95 alfonzo.gibby
12,420,212 *01592CAD7C1BC02FC70A9B30BF6BD0B19C321516 alfonzo.gouras
12,420,213 *01515CB01A5DBDC364D7A2A9C9F1BB30BEE5173C alfonzo.gullace
12,420,214 *01545A41D871B4FA07E58CD155F2E10D18930F67 alfonzo.hasselbarth
12,420,215 *0158D848A182116650F4FB9EB133EE9CF94AE62A alfonzo.hennick
12,420,216 *0153415325311BA565ECDFAE029BFC8FB594D916 alfonzo.honeywell
12,420,217 *015FAA761392C53EA246982288D1D9335D637DE8 alfonzo.hricko
12,420,218 *01520C4616BB3B0415C81A6CE4D296BFA9C5A1BA alfonzo.jaap
12,420,219 *015B49C7D8BF219F33D9F2015D89DF24595763EF alfonzo.kolkowski
12,420,220 *0157223D8C4D3007AFF71300B64CD8D94680562B alfonzo.lacher
12,420,221 *015B6595F3556404245EBDEF5E8997E74DF37CB0 alfonzo.lichtenfeld
12,420,222 *015E5DBF1450FE2F475E6D757377849C9653092A alfonzo.ligon
12,420,223 *015FFC909993A3FF84107D7FAA71DABC436581B2 alfonzo.orie
12,420,224 *0155DC780F527A000F702F6B6E359A680CA25675 alfonzo.rippon
12,420,225 *015528C991EF34D7BCF0661018978A4B6A70ABF6 alfonzo rivero
12,420,226 *01577DEFC9CF3B928CEB7E62EC53C6B5846B36CA alfonzo.roblee
12,420,227 *015A6455A04584993F67A4B143141E9B88036E32 alfonzo.sarazin
12,420,228 *015534845041BDA41E237B44CB5E4F099C95C6C9 alfonzo.westgate
12,420,229 *015C7F497D2A01B391836C28E7BB059D7B4DD509 ALfq-
12,420,230 *015AC73AEB557EB9529516FD920D27A355F7BEED Alfreba5
12,420,231 *015C140FAB9129E7C499BBC8DB8EEEAB69F835D4 alfred513
12,420,232 *0158D9DD09EC2B32C44EB2F97277731E9E18468B alfredagyapong
12,420,233 *015B348165A5EEED4228254B8213A461934BB388 alfred.aholt
12,420,234 *0152F25142B0A1AA7174A84C3CDE85D62AA15D31 alfred.bissen
12,420,235 *01555F9F1E7C3D0B9EEB5AB97B5B86AAA303E417 alfred.brindel
12,420,236 *0158F85D4FFC4952CE70B61D9C6227696AFA7F31 Alfredcat8
12,420,237 *01584D879F507C2D8E21AA9024C7659582D8EA7F alfred.cesario
12,420,238 *01582A24004B78A352EC1515C025A7ED55E8508C alfredcheneyjohnston
12,420,239 *015F08151070B177E609124D0C3B4299ECFE1184 alfred.damrell
12,420,240 *0155C14A8929ABF51D67C96D43688EF6CB59C67F Alfreddson
12,420,241 *0157D8ED3FA9E2473817917A91C946157078732E ALFREDEDERSHEIM
12,420,242 *01557EB985A54237E2AEFE94401425567F6A1A3B alfred.fuchser
12,420,243 *0159B27A1971D6F1B163683BE9A59FE7312C3C5E alfred.funes
12,420,244 *015C41B8AC397A3F05A21F572A7A5E7C419D8200 alfred.gilkerson
12,420,245 *0156089D5ABEB9345582439CA4B33F1E9B3323A0 alfred.guiggey
12,420,246 *0156CA5E2CDA477749E41A751A07734EAA1B1E51 alfred.hanel
12,420,247 *015016772E228D59957AAF6C02281303F84C23B3 alfred.icenhour
12,420,248 *01567468EB258ED7ECAEDD1EA8EC79C64DD25EA6 alfred.isbister
12,420,249 *015271FEA78D3A133851E128135F5D9109A9AC69 alfred-kindler-stra
12,420,250 *01595719C762DFB84E6AB2C8E90D9ACC0F6919C7 alfred.mate
12,420,251 *015E0F4A00424C7CD35B5C2F4BBA52218BA8CDE5 alfredo.barda
12,420,252 *0150EF5E36BE08ED57D8116E7E5E036E969ED196 alfredo.batman
12,420,253 *015EB2772BB01EF50EFD39DE5B320E4A4AF2347C alfredo.dusatko
12,420,254 *015B8C23CD76FFAF76065BAC6BFDB16BB9448A0F alfredo.empleo
12,420,255 *0159ECF92145BFA8FF1E8EBBA4BC757A6536BE18 alfredo.ernsberger
12,420,256 *015058EFC15006937E8CCA4C1A3B8E5F38BD664B alfredo.gosso
12,420,257 *0155A990E86B806F1EE69EAAEB35E2C7AD84C3A4 alfredo.gremillion
12,420,258 *0150EECF3E1B8026ECACB2D750F8A53E33A2FB5A alfredo.gutterrez
12,420,259 *01597324360315A5EC9DE2DBE1F733E759632B2B alfredo.hardyman
12,420,260 *015417A482563CED17E56B666E8068C69331DA72 alfredo.hieber
12,420,261 *015CD05C1C1189BB2373BDB757CA0576073CF072 alfredo.hogge
12,420,262 *0152B4601624416E543272496EFFBB72B41772A1 alfredo.jemison
12,420,263 *0153F7F27193B3E5DAC0279A5A36C158B1132B1F alfredo.kamen
12,420,264 *01582BC77EF9355031192534C8AE35424D490163 alfredo.leasor
12,420,265 *015B8E0ADD3FBFC9588C300F9E2F1541D02A64C3 alfredo.less
12,420,266 *0154E9E76BEAEF136AF04D69124BE6A38A622A35 alfredo.nyenhuis
12,420,267 *015AC2BA54A544A57790DEAD9C601F6C60A46299 alfredo.palmiter
12,420,268 *015272ECFBFE66CFBFA6F1712D2B62118216248D alfredo.pickler
12,420,269 *01532073CC6B65CB046B5BED73E3973CE4163C01 alfredo.quezada
12,420,270 *015E7657368B0B9CDE26D614C7F8206504B7AE24 alfredo.ripa
12,420,271 *0153EF25E5497DF24FC1C9A9828826BE339FFDCB AlfredoTorrealba5
12,420,272 *0154D9245E7FBFA607317BC28958B39D1096BB5F alfredo.wheelwright
12,420,273 *015875D37F37DBF7E8CD1704ED28B13DFDC9C9BB alfredo.winzenried
12,420,274 *015188BBD8869362513F67F6E8DAFABA282A52AE alfredo.zollman
12,420,275 *015398E2190B1FDA0D16E91A2078654D684BB948 alfred.petula
12,420,276 *015AE131CFD5B10B0E7E6B3AF22C7EB2375E6594 alfred.pinkett
12,420,277 *01598AF6CF6B4A683E41B20B955A1BFC9BCF4933 alfred.quebedeaux
12,420,278 *01595B4AF82B31E01AC59D0F4B8599C9B8A8849F alfred.sang
12,420,279 *0151631381C7E64E25D12C3BFF65175C25309901 alfred.shabel
12,420,280 *01517221685EA7652BEDE0E04B2B505B9D84592E alfred.siangco
12,420,281 *0158314D9914888251F8CB723B6C08B3D7557B49 alfred.vanis
12,420,282 *0154A7F181BD02A1C9E017DCDE77D9492B037855 alfred.wicinsky
12,420,283 *01500FC1CB1ACD63C4F7BEF8B3EBCB5C2445469E alfred.winge
12,420,284 *015C4DC75E15A14CD44D6CF9FFF8F57A740BCA80 al.freiberger
12,420,285 *015C3D1DBB2FD8EB6968A83100EACFE3B0F3B7E1 alfreidla8
12,420,286 *01573E3EC07331594C0777E1294C28B5B6BF8318 Alfrenall1
12,420,287 *0159F04BF268BB451A23040383D9223F5FBCCDC5 ALFRETONMRS
12,420,288 *015D2357230B0A27CD3403FDDDE1DD874392B70C ALfuh
12,420,289 *015F4A413D2D36E0A515B9EF014DA238F7531110 AL-FUJAIRAH
12,420,290 *015D579EE0BE8DC81C2BD9B819A49B362D2975B7 alfwine3
12,420,291 *015CCC1ED19CFC5C0961CE824162D2D02777032A A:l-G
12,420,292 *0155CAE35BBD2551A1ACE14FE578C2D61918B03D Alg0l
12,420,293 *0155E8F34A16ECFA40BAEECCFB24DB1B46C83771 alg0l0gis+
12,420,294 *0151D7BB6F0669C7976ABCB2963447A5D35544D5 Alg1
12,420,295 *015C091FA2C894B05D72D2CCC6C2B79F442C06F1 ALG5w
12,420,296 *015080C7C5A337D8D454423ABD50D151EDD668A1 Alg8$
12,420,297 *015466C78FE4FDEBB4E478CB33FBEC6BBB849750 algaras4
12,420,298 *0153189C132A326F04F4AC961F5DD99FA2B339CF algarptu5
12,420,299 *01502444C2C70E55A01273C33982CEF7CE106B64 ALG"B
12,420,300 *0152F757C1E5F5543AB029316FE780B79FBC53AF ALgCQ
12,420,301 *015CE7F87114197798D0C6E3D1D3C15AC5E17B11 Algeheels
12,420,302 *01544DB3E4D39CAEC51ACC688A041C16BC407463 algeriaschools
12,420,303 *0159C54B27F4B747D8A91A96B68079B3038128D9 algeriatasfaout
12,420,304 *0151EBFA37AFE1B87536FD2F05CAADAEDDB1ED4D Algerinh9
12,420,305 *015A9348DE181952E575D714D761ED07C97F5FD9 Algevkst0
12,420,306 *0157D90FDE13387530BA27C6FDA7821FC393D377 alghat1
12,420,307 *0150B1B65EFAFBE82534F7579652B3912B5E7774 AlGhg
12,420,308 *015FAB921D3308E14799516EE5B53AF4205AFB28 ALgI)
12,420,309 *015B8276D924F843E4030DDC0EE5FE01D2C80AB3 Algimiana
12,420,310 *015CDE3AA439C5353A0D1FB6612FCE6804A0D6F2 Alginalgin
12,420,311 *01592775DF95478D192B438C0CE79B22A79013A1 älginnanlår
12,420,312 *015439C86BE4BD1603D792BACCFEDEBDF9C6B92D ALGk#
12,420,313 *015BFB8E206D6E3D9D797FD78ADD36CDF030A291 ALglq
12,420,314 *01582A90F8591D1BF1FA3698070A48A2B194E51F ALGnOIx46
12,420,315 *01596A801AB1936E7AF40FD138CC0F3F773C522E [email protected]
12,420,316 *0157B1A4E4A08DE0871D8909A5B501B465EEC651 algonkinima
12,420,317 *015957B8CA9237DC1DD5287C6AF5CE27A55C47CE Algopa'beber
12,420,318 *01508AD9C0496157CB21F706836DDCF406938AC0 algorejacques
12,420,319 *0150A77704160B66063C964E58AA58A247DE041E Algovite!
12,420,320 *0159A4769D08064E40622F558B3C30BAC44B7226 Algroen
12,420,321 *015E6A8B1629D45EB1574EE4E5DB0527B3B35064 AlGTi
12,420,322 *01534B0E424E268A92EBC41B979FEFC145F4CAF3 al.gushwa
12,420,323 *0157FE724A1E1579B3BDE0F9C3556BFF1AEFA72A AL!Gv
12,420,324 *0150821A1B205A4ED1F4E13B49A28131DF0B948C Algxyhqb6
12,420,325 *01507B3ADE49CF0E14153D7477CE4E40CF340CEF A%)lH
12,420,326 *015E1D2AE93BC3AEBE8B4E920921495374478205 AlH;:
12,420,327 *015A6ED9F7402EFD39CB9E1DD68C9BF9950295D0 [email protected]
12,420,328 *0157F94AFC9217F32071997A8BE3158B6AEF54A3 A.lh3
12,420,329 *015B1705A21070112B12C866886BE5594BA83C67 ALh,4
12,420,330 *015E8CB64927705DD7D3C8CE28FAE8AF44379C30 Alh6F
12,420,331 *015D4B9B3C785F8A552472DD4A4457BFA9A45FDC al.hachting
12,420,332 *0159521664C7073A93A65304FAD5797D89B1702D al.hackleman
12,420,333 *0153B4082EB94208161729FFB3CF73F34B2C4674 Alhajalta
12,420,334 *015E396D80D788573810C9820FF481D898139271 alhambra12
12,420,335 *01574851546729696B48F72C484B98919AE62DF4 alhanif4
12,420,336 *015151B9ED6469415917A24E50D6888BE5847A03 AL-HAQA
12,420,337 *01557CE49948EBCC60A607347041968B9161870E [email protected]
12,420,338 *015673671E78130EF67B9EE2A108B2E7B987D7DF alhcstar4
12,420,339 *0159AEDC2AE36E1399905DECFE95FB8BBDDEAE3B al.hendrickson
12,420,340 *0150109ABEC4AF428888B584A496FD82F21B22CF al.heon
12,420,341 *015D4EFBC3BC90A69D205C9C5A5631ED0CF974A0 Alhh5
12,420,342 *015E9CC0961235738B1F56E7A6963F782EF8B1C3 Alhl)
12,420,343 *0159A823B522F41DA04CB0CB3C9548F698EA3744 ALHL7
12,420,344 *0159CA8B38159451CA430E9152A3D65F4F8659D2 ALHO0
12,420,345 *01522FB9CA2FAB23E2D2E73085ED90C6AD5113BD alhockey4
12,420,346 *015F845FBB31867EE5D11CED57D3B669B2701133 AL-HOURIYA
12,420,347 *01524A8CC2A17A91ACF02634CFAC46E0E4DC73EF ALhqv
12,420,348 *0150C7CC2C15ED2F7FA203DD51F2C09E3F62CD18 Al_HS
12,420,349 *0150D49C005842E7F2C6544A3809E274AA5150D6 AlhuU
12,420,350 *015A17018BF5D6D2DC53229345CC0318CB25EA35 AL-HUWAYTIYYA
12,420,351 *0150F644B9BCB64474BC2FB341DC219FA88C1B57 AlhuX
12,420,352 *01573A1536B817167639489CB09BE112404673F0 A-lI;
12,420,353 *01548F1DB133532FC318A64792C9932D55D908CA Ali"-
12,420,354 *015BE3D427F8CF3774A25FC8155058D1EA6DD8A7 ALI315
12,420,355 *015907E025E3A9A04BB57827F5E6ABDEEF552BA6 Ali3na70r
12,420,356 *0150DC903BEDE9BE7AF38CC48029C24C375EC6D5 ali.abrecht
12,420,357 *015035BF524D3DF088B3DFA0591FE444F67C0DD9 alia gray
12,420,358 *01533040B486C0AEC12F398255DD730B5256996E ali.alexiou
12,420,359 *015AF6CC5C2AE48222EC3C3FC5059ED0BFFE956F Aliana784
12,420,360 *0159F03EBB7F88413CCD1B66788B1C1565C01651 alianzas1
12,420,361 *015E73E2E11ABCD05A268BB9B9B4B1FF7DF4BA9E [email protected]
12,420,362 *015484EC8DD1B7154A1219CC980A29DE9066B4B3 ALIASENN
12,420,363 *01535BBB7A81BD28D159CE445A4C34EF4990C6C7 ALIASGAR14785
12,420,364 *015E888FB787E52D5C524123F793A509DC263DE6 Aliasingsed
12,420,365 *0153846F7251655A3E0132353187B5F5C1DC3818 ALIB1965
12,420,366 *0159E8B5ABA0CD611D147894F2127AA21F0AB941 ali-baba's
12,420,367 *0158FFBBA4F6CED8D021039080289865A96CEC19 alibalti
12,420,368 *0150253DECD2B9041C1E67F2B42DD4FEA2CF8D5C ali.beckom
12,420,369 *0159A38FC8D2234FA4EA0A21E8A54D24E5A8AFB5 alibicolin4c
12,420,370 *0159B90F881BE70B19F59E54F7B3222AB1986B39 ali.carreras
12,420,371 *0154B5E33F62C68CE090648D0BE477C8DA33B345 ali.casey
12,420,372 *0155F7B0DB704561B3CF95BB00F9F383F35BAD4C ALICE1QW23E
12,420,373 *015E5D6BBEEB5ECFBCCC6F5788F59357E3981D38 alicealopez
12,420,374 *015C7B5E5F0CB27C5CD2C893C1E51CE7D0B77EC1 aliceavn
12,420,375 *015E27DE2C511C371F04371694F36D90D0D05B7B Alicedawn3
12,420,376 *0153793E93220547F59DBD96EB42A409E64F0FDE alice forsythe
12,420,377 *015F298431B75B1189B99C7AD45517346B9C1998 aliceincartoonland
12,420,378 *0155BE272AF0E20E9381CA1E5F522BA5E2F58DFD alice pittman
12,420,379 *015B2D0562CFBD8CFA57087388131B97D233E473 alicercei0
12,420,380 *01543B215B2E13243D06596E531D30E1F131D046 ALICEVISA
12,420,381 *015E9C2FF94D5152A3BB6C185A31FE1CF5D61FA4 “alicia”
12,420,382 *01535132294B74A7154A3EA1C66FEB709B46820E alicia482
12,420,383 *015CD542D0570CAA5E7C3BA15B27007E128D0E56 alicia694
12,420,384 *0150C47B14297B0961DAF20915716D40ADB72991 alicia babbitt
12,420,385 *01553E7B98BAB9D12BDC3484BED20FE2F111DC51 aliciabiggs
12,420,386 *0152CF13023CCD14E103357A373913B48FA43352 ALICIA-KEYS-ET-JACK-WHITE-INTERPRETRONT-LE-THEME
12,420,387 *01526F297E3BC173EA45FCD9BE2FD4D4BB8D9838 alicia kitchen
12,420,388 *01526C240BC98795D250EE23F3467C8A9F6DBDAD aliciarlhes123
12,420,389 *015AC15A0C0B52E16A206259CA4C54B5446BDE60 alicia titus
12,420,390 *0153E9C48AE2BA2A334022C3FD7EE336012B41BF aliciawillow
12,420,391 *015A23B6F49E2E7A5C81BBBEE7EF7FE34453EA20 Alicinda9
12,420,392 *015041122DF23DDA58B6473945431BD25484E647 ali.dobiesz
12,420,393 *01512301647CB61B3E53933513E4A6D2194D59EF Alidomainit
12,420,394 *015A74DBF1768F48CA376E83ECD27700316EF580 Al?iE
12,420,395 *015309249B78E3B980051D3364E5A0D18D9F782A ali.eisenbeis
12,420,396 *015C3126A9199A786F1DA71D4B89C0710223E794 ALIENASSI4
12,420,397 *015FD8BEB4FAADF4F880309E577293A111DC984C Alien Complete
12,420,398 *0158B410A956DEB6A5D4697C48E2455468020C38 alien..gave
12,420,399 *015F74C6BC49F2D911E10ED435350543576BBF09 Aliensv5
12,420,400 *015986E621B7DD2D5EA0099069CF611D3FC21B17 Alien Transport
12,420,401 *015A309448E02830439AF95E873DFFCB1A0F8C76 aliercevant
12,420,402 *015BBC49166CC89DFBB635DB30E2458232C44F77 aliet roland - fran
12,420,403 *01565AE12269D3725C217DAAE350613E34B79A69 alieutika
12,420,404 *015DFA3D4E88B4EB70EFD5C452FF0AA5BED0A02E alifinch
12,420,405 *0156DF4A98E468C27DD2BADCB9E51A864AC55BAD AlIFt
12,420,406 *015AF75A408668FAE1317AA1BF2986E50AFFBE78 ali futcher
12,420,407 *015EE6E0A283AEFBA69D4DCF757CF21C894B7FC1 ali.gargan
12,420,408 *015A10C750350D15333C3CF27455DAF7DE1B8FCF ali ghazi
12,420,409 *015B081CA80D5FAAD4FFAE31ADC4E3C2123D9AC7 Aligiare4
12,420,410 *01551AC1C456980B0C084FEE62285DE3613B2746 aligncenterbimiscellaneousib
12,420,411 *015E00CB6AAF6066C9BC19932A96BE740FF4B644 AlignNum
12,420,412 *015C92739048AB0E2069EB7236050CF7BAB023C0 ali.goethe
12,420,413 *0155FC2EB211CF4421F3072E0896880BD089F3CC aligrizzle
12,420,414 *01519E22FD2661E7A96B8A03D31BC0FB2786274B ALi%H
12,420,415 *01562E4D1F6853E56B6F5699058BA88FEB98F14F ali.harelson
12,420,416 *015DAD8608FEC82B79E5E6309C5DA1AA813789F6 ali hassan shaikh
12,420,417 *015BE6E9ED9AD5ADDD21EF8F935DF626CAC1130B ali.hottes
12,420,418 *015B3B65AF10DB64156F0E167B1D14F1F0F5E401 Alihsus1
12,420,419 *0153244B3A08AA4070ABE9166FEEAE83CBDCE6C5 aliinM
12,420,420 *015815F7B386CF336E2F388712E88CC87CBF1BF0 alijiunga3
12,420,421 *01539485A5716038977F22C78C576C762365B495 Alikruik1
12,420,422 *015B0B10C8BC3F3992D8265E4AA3C1BB04154B3E alikthomas
12,420,423 *015D1864843CD67136543E6873B8B995F28D3F8B ALIl&
12,420,424 *015EE055636E64A368094B9A76A8B567507D6134 al+il0quen+
12,420,425 *01543CC6BB4C17218952D40372456BCA34C39A8E ali lamaa
12,420,426 *01500BFE0D23863749234DEBCCD54C0596741619 ali.leftwich
12,420,427 *0150351F050DDB0D07B79A392F65352128E32F83 [email protected]
12,420,428 *015391D0F9AA868558E77AEE0ADB852B6231E2FB ali.linney
12,420,429 *0155EC095D88A3DDEB793C5221D23219EB9825D6 alilomaned
12,420,430 *015A4233689EBCF1C289330E15BD267EDC165DB6 ali.lorio
12,420,431 *01575DD69FCFC2D3B487CA6F7247CF5004904BA9 ali.madin
12,420,432 *015096F5F3FFACC49CC7476B81B8E6C8C1E1A41E [email protected]
12,420,433 *01532EBC48477F27B2555A346873CBFE9DF6E4A1 ali meshki
12,420,434 *015B62FCADF6392DCCBE6B1150D5E4657C9BA123 ali.mohl
12,420,435 *0150487D0D620986790D436864707ED79D9D7CAB [email protected]
12,420,436 *01590F5687BB23CD94A4A8B199FA2073A5E354AE alin9100
12,420,437 *015D483B5E4DEF53A7E7277E834BD285A5AA3A04 ALINABE
12,420,438 *01596CDE1F458D0D9F12ABD4F9A7E1E088F8E1BF alinadea
12,420,439 *01594113F6AEB776072FEF75A8FBFFE0902A6699 alinahoromnia123
12,420,440 *015199C1A372F9A2905F8B39BDB38239C3EFD0E8 alinbilt
12,420,441 *015990D9BCCD80C2C68508871B06926564D65CA5 alindes9
12,420,442 *015A38C731C31C16D412418FC51EEE8A884D9276 ALINE10
12,420,443 *015AB1D68D653A82BF29B251FB84C8AA2C50A3A3 aline adam
12,420,444 *0158220C00D435637FA8E16BB6704266C38A4776 Alineth4
12,420,445 *015572A861A72965DCA23261C360C21B045E5A19 [email protected]
12,420,446 *0154DEC1857517FEBBA1103AAF61DF8AB449F1CA ALINGUAL4
12,420,447 *015739A64E1E82D667B3197B0BF230508FC9E926 alinka623
12,420,448 *015CB75DACF8B8345AE9E6899173AD1BF7DFD018 a_linkinparkgurl
12,420,449 *015DDB02CA952D455A9EDC9F4A62F5A3A7D55A67 ALINUS12
12,420,450 *015894ADAE7CEEB792BCB64CA066703B8525641D alinutza_ciushk88
12,420,451 *015E6BF5326332CD9ACF46B2092C800EC6311A41 alinutzadragutza02
12,420,452 *01547E8E2A10FAE00B6B5D6F1599A0D24937B4B3 Aliongea4
12,420,453 *015352A5C68448D572C417BD0A5E0FED68F66ED3 Ali Original Soundtrack 2
12,420,454 *0152BFC0A8F640473ABE1C3A4011085604154314 Aliortw4
12,420,455 *0157C228D5A8C79C95A7572F28DE98D83C44CBFA ali.parbol
12,420,456 *01552B719532385B37892F1A5350E900C3FF76C8 Alipofikia
12,420,457 *015013509987542A7E2FF798A19A181B7A4F942A alipompa0
12,420,458 *015FED3E167A6A5266BEB0D84304385E6C6AD458 Alippuun5
12,420,459 *01575F26C23D2D6E2B507796FFA70F71F4BCF318 alirece2
12,420,460 *015D5E331730CDE56E2F6897620A5140879B3964 ALIRED23
12,420,461 *01547ACE98FF206C418391FEFF7E66149F4735A6 [email protected]
12,420,462 *015C112939D95779EBE6D8327F6B40EF6BFCC5C9 alisaeager
12,420,463 *01512E4971DF90192493F3A359426C28F5F88BD7 ali sargent
12,420,464 *0158636085543A9EBC365689867EA98E4854000D alish10940
12,420,465 *015F074B1200764706E9EC00E30302D4360F677E Alish2
12,420,466 *015FE964ABCA1F6769D88F8DDDCE35BF0BC8FEA8 Alisha309
12,420,467 *015E6F41217498BA1E721AB55252C14D0736864D alishakeller
12,420,468 *015E21BB80D1639B64C0DEA22FBAA2ECE576E767 alisha tigner
12,420,469 *0156F4A44DC6D0B2D74F20F2EC3D499F16756CA7 ali.shroeder
12,420,470 *015A5556529091E07AFF77185E5DEC8F3D1D7EF5 alismata5
12,420,471 *015EFFDAD63A061076548B6734D2AAA37381FDF3 alismatceo
12,420,472 *015DA49B0CE9E3AF5A044493D5FCD3C0EA305A36 Alison=
12,420,473 *0151ABC898F5091664D3BA017EBDE9EF42B59042 alisondinamo1
12,420,474 *015EA3EFFA32C2083E988F5B077136DB881FCF45 alison herron
12,420,475 *01526FAA1B0D6BF68F5476B2379746B25304A180 AlisonKirk
12,420,476 *015E9E274F9B72A364A8623F08BCF6B5B9EBC702 alison marina
12,420,477 *0152F4EF1F6349E20A15D3BC14160348D6072863 alison plant
12,420,478 *015C5E097C945B4368436BF5590C1573EBF71340 alison whitaker
12,420,479 *015E04F9ABD3CA1ED079148766AE352AE015B1AD alisSa
12,420,480 *015DDEB27A5C1C395FF244FE58F548FC3BEBFB5F Alissa128
12,420,481 *0156BAC0DF4765BD62B9D1BDE9014B0BFBE97244 alissa154
12,420,482 *01532B3A5EB7DB73F48603DD022517E0936F192D Alissa369
12,420,483 *015DE5C2E9C5ED08D9E14A9EC253F68279F4370D alissageiger
12,420,484 *0159A3032B3741C903FA3EE5041C6309D4B46F5D alissbaby123
12,420,485 *015A3A864D852CC5DF68A1D6709E3A5E8519B6A4 ali.tapanes
12,420,486 *0155E6B6CBE37021FC54520573BB67AEF0077951 ALITIRET
12,420,487 *01555D6F718D39412D354552855A277F5CC2BEC4 ali.trovato
12,420,488 *015497B9C1C6C7C84FC526378D13222802071B7A Alitteli1
12,420,489 *015C59BD831245738682D049B169657A74D6BED9 ALittleBumpin'
12,420,490 *0151AC4FFC9DF3CE580141C65A04E4A3B4A58E8B [email protected]
12,420,491 *015C165726E456639DBE58F64A33D5F252C6CC40 AL&iu
12,420,492 *015E27610353B506D0B33CB1EADBB7445067F91B aliveaux2
12,420,493 *015E504BABC1B7B7F06FB64427E81A765CB6471C Alivein85
12,420,494 *015AD7317957A6DE02BC9387CF3586D25D50B029 alive<奇跡の生還者たち>
12,420,495 *015DB46B4C99438C0AD3DCF3AB01275015E59878 aliviarei4
12,420,496 *015A0E6A0CBD80E0A3459E238567BA572BEFADE9 aliviosas9
12,420,497 *0158929F12137AD2E34AC1B1F0D6914912752B6E Alivioso3
12,420,498 *0158D9F6ED007A9F154D1994FACB94ABCBC70A96 alivuokralaisessa
12,420,499 *0156DD9EA33FD1CE88304331ADC4BA68E0846FF5 aliwajdan ali
12,420,500 *015138D0639240D701ED5CABB30AA34C6011C999 ali.weter
12,420,501 *015AD12E8B6E8F9E937C76E9B33CAFF1B20344BE ali.wiscount
12,420,502 *01542DB1B83EEFBD0C33AD3E5B66CEFCF53AA6F5 Aliyah370
12,420,503 *0158AD4649CA797AEA8FF6827272C38F9B231176 ALIYAH4
12,420,504 *01546C82DF7F482CAF02B92CA26253E5069F2264 Aliyahes9
12,420,505 *01538AF302E9BAFCA12439F050487B59952032BD aliyahoing
12,420,506 *01530BA59F3C8DCEEB359621C858E5893CB1F73F aliza pick
12,420,507 *015F3EE9912DF5E3387A84ECB503D9F677F5AE66 [email protected]
12,420,508 *0155B5E297E446FF78DA827CF4DC71DF13EF14B5 A??Lj
12,420,509 *01537445518857891A7B506F5D5FD0CFD815158E A#lj+
12,420,510 *015AD10A013D3B8B1DFF6D42037519B6BD0733DD Alj)
12,420,511 *0157D33E9E808F0D96094DFDEF64156A50477979 Alj5e
12,420,512 *015F616E8CCCE0018901A4EF0276D6A02D833CBE Aljehinove
12,420,513 *0158160D59FAA947F3A37F4B4660DF677B25BC9C AL&JEN
12,420,514 *0155E96B56BC49F5FA670D77B49E42BE5B3F784D AL-JILANI
12,420,515 *015984E86D2DDFF208A14622E6F5C2FA27C56C64 Al-jl
12,420,516 *015EA50330E4E2A12A69E709C070B94A7A4BB02A Al/jm
12,420,517 *015B080AF9FCFA729788C7E799363130B8F6FA44 aljon velasco
12,420,518 *015C8EF48DC0CF938026A745EA20713ACC9E1951 aljores0
12,420,519 *015ED52B997CF34B007DEF8402F51C29BDD6D3ED aljoshined
12,420,520 *0155B5BB6E67BFCBA7DED33E47D6F752AB5F3B06 ALj
12,420,521 *01595A65C1FE2D15523E96EB46A292E4D6BEA2DB A.ljT
12,420,522 *0151307CAE159946B5117E6F6A6166E33CE27412 A(lK?
12,420,523 *0153DFBB6799D96F721D6499FCF34C8886524015 A#lK$
12,420,524 *015595E8E9EEFBBF26A2A27987D6017B79486CCD A+l+k
12,420,525 *015CD2316E5D7E49F84443C965BAE614E5C09600 AlK9a
12,420,526 *015C2DE5A9E2497AEDE3A797C93B79A66F135E9F Alkabsw6
12,420,527 *0154AB2157C493B124D524233D4068C9E974A353 AL-KAHTANI'S
12,420,528 *015F902AB9F9D53DD352F74EA00D83AC81435716 Alkaliphotozelle
12,420,529 *01566F0219D5EB0C87ABCFE915AC4525B24D10D8 ALKALK2
12,420,530 *01595ACB9CE4E4D23B407FF2E7D7F4F66A838307 ALKANNINN
12,420,531 *015FDE8516D503F1E2A5DF3EF5BAFCA412C9DDFA alkemeye6
12,420,532 *015B3C4462629309E7010A6FB35F77A3D25DEA92 Al-kh
12,420,533 *015C46BA03549EE8B193D1711E09501193E0F85F alkhafji6
12,420,534 *015F48719D086230046DFA696501F14B5ACC3C7A Alkiesalkies
12,420,535 *01552C0F7325F236658E10A06FA80AF188C53FB5 AlKIL
12,420,536 *015FE263CC9D7C03EC09B575EFD8991F6A12F529 alkiphron
12,420,537 *015CB117B55C1686D7DBE1374A41876D864F6169 AlKiS
12,420,538 *015B27C2CE0E0B5FCB2CE89E2529FEC08D9C3446 [email protected]
12,420,539 *015EDE1DD8C9F7BDC3F1FC39614B23C56CA30A1A alkjrhjljd0fvdr
12,420,540 *015369FFC3628EB975976BF65A312E715A843448 AL?Kl
12,420,541 *0152581060A1CEA7EF53F68A1F8EADDFEDA87595 alkmaar6
12,420,542 *015C446483066AE092F8568FB0C35E2AB059ADB4 A%lKN
12,420,543 *0151FA73D9971ED60647163FDC705CA8B3266F46 AlKNb
12,420,544 *0153B908F8E9738379B71362BE9662101A37B972 Alknivtt2
12,420,545 *01536C7134BD15B164CD031E8F64AB4399C396DB alkoaa
12,420,546 *015598FEFBB3BB8E1FA32DBD7E1D56D239CC0877 Alkoholiprosentti
12,420,547 *01594F2CEA26A5211D4266368E364E0143E8F961 Alkoholiveron
12,420,548 *015FCE77C71A7B502A1D81855E44009DF9B4AA00 Alkoorts4
12,420,549 *0156ED0B66EB1B8D56C9389BB68D9EEF763F35C1 Alkuhli
12,420,550 *015E42B92D95D290E449457D074EB0AF54724DFF Alkv4
12,420,551 *015FD99571DA760D423FB0B9B83D85C2C2669116 alkynoate
12,420,552 *015F90509F9C5F6B6F76933FBBC10A3616EA788D A
12,420,553 *015ED9B532A237DE1321E5FB776368DE6432B041 Al!l"
12,420,554 *015AAF15565A1A4337A8EC736B4D4C63AA4D0323 all160pzythetalk
12,420,555 *0154E0AB843A12EA10526C9AC60A3F5AA462CB72 ALL1HAVE
12,420,556 *01584C215C41FF44A3CA36FF36D9D6D95CEE943D ALL3G1ANTLY
12,420,557 *0152BAC29F1F491FFEB1E4216386E46C93BEBCF7 all4me143
12,420,558 *015ED217181F40412FE721B9194C065AA5A24100 Allaamal8
12,420,559 *0157E6D9C2121830A1D490711A978E734CE26231 ALL!ABLE
12,420,560 *015BC231692920746CDD525C79C42ED863400A89 Allabmal
12,420,561 *015A0278121A4DA84DC4993DAD30685644FCE0A5 allaboutmilford
12,420,562 *0151BC9388A77F863EA26A68B9321015DFBF31C7 alladaru4
12,420,563 *01597396CE79E67F8AA0847A7D41DB7358A39884 allaged9
12,420,564 *015418081911E1BDE525FDA13ECD229C77DE4E23 allaghiate6
12,420,565 *01567907A69CF48496851FCE05D0DA30C37913EB Allahabad4
12,420,566 *0151BB15E44162FECF6D0978BC836D00CE861AD4 allahayani
12,420,567 *015E15152AC5A0019652B4C9B80729C28304B5F3 Allajar9
12,420,568 *0154E27527947AF10BBF2A98980C274F48AFA66C Allajuk9
12,420,569 *015306ABFA06EF5BDB5981CC7813C5B78DAE1F6D allaklek6
12,420,570 *015FC8DEC89A12D0487485DF3E606C5D982846F4 Allamaoh7
12,420,571 *015C49A523A8BE2135881FDEB490BFD6C93B0B26 allamaprabhu
12,420,572 *01572B3FF86BCBD44A6EF437BFED2DA2FB2D6CE0 Allamaup8
12,420,573 *0151310D42D65FDF645EAD3A3EA8230565026ED3 államférfiút
12,420,574 *015FA3C47AFA14E0D56913AB63D2E1FCE3E4C107 allammos7
12,420,575 *0154ED7E2123891BEAEFEF0314B8A23E658C2305 Allamort2
12,420,576 *0158066339C68E631DB6A05293BF795846073BD8 Allamous7
12,420,577 *015AA712C9BFA4C40E259BC86C3F90519C7B0876 államszövetséghez
12,420,578 *015D695C172B76DBCAE0B61B220A5BF957EA07D9 allan.began
12,420,579 *015C6939FE6AE188A3DE86071A8A15D0D0849439 allan.berns
12,420,580 *01546D8D3F52F546E31F843BD451984DCE7F5473 allan.burlando
12,420,581 *015A76F0E7E87EF9B3FA52784BF0C9482DB16A38 allan.conner
12,420,582 *015F1244F870F449064CB14A6D46300A6D205E00 allan.debois
12,420,583 *015518151AA6DA3A18944B5843CA6341950DB2C7 allan.depeyster
12,420,584 *015137B1BF623EF7B30F4C6B314454C4403020EB allan.fontecchio
12,420,585 *0151EA659743393C128F445E31A4169EDC12C2B9 allanforeman
12,420,586 *01522A93C88F0DA1E6E4E00B1880C9BECB017133 allan.franculli
12,420,587 *01555F44D8584C66849826F03999454F6339F5C9 allan.joly
12,420,588 *01594A836E303B9796DBF9FDAB8EEE08D8DED7AC allan.kirscht
12,420,589 *015A54E6BB9A7AAABD460F6423E7F37C93E3F43A allan.lauffer
12,420,590 *015EC29D0ECB52CBB6D1EA03E5F620C0229E65D5 allan.maler
12,420,591 *01512078E9C0C8A65284F16B72DFB2098F29D33D allan.rathmell
12,420,592 *01534B50FC30B0EDAE47B0571D33DE222EA0359F allan.reckleben
12,420,593 *01564C5FC0F4D4B1FD0A92077926C51624173276 allan.sexson
12,420,594 *0155CBA3B76EC991F7213540C8B72A4EF48B2D92 allan.skow
12,420,595 *015435E25E77810B98FB44ED997B0619906B7DEB allant!
12,420,596 *01511A68D227AC0EFF75F8F7EDD97D81C4FCB828 Allantoiini
12,420,597 *015251D7A22AC78444234E08DD8DEBC5D2B09521 allan.toline
12,420,598 *015AC7331F32170AE76FE00AE2C84C7651F78E11 Allantoma
12,420,599 *0152ED0125E4AD2C2FA578077341BDCA56E30137 Allanujs3
12,420,600 *015AD9A49559B446EE18B48AF517D0F4CF357B45 allan.warila
12,420,601 *015F20467AD32DF918AADA4CF00E0DD69EA0D5A3 allan-williams
12,420,602 *015A56A7F7EBE44FB35B8741936C30567BF2DE3E allan.zwolski
12,420,603 *01562488BE0226FE1F135682CBCF2F8C20FDE4D9 állapotaikban
12,420,604 *015DB8B1DF4E171BAE3D173FF744C9996D6D9462 allarine5
12,420,605 *015D1003B5615A70E98708BD69C4DC60900B7B90 ALLARMAVO!
12,420,606 *0152695D749955C1EF68A51BD54F78E01CCA7438 ALLASKA
12,420,607 *015D8E7F265064A0E973AD184FBC74070BD4E140 all’assurdo
12,420,608 *0154DF6D0A0903ACEFF4ED03ABBE6C5884680E74 állatartásról
12,420,609 *0150907DD7754E71418686D3C2533D0AF7E549C1 Allauured
12,420,610 *0157E3CE500CC97AFF79B21E379EFD5664D6A2F1 Allavággi
12,420,611 *0152C85F7C9AB033DBF1A33370EE21C2652E60BE allavata7
12,420,612 *0158E9791D3DB1C4744D3BDE62A4DB41ED5CF601 allavo
12,420,613 *015ADBC23E50781F4CDB9B80C47E27C81FE4DF0F allavuts3
12,420,614 *0153150715279DDEF12F0E155900DBCD954FDE9A Allaxoy2
12,420,615 *0150FB059C09A4F7A121D36735F80056F518BABF All.d
12,420,616 *015C815CEF85D2CA3176586338B4AB02B8CB2729 ALL-DADE
12,420,617 *015860E6B6BA0B711CD8F751D39D4D508FC3B327 alldolls2
12,420,618 *015668C3A948C5472BBBE166ADDA2F44CA3A5CB8 Alleanze1
12,420,619 *0157BB790B258071971FECB3A210EB77061800F7 alleauracrachesurdali
12,420,620 *0152198ECF151AE54E132D4C36621A11624C79C0 allebara8
12,420,621 *01510A03FE57889CC934F6C12FFD5CBC68D1AE35 allecna1
12,420,622 *01598F559D633B0247DE93FFFE3918025BA1AE9C allecsa5
12,420,623 *015BFA3C0840B1C2976DEEBE4CA353BCCAF2577F allegationscough
12,420,624 *015E35697EC90D838FDE9EC9C0335827EC477534 ALLE'GERA
12,420,625 *01552827B20A86BF50CF208D54736793BE12BF5A alleghanyhigh
12,420,626 *01581971393333872FC13F43A064F19BA9C26E30 Allegiezs1
12,420,627 *0159E6EF858488AC6930A21861FF39354E4B0A5B allegorical
12,420,628 *0151BC4156C59C3858B97898367AC5B7F705F14C Allegrocls
12,420,629 *015587AF0BCD521FD7CD8E2F79A8E02E4F052E75 Allelisms0
12,420,630 *01599EB2654C05F3796AF6929A719D3FAED0E102 Allemüllen
12,420,631 *0153C61113FC55CF613DC79860AA8500F93B8169 allen.barcliff
12,420,632 *015E9C550166B511A4B15ACB349D82F78C3D83A7 allenbarcus
12,420,633 *01576DCF4548EED934C69B37087FA0475710417B allen.beyers
12,420,634 *015E849B44E3FDC3EBCCE1D5A775DE452855AE87 allen.brez
12,420,635 *0155F346887D45DC2DAF0841D8BEFED399B0D483 allen.buschur
12,420,636 *015AD785581E6FBF932BB6BE388A187E86FBBAFF àllencontre
12,420,637 *0156324103610606C7D2E7A8945ADC598FEC3CC6 allen.cronoble
12,420,638 *01590DD157777A080D54CF741C87A05B7A7F5AEE allen.dickhaut
12,420,639 *0150A8DE2F47DB6C4769DA9E692B338903CB0846 [email protected]
12,420,640 *015E1A03073D15CAF8FEE4063CEE97CBE6836339 allen.giasson
12,420,641 *015B6D37C0AAC446AEA0831ACFAD1255D4F3A620 al.lenigan
12,420,642 *015628EA0897557E3347C3CB2211FACA85B3C99E allen letcher
12,420,643 *01599807C61E9498931BEA87CEED6AAD954A210C [email protected]
12,420,644 *015C49E4C70C8F3AB97CB57E96E54101D0711049 allen.markunas
12,420,645 *015C880ED6B954646D7BE4A96794099F8F3D9696 allenmarrow
12,420,646 *015DDC5FC6451C1E0347797FDECDF8125700BBB0 ALLENMARVE
12,420,647 *015989C4699CB001C7AEFDAC76A30B66D289A0E7 allen.massengale
12,420,648 *0158CD00D106AD10799A5D1AF870510C101B5BF6 allenmoir
12,420,649 *015BFEBACE562E6B1676711947AD5620DD2F7AD4 allen.nebred
12,420,650 *015E7F7B11A45D9A1CB5D9A19A4F6318484CAB88 allenpauled
12,420,651 *015348C72B5D50879A8D87DD55DC1FB8F3F33ED8 allen.pavolini
12,420,652 *015A0CC8E3DE540A208C9A54217E632B9EFA6540 allen.penaz
12,420,653 *015E18FCA0578BB633D43CEA1405E2D3D582A43E allen.postert
12,420,654 *015F7A7B5C975EA1664E945FC2E3AE0CEBD0C122 allen.rakich
12,420,655 *0153A25F3B80BA05B740FF1BC0B47A314BDCCC5A allen.riedle
12,420,656 *015DC86EF800F368CF1B80B3E71C306B23242AEC allen.riviere
12,420,657 *015BF82F623D6E477C9DB8239FF3F34778783A6B allen.sandstedt
12,420,658 *015A740E8904973D4D02B8EC3CEF6E4532521945 allen.stieglitz
12,420,659 *015395985E60B9C7F0A1907AEA47D49534FE3CAD allen.troncoso
12,420,660 *0158F053C9325323A8AEBD54393846C17469F7F5 allen.vandenbos
12,420,661 *0152106DDA3F565B76C1AD6A86CA0035F97C5B54 allen.zamzam
12,420,662 *015193E80115E8EB8EFD041AE85C75DE60C21966 alleraak0
12,420,663 *0154172FB697C95F23F62D3D4EA537A348F0F972 alleraardigste9
12,420,664 *0151E15A498F1FA1D32530F0233129110050F892 Allerabm5
12,420,665 *015BDAA3B873D7CF48AEFBFF54061244AD609396 [email protected]
12,420,666 *01537DC62682F91AEC8616707A75D4B319AA2F2F allerere4
12,420,667 *0159B4E4428C542B5C2404BEC54B537A43D3DA73 Allergik1
12,420,668 *0158B855FC1AF21980737DCBF4E4508EA2BF2100 „allerhof“
12,420,669 *015233E7580AD131CF565E3C40CAB280CF22EF97 Allerjongste
12,420,670 *01572D82A23DADFD80F3D0E01615BC556D1422FB allerweltstag
12,420,671 *01574205D14996A28EAE677882E0F45014FAF92E alleskur6
12,420,672 *0157A91B9078EB7C21CBC0587ECE6A318EC10BBF allesoverballen
12,420,673 *0156B786514FF670BB85215970624441FC7A63A2 alleycat33
12,420,674 *015CDB18794D2DF50B667992BF707E0ECC9D9CF5 alleynian2
12,420,675 *015FA1DDB4DD147C0138B59F56761C4B87CA24E4 ALLGd
12,420,676 *015FF8C6094AC040D9E46CFED7CEF149A393C51A Allgmeeinplätze
12,420,677 *015931D6A023C613ED591B3B75CA559C48E84EDB Allgütig
12,420,678 *015B74927D64CB4A6EF563BE9BECBA1CF6D8842A AlL-H
12,420,679 *01560796DEC20E65B3B8CA54635169988E2ABE8E all-hallowed /O/l_'h/&/l/oU/d
12,420,680 *0151157A5A7D0965FFEE003DA3A8A8EA2663229A allhopins
12,420,681 *0158E20899ED0AEA6CC54EC437FF01FD35EBCEFC ALLIAMEI
12,420,682 *01595F833EA0F3F805F3F43CD6B7341B85546C8F alliamok3
12,420,683 *015E1BDA2BA2C9DF90093801C21CAC981A6E2DF3 alliancebowl
12,420,684 *0159390D22D76A50E5C96919146109F5E720BF6E allianced8
12,420,685 *0150F50322649AB2480C0AFBE855B2BCCA8E3E13 allianzwappen
12,420,686 *01576EE43596D221D70757879DD9E775CBBBC5A0 allibmaming
12,420,687 *015C96698F3514CD4C9F346F43769ED8D9F3D044 allibos9
12,420,688 *01507111F09469F4F6CBDFF751B2A02518AEB466 allicirD
12,420,689 *01536B06ADBE9589D0C858F8FECC43CCD0D0E8BC Allicsir9
12,420,690 *015537294114965FBAF93182540AD554A1EA16FF Allidauga4
12,420,691 *0157236DD9A07B406A131E35B11C96E53B035C25 allidiscogscdr
12,420,692 *015430542CA60FDF5E442CC45A0DC5DE2D39F3BF ALLIE`12
12,420,693 *015347742358EF80FEFF7F8AAF2AD9A7E4558FCB allie23:roadstat
12,420,694 *015B6038ED32A05768D2CA240F802094ACF11763 Alliedhe
12,420,695 *015D4CA6D926791BCC3C9E32A8EDB5A0A9BCB9F3 ALLIEES4
12,420,696 *01569C2883A1461D044605DCDE492CF38CBC6550 allietx23
12,420,697 *015D66997ED325358C98B4D72A34F22F051DD5C9 alliewilkes
12,420,698 *015B9866C444B577A76757D3BBAAF87631E48E5C alligatorstaarten0
12,420,699 *015E7B32D2C034938CB38E9A9EF51E87D9160C55 alliiepoupey
12,420,700 *0152A2C867519565E973BA633639C082A660E8B2 allilujevou
12,420,701 *015FD103D44B8078FC51D0117CCCAEA03C898377 Allilupi5
12,420,702 *015E3D33EE6997C70A54E18FFA3182778483E462 allimolbbing
12,420,703 *015318E99E2D7CF7F5A1C733CB49F58563D580B4 allimprovvisoset09
12,420,704 *015B178EFEE96000BE4CE7FF60158C81916FEA4B allinclusive1
12,420,705 *0158E2992D97CF9C9341F87BD255B44032CFFD97 allindati4
12,420,706 *015EE8A1CDF9FACF954F2C3B8113C2A7E15C6F0D ALLINDIANS
12,420,707 *0159BEA8B18E8C84888C6B43F76D86503CEEB5A8 ALLINGER AO1 L IH0 NG ER0
12,420,708 *015A5FFF40ABC36DC9375BB0F7E1F1B259CA9A39 allingsed
12,420,709 *0150F3ED60A5A1148D36EF62A1A1E633A8FE87CF allinidd2
12,420,710 *01588A55A32A1945312C12FF92B0F8A6B7B8D7C3 all'iniziodelamorte
12,420,711 *0157E8B16DEA89DC52BCE2599A91DF13788F73A7 AllIntheNameofGod
12,420,712 *01538596D090B08EE6925C4B30FAD588A99CA610 allinwor3
12,420,713 *01570CC05F75D03195AC85EBA6ED98B8EE237431 Allioitr6
12,420,714 *015FA3CACFF0D6C72869FA65D1634195C74051C2 Alliokas8
12,420,715 *01544425A816001633BDFAA467A71D6A96D44778 alliolap1
12,420,716 *01515F5EF77FFF7165235395E4F9746179C4BFB9 alliomuu1
12,420,717 *0156F8FCC18EFA9CC732F693DAEECC9F9E8D70E7 Alliona
12,420,718 *015868B3234F4707BD029A4930C1989A9B9E9DDE Allionip3
12,420,719 *01528E90F8CB4FD3EFF8F3AA3E917D547AFBEFEF alliprapping
12,420,720 *015FCB1B57D132B8E863A0F0E09819CB307715B9 All is Everything (interlude)
12,420,721 *015C9A2B642A2D54DC13E140CB823C797CDF8302 Allison53
12,420,722 *015DC71E20196A55D3DCCC45947842B653FD7AF5 allison apple
12,420,723 *015DB208109A24C062006790450195856AB174A7 allisoncollier
12,420,724 *01521755CB84DCC50B76802ABE0A209C1673B0CB [email protected]
12,420,725 *015756B079CA5DEADB852D11C92D4C5517CC2F61 allisonZ
12,420,726 *01510CA568E09D20B7ABF5B0999FA8E782F1F361 allissacargile
12,420,727 *0159B4519A49BF201176F322EA5DDE534075E443 allisson034
12,420,728 *015AD85BBB6FFEA3EED8CD85A240B337B1FB5158 allistte3
12,420,729 *0154F757852FED840948C8884551D096C3385AE3 állíthatlan
12,420,730 *015D1D64D4728E49F91216A9F97AC5D6DBDEDB63 Alliudaa9
12,420,731 *015BBFD6C6862C509A2CC82083A422A0072DE350 All I've
12,420,732 *01552315DF1EAEABB3EFD2A5326DDD0E1FB4A5B9 allivetn9
12,420,733 *0156523D949C15A00BC4879079E004C36A53EC28 Alliviuhing
12,420,734 *0150AC554299A139C9023A1F99D6B875AB1F14F1 ('All I Wanted Was To Make You') Feel Good
12,420,735 *015153F3979E622BDD1A5FA952B631CA32A271E5 ALLIZOMACEVRESINULAIDDEUQ
12,420,736 *0153CAD9B0F1E85F855EF9BC25B80B765589330D allizomtensmadatropasa
12,420,737 *015D49277E393752E2AD896A206A3099D88689B0 ALLjq
12,420,738 *015A96EA2A3CEDDFF00404849287B9F7D1FA3808 Allkampf7
12,420,739 *015D5EA2C4028557BC337EA2A2D5665A5AB5AA85 alllubedup,nowheretogo
12,420,740 *0158481177907281B774910257819DC6E261115F Allmnlkarens
12,420,741 *01535430BF7196D34D0E9FDDCE2E18038824775C allmosehus
12,420,742 *0158A5EC7C7F6243BED102B609A218E09646E875 All My Love Girl
12,420,743 *0154ABA1CDED22EEC9E79D5A110C9D77FE708F5F AllMyTrials(liveinMilan27-10-1989)
12,420,744 *015B6B0558A106B508ADE02BEAB9012F4E7DE28E A-lLo
12,420,745 *015B4DE534586C1271DB42BE09164A86B859A1A0 ALLOBRIGHT
12,420,746 *0157907DD5792DA3666A836C795BF5DDAAE3BC16 ALLOCOCHICK1
12,420,747 *01579A4054F948F530ADDDFBE4A91FB719932C00 Allocyanine7
12,420,748 *015B17C62FDC96A742DC8FA78E0BF48D5A59AA88 Allodialherrschaft
12,420,749 *0158B89FB6B22E472E21A62AFC9FA82913309660 Alloeo$tr
12,420,750 *01585A8347092BB34AE8C473ED98AD1DB04098AC allofthis(jacobcookremix)
12,420,751 *01586A1DD23C5B3888CCD6C9576A837F587C794A allohiak5
12,420,752 *015FB548D0D9CFCF2E0BAC6A5A214C5C17B0C040 Allolove6
12,420,753 *01567723024BCEF67CFDDBF4F07901380908E0F8 al
12,420,754 *015240EC87C345E39EDCF6D2ED6150E3865913B8 [email protected]
12,420,755 *01593FFDEC25D184488BE25683D9522CC1FAEEAD Alloplasm!
12,420,756 *0152B0301F50B183D80B0BA6499DC27018DFCFDD alloquialism8
12,420,757 *015BD2F70B491D9C8AA029406F6916D878218939 allorakk9
12,420,758 *015AAA5F28BEFBD1AFB5A722A797506361C5DF09 All or Nothing (a) :60
12,420,759 *015CF0A66D40145D0EB995B76E4EDD2796A6A93E allosaurusicon
12,420,760 *015778FC62F9CD006AD5FA084FADFC867A3A85C4 Allothigenous.
12,420,761 *015F4567E68AC5849141CA9DD68A269C5EB8B4E5 allotiphlus
12,420,762 *015A3207FA5E43DFE926DA832E56D32D1083A15B Allotrionymus
12,420,763 *01561D7CEA0B68919D529455AB1EF36396CEDA4F Alloues3
12,420,764 *0156A5B35F7316D3596A982456E308BFAFDDC014 ALLOVERS!
12,420,765 *015D69A67ED47C717D9B96869E266F924A56AB69 allpraisesdue
12,420,766 *015BDFE81C3AE2D6FFDD5EF4A7DD7E4D48BA04CF allpressdavid
12,420,767 *015E8A41B8C099833B0B5724EAA2E2C7324665FA ALlqe
12,420,768 *015431A69443AEED40F6609E0A99E95EC3327E07 allreed
12,420,769 *015878E72BA5818EF9F38A15FE0272116DB1744E ALL-RERUN
12,420,770 *0155AB417A2653637CD63B16A1C0BAFE82A92EDC allroadstofault(liveatnewmusicweek2004)
12,420,771 *0154736E3B77A6DBB9989F6C13C60FDDC52CED46 A
12,420,772 *0157171F0195EB7C23EB33D2EFB94C98155C450D allsokay2
12,420,773 *015EC03F3D366637EDBE60F1FF04C9BFE544E05B allspråket
12,420,774 *0151E1941FBCD08A1BB6F623DAAC67759F5CA6E5 allsympathischen
12,420,775 *0157EE4D046434129D009F2C16FB1CF342CE9771 Alltägliches…
12,420,776 *01580EAB2FC38FE58089696EB27F10A812FD9018 Alltagskennzeichen
12,420,777 *01554956820423EEC68D24D947235E12111D116B allthat65
12,420,778 *015138C7E0DBE06580325C854C02B4B5D8F1D176 all the hits and more (part one)
12,420,779 *01548876437D29A9FD17B4D11C049D50F90877CF All These Years Gone By: Selected Songs, 1986-2001 (disc 1)
12,420,780 *015F9058686B4CA42DE505E548E28D422DDF2C6C Alltiet
12,420,781 *0151C92E41FFC701FF0F1D7E0633E8D73862EABA alltite5
12,420,782 *015F8EDBA54727C673DDBA59B3C0195178BB73EA ALL-TO-ALL
12,420,783 *0151E52D4E9E029DBF598D1AA8590825290CBB19 allt vad jag beg
12,420,784 *015E11B70430459B2C4E69835F29E7520F002571 AlLu8
12,420,785 *0150AE4304A42AE748324AB047A088603FDFBEC8 Allucucing
12,420,786 *0151F7441951F3DDC89D1CF93EA2DF59F0FD5826 Allumaits9
12,420,787 *015BAA09D04C3DE6EA8C4E12FA37936522155672 Allurant4
12,420,788 *015063626F128706B8414008EEBFBD1FA63BA74A allurbe
12,420,789 *015F771A4AA2BD9F5EC6F57CC66748D8D1AD0667 Alluremen75
12,420,790 *01508D4D15CAB262890B9A5411A77A262617C25C alluremnet
12,420,791 *0157D49D8C9E1C5238D9E3612E63C2F740E17B7F allverulegastur
12,420,792 *01585C07C0F63F0026D1FB7A4FFE04E1A1B924C4 allwize
12,420,793 *015A4BE6C7D46B71CBDAC5AF30D844CD840FA1B3 ALLWOOL
12,420,794 *015E13A6B5702D475C22D551A63E1101ADA557F6 AllY?
12,420,795 *015043D02425047A4BD6CEA44D3C08EE15A79F91 allydias4
12,420,796 *01535DDFFAA915534C24A7CFA7070605545800D4 Allyeene3
12,420,797 *0153CA76E96B09DFF4EE9D1548004BCFF2D9A9B4 ALLYGR7
12,420,798 *0159034A18DF4E9D22B057D1DB884640BE7BDB14 allyhpat3
12,420,799 *0159330E4C8C97FFF5489F874E3B3CB4EC6F1728 allyjdy1
12,420,800 *0153CDD01493E84245E1591A3573491DE00ECA14 allysonhenley
12,420,801 *0156A352DE491D44DD419E0C34A677683BC4A8FC [email protected]
12,420,802 *0157E4F4A5A0D49181CDE0AD03CB52EAD33A13EF allzumen5
12,420,803 *0150C6FE54FDC57B21153CE9FC61288E462F547A AL:M=
12,420,804 *01524F9A760EDDE56BD705CADA481DB092E0C366 ALm6e
12,420,805 *015662122C0F47087A35B109EE29262DA8D599F8 almaaalmaa
12,420,806 *01515C7A8E30A7405C2D0A1885287E3A482FDBDB almachabel
12,420,807 *01508ED6406D8ED48FEECC4C9B8C4F19E2A5733B Almadene6
12,420,808 *015E18E54E6D20BE8C5C5F12DCDE18C7CA8BA022 [email protected]
12,420,809 *0152E0253414F1FE49409288FC6B020C1EF0ABE7 almaguire
12,420,810 *015A21BA888074139F87920619B5FF5297151FA0 ALMANACO
12,420,811 *0159DEFD2F579E18C1EA0EB4826BDC77730C359D almanzoLrg
12,420,812 *0151590D66D5EFFD6F8ED94B60495F848F69F40F al.marinas
12,420,813 *015F4D20507601A64D4FE39D8D836A4BE196D7EA almaruth0
12,420,814 *01505545C9A296B18803939DCE3BBCE144888121 almasching
12,420,815 *015E1B767DC33443071109D7B8780D6B34D0BE3F almassof9
12,420,816 *0156483CCC06A2E66682CFCA3C57B9E78831951C al.mcoy
12,420,817 *0157633C2CDB036EE264BB1F0C3600D78C88BB3C ALMEI
12,420,818 *015BA1D7F27ADCC02B8E212F0E237C268AA0AFD0 Almejias
12,420,819 *015B6D49F8E546890C2D6E0814B3F25FBC2B1948 ALMERESTRAND
12,420,820 *0151744AB288184335B0206C3DE27FCEFAF37D4E almeria4u
12,420,821 *0153151FBCEB25FDE918A9E5670BAAC7323474E1 ALMESSES
12,420,822 *0153923FD487A9631583F0CA88244D7B17896B2A almight6
12,420,823 *01596E8FAA0DF245F49F385B0A25D22568C774DA almisión
12,420,824 *015EE99DD488969788CEF470783CA2DFBF41474A AlmLg
12,420,825 *015D2CB4A1939828B7E4C085416ECB268791A766 ALMMH
12,420,826 *0155010AEC446C64E259A5DCC22D7FC25FEE42BA AlmNatFr
12,420,827 *01535A219F6135D34F74ACF5FB7D99EFAB2451BC almorabus
12,420,828 *015C208A44804ECACBE5E01B12878CE5BE7B1267 “almorzando
12,420,829 *015A6220E433AA1FF38DBCEFA2BAB72B19B1EA28 AlmostAccidentalAdventuresofBellandTodd
12,420,830 *015077ABD9CA894BEF9E4AA2EB7290E13E36EF02 ALMOST-ALIVE
12,420,831 *015F0EE17DACBBAD34F50BB6CFA8D58465E223CA ALMOST-DUPLICATE
12,420,832 *015A223B4C89A55CF103CFE16AD66DB55F7A08F7 A_lmP
12,420,833 *015F72D69EF4A104BB91DDD39A27D9AE39B38B1C ALMPANH
12,420,834 *015CC26337A3C2E822FC2409575F870990B7E471 AlM=r
12,420,835 *015D34D62B2349F51F5D1B939924660CF419B679 almsfolks2
12,420,836 *01508DBD096F6021686E04C22819BE209457BC44 almu24
12,420,837 *0158B24BE5AB3A19B7E5CE8AB7A8815AE659A5E9 Almuatiary
12,420,838 *0158A330A846324589FD9E991A40E5FB21D23CE0 almuem
12,420,839 *015206BBD9F60A1ECD27B5C7BF407F172AD9CF19 AL-MUSIQA
12,420,840 *015AF3F3AD553490A6ED41804F3D2B6F8C69694E almuziek2
12,420,841 *015D8086096F5E859661C2FA67648D4767D8E46B ALMWN
12,420,842 *0158481D700E0D8A221FEFA99146AB85F7F951DE ALn?"
12,420,843 *015073646DE29FDD18E51B6CB6E5750F6EE746F6 A/_ln
12,420,844 *0152BBDF2453E83C9A468D27396B3F6C95FB329B [email protected]
12,420,845 *015DC17F1ED75364C398BD6F6046B1D71A9A9D94 AL-NAWASER
12,420,846 *015B0C03A098A9E4F0148D40CDB09172C873972C ALnBH
12,420,847 *015839BB5D1305E1B73F4EDF84ADE299EA5AADE0 ALnck
12,420,848 *015472D78DA921822F2C469A6E91D1C3C4A6ACCD AL:Ne
12,420,849 *015DB383FB74572C74F6C3E2F0615082C46D968A A"lNI
12,420,850 *015CEA2E3C83EDF7C571EFB991C7CE42E8009CCE Aln?I
12,420,851 *015BA0BB54681AF769C31B0352D1351A61E6987B Alni;
12,420,852 *0153D9B691E97706BDF61A73BAEFC9D3BF6E6B6B A#lNK
12,420,853 *015F27268EFE5D4FDD9BF2F8EA6C5607AA1ED273 AlNuo
12,420,854 *01545CEEDA983C23C1B67B5DC0ABD456FEDFDA98 A-!LO
12,420,855 *015A4394599943DF8914B4D515AB5C290A385637 ALO#&
12,420,856 *0156A196C66EB1A823A27BBE3130A9BF9B03ED86 A#
12,420,857 *0154740515FCD83C747230D8A8A1C53DE15DE868 A:lo/
12,420,858 *015BEF0022DB8D0FF3F4A5DE1CA59D29EDDE0A05 Alo(:
12,420,859 *0151B24F4E886B6F766A93633D5968251C37018C ALO2008
12,420,860 *015EF0CC92DF95383915C14E94848D2C81523772 Alo3a
12,420,861 *015FBED36963136665F1F1BBD5F32C8A82F1EE71 ALo3k
12,420,862 *01587F97ABADF6B9CEEECDE89E328D132AB7D407 AlO6
12,420,863 *0157050411F1C3E7EE136304770F9E53FFA69862 ALOC,
12,420,864 *01507A89BC45AECF219B4781BBC1D8B513ADA836 ALO#c
12,420,865 *0158351DF867A63ECA3FC0111C964EB31FD8ECF0 Alodymuses
12,420,866 *01521CF90D06ECDDA10CDED375995509F5681E01 aloes.bbs
12,420,867 *015A50B1ACBAB66E3EFAE880089F309890D22024 ALOHABRITT79
12,420,868 *01508776A3B7558AC5C9D305340EC20E01C6171A Aloha Friday No Work Till Monday
12,420,869 *015C55B82606B1FC9D9E1C89A5A6E445ACAC4C8E alohamaysa
12,420,870 *0157CF115068F5EB0ED61F6A5B3ACF5EA236B9A5 aloigi
12,420,871 *015016B2E4DC41383FEE1AAFD64025986A60B860 aloilgos4
12,420,872 *0156230CC0002AB369262AF2415732F1860E1447 Aloilofing
12,420,873 *0157AF3215F5C538770459E1127DDC42C35EA9CE alois:x:543:1000:Alois
12,420,874 *015A6A330FFC716F096B03371BEF8FE2342F03B3 aloituks3
12,420,875 *015C8D3833DE497472707BAB7A1C27DD99B97A47 Alokkeip8
12,420,876 *01511E7A5D9426FC2A3F32114F1F87073357C4FA A!LoL
12,420,877 *015478E06F0DFABF92225A16649908C5AE4AD670 Alomond4
12,420,878 *0153B834C06462B85AAF364B9C4EAA6FBB1186DE Alondra173
12,420,879 *015F8050B9E8A8E9EC653FA8B9C5C83C7CE6911D Alondra690
12,420,880 *015BF1645875D1D4D18293CEB9AFAE29398F8036 alone094
12,420,881 *015EF51966CF1286BD45FEA415869B7569C36D99 Alone-PartVI
12,420,882 *0157919CEE851AE72862C2EE05FD4C6DEE3A2B3B Alongging0
12,420,883 *0155BE3FE12097312E793D9423BDDC2C9E55FA84 ALONNA08
12,420,884 *015D8BB161661D749BAE6E98F4F618586705873C alonso.aldana
12,420,885 *01532C6F7B84C9FC1CFD55FD0E6BE4E9BE40A438 alonso.allio
12,420,886 *0155C1046529A4B52549041E0B1867560C54ECC3 alonso.bridgette
12,420,887 *015274618B2315ADB7127B192C4895DDD37BDE82 alonso.brucie
12,420,888 *0150A623AA7E6AFC530F4AC1899D43174E3296EA alonso.cansibog
12,420,889 *015A3FF4B55015969FEC4C204346CCF197EE00F4 alonso.ciccone
12,420,890 *015E8CD85E626A32772F9A74D164F2A1DDC4A892 alonso.eatman
12,420,891 *015C6849EB1DFCB8678F77F54ADB95E7040A5459 alonso.fowkes
12,420,892 *015CBE6EE9C7A3774D8DFF2000FD36D4510076EB alonso.gobeille
12,420,893 *0159E0DACCC54C67CD763AB9E4A2C1F2503A7DCB alonso.hochmuth
12,420,894 *015F672E8E69F642B34AD2EA18AA2AC6A6A67C44 alonso.johnting
12,420,895 *015C55B33EC08BFD34BCF28BF50D5FFF069FB0F2 alonso.karls
12,420,896 *0152FDBB1102AF6E31CE7541481264A751C214A3 alonso.lorz
12,420,897 *015157681918379BC0E86448048F2E4AF80847EE alonso.mackle
12,420,898 *01517DBD5F46F53B3EEE0C72D6EFC64B0611A188 alonso.madarang
12,420,899 *015AF1FB0FC27DDBC1EED3E19DA4493C8CFFEEBC alonso.mcguffie
12,420,900 *015C61C3D7FE7F71B74901290291A0FC65CC8DC2 alonso.moorhouse
12,420,901 *015EF053F0D96E6A953C7AF11E33C63BA0371F26 alonso.pallares
12,420,902 *015508556A171CE92708E91DCDF9C6EE65D87B52 alonso.petch
12,420,903 *0152C93F92EEA636ECAE8A7399A0CCE887114462 alonso.pinkerman
12,420,904 *01575A2F722900D24987EA75129F6F584CFC24A3 alonso.savinar
12,420,905 *015D226E20EA11DEBF6DEF7907D75874AA50F597 alonso.schmelzer
12,420,906 *01580FF8DF8FAC95A52189183031CDAC40AB6133 alonso.shrout
12,420,907 *01593BCF99D36A1C5F94C8BFD8E3366B96CE3D66 alonso.simek
12,420,908 *015F859255B514DFCC81A201057C58921FFB14D2 alonso.vierling
12,420,909 *015C7BC6F6B41FB6A4E200B51A94ED5FCEC3AD2E alonweintraub
12,420,910 *0152832EF8BBBF8347603BD7624DC0B955473F15 alonzo.collica
12,420,911 *015E3DAC2D12FE627347B68B1C3131DB8E8566A6 alonzo.cracknell
12,420,912 *015706696CE2A4048CCC26B62936A4B82642A0C0 alonzo.gelinas
12,420,913 *0157F58579BF1B903F923EAA358F5CE836162F15 alonzo.hance
12,420,914 *015E224F21E093E342E4BBBD80DE90F5987BEEAC alonzo.hoeft
12,420,915 *0150E7D23F88FFC95C2A3D05623DE9BCE4245788 [email protected]
12,420,916 *01566BFBDC908641EE67FFF17A932DF919288F08 alonzo.katzen
12,420,917 *01547E3B1F7ACDED5E84398A66C1C1D7936D2A2A alonzo.kernodle
12,420,918 *01595A8AF8127B3AC1099E7CE80BC17BAA2D126D alonzo.kitch
12,420,919 *015F06D6C9FDE8761D57CC616C9CE7A570709A4D alonzo.knaust
12,420,920 *01571262EA4D7617B6F9176D46CCE1895E89BF2C alonzo.kurowski
12,420,921 *015AC246E8429545637EFDF45E5DE58CC6E25208 alonzo.liskai
12,420,922 *01530DF10C650F9878EB1FC7E30D80307C94CB3C alonzo.mansel
12,420,923 *0150C16ACE0587E89449DC499D1703B6F14928FD alonzo.meeter
12,420,924 *0157FB1FACD9CCC221EB7400E17DFAA49FC4A28B alonzo.okray
12,420,925 *015909EEB3AF0EBE33A344261F2A9E4705ADC381 alonzo.pless
12,420,926 *015242F308C46667CDB10CE242C7FB275F83826E alonzo.tugwell
12,420,927 *01533290DCD402783E24348A0A7E246F1235F24D alonzo.zorilla
12,420,928 *015A349C9D3AF747C607B14FA387A6F269295CB8 alonzra3
12,420,929 *0159DA1C70B475264A6CF5D3E6D8D41460154D8C Alootmar9
12,420,930 *015E1B0D80D34CE7195244EC5138FE09FDEB3E9D Aloowhue
12,420,931 *015C4575F08E5FAF2B55762255BE4FE489E15D55 ALOP_
12,420,932 *0153C965D8831D76CBAA1BE4584284A359450E58 Alopecoided
12,420,933 *0156EE1C12B5350B554B271A3C215958AADD3427 Alopomoh2
12,420,934 *015E02460FD8C04FBA7A93E83893893719FFEBA1 ALoqQ
12,420,935 *015C3471E36F61699E6F5DB95A006F1BA7DE37DF aloracot7
12,420,936 *015526951F48DA3D18C7AEF4C7561BA03F0831C2 Aloraets7
12,420,937 *015328FF44A66B1BB9851CC766FD80A264BE0DE4 Alorevir
12,420,938 *0152ED049496109CCF91DB88570ED7A4A140B75D al.ososkie
12,420,939 *0156DDDDEA79BD26EA6C7FD4DB7C46593E7D15A2 alotacs7
12,420,940 *01584961F3081C83940A9B0F9BE5A2B54DD61C3D alotbsols
12,420,941 *015D111E362B0F2D4E5480945D43AAF805167834 alotorra7
12,420,942 *015073B815DF9C24DF01D85E11A5B5A031FB596C alotsip1
12,420,943 *0150577C01D5D795DD648DAE2F1553B1BBD09A78 alouettescest
12,420,944 *01503EDD4F793EB0826EB6F9CAD54FFCB3273183 Alounit5
12,420,945 *01536CA28487061A06C1CA72C36C540659A5E929 Alousious3
12,420,946 *015B5F16D1672962966C36607E527DA9521D7FFB aloviared
12,420,947 *0157C2A8FADB696A8AFF19CDE7961FD8CC2B8F83 A$LP.
12,420,948 *015F31B047E817762DB4F02DE0DEFBA3F668D9CF alp35tral
12,420,949 *0155E4B2209CECFCF46F64153D36CA1FDE0EA533 AlP4e
12,420,950 *015763071B3F13D9C4FCEEFF960BD85C87DDBB36 AlP6k
12,420,951 *0158C8B5EC87C02AF5346A6012516B8BC82C0710 alpacca1
12,420,952 *015C7EE7A3131D4ACE7AB37671804FD6C48323A0 Alpdfooh8
12,420,953 *0153A6665E9EC2058D13026C404D4D720A8EA76B AlP)e
12,420,954 *01564EAE19F13B10A9A6C5ABE5BAAE9054B18EF6 alpenae
12,420,955 *015C1CF8B72B570B467B5756F58D142922817092 al
12,420,956 *015CE944F629742B9A026DFE46971225ACFA44B7 alperses5
12,420,957 *0159D674D6F55E94CFA216929771A8F8BE461CAD ALP:g
12,420,958 *0155C54AA1E35A96189ED2135A9A119CA4876153 ALPgi
12,420,959 *01567DA30C7362CB351218034C33E964F693E020 alpglaĉeroj
12,420,960 *015AD04A7391A8B58D333A2DA32C33A1C8F11D31 alpha1^
12,420,961 *0153B2ACC8227BE2EFD7C75ED96F3135F801DF41 Alpha1america
12,420,962 *01555E438BFD5F32511C64734EF1BD206F0ED7E7 alpha60.dewww
12,420,963 *015C6520A975A689E43193A088670F4E68645030 ALPHABOOBOO
12,420,964 *0154BEC484248E0DF0A2D7F6815488C924DB38E4 Alpha in Flight (Sound FX)
12,420,965 *0152E4F7592E9D4FBCB29CA304472B1ECCA22634 alphanaphthylgroup
12,420,966 *0151579AA9EBC953F57B28ADB973F47F79E338C0 Alphaplayers
12,420,967 *01525DE61AB3F80A2AB8FB3CA8FA1B28A34F7127 alphaspherekonzept
12,420,968 *015472CA6F50D415DE07ABF7443C4C08BC1D4788 alphesiboea2
12,420,969 *0159A44D800AD2F099F420F7AE565F7FA781EE07 alphonse.ardis
12,420,970 *01539ABD46AA924A21307C4A60F07E25A47841DF alphonse.bobseine
12,420,971 *015B94B0478BD7257FAEAD4D9F4D230F0AA21AAD alphonse.brewton
12,420,972 *015AA27230744AB2FD997B132874AF41D01CF6C0 alphonse.diedricks
12,420,973 *0155E9B77DC37E6BA368174C1E8D1979BB1713AD alphonse.dippolito
12,420,974 *0151CC4DD9BAAAA027F452A66269CC14793D4F58 alphonse.dubicki
12,420,975 *015CC4154EB22B472B6D49218A84A14DBD423A6E alphonse.elpert
12,420,976 *0152B67C5B280A06F3C7E75A77DCB7FCE5B18F5A alphonse.fogelman
12,420,977 *01510F5E40E46D586826F4D551DAEC5BB011A297 alphonse.frenner
12,420,978 *01581D6B9B832BAEACA0D14D0177E4C2E940C569 alphonse.giuliani
12,420,979 *0154846C73FCCE3A2EEAE17A1792A4ED37A8CC0B alphonse.guelff
12,420,980 *015D8348FA224E7A08181F426FDB530AA1E96682 alphonse.halt
12,420,981 *015C2D9D8191A4A282BED16CE3FB94257D8038F8 alphonse.hibdon
12,420,982 *0156DBEBD224D5E348603E83E6A274CD20ACF91D alphonse.honza
12,420,983 *015C145A608AF94D8929224AFA0D8F7080C59741 alphonse.kalk
12,420,984 *0154DABE4AEE80620AA01AF4EB1F90F158080ED7 alphonse.kind
12,420,985 *01571C6C2B11E543D638E87D447C804E33531572 alphonse.makel
12,420,986 *015D934B4B4EEF3D49EE3C5A5E3B3DFA300863F2 alphonse.meighan
12,420,987 *0153A1DEB2E60095A2D8535B9A3B5C6049110991 alphonse.methvin
12,420,988 *015ED12CDC129AD3947113E8B000FA912E3D9791 alphonse.neborak
12,420,989 *01534E0B557373C2466656046B399D4B0E00FF52 alphonse.nunno
12,420,990 *015ABED3BF3EAC287971FD46A5536ADAC217CD52 alphonse.oshields
12,420,991 *0151486643EA9A10BA13B5C2D662A419884A3678 alphonse.reimold
12,420,992 *01517F92669D07049343484DC1212BE40906D4B3 alphonse.romanello
12,420,993 *015AAE15DFBE2BB306C3DF59080AA1262E52AD03 alphonse.stothart
12,420,994 *01541F97296DF62A598C1B4A3D75E298CD252A53 alphonse.vandenbos
12,420,995 *015A3A0D1B40C8AE863B564247C04E8BCBE7CCFC alphonse.victorian
12,420,996 *01596B490DBCF16994030F5CBAB947A8B3226779 alphonse.wilke
12,420,997 *01582F7DB3FDEF1DA56565F04B39FF82627A4714 alphonso.aspinwall
12,420,998 *015D2547BFE1AD898F9FB4F07B39CDFED871ABF7 alphonso.berrien
12,420,999 *0158BD6F62FF4B26527406A04D374378635BCCFA alphonso.broudy
12,421,000 *0154A2FAC87995622112D6CB4C15901BEB40E3C9 alphonso.cary
12,421,001 *015517FE11D152E3C69A47F8FABC349E7EF414FE alphonso.dallen
12,421,002 *015D6DFD79BE416E3324CE5B4FCBD4004338919C alphonso.foard
12,421,003 *015FD7DDE04E25D1B800F13F3FC6049850FBAACA alphonso.giedlin
12,421,004 *01522AB7982A9A7573F8B80AD38225EB6F2B99A4 alphonso.goetzke
12,421,005 *015B9FCB7E111682DA4B85134AE3D7617AA463E7 alphonso.graft
12,421,006 *0151121EF500C20B94D4535568B75EFF5F698D0E alphonso.jaenicke
12,421,007 *0157D68F5AE5B90197D62FA9EFE380FA0C0DBE1C alphonso.klitsch
12,421,008 *015FAB6D58886F286B75E2905930F681BA0E3F17 alphonso.krupski
12,421,009 *01505ACAB786BC4ADE59350344AEF027F95DEC89 alphonso.ogles
12,421,010 *015CC26AD60BFD3267582BB95BA5BAF5E9FF4484 alphonso.pfleider
12,421,011 *015349CFAD3F4FFF90644090868581678F3EB655 alphonso.povey
12,421,012 *0154F7A015BD15928B7666629C307229EE6A1A5F alphonso.rusch
12,421,013 *015C98395E9B0EB7E68EFD518BF81959D707D82C alphonso.treat
12,421,014 *0157B03D97C4A518DC78E7168BBB762CC6A77FA4 AlPHT
12,421,015 *015AC9FE57142D2FB2E81FB08CD654FDA66323A3 alpine0106
12,421,016 *0158533E1EAD25D4ACFCACE4442B1214380F47BB Alpinefrogs
12,421,017 *0152BC27100C5E27204A9DCF3CE7DCE6A0173384 ALPINESWIFT
12,421,018 *015F7E1772B2205D8FF4F4146130DAD28332E03A alpinistákkal
12,421,019 *0153E96D21535168A54CF00209265F39C3137FDC Alpistela9
12,421,020 *015740E564BFCB8B2C7E9AD725E362C4A1125FAA Alpisteling
12,421,021 *0158C88342A60BE53E4EFFEEDD98EAC57CD1682E AlP)j
12,421,022 *015E90B30729CDE47F68FE4E370875A8DAC984FA ALp)M
12,421,023 *0155C97F1234A21326CE8BDFB210BAA67BBB564E Alpmv
12,421,024 *01569791F342F04A941C32146F2A0ABAE284762E ALPnB
12,421,025 *01584B5353221873ECD2663B553E0763166D1D2E AlpNS
12,421,026 *015BC23DBC3F2F16D3CAEBA850FFAE0B8EA2F76B alpoemoh8
12,421,027 *015CD0012F49492C2F3D25ACCA4F3BAC6824726A alpomret9
12,421,028 *0154F2DD115B8A75A0A049DC12A50D9C428BFF50 ALpoP
12,421,029 *01578F38895D3943BC9812D5B72F89A201490BDA Al popolo di Parma
12,421,030 *015241AF046958F188336277E66A8194D94AA96B A_LPr
12,421,031 *015643AEDCAE5BAC4CB5CD63E3FE145712999E4F ALPSAYS
12,421,032 *0151CF220563439D89B8214CDAB0E64852CFCEC6 AlPV#
12,421,033 *015DD0D7DDC9CCF46B0B2479E0F3B1BED8BDC9A8 ALPw)
12,421,034 *015F6C03C851FED0CD1921A0FDE4C115CD32AA17 AlPX-
12,421,035 *01519BF20130B6F9BA6FD95EF32A2103F1F49596 AL)PZ
12,421,036 *015DBE6CFEDF9B8BD0247FA33FC4890D860B53FC A-:LQ
12,421,037 *015EFEDF3326FC61EF1AD5237F59E69DFB0892E4 ALq(8
12,421,038 *0154BE31E32A716E769796FEE195A0E01A6B2A76 al-qarara
12,421,039 *015AA06E87939AB00B89DD2DF8C31D0CC50EC695 ALqB7
12,421,040 *01516612603ECDD265438384FED2BBDF7AE8BB8C [email protected]
12,421,041 *015DD8A3C8DD2C710634B6C16F8B0F536EF88B1B alqcwaaaalaccaj
12,421,042 *01503E638A98883A9A376D3177E3F14D722E835B A_LQD
12,421,043 *015EA5F092BCA782FBA223AA53CB68DBCEA42D95 ALQHZ
12,421,044 *015DDF80BE26B20682CA7E04D57F14D9A4531CAA ALq&L
12,421,045 *015BB3E4C2BCF1CB84BBA0CAD049FCD2BC4876A7 ALqMK
12,421,046 *015403C41CD4363BF2E6113C294BB4B8A8945056 ALqQG
12,421,047 *0158D475C75876F501F9676B8E6DE2F7C745BF4C (alqualondë),城內的宮殿由珍珠構成。天然的弧形岩石港口,寶石散落在海灘上。
12,421,048 *0156C12AA6BE609804B5EE3D052D48ED6F418BF4 ALQUg
12,421,049 *0150FCC276AA7E3CFD173123C4E3A64079C613BA ALqWp
12,421,050 *015057F1D0E8DA97957E6B3E110D91D7DA7EA87C ALR+,
12,421,051 *015172FC7D5BC634B0A70018CF2C955FC4AC22EB AL!(r
12,421,052 *0156B2C92BB8DFA98B43E3E9E8F7CB3D6FE536FB AL(,r
12,421,053 *01596AEB58114DA4751D8EAA6F5F5A388C57A5E2 Al:R?
12,421,054 *0157C2537A6AF0F1C367A5C7DD0A3C032E223664 Alr%/
12,421,055 *0155DDC755A21846F399098942AFCFFA126EFE86 A&lR4
12,421,056 *0150571AC21D6886BDB46C6E72A6C3947AFEEF44 alrartir
12,421,057 *0154ED68FC50DF309CC6BC40B5CCB66912303656 alra’s
12,421,058 *015CF2DFA86D3FA5A1B7F301BAD8BF5017F49722 ALRDG
12,421,059 *0155302CFFA89D430E80F73CEA63851D7E58812F ALrE3
12,421,060 *015040CFFCDB5F87E5A956784F6666D3FFDCEFA9 [email protected]#[email protected]#[email protected]#[email protected]#
12,421,061 *01536273DDA5E589E4A0576B427D8D607F4610BC ALREADYDEAD
12,421,062 *0150E0D8EFDDC02BA053743BC87213F079366AFB alreadyes
12,421,063 *0156D64AFAAAA95F5E96B334B3BC53F37722F997 [email protected]
12,421,064 *0159A957785178320F1FDBCCE5B2CEB014AF0265 Alrepooc2
12,421,065 *01540195AC8F34277A9B86B06E456CEE05ADC4EB al.ridderhoff
12,421,066 *0151E409A83E782B0B0FC3804250F88813D0B36F AL-RIFAIYAH
12,421,067 *015D1496C643EC1B2A4BE2FCC643C03E517A8955 ALrj.
12,421,068 *015C15BCD7A6EC3664519B1BF21F28686AD4ED44 ALrLN
12,421,069 *015242C1496CCAA301B39A785B5EF5AE6EB4859F AlRq,
12,421,070 *015E411EB9D22A05136E880FC144B58773EE4840 ALRrO
12,421,071 *015941D579865485F84038F7D52886EC63E5D1D4 ALr;U
12,421,072 *0151E11051D5D46AB734265BA607725038173133 alruvisu
12,421,073 *0154140B3067B349D9B3D384931F92385C0D2FF0 A%=Ls
12,421,074 *0155D0AC768CB5C9CBCB59FE43912C1EB04292F1 Als1b
12,421,075 *015881DF8BA4E046805E17F00151A283546833D8 A(lsA
12,421,076 *01546A5035E9D5FE6CF1230D8BB86767D2585D8A al.saxena
12,421,077 *015456531CB82A6E9157E2124DF92B03D2BBF74A alsaziani8
12,421,078 *01537605BA6501E964C3D9BF42DED8B986300393 Alsb1
12,421,079 *0155E74319C8AC7A10F369BD3F110CB1AAA6B6E5 Alscript6
12,421,080 *0151F58DAEEF15670F0DE72965979763143011E6 alsen estrella
12,421,081 *015477F282B327674025E4DA3F2B97C1A74120ED alsenet2
12,421,082 *01532487051C1755A5F92C3A13074B085E90D07A AlSG#
12,421,083 *01596D2BB336E8B25823A4E4BA4805E379F42253 alsherry8
12,421,084 *01525D3E434E90946AB59895D0B2DA144B8B2240 ALSINA3785
12,421,085 *015A81865A997AA28944DFBB6BB12A7C42E43F11 AL-SINOUSI
12,421,086 *01533071EC11D077CDC5A7550D42AAB1831FECCB alskreet8
12,421,087 *01545413644ED67C42300E8A784E2EF00F6DF827 ALSLb
12,421,088 *015B8F496BC94EFF16ECB3457711BDC69164FA19 Alsleben——阿尔斯勒本
12,421,089 *0155098678BE61E36943601122D46EFC6C155041 [email protected]
12,421,090 *015F5FB1435C4392D8EC742D2A8C78C1D9421604 AL)So
12,421,091 *015D1BCC778F073C638247D9CFB713E551ADA565 alsogut
12,421,092 *0154F0AAC2AF01497FD82D8D9460D93526085102 alsoncr
12,421,093 *0156574372945D3BE2758AD094DAFE39F7A89ACC AlsosprachZarathustra,op.30;7DerGenesende
12,421,094 *015EA74ADE448D365AD4CCDE08CF93B306AB7AC7 also sprach zarathustra: viii. das tanzlied
12,421,095 *01568A5AB97B5CE188BC807F65B4BA932603C5EA âlsou
12,421,096 *01563D2A662C849FD978B50B27A6E245B994D7A0 alšovka
12,421,097 *01538C20358FD9709F37A52604E9C5468B01CBD0 A.LsP
12,421,098 *0153D79E5ECEF59457E638B60660A030260D970C AlS_Q
12,421,099 *015263F31B700ED15B65B5408263C9F00B8D3E43 [email protected]
12,421,100 *0151B2A468533885972965031CD58670D20412F1 ALsV)
12,421,101 *015E80D67DF424FBA3AAE83ED95F781097E32608 ALSYDYYP
12,421,102 *015D384D0AC200E53FF5E4FF2B5EA0D24E740461 als患者さんを励ます会
12,421,103 *015307DC938C0C1221FA1095E842EDE5DEB6A7C8 A=_LT
12,421,104 *0159B9AA4DC3E9D51584F57EFF8C6692A821AD11 AL._T
12,421,105 *01507BC869A038816AD83089ED2DC8B23486DD4A AL#T&
12,421,106 *01517B51E17FF1F031BABE62EA84410675C92071 A:+lt
12,421,107 *015F359FA5AF60D61EFB1264BA06BFF1F7FC76A3 AL-TADBIR TRADE & MARKETING ESTABLISHMENT | SAUDI ARABIA
12,421,108 *015EDCC9BD63EAF10F91A25168B78BE05C0806F1 $altai
12,421,109 *01524F1EEF95120C134CE902E1A01450877F7C45 Altaiophyllum
12,421,110 *015D29939ED866562252531D717F0C11A8C907EB altair680kit
12,421,111 *015FADA8B0942D8E6C1EB56511E430EE14E3412D Altaitas
12,421,112 *015376C897A1A7C6318503F725265A1E2D3A01E2 általmozgat
12,421,113 *015C18F96D3AE60DD2E57018A21C6B816B2CDFCA altamaha8
12,421,114 *015FBEC94EDAE77FB7FDA79B7B85A54AE3B362FC altamira33
12,421,115 *015753B4A5FAE91052E3F2F30817F115E550D17F altamodal4u
12,421,116 *0152C7B68078871C6C52D817C926944CAD63FE72 altarofpain
12,421,117 *01505C25414915C1887BA8051F332CE9C535B7BB AL-TA'WIL
12,421,118 *01591A9F7024777CAFA10008F837E3C43C41876E Altbauvolumen
12,421,119 *01589214CD0C61A0C2D43CEACB37EE87D4252CCB altburmesisch
12,421,120 *0157DE9CEC897E543BB7378C754DF59EE2277AAC Altbüßer
12,421,121 *015C556B9EFFACBF7A1F2FEB930F037EB00A71D3 AlTC9
12,421,122 *015ADEF757876E980B5839EAF988284731A82C0B Al-tE
12,421,123 *01533BE4613566B26DBE1DC2BB6039D02C8C6867 al.teakell
12,421,124 *01579F2483F34694215897A073973067FD5F662F „Altena“
12,421,125 *01501E1B3B24FE16E8EA3721BA7EF0A5FE887B44 Altenburgera
12,421,126 *01575969067CD06E50592546F1F7BE5B03AE2EBF altener
12,421,127 *015ADFA4324FFCA53176449576033C947C7E823A altenklub7
12,421,128 *015C46CE50B2D6973471B3E370871C01C0A9B259 Alteriumed
12,421,129 *0158ABD6B8CA9984EA8E3F0AE9C0D8522944F84A alterkodo7
12,421,130 *0159D99E1BE039BCB8D09DFC94232901F9417C96 „Alternate
12,421,131 *0158A8492095E04DE6F9B26C34E68351B0D886FC Alternatiivseid
12,421,132 *015F49654CC322BE1AC77BDE226AA9288881986F ALTERNATIVEADD
12,421,133 *015DE395EC09DF28726BD562B86F6F1D49CAB601 Alternativerne?
12,421,134 *015BF40AB8D1CFDB3AB29B2891B405EE51DF1A5F [email protected]
12,421,135 *0153DA42E3E7BE6A7552A301A2A126648CFB66CA Alternativunterricht
12,421,136 *01573A5C5EB797CDAC94B3031933E9EDD464D84A ALTERNERA2
12,421,137 *01591D8124DE850A2DAC5DC2E97531E64EA986E2 Alternions
12,421,138 *01515336DE4B993BD7A3E3CB0C0F8FB892E202A2 Altersbeihilfen
12,421,139 *01545BF9048950EAD1792B7FE8CD64D171BDACD8 Alte Zeiten
12,421,140 *01526691BAE6681E23BA463C74DF9A11D8A51BDB altf4.bbs
12,421,141 *015746A60B7BF75F85DE18C8DB27DEA4E80C8002 Altgestein
12,421,142 *015A71578F2950BA91ED5F8AE2E21FF4AD8CD1F0 a.l.the
12,421,143 *01564AC537480F8E631FA52078117302B12EBD8C althia sinclair
12,421,144 *015DAC3C9BEDB2177E54B6C65417D4FC075DDDB0 ALTIMETERS0
12,421,145 *01550A9273CCF799EF56FEBE83791DFD193460E8 alt="Ing
12,421,146 *0156D375434DCA37EDF91DE074B0A6A123CADA33 altitudional
12,421,147 *0152B25278BD6F8E6D8B53844A42C1B7DF983C4D Altju
12,421,148 *015D1204082CE907B2B67968B29E39FB5FA80D0E ALtlh
12,421,149 *015336A2DB0D019D6388604DA54FF2ADA61FB032 Altlußheimem
12,421,150 *015FAEFB67368B92C509330C84D92C1CF0268DD5 ALt:m
12,421,151 *015657D18E0FEB0A2E299F47000B1A8045867BAA altmangillian
12,421,152 *01503D6119E34E44B968585EDCF99DF53F2D0C32 altman-lecture
12,421,153 *015ABC0A19C6EA4FFACB261A581A50B7084FC10A alt="Neil
12,421,154 *01564D0542EF8A6522C36193AEAAB98CDA02DD2C Altoale
12,421,155 *015EAEA0B0DB0B9398F22F301AE1CE44F40EAD39 Altona–
12,421,156 *01551F4A1C898163935240129A85F09CFA243BE7 alton.bairam
12,421,157 *015FA7144F065A1CAE608CDEA147FAD4311C3BAC alton.barasch
12,421,158 *015BE34497DF1C153394FB0EB9937EA457325285 alton.bisso
12,421,159 *0159078BEE62690A8A97539019D211724AB491A0 alton.cowart
12,421,160 *015D2103055064593E1C0CE57F394630B8D037CF alton.deaguiar
12,421,161 *015D83B3F08E2EC4741626EAB89BEE66DA1D0E84 alton.dinovo
12,421,162 *0152F8B0F7D90AAF958CEA5ABBA6DE5E31AEA327 alton.giarraputo
12,421,163 *015911C62D4EAA53AD2245EEA5B512284E51996A alton.guittennez
12,421,164 *01590099EFF2DFACA28B6F3F361BD36C73982E7D Altonia3
12,421,165 *0154BB79DDAA5FF26E86C6BFDE63992D4B4AABB7 alton.kinsland
12,421,166 *015A955BAC5A0ACCD8EAAF725E84D60A9B6FAE64 alton.kizer
12,421,167 *015BCDC0CB0895EAEFD1ED4C4A7E3172A1A86460 alton.lariosa
12,421,168 *015F74627BEEE95158958A27FE5D4D824726E7E1 alton.linford
12,421,169 *01538BA8F5E65DE7923C7EB6773364B0BF2A933D alton.loperfido
12,421,170 *0157E5531AA6A750049146676E5C8ACDF85B68A6 alton.purkey
12,421,171 *015BD00ECE6D5EAAFC74D1CCA2E7B8EF3946F1C1 alton.sheikh
12,421,172 *01533211F580DDC4386928E59375369DE55F70B5 alton.stonebraker
12,421,173 *015E39DD9CB4DF8E888F22652D8EE0C8C7AD3F6B alton.weikal
12,421,174 *0154E29E4D05F33783695EE1DF187B78E024729B alton.wengreen
12,421,175 *0158219E8D5F93348D968A771D0EA1722FF69E62 alton.wiggins
12,421,176 *015BC2CDBE0206196FFAC289D2E1A871C76E3B61 alton.woldt
12,421,177 *0152AB03AF211A1D21D77BC08F38F86D7BA10E47 ALTOROVER
12,421,178 *015D3F3EEE9B8B7E0708A1C713DD1877C54885C0 ALTOSAX3
12,421,179 *01586D8E2083429F5CA355D05A3D2E11C41A3628 alt="P
12,421,180 *015A9B71AFE3314BED575065F663BE8C3A03305C ALTr-
12,421,181 *0158B2168244C6B70C1F60E1DFD4BA2693B90788 Alt.soc.balkan
12,421,182 *0157B7E18AF7AE7B764B2776BC5D34D88C836BE9 Altstatt9
12,421,183 *015DA6B1D06521A6DFB609B491E18E02B3CA285C alttari123
12,421,184 *015C853403D9AA5D9B3126AD1530BBE6D5225606 altunmaro
12,421,185 *015B1751E7D9A238DBC13233FCD7B81978516376 ALTURE5
12,421,186 *0158EE18E6C9B0F3824490DEE71DEAEC964F06BA A-LtV
12,421,187 *01501F14BBC53AC2B162C41EDD6B748BCD03242D ALTVORDEREM
12,421,188 *0156B97763394A2ADD03D1A7983DAEFB0D35140C altvyters
12,421,189 *015E572FBF1612B7E6F9954969AE73A7DC4BE892 A&L$U
12,421,190 *015787A87803F6C803DBFFC7234601821A3334DF A$%Lu
12,421,191 *015B89D95A6459077C1D2E97ABBAE2F1C0A7ED78 AL%u,
12,421,192 *01506ADB435D14F4A33613860F6AC1712E6D423F ALu:0
12,421,193 *015D02FAD392B6E2B0817B36BF7A2E516C34BE1C Al?U2
12,421,194 *0150E4730DAF5CB4B1FE37B7895B34DB868C211F AlU5D
12,421,195 *015D98ADF622BC811603BAAFEB3699891DD35104 AlU7D
12,421,196 *015A0BC3D1735A31775C0EACB6477BBB7AF5E18F aluayalde
12,421,197 *01506D72A1142A3EA30177C1B54858026D4EDFF6 ALubart
12,421,198 *0153F5CB964168E07B21DDBF8FB0721010826A0F ALuc4
12,421,199 *01501871B458E2A507CC79C5539585A1D55EA515 AlUck
12,421,200 *015CD0F1249798664EEDF3C981415E175DA2236A alucsabs
12,421,201 *015E87765AD1D00A7C0E8A827EF8D84296C059EA alucsuob7
12,421,202 *0151D871EA8E53E553FF2B206ECE62AFFCFC9F7F aluearkkitehti
12,421,203 *01509AB8A0D626FDCA0831B22056ADF3ED02198B ALUELUOVUTUKSIIN
12,421,204 *0157C35DA90FF5FD155650552CCA296650E86090 ALUEMYNNYTYKSI
12,421,205 *01527DA854F4171BB3CC17B90FB2FC7E0BF5898D alufxq
12,421,206 *01587BFBE16B70B1DE9141D417F1C9CC943B295E ALuih
12,421,207 *015582918EEA4C0999E4841A89906E0F891B61EA AlujI
12,421,208 *0153B8B98E66F4AE6CAF65C946FEA00EF4415C43 Alukan
12,421,209 *015BD657E269908EF59AB41ACDAACD3C710DC59C Alulgha
12,421,210 *015BCE9EC84476B3EE76A7BABA82F9AA3603650F al.ulmer
12,421,211 *015E53742B956240B055F2C518F5FEA177C58052 Alumbrosa6
12,421,212 *015CA6E7E8B226CFE93F6C6CD6A3612A7CEE000E alumen3
12,421,213 *015F6EF61CA42E536605910A2B422536BF24C768 ALUMIC8
12,421,214 *01555152C51E20914C1BA667B88300CEBB358370 ALUMIFEROUS6
12,421,215 *0157DE0B80C3463A0504BC70D6B1A81C11CE9238 aluminowinchite
12,421,216 *015F768FB8F1714AA0195642574383E620FCEAA7 alumnicentre
12,421,217 *0157C268269873D3976173D2501B6C4889DD9E00 ALuN8
12,421,218 *0159953F8FF2C47252C0A77750981268B5249F10 ALuP5
12,421,219 *015559BB3E9564DD492D61383123AA4673EA9594 Alupacstsop
12,421,220 *015E58623E733A14C7B67665DAC3DEABBE407D2C ALuq3
12,421,221 *015FD48C2921E8F0E3F69B1DED83463A7CF2D337 ALUQ5
12,421,222 *01588B1C1DDEEF4E24A49D071CFF529DCCF0BEED Aluquete0
12,421,223 *0155600A5D479CB8AA5BE9C624C9F1D181C7E60D alus007
12,421,224 *01569C0EFC31D930FD110D634F5E3D9DDBE59F9D Alushjerd
12,421,225 *0154A0CC0C72CF882D52F3112BED1F3C43D22F45 Alutorb1
12,421,226 *0158744EE2FA037E782BCCE9CC80B81B803F2751 Al_V_
12,421,227 *01539EF2F0D91E16C047C989ED4495FA7B9EDBDE ALv1R
12,421,228 *01537E3AA7FEAFB6EB2E813EA1B78EEFF0BD388B A"LV8
12,421,229 *0159CF68630DBEA86F149AB00EA09EE25CCD53D6 AlVa?
12,421,230 *015F2FA6FE578788EFD94A0790F27A4456BEE263 $alva91n9
12,421,231 *015C01A0636877F641EBEAB6BDDC21E8CC1FFD4E alva.belsey
12,421,232 *015896EBE646E35C485BD1CE1C62FCDFFCCCCC28 alva.bohlmann
12,421,233 *015D62732F786E21E139F76D7786511952F83E37 alva.brading
12,421,234 *015E48CB2AAF7422C053F24A568719CC5D0719E4 alva.coady
12,421,235 *015F7573AC83718A77D8AB37E384CD402CA1AF3A alva.gautier
12,421,236 *015F8637C4ECF8675CCD36E6474F99B1C25BFB2C $alvagepr
12,421,237 *0159232DBB78590B481D3714DAB46843F7818D9C alva.grip
12,421,238 *01514850F7A447D97BAE56DB4DA89F911094C828 alva.guttierrez
12,421,239 *0156AC299F294A00EB48DBA02FA1FEA5438F873D alva.guttirez
12,421,240 *015486FB7ACE0B0C132E9DCCB3D01B55259A175C alva.habib
12,421,241 *0158D79C6C60034D7861F0480480CEE8911C62DE alva.haeussler
12,421,242 *015104A66A7C39A18D4ADABF2056CDB475745D70 alva.harmann
12,421,243 *01557AD48F6FFED373646E1FFBAEA583DA10F252 alva.headly
12,421,244 *0157E629D1FCEB3DC1A30E9AB99D5BF4EB6EC781 alva.heeralall
12,421,245 *015EC0F0ADBF3CD3AA75A925AD676F5DFD3D1422 alva.heltzel
12,421,246 *015532E2593E1AD1883B920482F5E1C91ACD8710 alva.heming
12,421,247 *015FCC3FDA3718B0D00D38DF6F4A52B013E4E052 alva.himelstein
12,421,248 *015E147C19A88A173A10781FFC32D77F63CE7657 alva.huttle
12,421,249 *015F31497145252463337C98AFE742BE68115918 alva.jiminez
12,421,250 *0158D7959E6BEECAB7B746640759A2B4E6777D37 al.valensuela
12,421,251 *01591ACF5DBFF3D40C106BEA25A34397A85A770A alvállalkozója
12,421,252 *0150B56F2FE949243F0A6C56152EDBCFA7A1C1BC alva.meierhofer
12,421,253 *0158FF97239A90B364D3734357A3E03E20E2B7D6 alva.mohinani
12,421,254 *0151F329565378536B8139A58E01CFFFBFB91CCB Alvandor6
12,421,255 *0153D5AD1AB6B27DF7148B728978F5FE250276D6 alva.nemunaitis
12,421,256 *015D9EACF66011FED7DB5895EC6EE7560FF170EC alva.pinkelton
12,421,257 *0151B6B6FCCDBAEB4E6F3650DC9B9788D976B4D2 alva.primos
12,421,258 *01538AFCA6DFF00CDAE5BC42B541723983DA972A alva.rensen
12,421,259 *01568B7A526EE91CCBD531ADAD540F16518BA9D2 [email protected]
12,421,260 *01521392F55708CB57871122B64AADE14A2504A5 alvaro.agunos
12,421,261 *015A85978E613290591E7A02C590512A874C7939 alvaro.anglin
12,421,262 *01524C1AEC3F57EAEB0B98A6AEDA5B27C9DB1F2C alvaro.baarts
12,421,263 *0153D662FA148E84B21D6053A2D1C255D90E0D9C alvaro.baltzell
12,421,264 *0152C9186C0FC5C85A5C38FE923817BF0160EAB7 alvaro.beston
12,421,265 *01559D324678D916CAA0A68A7EB445E7101EC306 alvaro.blackledge
12,421,266 *015A1ABB0B5C48BF821BA1305CA1ABFCE4D56504 alvaro.carpen
12,421,267 *01500270E0878236D9131F6F7D01A472D0864F9B alvaro.caya
12,421,268 *0154764A47813F3086DFA0B5106EBE73CDBA87B1 alvaro.dederich
12,421,269 *015D75BB7EC8E4ED8F22BBA0127B09F7E2A239B5 alvaro.dyer
12,421,270 *015C6DE1AE1D6BD209A24369EBFF4FFFA7AFD6D6 alvaro.ector
12,421,271 *015F8A8F5C612E1BB58AA0D9824D457A38FC4A39 alvaro.everage
12,421,272 *01534418FE749135BAC1F999BEF18FF9492A105F alvaro.holzem
12,421,273 *01599D715E08A0260AD7698448D00995322F1E15 alvaro.huntoon
12,421,274 *015B849B9D10438B7E886D9596A65F68E86E05A2 alvaro.hutchcraft
12,421,275 *01516ABCF43BB0017804B317753E51B412F97903 alvaro.laich
12,421,276 *015AE14D89BA516F372F4E092CC572C88BF26502 alvaro.mcshane
12,421,277 *0153220EA37DF0D59517E2EA0A42D797A95E467F alvaro orozco
12,421,278 *01558FEFAC1BEAB890F14EC3714CEECA163B0AC9 alvaro.pacek
12,421,279 *0152C6C63651FF8B06227339D7DAF004A8E00AB2 alvaro.piehl
12,421,280 *015D814474EC11D33DC4D849ACE5A90D72A76505 alvaro.reppond
12,421,281 *0154CD8C9736506048FFF840BFA0E9EF0D3B554C alvaro.treon
12,421,282 *01521F1BBBFD1FF8F8FB538DF935D23B68CD8721 alvaro.wellen
12,421,283 *015963981D08FC77216704C9EB736F7FD6ECAA79 alvaro.yennard
12,421,284 *015E77467B67C96CE4C9046A760103710A3CE8A1 alva.segal
12,421,285 *0158FBDD056C961703125D9B3952D8B6F5490956 alva.shinn
12,421,286 *01583FCE2F469B8B83DE449A9FBCAB834F8D30A1 alva.simser
12,421,287 *0159426E7C1BC986763ED1F273BD4A0EBF5454F8 [email protected]
12,421,288 *0153FCD594FE4C9FC1B8AB100B23A4C0686E6F1E alva.yochim
12,421,289 *015DDD1C0B41FE812D25D6B63BE271EB6F72E83D AlvC7
12,421,290 *0153CA78C17143291544D40FA65DE06CF19E0C3E Alvedas4
12,421,291 *015B7AC0B85615989CD4081C6E03E80BE5C05F6E alvedriing
12,421,292 *015FDA486A0E0E978BBAE93E0B50249E989A1088 Alvemman
12,421,293 *01580635A043316AC7DA4DDC7CCD561A4E424362 Alvhs
12,421,294 *0158BD4AEDFF29231447D81B7CB5416786B35480 alvie?
12,421,295 *015C66575968BC3786DA95056DEB47CBC40AFE71 ålvikbukta
12,421,296 *01513DF2037F1ABBF322189392903D901855FA50 al.vilardi
12,421,297 *0155FE031B80FBC5836AA0B8955EE6FA8C7DAC5C alvin869
12,421,298 *015AEE326092FD8254260BE8450C81DC9FB0E8D1 alvin.balitas
12,421,299 *015B0868AB943D95934C56819954453D7DEF6CD2 alvin.broadwell
12,421,300 *015510FAFA7D01DA84290CED2BF64CC37DC51C9E alvin.collozo
12,421,301 *015062A227ABE84A5A4037C9FD69C7EB36091427 alvinfer
12,421,302 *0155A1D8BF31A9336763000E755E4253BDCF4256 alvin.gennings
12,421,303 *015054F6293BD07DE9DB8B57BA9344AEC8E368C5 alvin.grisostomo
12,421,304 *015EF883D64CC70D0719246369A805D667839045 alvin.hetherman
12,421,305 *01529D17EB4D96316EB9B2F84F47BF5EF8469D18 alvin.juda
12,421,306 *01511769071AE9D8CC8BBDEB45AB5601A7594FAC alvin.kusinski
12,421,307 *0150FDFD3D7C2602CAFD64838B5E19A5636CB492 alvin.loosier
12,421,308 *015845AE59E7D64F6980CD61713F2B1562F7C6D1 alvin masan
12,421,309 *015CC3428FF10EE8A7F73D24AA74335EE023BEF2 alvin.mashall
12,421,310 *0156130FFAE08EED6E31EE372DEBDA0196E0B995 Alvino2
12,421,311 *0155BC9FE7282634CE1DAE79DDCAE230BC240A95 alvin.pohl
12,421,312 *0157A1969A964B7BC162D81C9668F7A5CAB7CC7B alvin.rued
12,421,313 *0159042163647032B9BDA839DFF5C376B16037E0 alvin.rumsey
12,421,314 *0154ABDF7245953EF23FA32194FFEB82E87DB5D9 [email protected]
12,421,315 *015DB50EB049B27210BD1036F05E63390C2D44A6 alvin.skura
12,421,316 *015C745958A6AAD80C7C5BD22C79C2871FA027DD alvin.steiber
12,421,317 *0152A1273F2A85A973FD4D344A846482A907E0C1 alvin.stokes
12,421,318 *01521B0707EB32657F9AC2020E1F32070B6E1ECD alvin.timoteo
12,421,319 *015C1228BB8C525043CD725A9AA5E10C633B5927 alvin.tollefson
12,421,320 *015FAE24CE6F255EAD6DCFE1CC645FEA30AD04E0 alvin.tolson
12,421,321 *0153B7703CBC75539748359C1D1B470A90BA9D75 alvin.whitemarsh
12,421,322 *015E3B228541ACA9A0B1F784F58DAF951FDD6B15 [email protected]
12,421,323 *015AC23DDBB652C4968FF1A6350F2C0FB685CBBF AL:vk
12,421,324 *015E5C20A48D8D5BF0A48C8ACF6BA32BD927A6A2 ALvL0
12,421,325 *015DE3963DD4E4284C619D8438022CF248A4EF96 ALvMc
12,421,326 *01534DFBD006FF35AD3624002193B2104470E2D7 Alvorecamos
12,421,327 *015081EB2371FFC8C7686F5296E5F0F7ECAD2ABE alvoroaras1234
12,421,328 *015669C87CBA0711838D021DBE352D0EA64AE7B1 alvors
12,421,329 *0158F453E23B69F7E08FFFAE9BB326C2771833BB ALV%P
12,421,330 *01510D81397A7EDC5604416B8BA5DA329399981D A&L+W
12,421,331 *0152EA6C37C5F36A8EA889E101974AB6B3A97413 A_lW
12,421,332 *015EE3C7180E8614640462D226B6D197DABE0B7A A-lW_
12,421,333 *0151A7F2B419D20E77CD55E8D38F5FF31B4AE19E Al;W)
12,421,334 *015DDFF56759B300CEFAEE64E5E6ACFF5C871CD3 Al&w:
12,421,335 *015CF54A0398030BC245BC86FD9B783FF6ACA17F ALW5r
12,421,336 *015BE265837E325FF3ADEEC720018DC86E160C2A al.wafer
12,421,337 *015275880FC064750CE3C16595E3244F850E00D4 alwahlid
12,421,338 *015E085E3665CD82F841005CCC321F67709E60C3 Al wat adem heeft
12,421,339 *015301E275D43705376B968009F2D828C60FE847 alwatandaily
12,421,340 *015C83262F410AF1E478B075408853BFBCD6FF5A ALWAYZN4EVERS
12,421,341 *01533728A3131FD585A0AADEE2926461D466D378 Alw)e
12,421,342 *01591E0F80856C127D4B1CB8F7D43042887C990F AlWGA
12,421,343 *01588A82C6718EC6859DAE9934F8E323176F960D AL_Wh
12,421,344 *015C4291130E105D4E1BCCC525F79988F8107AA5 ALWI;
12,421,345 *015A0BCE915C387931F6F58E4685ADC603A5BC25 A)lwM
12,421,346 *015CBFEDE25662CEFF812E3948570784270A5123 ALwoV
12,421,347 *01574C360F50BA8F7EF082432FAC7F34959E6C6A AlWu
12,421,348 *01529F619AE813719027F319BC004E6712A0A96D A,LWX
12,421,349 *015C878E76B371A4CD09D9CECD74872A7E806743 alwyn law
12,421,350 *015D8751904880C6CF4E14554747D75B23D0B0B3 A-$lX
12,421,351 *01579F19D47DB4E1052844F4EA1A2EB68529F7D0 Al:X.
12,421,352 *0154B6996922EF22C392C65A979B24990B08449B ALX4V
12,421,353 *0159A48F0441330B3A3498B97ADF82D10792C190 ALX;E
12,421,354 *015D00B0624D02E460EBDBC6974A0B7A77F23F64 A
12,421,355 *015BC5C7EC162CF6986F3B317188CCFDDFE2D91F ALX:k
12,421,356 *015784A51370AED7E0C68D76950D5A61CDA155D4 ALXKh
12,421,357 *0159D8C0E0CB67FA943658C4B4994E550CDC384A AL;XP
12,421,358 *01512820D4448649B6D9335E519A13D2F83D1AB5 AlY(3
12,421,359 *015AB8EE79B0E791A55D746202A013ED111F3681 AlY,4
12,421,360 *015ACE90E4D9B9B47C2C22FC3B129B0E997FB1CA AlY!a
12,421,361 *015B8D648AB162C778EA56C0768778A16426D3DB Alyanakian
12,421,362 *015A24FDC46C2D384C3EEB6F991A48FAB2B6B08A alyanced
12,421,363 *015BAE04EC0E5E2321DC927A5186FEDF436C757E alyfares
12,421,364 *015783334C35BFCB2FEB6BBE557F03ADC0EBD099 alyonabondar
12,421,365 *015B4530FE97EF1B80E51C45BE7672EB908A8C68 AlYrP
12,421,366 *015828C0EEF308332802155B8237D44916CF026C Alysoima6
12,421,367 *01512A768246DE21609F811F6045729BD3806BB3 alyssa almond
12,421,368 *0151FDEEDCCADFFE1B235DDB48D2E9D186534F59 alyssababa1
12,421,369 *01541916CA7FC15C25AA6002D663E22028254F3E alyssabarlow2005
12,421,370 *01529C1107A08C5B9C457E818F7424522DC378A1 alyssa mae aguilar
12,421,371 *015F040F51B29782A45B9B60F23F37A9B1397576 ALYSSASUPER
12,421,372 *015078E2B51F9446269412EEC38D681C9AC11163 Alyssbswing
12,421,373 *015035FB3DDE5EA2E16F4B394FD2826141DDB1B4 alysye
12,421,374 *015A4E7C9819C62037A2390997A16F33D61488B0 alytuskim
12,421,375 *015E2483E2858AC6D0D59FC12A4A899DE3528D5A A-#lZ
12,421,376 *0152B21597A6B201C01AE044684A7107A4E45228 AlZ..
12,421,377 *015B31557FCC6BEF3ED7CD5E9F87BD440CBCE0BC A
12,421,378 *0155D43EF211FCF39A23AF0D59F7406010B808D3 al.zanella
12,421,379 *015F69572332876373FEB51D672AC941F3738EC6 ALZAPRIMAR
12,421,380 *0153DC720EE9221E59B7A38AA654D74DB628CD36 AlZeq
12,421,381 *015D51971AD108CABD7717FE647898CF2955955D alzórriz
12,421,382 *015129F280B31308F17672EC4CE2286A44BF9729 alzqn
12,421,383 *0153431AE98789D97204C37C1063CFCA7136DA57 [email protected]
12,421,384 *015C4784E7B313189CD236D3F8298D67DFCBF065 Alþinga
12,421,385 *0157BB95BB0CBAB9FDB6BEA1A89A0FF194957A50 A`M`
12,421,386 *0154B935A641C9989371236E32461034410D9118 A=:M
12,421,387 *015B614C772B82ED7B98A10E4FE5C9A658A1A735 A_(
12,421,388 *0158F14B782128E5B84135FD50222DC665AC34FF A,M##
12,421,389 *0153F3A425D0CDC9286CE69B66EAB0433640FDE7 A;%,M
12,421,390 *015AC514A60FA76E923EB16CA6E6F68BDB53DDD0 A.+:M
12,421,391 *015A7322EDD60EE0A7E3A0FCAF3696694898CCAF A$M&
12,421,392 *015C447682AD5653A6E535EFF6232A4FEBE79BAF A+-M(
12,421,393 *0159E0A651D5A9BCA0FDE6E4BF740C57C60F2635 AM-_=
12,421,394 *0151A62AA85502D50718630625A464F989F1E37D A_m
12,421,395 *015F3A1C93C8386C63DE9EC527613772E9AB5BD0 A;:m=
12,421,396 *0154E14FF5766F237A91D619F13609CEE247393C A;/+m
12,421,397 *0156889E6DAE8431952A95A7E2A70075EF00B825 A'm.
12,421,398 *015E90DF71D7074B2D0560648EAF38C4B94668B6 A$_m$
12,421,399 *0151ABEA7A533D15124DE462A3DF85256E5688C9 A
12,421,400 *015776C2D61E918792B354963F25E7F2553FA8E6 „am
12,421,401 *01515298816CC01FF99F5386AB062DDD33CF40A9
12,421,402 *01505418F7B8FA37E853FDC981B0A30246638C01 A(M0&
12,421,403 *0155B578F02E50E3A8991CB2BD715C74948EBEB3 A+M0:
12,421,404 *015B6279DEA6D1B8F1B38792DCFF5C4E8256811B am0eaaaaibaj
12,421,405 *01533BADC70D756147194035099E74A5439C0307 Am0un+5
12,421,406 *015EFE449420686C065C02393EB0E48190DA42BE A/M-1
12,421,407 *01512C056EC421880DFC30AB5BB2891063612C45 A)M1_
12,421,408 *015960EE08F55D3088612F6CE20274D1E31A6856 AM11?
12,421,409 *015DF6656B30296A4155C37F74A275E2EA37F50A am1403
12,421,410 *015EA725F12A2787B0210E8CC08D40B78EAFF443 AM1e?
12,421,411 *01572C5BB3B4FBF01685BF5F99A4D194DA4D55AA AM1fq
12,421,412 *0153F6BC50CC58AA2D869A2E187E67A1FB74839D AM1kT
12,421,413 *015F02726AB622131CE3F56910C1A3F27899F61C $am1zda7
12,421,414 *015C5B811AB4D3F8F98C4CBFF86663B4D3933984 AM2&!
12,421,415 *015790326958B333B9011DE337160A5F0F1DA352 Am2_=
12,421,416 *015B545753663E2B2D3DA82BC19A5A6296E5087D AM21d
12,421,417 *015B4B6914DFB5298B0BEC584CD55125941ABD38 Am2B.
12,421,418 *0157DD8F0CA6BFF37CC4BA287692AD9A4F7F1176 AM2Lm
12,421,419 *015949E16C884A6C315D7983ED8D50F6796E20AA Am2wf
12,421,420 *015D906A3CBBF846150631AE8B3ABB5AA4C71AB7 Am3j+
12,421,421 *015DABAD09773271468E5D4C667023E9745634F5 AM3o_
12,421,422 *015A7ADF6B72FE6F7590F1EDE0D8A1A2103A2447 Am441
12,421,423 *015E66A9ACF6973143F51194F4572AA60F4762CE Am4fE
12,421,424 *015F6FA5F8DD7AFD82388617789CB6D42A93BB64 Am4UB
12,421,425 *015E084BC2DCFBC05AE274BDA092806C47068070 Am5"G
12,421,426 *015F15694B92D24B727FA73FCBE2282DBFB425EB AM6(#
12,421,427 *01571BBFAC6E83270330CCAD80AB98D0CB427D62 Am=6)
12,421,428 *015974BAA2773B5E1252A4FF41A1BED7A637CEDB A=m68
12,421,429 *0151B55A1265AB3D4314A6B32AE88D3E61ABE996 AM68s
12,421,430 *015C950BF03E4C75704C4ADDD02EA4239DF74E43 Am)6E
12,421,431 *015970F08D0F608AEE95DE404E1957CBD2C73F83 AM6Nr
12,421,432 *0151448DA2857323F3751B21F5137F22460994E3 Am7_+
12,421,433 *0151A86F784F5345324E77EF5E262F309BF0A8D2 AM7#k
12,421,434 *015E858FB09B33EB4048B67D97DD6D3422ED0258 AM7YD
12,421,435 *015DE04B66483E18147CFA65A301F6A26AFA5C22 A
12,421,436 *01523A6296935D86FAE4A696F62970E1DDB691AB Am81$3xual1+13$
12,421,437 *01557035CB24BB94EDA9933C8A71DFB7E82F793B AM888
12,421,438 *01527AFA609ECE260553C78AA4F6830B0D77805F Am8gE
12,421,439 *015CE79AA47A6936A6830E1148A80A28AF1DA79C A:M8H
12,421,440 *015FC78E38980AC564B4AB4CA913D0E0EF73547B AM8iC
12,421,441 *015D7A842B432D70A3A94991D013B90651970810 AM8#k
12,421,442 *0157B90EFD13CE12D15E9B795F9AAD390FED07E8 Am8oc
12,421,443 *0155DFDDD86E0F05CB62D646681C55796F342B7B Am8?T
12,421,444 *0152EDB10DE3B79452ED657DDA4B09FCEDDD31CA AM8!T!0N5
12,421,445 *0151CDF2E480789EE3E4850EC6280014FD10438D Am8u1a70ri3$
12,421,446 *01515F2196C33990FA3EDA315F7BEF8E36183981 A?M8W
12,421,447 *0155CB068A2440E951CF7B6EA2C533B749BCEED0 Am8W(
12,421,448 *0157B60DDF19F3BD3CA6CCF172BEF664999C233E AM;_9
12,421,449 *015AD9081449917E46D83111E70C5B2485D82094 A(m9$
12,421,450 *015CC7DFA672FE3569B9331D7C6A870039C4FFD4 AM90a
12,421,451 *01539B9C7863F03E8EF35A963685F5F5FCD3392C [email protected]
12,421,452 *01555F0022C8DBC45D405368CB97DD29305A1DB8 AM9Kb
12,421,453 *0159A4013B1C29151EDCBDFA709BB8D9ACAD644B Am9Ke
12,421,454 *01589635C033284247DA592766FA519578D5CF51 Am9=r
12,421,455 *015DF342A34CBDEEABF58A3278FC7A02748E3FD0 AM9s"
12,421,456 *01538A210C8E6912E2D2509DB32BEE185173DC8D Am9tV
12,421,457 *0152D291DCF7B93923E4CC0DDEEC130D7899115B Am9Yd
12,421,458 *01554A6A25249AD4D1540DA55041713C14A3AA32 Am?"a
12,421,459 *015A9C8FA6EEEA3C5F7A88D6C6318C2A3358E1B8 [email protected]
12,421,460 *0156CD0BF779D5F6E81AB3C46E8B52B216092635 AMa2,
12,421,461 *015DDF42B44A333D1C60AE543AA3606378F45A17 AMAARAYAN.H
12,421,462 *0156474E9701F729ABBE028D1FDC58A620F7BB2B Amabil3
12,421,463 *0150BA37FA5BBC43E774A67FBF555C9365C990BB Amachakuspa
12,421,464 *015F8990DD2FBDF82DD50888260396C975BFD9EA Amacibsw0
12,421,465 *015BB11E900BA79EF6641DF5FC7D4741A36CB196 AMADATO1234
12,421,466 *0150AEDEBDEED66E9A197C1CEC2268F370D45D59 amadeussherri
12,421,467 *01524A066CC5F376FD167BF3F020EC990E54C756 „Amadis
12,421,468 *015A9AA41ABF382FDA9EBA26985A23DEF5A33C2B amado.beppu
12,421,469 *01569DFEE3D6C67F24C4353CFCE865FD6552F0A2 amado.boccio
12,421,470 *0155606756AB4FE544B4136B733FF573F3940A59 amado.endris
12,421,471 *0159FA341E3B41815CBD5E0435FC2475D642A32C amado.kerkvliet
12,421,472 *015BED244E5F5A6AEA134DCC99B8B9D0FB5BDA20 amado.littleton
12,421,473 *0159D098B15448B33A013957C4F82CE4D4FDBEE3 amado.malik
12,421,474 *01574EDF90EE00FADCD90DD3FB1B062F0C65AD52 amado.mollberg
12,421,475 *015D3D6172F755A05280510D56D2E4EB63D4B50F amado.opsahl
12,421,476 *0153CFE48777321934D22F7DDBBED30CAEB99865 amado.pantalone
12,421,477 *015A129445C5708F71257737E60256E88649CAD4 amado.plohr
12,421,478 *01574393F5C2DE90EE00DB215C457F89F899A9FD amado.quirarte
12,421,479 *0153C49F299416AFF2E989F563A4746874B590B7 amado.rendel
12,421,480 *01581CC1D0C38016F35072ACEFC90D94BF7EDD6B amado.rokosz
12,421,481 *015061D47D5D56AB6EE2961325A89A2BC1E5554F amado.seier
12,421,482 *0154EB6BCF6EEF3217C5FDA56982374F060E0723 amado.swiney
12,421,483 *01598E0E6088EB94E8094277D40D91B7C3D15EE6 amado.tsantakis
12,421,484 *015092D23FE5DB88CEE70D6078008900C6843B84 Amadouaient2
12,421,485 *015E482348A27FD742384909C8AEAAB5289F1E78 amadouerez1234
12,421,486 *015C9B304274A96D3E8B843B72EDA35A39A075D6 amado.whitelock
12,421,487 *0152C871DCEF7A93A45B86B592269ABC02FFDF9D amaestrando
12,421,488 *0150633AF5C55E50B111C404548952236F7C0C11 Amafazna9
12,421,489 *015850D3FD144CDA919A4954DBBE0D91EC44802B [email protected]
12,421,490 *01500A604EF2398FE209858E01E85E16AB994665 AMAhe
12,421,491 *0158707654CA53EB8B0B41B9DB5E7149999E68BA Ámáiris
12,421,492 *0153762B74183E739C2289B0190E5891BD6A1B76 AMALGAMATION2
12,421,493 *0153F2E0FCE466A4A598E5183838DB25846DB917 Amalie Kjćr
12,421,494 *015A909ADBBDFDE35264001B33AF562571D39B51 amal samer
12,421,495 *0153379CDFEA54010B9F77F7A6782E675EEFEEAC amam3n
12,421,496 *015B66B6BE7A1A92E7553C5B4F6AC90483A631EC Amamanta
12,421,497 *01511B523529BD90D2EE1E4C41AE8AF0902E785C AMAME18
12,421,498 *015FE045AE6C850DFD90589BD54672514E7C5DE8 Amancaya1
12,421,499 *0157E89D0B53C15918B7A504763810345A0C74EE AManchesterCity
12,421,500 *0152EAEAA3E9AF1E3625754A0EE14C5A28206088 [email protected]
12,421,501 *015A697C0CEE4EACA46CBF28493579C5D7CBDC74 [email protected]
12,421,502 *015BCA59586E67C2779FCD3FB8BAEA04EAD5F2CF Amanda746
12,421,503 *0151BAFF7CE9DD8CFE6BEEBE10C0D9431FC50217 Amanda839
12,421,504 *0150FCB77848F1FDC60AE4F1CDDB53F16643FC12 amanda8587
12,421,505 *0153E257EBAF4ADF315BC94AC91558AE5F602242 amandaahrendsen
12,421,506 *0159A6A7347DC214BAAFF2299851E2403F4F3B8C Amandababe
12,421,507 *0159BED7A6F2EA4C43EDBAA432680715119B142B amandabossi
12,421,508 *0150ACA3727035486A2B2E7B5A9A03CAF95BDC9B amandagolfing
12,421,509 *015076A2B775350F3079BC8062ACD2A782A52056 amandaingle
12,421,510 *015A47A012669DC3E7D3374586893501D9C0231F amandakeven
12,421,511 *015EB3311B5AA8B76D702310E42A44796321E641 amandakrauter
12,421,512 *015059BAD94A78E76A198EAC0A77B014EC0BE370 amandakulesa
12,421,513 *01528DC03E114AFB133F429A68A34CED9CD5D219 amanda l bartley
12,421,514 *015ED31D86A426A728EF5DA390235CEF809AECC3 amanda lee carter
12,421,515 *0158887A12BB7770CC1E00BDD85575C347569AE6 AMANDALYNNELYTLE
12,421,516 *015916A65E70C6A3FF5513E4BD2E6C399AA5306C amanda mitzel
12,421,517 *01522EB69F79826EBBADF68685EBF4012ACA0C93 amandaowens
12,421,518 *0156B7CED02796CC6DE660B50988F7FDB969F360 amandapiccus
12,421,519 *0152C68008760B9FB116240AC21BAC19D16073D5 amandaregional
12,421,520 *015D856F1EB4A6118E9F3399BF7F8763A9804F00 amandaroesner
12,421,521 *015DF159031991C5E4A13D681A68CC7C0DB20C14 amanda seiders
12,421,522 *015A6E23056AB99852396E0548B7D78EB7646031 amandawoiwode
12,421,523 *015DA8A34E3E79E3307F5408265F43E8CA6BD963 amandis4
12,421,524 *015C770DA7A8E1F852AA8C476F0A83E53722DB1B Amanecer (Martinete)
12,421,525 *0159126D68D6E640173648AF18644CDDE2C85FF6 Amaneh3
12,421,526 *01597B0620A0DC3C86CA46B884084FA04312326E Amanewel5
12,421,527 *0154152F74B4C519FBDF8182D97F52B31971B705 amankwaahw
12,421,528 *01589AD408F5ED36601EDF5E41E5ACBDC9FEAA12 amanoa)为后。和以往的昂德朗统治者一样,欧敏国王和阿玛诺皇后跟随着纳德的信徒学习黑暗原力。
12,421,529 *015B041DD3D1395FE7B184CA1DDCB7EA639F8AA7 amansiz9
12,421,530 *0156FE69CB842A1C1B0C04ABB910FC6242CF9CD3 amantiaami
12,421,531 *015A727CF6EB6438AC7EB20791484A1FD8C5FF6B amanvedika
12,421,532 *0157780CBC647F64DB5678EF4CE5DFC691AF1CBC amanvilloise
12,421,533 *015CD87CD7AC8075815A5E567FA4875A611FAFFF amaranto0
12,421,534 *015107BD938D635D76306FED04C868A8A2B28D1B AMArGo
12,421,535 *015BF9001C4E0DE35ADFD0E0DA245176383AD0DC [email protected]
12,421,536 *0151D1E492207C533C4F9012D44BE1BBD9546268 amarici0
12,421,537 *0151A641BB00401C3F1AC44A3B33417C8E06F61B AMARIS05
12,421,538 *015C069552C615D8A7D1FC508F570CC5F4A05621 [email protected]
12,421,539 *015ECF583F31255D5618320ED805421E3A196280 Amarkoke6
12,421,540 *015F781285EAD4362D2A503B274FAE472E6473EA AMArn
12,421,541 *015C8621C76F1E5B1B9A2995064554795B27B98E amarteias1
12,421,542 *01503064AC1B130481166CDA35581C3A71447220 amarts1234
12,421,543 *0154799190D72A9E75F5A54A54322914C48D6460 amârus
12,421,544 *015F3E1099F95E8F30890B2032F15A9F111B7A84 amaryah5
12,421,545 *01596A569EB1723827454551520420FF4CF99F27 A.mas
12,421,546 *015E0ABD0096AE9585BBE0293BBF03F7B08AFC77 [email protected]
12,421,547 *0155A8C3493B8B0279CBDD94E96E80CF5EAF3D69 AMasa
12,421,548 *015359F876CA17FFC05479A8E18BAD263ACF1FCF amasproduktita
12,421,549 *01519CB546629FBAB076D4F1064E0EBE3DD17A85 AmASs
12,421,550 *0155DFBEC2C0C6CF1765D02AF58FB8BA297C7BC8 Amataito4
12,421,551 *01501C716EFA0C8C2990EC82DBE781E63FACF1ED AMATEU
12,421,552 *01584616C17F95E1431F3550014207051EBBB859 [email protected]
12,421,553 *015E114CF28127D3D43E17780C330BA129E02686 AMATOEOERIMILJONAEAERI
12,421,554 *015B8CECB9EF50A2397269E24B16181EA53D4433 amatørsangkonkurrence
12,421,555 *015F5D630D721844F2F71CA27997ACCE2FDD9564 Amat|rreglement
12,421,556 *015B005E41CBC7A8F2377336160868B6DA4DF4D8 amatsoonide
12,421,557 *015456B51F6879C27FF2F5398D9139578373312D AMAWENIX
12,421,558 *015FE3251D9C8A7F662935D60A570FA30816C582 AM&aX
12,421,559 *01533A1C2264C39479D13D51460F2F309B06A11D amaya.alonso
12,421,560 *015BF18E31D22C544F4C999308E19F5A6DDD0A8D AMb=0
12,421,561 *0157F5F3C677AA72CABCD6C92E1A7EF8AF5A1815 AMB1D3X7R0USN3SS
12,421,562 *015701896539A0EDF226897F6A11156CFD22B7A5 amb3l
12,421,563 *0157890FFDE6F4E7B4802B6F44EE382AC33FF136 Ambaryns
12,421,564 *015D6733CC45AC905F7C21A95CBB40C7E9D25FE4 Ambassad
12,421,565 *0156F8D488ED13664114353F4AE8F3B329617565 Ambassies8
12,421,566 *01574E72BEC55EA9A9AE83DE135515A9595664B9 Ambatoanjahana
12,421,567 *015697411E2D6255DB0FA560812A2C4F7EA6E8C4 AMBELRYNN
12,421,568 *015E88011A0EBF28ED56BD76D674E8F2F64D8466 amber150
12,421,569 *0158AE2212CFFAA6123756742029C6815757F609 amber-brkish.com
12,421,570 *01560980769E495B41B51FDB55A8D15FF972FAFA [email protected]
12,421,571 *0154FE2976655EA6B126E7D7CE453534290E0574 Ambereric4
12,421,572 *0151C63302D27C48338749D4E4EC8E6FDB4D44EF Amberfarbene
12,421,573 *0158D671158A56AA55AD4C1ED9BBD70079622E99 [email protected]
12,421,574 *015D3677B230A3A9D6EA310E90BFFED577AAF57B amberkeever
12,421,575 *0156B4B679E2E7C560D26510F6623B10FA79E5C9 amberlee sanchez
12,421,576 *015C94BA56DE0443DCFF01A40A90B47D75B16477 ambermccammon
12,421,577 *0152B7AECDC0E7A848FD0EC16AC78D49F7105583 amber reimers
12,421,578 *0151E76D3910CBE9B56922AA2F5624DB07DA2A9F amberroher
12,421,579 *0159FAF7D7A87FDA6F93B46FC28025C2A5B33FD7 amber stauffer
12,421,580 *0154507CDFFFFF3CC7DF0F751962C3202A1DD015 AM!bF
12,421,581 *015F6B5A837419294474C65168B1C6C17ACB2068 AMbg3
12,421,582 *015F8349B270FED32D969DB2290E7541EE99D0AB Ambiantes9
12,421,583 *0155D278F87B76A3B37D2B06C47A7388F156DA48 ambiatised
12,421,584 *01554DD9EC72C7AE8ED097A17BAA408C7E39CD82 AmBIb
12,421,585 *0150FAB5370DDE0E191313B1C65DF73A82EAF2D4 ambicijonizmu
12,421,586 *015891E0B61F1DFBE42C38214B36A3FD5CFFA0AC ambidextral5
12,421,587 *0153456F5B84A2AE16B07535E5F2EDFADA90A73E ambientying
12,421,588 *015DED0F5D64D7A66D1EFA564A38F9A7938DCB09 ambikhing
12,421,589 *01529E93F8C8DB7478DDE54F956B372C4822FB5C Ambilingual
12,421,590 *015B7FC4191422163CF288D5E11E924525D1AACB Ambirem4
12,421,591 *0155AFF0A7BDBFBF5F1A5A0D92C6365444AB235B AMBITIONNAIENT6
12,421,592 *015A5ABDA24E61D1BD738F2161D68CBC620AE8CC ambitodelacosta
12,421,593 *015CB03D6C7341E3F4224C921F30E763DF7C78C1 AMBKk
12,421,594 *015C2009A787B27543D352B39F24DA04060177E4 amblermw
12,421,595 *015F217FFA92F0EAE77CE443CB32450C484F8E81 AMBLINGLY7
12,421,596 *0153173577F458983671F28F53047AB691E72258 Amblycephalidae5
12,421,597 *015C54C274666FE1694AA3E9B5B109FF9320C308 amblygonitu
12,421,598 *0158043F6A7A5B497F7FD4F6804849AD34926253 AMBLYRHYNCHOS
12,421,599 *0154769E58B3778E18E10245A67E8DABAE0FA50D amblystoma5
12,421,600 *0154D9C277830BC4A2FDE50FEF9066EE495F72EA AmBM=
12,421,601 *01503E5E70CFC73B7794E572C634BC30A4D2A88A AMBOIIZFREAK
12,421,602 *015E8B4E31D76D79AFE54F078C10FF07A2C007DE AmBoZ
12,421,603 *0152E3032525EC9044FA274C8F1E0860E9B07D48 AmBPj
12,421,604 *015F8570DACDEAF930459729AD2E192367EBBD33 ambreentanveer
12,421,605 *015E0E1A011990153CB4426799C99AC485FA272B AMBREUIL
12,421,606 *015F33937CC140B09F55A157B24A634D8375ADE6 [email protected]
12,421,607 *015B7B04ABB0329FA866677FEE9A34D4D2B0396E Ambroaiane
12,421,608 *0153175C5778C02F47E509EBE0CE29A7A732E994 Ambrodiscus
12,421,609 *015680B602B600C17CAAC27DE5AA393D0FCA75DE ambrose.benderman
12,421,610 *01561F2DB8E660F1204593EAA36D97DC3CB90BB4 ambrose.bowley
12,421,611 *015D79513236F76F94F41A280814E3EAD2ABB3B9 ambrose.cannone
12,421,612 *01580992BC3CFBB53A3D994B37B8B6AC9EC80152 ambrose.cashmer
12,421,613 *01509ED0929E7A1A696CBA76BECD9FEC060CCF4C ambrose.chatlos
12,421,614 *015197FCA996358DC53AD7DE444DD87D3CA915C1 ambrose.degrazia
12,421,615 *01584F2FB216E16D9FA8B606993BD7196E03EB97 ambrose.drader
12,421,616 *015E8D20D398F91A5E3A8362EBDCCE7C08F20DB7 ambrose.dufer
12,421,617 *01537D6C14A0F2943A09B15D250360F16E389283 ambrose.dydo
12,421,618 *015628FF129D046C43205E410BC47239C76433C6 ambrose.enns
12,421,619 *0152298F02775F5BCF8EDAA2310910B8336BA1E6 ambrose.fletcher
12,421,620 *01540F06B99E11CBA69874B014148BB05BFDCB05 ambrose.haggermaker
12,421,621 *0154777DC0CF307D19B52A5432C660B27543DF52 ambrose.lisherness
12,421,622 *01590B8228882A112BB74B7604FC31025A3B1C57 ambrose.lockrem
12,421,623 *01528DD2322809D073CD5A10CA0DB864716199EF ambroselong
12,421,624 *015B65F92229878A20F8F1313275841B4C773AC7 ambrose.maheu
12,421,625 *015C3C210BE9B4EEC7814C083A6DF94D4ABE363C ambrose.mallek
12,421,626 *0150C93D1A1CC2068AC62791422A5D35F4A96176 ambrose.polashek
12,421,627 *015F95220F709E107A907201CE9B5555063F2FC5 ambrose.routt
12,421,628 *0151F3DD0106CE7C0D1EF89FD20836C74428EFC1 ambrose.sego
12,421,629 *01564AE57617801B0430D57C441C5909DAB07F5F ambrose.tatham
12,421,630 *01560A53121AD8CC9F1391C9721EACBDE4B41C1B ambrose.verdino
12,421,631 *01513C256B2426E1D34FD55CB1CE7C8D56B02C48 ambrose.whittler
12,421,632 *0158A409AF8BA53757106A9793327E4ED1490978 ambrose.wimes
12,421,633 *015EB94852B386B0BE1AFEFCBCD289102F759877 ambrose.zdanowicz
12,421,634 *0153A43DA0E7C32031579621CC4B570BE61E575C Ambrotype2
12,421,635 *015A17BCA872778C892EE3FE7DD454CC8EBE498A ambroziaq2
12,421,636 *0153506FD57E4A87173B478164469F047EE1A61C Ambrozijan
12,421,637 *015B3CD217A0A48A9AB66042A1C78E1E5179DAE2 AM+BS
12,421,638 *01514EF6145DAD9215CD2653C07278C6562F7E9C AMbso
12,421,639 *015D60FFB5D28EAB5431954B492ED584D7FCE026 Ambulansebaat
12,421,640 *015B450587CFA2C34551588F62EBC0B2DF7F02B6 Ambuline
12,421,641 *015E00F1217207645A8E78DB55271A6B6374CC1A Ambushvassal
12,421,642 *0150F2DABDD86564C62F20E005B14E7FC78D234A amby2096
12,421,643 *0159D79BD8D3CA327F8B911C178C5B4040762817 ambyā
12,421,644 *01550512BE899625F2D00D25357194C5CED33077 A?.mc
12,421,645 *0155F337A238A151DCF58C6FAE2D985A26B6F29B amcasusrapid123
12,421,646 *015B16C25ADB42FBFCAC0A81E1F3A83D4D37F11F AmCBR
12,421,647 *01520C8247D734FD381C6FE8780CBF4D8268BA3F Amcdbsws
12,421,648 *015B0BECF0C71AAB5E5D8D6B3F1B2707AA0BB362 A
12,421,649 *01594B1359F65A756A761883644B4A9B9C62BDDD amcle048
12,421,650 *0158ABCE5848D2424D96B74C32B0C33F867FED51 AMCMHQQKRAHSI
12,421,651 *015876A90BF12E14FFBEF8E54BD33463C452D8B3 [email protected]
12,421,652 *0151052BEE8EFD8E04DFCF16987C880A2B0FA279 AMC=Y
12,421,653 *0150F56F264DA2F83767CFDE1B905549FAD9678C [email protected]
12,421,654 *015EB5CE8E3F30DF6AB47FCCB9AC7580D363165D A)Md.
12,421,655 *0153C6AE72DDDF8F36C4F4B2556CA38AE6B9101C A;,md
12,421,656 *015654EF8FC1B3B6208A65C2C8D0275034EE5BD1 AMd5K
12,421,657 *015AA2412DE6CBA1D3B8305DBAEF76E71569AFA3 Amdashe3
12,421,658 *0150E10EDC8DEA327973E0DE9858EF1F6A6B567C AMd=D
12,421,659 *015A18ED8669BBD21A0F3409205BA6BB1CD97451 AM+de
12,421,660 *015C4C0A3C731C1CC9250121C7DBA6D84B248702 Am%DF
12,421,661 *015CFCF361DFEC919B1FB703276922B43DD7223D A
12,421,662 *015E0E26FE5E01E2C3EE4480C441D963BF888FC6 AMDK1
12,421,663 *01599D375F1F29AE0C06B58DDB67F933E6A6A2D2 AM;Dm
12,421,664 *015CDEEE6BD6F612EB4C77CE1CE504DE7789A9EC AMdn7
12,421,665 *01522BC44535F04B5AE9FF3B040EFAA4B8B10C8B AMdS0
12,421,666 *01534298E12D498170DED01667C7489FC6975BBC AmDs8
12,421,667 *0158847E3A97CFC4C80883ABFFB1EBA137F71274 AmDVN
12,421,668 *0154C5E00E213A375568B84391FB9FAD3D7DF72E A
12,421,669 *01504DE7EBAFCEAB2B34EFE8196383EA482F94FA AM:E"
12,421,670 *0150C4EA4CB928F706A4C9340A2629845AEB6259 AM+?e
12,421,671 *015EB92004207D4A8DED0397DA69B04440AFD458 A_$me
12,421,672 *015F5C40A4809FC8839640047C0C3C0FC5EEBABC ame110rate
12,421,673 *0157B9194D4743DBE4DE7C1FEB4643D9BB5F6BC2 ameareis1
12,421,674 *0153FFAB1058DE5EC66D656E207307EC3F27A8A4 AMEBID8
12,421,675 *015195224BDFCD2391FFCCF9757EF80336B82DC8 amébovité
12,421,676 *015593AACA4421AF35900F9831CA5C21906CDEC3 amecp
12,421,677 *015BA4479B5E7C6F282D408F5A853A6D368510C3 Ameeraly9
12,421,678 *0159944630550A1A856EA832C10197181E8D69CA Am(Eh
12,421,679 *015A77E0CEAA2D8FD75871FA30A7BBA3964CBDA9 AmEH6
12,421,680 *015DE9F28FF9C00A58A55A7B4AD92A2472538E11 ameijoarvos1234
12,421,681 *015655DEB364E59A6148F007DBDB72533515AB76 AmeiN
12,421,682 *015F9C1EF0A44EEAB1E1FBD9165AD07DA8DAA135 Ameivetai8
12,421,683 *01573DC75369378C966A28B3AEF3D01100973BF0 A#Mek
12,421,684 *01506D129D3BA943770A7A4F7B2BA33CCB9EF08B AmeKd
12,421,685 *015E0714CF01167FFB4F260F3B989CBD0A2CCA77 Amelie741
12,421,686 *015D27850B4F03F59E78C24595CEC351A3A5EFDA Ameliemorgan
12,421,687 *0156C227B95D152F0F71FBB5B7D39CB67FE10CF6 AMELIETINMAN
12,421,688 *015E68DF39D4E774D6A8871E7A910A8DC53779B1 Améliorateurs
12,421,689 *015D13E3647186B84BC4C92AC017D6A0880D293B [email protected]
12,421,690 *0157B728592721225ED6DE62484BF916832E76A5 AMENAGEE0
12,421,691 *015130988CD1E1C39A62F9E37D44E643EDD99EA6 Amenagerait6
12,421,692 *015BC15EEE400DD17B55AD3996FEBB3D319299AB AMENDERAIENT6
12,421,693 *0156D7BC92D0667DE7E1636BC476D87EA8675622 Amenmesse
12,421,694 *015619AD82D34BCDC1D3AFD0D4D146550667CE7B Amenoscope
12,421,695 *0153CC0D9F5CE27C304A926AB97B772B1FF4CA2D AMENTUT
12,421,696 *0154AD1ED7D0B6C40FABBB3061EF45A7D951EB74 AmeNU
12,421,697 *0153B7CDBDEA6AEC98F675F5B42F2E99641D2786 Amenuisa0
12,421,698 *01506DFC53C6E02C3F63C094771F4CD601E50EA9 [email protected]
12,421,699 *015D01ADF36538D96D1B7C5648A4CE11A66E8905 ameradases
12,421,700 *0157BC12EBD31AE64C560ED2A887ACFEAA557274 amerang4
12,421,701 *015990A938F0A4AD5572960100A19CCAD07D5D6E AMERICA7TOMCAT
12,421,702 *015AD1B1DDD83EC01E3B318ADC8B4AAF033878EE AmericanDunkleman
12,421,703 *0155A13EF90A463F9885B504E8F78E5A49A5C589 american-idol-dancing-with-the-stars-and-csi-top-broadcast-net-viewing
12,421,704 *015FCEAA5F0592353DAA7D8B974C8275E2C6C93E AmericanLegendsmoviebyWaltDisney
12,421,705 *0157F2AD1D909205EE3222053698FA03290D215F AMERICAN SAFETY CLOSURE CORP | UNITED STATES
12,421,706 *015B7BC8A4F8746EFAB31E1394CC9FA988534949 AmericanWaterSpaniel553
12,421,707 *0152EFE48EF28E9F8014543D38BF8AF7CFA5FC26 americaserves
12,421,708 *0150503B1D141B6212E4F5975E6582F026CDDC9A america—were
12,421,709 *0158777FABFB8873D8F5DBD58F0D11DA198E51C1 americawilly
12,421,710 *015B8C18D698DD07A2237F1B22AF0C88EBB95941 Americios2
12,421,711 *015E46E0D7CE0B43B599353C8460A757E7BE0C12 americu6
12,421,712 *015F32A59434F3E670D214129F9E048E72219F09 AMERIKAANSE.
12,421,713 *01577396FCEA665F7A9932C115341381A8296703 amerikansk
12,421,714 *0157F1B3A15039AD1A11DED8F316CED95199683C Amerirk
12,421,715 *01544A4C2BF9C8B70ED16C4778FE48F2B5575CDC ameriwido
12,421,716 *0152191FB0DAD692BC2110FAF5E3CC99A77A76DE A Merry Christmas
12,421,717 *015E2229BD218390356E1837319AE0CDE7D54203 amertsked
12,421,718 *015029E1A1718F136702E4BB58D8030913CB8F03 ameruschialabazo
12,421,719 *0153366A621EBF4A19D8337B770CC2A8A8D4D619 a_merzifon
12,421,720 *0150BDA7DD0A932D75FE72AD8DBCFFC7E2BF0FC4 [email protected]
12,421,721 *01512E66E049EE42D8134DFB08F8F65298438657 Amesbarry2
12,421,722 *01541EA6AD5748963FACB6727C5327BE6F330860 Amesmode7
12,421,723 *015630EBB926C486D427DD73D9E194F925A2DC5A Ametani
12,421,724 *015A244D1852DED21E23D5C1D0BC7ECB096A35F6 AMetD
12,421,725 *01539289D8BE8EFE3110384EE57AF1E169BA4C1D ametlladelvalles
12,421,726 *01527C7FF1ACFACE4604C8FD7599C36CF9C4DC14 Ametsys0
12,421,727 *0150A642381EC2DBAB3B71A1987AFB2C51EFFC6B A;mEU
12,421,728 *015AA8DF0C9060E16E028C6EB59F698BFD7C9BC0 Ameutaits5
12,421,729 *01568099AE7F61E4E181E81589EC5D8AAF5B913B AME!v
12,421,730 *0156CF9FE0FA6CD75A6D8D34B6249AABB5D08F3B AmevF
12,421,731 *015013FE343C4AE3A67C62C0BBE467C28072F13A AmE!Y
12,421,732 *0154F286C9DA0F96490F3ACE33168714EA8C44F7 AmeY+
12,421,733 *015E77BAC438CE78485BCE0C41EADFBF524EBF87 ameygary
12,421,734 *01530276E7AC35277274986ADCC0B6A70C16A616 ameyseco
12,421,735 *015588603D8C305222F63F1A37418E572471AAEE Ameznir1
12,421,736 *015A078ECDF06D7E3983B35D799D47979AB62E0D Am;"F
12,421,737 *0152BC2D26A1D0001F3DCCBD8D7064562EEE7D09 Am+!f
12,421,738 *01525AF6A3A542AF3DB96B515E2DB179F6AF3DC4 Amのデニス・ハルムをF1チームにも加える。ブルース・マクラーレンは
12,421,739 *0156DB2A325036C858C4EE32A100316DE83BF12F AMF/9
12,421,740 *015C34A4DD82C4AADAADBE7F294C01AFA3E7283B AmFCC
12,421,741 *015BD00D1B5A199473F004C02D9FB04BDFBD35AB AmFgc
12,421,742 *01588AAB42895F904E907D293028169A99EDF86C amfibiulo
12,421,743 *015F71ED82E92B9ADD9057DF2126B6CC2362C8A4 [email protected]
12,421,744 *0153EEDC0C2EECFA7E756884E9FEA6DB5F38C4DD amf-rpc
12,421,745 *015A536A559BBA4267CF640684C44589F9992597 AmfT2
12,421,746 *01523CCF9F547C503F761AC215209296265E65DD [email protected]
12,421,747 *015FF2AAD5848EDFE91940211B694FC4062E3AF2 Amfug
12,421,748 *015EF59CB6AEBB8ACF5E66F0A56C13F74BD7B71F Amf"v
12,421,749 *01570BD0911EA9A4FA0D6FFBB500FCFB42FBFBDF AmfY?
12,421,750 *01560B8D758ED836DAC9BDB49C3BB2D50D21A4E9 AM!g
12,421,751 *015CAF7B95E9A140B80FF67399ED96C768309A7C AM=g1
12,421,752 *0156375636BC72C458640392FDD15D0774564BBA AMg4H
12,421,753 *01506D0E3868228607D1A2E48400FB5E70FD0E34 amgad fayez
12,421,754 *01579775C75318C1FDC1111F6EAEBEB10E47543F AmGcB
12,421,755 *015383330680B17E9D3C0F2FD1009CA2247E84CA amgelhp5
12,421,756 *01546A880B3D9103836AF86AB825FBCC9F76D053 [email protected]
12,421,757 *015C7F5747155A382917DC8E7C6F0C8E532FF8E1 AMGF"
12,421,758 *015BCCE51ADCA8EA6011618BAB3E976C903EBFBA [email protected]
12,421,759 *01579A83EE47F53C1238988B0A8C653EDBB2C919 AM.Gk
12,421,760 *015A4A1910683857E2549EE8B7ABF59D308EE212 AmgkK
12,421,761 *015706E4A05C0617CB76D9E0C2CA0B72BFDA1FEA AMGsingles
12,421,762 *015FF1406787E55AE42A228DB9AF7A7C08E96AB7 [email protected]
12,421,763 *01574AD16B25078392A1DF0B261D8BAF3355B975 [email protected]
12,421,764 *0150D52525CA7A1170C00595AEDE953A85D08DE4 AMgwE
12,421,765 *015538C2E4D421E5FF95F49ED74E72ECD3B48906 AM(!H
12,421,766 *015B2E7FEC48C28D1492F4F60916191CD4B2AFF5 AM+-h
12,421,767 *01578BA6A9E561FADA7D9835C119963C44BCA1C9 AmH1!
12,421,768 *015544D569A899DAA80C098A2194C38F98E4F8CE Amh%5
12,421,769 *015E7235F01F3C5307611C016A9D499CA399D08B amherstamherst
12,421,770 *0154DCB94E24197EA1CC61DBB4F0A4EA127F157E AmHhu
12,421,771 *015F4CBD1C170F05DEF77A4AC43B5B316E2C02A7 AM!ho
12,421,772 *015CB07249722F27B4221AF51B6160729883E013 amhqp
12,421,773 *0157B35E90E97B20696A29F4D268B2442602E163 Am/hu
12,421,774 *0152680C93B3D2F54AB81993CFC4DA7B38938F7A AMh+W
12,421,775 *0153B52F443A1292867809A03490027AD8A5BCD7 amhxs
12,421,776 *015CAD03EDDE2EF6397AE7B8BD914934ACA8688F AM"i!
12,421,777 *01540257CCF6B03EFB1BA663D19985BBC02CAC67 Ami$&
12,421,778 *015BA078DAE8CA509A6030962B3F75FBC45FAA89 A)mI4
12,421,779 *0153EC408552893F6C9078E73F07AF38E4634445 Amiaami2
12,421,780 *015106CE1D819A68ECE4524BA85E41EFA329CD16 Amiah124
12,421,781 *0159E0A2A3238AA90D8C69AEA1482C4FC6BC2F47 Amiah484
12,421,782 *01513F40A6BD71EBB8FE8F099FAC0D5DC0D86B4B amiah570
12,421,783 *0155BE86771269FA2C52287B55E7BBBBA2C13700 Amiah668
12,421,784 *015522B8943608769316FD5B1B583D79EC6E88A8 amiahbaby
12,421,785 *0154D2AF8EF44C34CB90F0B3AB16AD8147B38615 amiamau
12,421,786 *01547EA5469C0AF56E5DB288BB0A3B033F3F6336 AmIbd
12,421,787 *015BDDDEDFF520491C9CD62602F03262DA93B29C amibms
12,421,788 *0150ADC47BD9F23199876FAC69AD95F170D006BF Am:ic
12,421,789 *0155D59F391087162D695C2428EF81405767E983 amichiel6
12,421,790 *01558F7BBE435EA5AE2AC17697055C94FB031516 AMID0
12,421,791 *0155BB45FEFDDC6948608E51E0F51D59A9F1DF90 AMIDASES1
12,421,792 *015D7B6331D7C639A345F02839D84EC8A39975EE AMIDOSUCCINAM
12,421,793 *01575DB562CDAFF2D82CE3E812AEAC3BF398A8D5 amieredman
12,421,794 *015A47D8E627A2A7F020170547600D7717E48F5F “Amiga
12,421,795 *01548CB68D5C57116C1DCFD9B4F81E0F935ACB16 amigac123
12,421,796 *0154F67C4FB5962102BAFD4391ED30FA796069A3 Amigaemmitt
12,421,797 *015B6C716CFABB75F57954627C966C6AF0BB4F15 AMIGAMAGIC
12,421,798 *015000B9B35E0B71AB135F3F99FA325D8A10778B amigaman123
12,421,799 *01534B9A11C7C3D80B6BB73F6A50ECB2A0053FDD amigdálida
12,421,800 *015AAF8B6037955C16F52F6636824A267E70894F amigomapper
12,421,801 *0155F2723E3410AA3CBA3774FE28F4F8C6C9686F amigoss:imati
12,421,802 *015B80EE15D11CE3120477CAA4FF9C0109746260 amigreis123
12,421,803 *015E4E34B0677AEA6F57A2B9BF5F1A78E5A2B5D0 Amihsukus
12,421,804 *0159A0370DD6FEE66C8A503E7F29FEFBA51929E5 AmiiZ
12,421,805 *01527AB233674D884C7FC532D44C01AB5F3E311B Amikasas7
12,421,806 *015E6D1C32C5B33BF6F40D38FDB4D29FAFCAA333 Amikeco»
12,421,807 *0152A54B1BF52CA0929661A972CE6AF2649F9E39 AMillionBrothers(BlahBlahBlah)
12,421,808 *015B8871CD76D0ABB10FAFBB89B08E1F1DF1A03D Amimia4
12,421,809 *015F7FA1775F3794E41A661F3D5DF429ED63D046 [email protected]
12,421,810 *01583FA6997DC17221FD0E75E817DA5F40EE2CCD Aminangams
12,421,811 *015838BB8514EAA7B39618AF5100CD818322DB25 amin ghane
12,421,812 *01539376467AD3D38F52CAF595BCB2ED3233F5C8 Aminhotep8
12,421,813 *015C9A9EE4F9C8D7C4D4CE4C43D157C619B96918 åminnelse
12,421,814 *015FE9B71437CE38EA8D659D40738D5C9EE62080 AMINOGLYCOSIDE-INDUCED
12,421,815 *015877AD83DD601080CA40B3768F950DA02BFCE7 AMINOGUANIDINE4
12,421,816 *015CB42EBA5B916A5E25E36B68BF1F8E0DD10200 aminu anwar
12,421,817 *015741A31FB9C59D465C2A90427C4A3B1F4C4377 [email protected]
12,421,818 *0159935AE479E3A2945D815125925745A48C9A61 AmIoe
12,421,819 *01588C15B79725E0AAEB0D939D0C94E16F0EEB93 amiposte123
12,421,820 *015284051350FE5BBA3B180689EBD59B03829C1A Amir618
12,421,821 *015443A9CD9672B800A3EF569BB59BDC03C8F047 amira banoub
12,421,822 *015E600BC6920B77FDF6CA74986D1EB4077D5940 Amirah411
12,421,823 *0159DE94FDEE370CB4E2A7A5B335F26BE5D284D3 amirah706
12,421,824 *0154C6A58C7F2EB36DCA104DCC4F661110CC7E01 amirahirwan
12,421,825 *0159F95C4903F5C6972E6E7ABAE06677398A592D [email protected]
12,421,826 *015B88C1A7A16DBB5C0605E5B3D9BA346225DBAD “amirallerin
12,421,827 *015841B013FEE5B59904E5785F6D5474552CADF6 amirhamze
12,421,828 *015D3F034B904946DC3BAC8CE75CC6C312F4FED1 Amirhossing
12,421,829 *0151A2F9BC61ACF5C8ACE1F5F9F5970731FC2067 amirian.com?
12,421,830 *015CAF035513CF026507BFE830AD78CBF3DE4174 amirmilani
12,421,831 *0156C67C54422B4D842B1B4A14A5B85CC31631B0 amir moktar
12,421,832 *015EC374338D013591C661EE418A5743BFDB8E09 amirmoore
12,421,833 *015A9C95148724F0EB3E31B1ABC4059B656DC7CC amir motallebi
12,421,834 *01500C0E6B511BFFABE6BCA0BA228EBF0705B5C0 amirshahmi
12,421,835 *01509B9FCE71E1090AF652A7D923FA1CB2BEC6AE Amirshipses
12,421,836 *015FA26D242BABBB9F055FC67D8E8CD03B9BE266 amisailor1234
12,421,837 *01548AFE32E12A29C12D02074462B26828EC9160 [email protected]
12,421,838 *0159EC69AEEFF53C485A5B309A8B5B9A7F53EFD0 Amisemihs
12,421,839 *0154F585464A7D491D0782ED5F5F145A7861BAD1 amishimaed
12,421,840 *0151BAFDA3A8B71F05C3F36B0BEDA7F33166E05A amissingsense/rasa
12,421,841 *01519931D66702C8CD616589FB4E34697B2B14C4 Amisxoy8
12,421,842 *015C766F03D5F16E7488748E6BB8F91D7E2C18B3 amitabh choudhary
12,421,843 *01587A3826C553AEC7F8C9D880336DECBAFFE9AC amitaja
12,421,844 *015765DC7255265D11A622F9E7E73E8725792D5E AMITARP
12,421,845 *015F24238FEC7FCA5C796EF3F761D50F0D8F6FC4 amithasilva
12,421,846 *0155E89AED69ABAC02CFCB873B13A648D62A287A amìtidas
12,421,847 *015DD24764BD599A250B7A2FE84B50B0D8D3B3D8 amit korach
12,421,848 *015CE71479989B81F3984A2AF5AAE823A7EBCC5A amit k roy
12,421,849 *015221E246C2FE9366F0CD56743C3C545CDA4A3B AMITSAR
12,421,850 *015DFF3941F42BC4FFFCD82BF06452E89F58F6C4 amit shay
12,421,851 *0159060DEA1236C633056134B15413C137478775 Amittendam
12,421,852 *01563186DA8970EAF494E4A469CCB19833B0804A amitylaw3
12,421,853 *01503E7084759DF557D5B750F3BC6A796D0461BD amiudailhes1
12,421,854 *0151838F07E4467F5804DCA46C4DD708E721A12E amivocap
12,421,855 *0152C43DB6F582AA3FA210696DF504CCED88A7C2 amiyah011
12,421,856 *015D0EA6B114928FE8B5718DE5BDC99626BCD55C Amiyah622
12,421,857 *015F4158E9D3DE8C3BA1462EE3A7448610466BE6 amìzi
12,421,858 *0158239BD92F11A31A5A09E4B93108D66CB36733 AMj1X
12,421,859 *015EC47BF2230109950E228746811E62B396C738 A(;MK
12,421,860 *015DA55C035818E7E4C2C8D5221727C39C9A7694 AM,%K
12,421,861 *0157BEB46225BA2B71C7EB08269ADBCFDE4E53A6 AMK#_
12,421,862 *015CBCB2F10F046F83AABD2CF1C4CBB4081CC46A A,M
12,421,863 *01584FF959F492763F275A2786FBAEF97F3D1FEC A/"mK
12,421,864 *015AC07C54ADD8FD35CDD929949D87F11C6D6397 A.mk1
12,421,865 *0155402715A8F2AF09B910F396646E1F358B30AA Amkaintz
12,421,866 *01521E5AE28BE55E8619BAC9C297E9F60C5C664A A&mKB
12,421,867 *015356656C21C77E55636C1B04877890E9802374 AMkC"
12,421,868 *0155303BE4AB2E0F6CC590317C5343C6C7321391 AmkD?
12,421,869 *015F7D3B1E8B723E01488D338FDD3E1A73D2E8EB AmKDv
12,421,870 *01590E2A73B41735109C427F8E101B508EB60E4F Am-kh
12,421,871 *015ACF9C0EDE395E0BC099429FD451D614AB0D70 AMki+
12,421,872 *015193570974894A5BAB893D1ABCB8E23733D241 AMkj"
12,421,873 *01500A313900FD62E6F6C5820AA818A14961CD87 AmkON
12,421,874 *0150457766F66CD72F74E21A234CE6C841A6E9DA AM%Kw
12,421,875 *015E22FFD05970FECEA129EE62D042D0AFC8AC65 A_Ml"
12,421,876 *01563B8BE01939B7F5FC2CDE6E91D2C8383A76F1 A&ml!
12,421,877 *015F86692BE9231A0F81A3EA543DB1655553C5E6 Am.(l
12,421,878 *0158100049AD3E568F5C2334C62092C476881F42 AML00826
12,421,879 *0154CA8C4982A0CF1BF1257FF6F06E2B954866AE AML;3
12,421,880 *01569265448729C4D54D1115A9C2A77AEE69380D AML7d
12,421,881 *0151CEB6E066581A703725174A376B053AA23CBC AMl=9
12,421,882 *0159F904A08F43E86986F3B8AECD9B4981089782 AML9e
12,421,883 *0155D4384BAE8C5DA62FBE40D8DA8BE241C0BA5E Amladnaw8
12,421,884 *0152319253836448D2B9B367286D4735978BF1BA AMLAWB
12,421,885 *015BCC68272E3C07B2A2D402CDF4342373B1A357 A=MLb
12,421,886 *015CC515E04BFE67DE7A5CEA3AB61F433F8E533A Amleggen0
12,421,887 *01590A4AC21E9B1A2923A32554BB73D79F490453 AMLF44
12,421,888 *015D51532D22B00F94AB98C42AFE32714E16B128 Amlj1
12,421,889 *015F340736221AF38EA63D1E5D2BDF837AE205AE AM,LM
12,421,890 *015C3F7AAC1F6B4F6F29D138A8A62AC79687C850 AML!N
12,421,891 *015E45A97B338310309085D17DDD885457A5F9FD A/mlQ
12,421,892 *01505D407A74B9478626F590E5C9A54C48E550FE amlraFcM
12,421,893 *0151799502FFA8E39FF9CACAC07CF53A95F2636C AMLSN
12,421,894 *015194AEA5A005DF6511BCD1F684A61808D3EC2A AMlTD
12,421,895 *0152AE1A09BB71E4D986C65D22C3F470E7B9AD31 AMLUe
12,421,896 *0155BFD12AE93E827EC0E3C786C898FB3A828E3D A(M)m
12,421,897 *015D0B08A0C357FA3BD361A8ABAAA9B7ED536237 amm0n1f1cat10n
12,421,898 *0153C1A0C398DCA299E5F4F56F99A5DBF89D0906 AMm7+
12,421,899 *0151675C3095A36FA479B00C492508DD571C655C Amm(8
12,421,900 *015D0FC2611BF54ABCBC4F4649E757863EB8151A AMMANETTAVANO
12,421,901 *0157C9377F7E1E625C4DA45A1F796D04734C5E60 +ammany1+e
12,421,902 *015A82A4321B6C05BDEE638EBF2CB704C261780D ammar khursheed
12,421,903 *0153C232D4E5A58C637F75E5D14326A40114ACA9 ammar mansour
12,421,904 *0151D5A7C090FDD112E8E23DF1AA3102B06DFA8E ammassavi0
12,421,905 *0150A2E892CC44F28DFD6BB8183E18794918C6AE ammattilaismaantiepyöräilyn
12,421,906 *0154D81FE5BAEF0D102D35F68378C3E957527AD3 Ammcvso
12,421,907 *0151644184EF7538500F4BA0F517A354899B77EF Ammensing
12,421,908 *015CB279CD4D6C7DD97D90C2734312A31F1FE0B4 ammerson7
12,421,909 *015561318A4779824B64515B70828B10074CE589 AMMETTONO5
12,421,910 *015A13CB2B2CE688306894188B733F8D3C5B6AFA AmMFE
12,421,911 *0153F8855906C16F46D2969358CB60704A309A1E AmMHu
12,421,912 *01539715DFAD0653EF9C1E9A3492CC9B29E77EBD A+MmI
12,421,913 *01540279B3819D8ED6395FE2D656C99B3EFEA46E ammignonassiez
12,421,914 *015626006133786618B13AF0E5D404DD838B539F Ammijruh8
12,421,915 *0155C7527CC868754889472036DB192C9512439C ammmh
12,421,916 *0153AD9AF2A11F65FF9795C952284C4556935BA3 Ammoniace
12,421,917 *015814A3753C26516FE566C880B94FB7E200097A Ammoniacum5
12,421,918 *015D70B1D9320469E1E76078537C4334F5079883 Ammonifiers8
12,421,919 *015CC6A41ADD9C177047EB6578E01A383B0F4B95 [email protected]
12,421,920 *0155310DCD547FA181D560ADB1F9D65B675A3918 Ammontar7
12,421,921 *01592AE1AAC9C74CE4E6971466FAA8674D9C509F Ammophila7
12,421,922 *015C479E28052653528D289E6DCF4F84B53FFEB6 Ammrtstu9
12,421,923 *0155B532E45E7821B69214C16FE1012C27543E18 ammt21
12,421,924 *015415DF09224FDDE8C568508703B0D8F6725CC5 AMmTF
12,421,925 *015CBB8FE208A86C5258B49AA791C182A6863C8B A(MmX
12,421,926 *015D0EC2F07B85E99376A54887364EC6DA6F4E57 A&M
12,421,927 *015A10908E62CA230BEF9CC48F79C9BDF3E9A674 A"%mN
12,421,928 *0157DF05BF730096A77B0399265120300CC2F820 AMn0%
12,421,929 *0154F20C30F30305CB8A1D974D5D5FF268B1D47B A+mn1
12,421,930 *0150F8752444DE259F546CCCED64697CD9E61166 AMn6w
12,421,931 *015CCD79E908E39CDEB1574E4E2FE0F75B57F0DB Amnages7
12,421,932 *0157A6684C536C5EA100660B20A50F7E632C567C Amnd"
12,421,933 *0157D0F16A9F720E19910F4A2B73AD307E8DA218 Amnegaha
12,421,934 *0158BEA2D214DAE07F7FA17943CC975406747563 Amnerait0
12,421,935 *0150A291C57E8A7AB226F8DA752E874D85937AE8 AM;NH
12,421,936 *015D42F1633EB8AE9E711C18B1D8BB99F837B235 Amniac2
12,421,937 *015724960CF5E294795734855D72C7D64739820D [email protected]
12,421,938 *015494453E90D17875558705335A332D7074FA78 AMNISTIIONS9
12,421,939 *01555416B1BB04B5942F536E9138C47CCCFA849B [email protected]
12,421,940 *015AEEB5DD40614C752017B4245F38B8ED79A440 AMN
12,421,941 *015ED781194BF6ED5BBC2D4EF534DC4A375449B6 A_MnT
12,421,942 *015ED8F50FECFF41810984B49446F7B9C568130B AMNUX
12,421,943 *015FC8ECB44BFBE04415322072F7C25736528CA7 AmNY$
12,421,944 *0153BE9CA1983E4C47C027C65397340C45D24F0F Am/_o
12,421,945 *01507C7D71C9CC9CC25C02530C918A2FF3E4DC0A Am=o8
12,421,946 *01543F5D2BBD05DA3B9088624256EFFCFFB20D0A AmO8q
12,421,947 *0151E6969369AB9F25CE1FBA0F5868BEE5F6688E Amobarog5
12,421,948 *0156A5360FF447062B2A176373BE60EAF532A290 AMO;C
12,421,949 *0151A1E624AF04BEC13FFAC250153D6A1F364D1D amochers4
12,421,950 *01515FB9B125792765031232873823EDD1A393D0 [email protected]
12,421,951 *01520E8ED54B6EFD525CC2D9114F7F140D70F965 Amocisum0
12,421,952 *01575BAE5870260EFEA961F92C207EDB8587D938 Amoco.
12,421,953 *0158C8939613A0D1357B1CFAC31B75931FC5C99C AMoE"
12,421,954 *0155A3CC04B150E2C59024E6E58FCF7FF74F59D9 Amoebend0
12,421,955 *0159E618B0701BD22DF98F1A60BC9CE741251E90 amoennaxhe
12,421,956 *0158AA8196B70E967466516D3C8364FD5BFDC7F4 AmO;F
12,421,957 *015BFFB6A7D12F0220D56396ACCCE957497C03E3 Amogogam
12,421,958 *0159B4DE79699D856C76151F4C7993B81FF1A02C amogono0
12,421,959 *015AC0959D5EDC0DEC7843F1917749385B2EAF76 AmO)h
12,421,960 *0153D9C6D0C7A12C73E2C0781C3CE5C06231511E Amohcirt7
12,421,961 *0158665E2D55125E6909E114104AAB4DC5098E83 Amoi-
12,421,962 *01533F719BE15E2D0E9AEF9D22D5A2A3EC44D261 Amoldam5
12,421,963 *015807E24F412FF0D6687AFF084DAFB18A9AE0F4 Amolify2
12,421,964 *015503ACBF8F089F41B3B1A9EBBA9DD5A96D22B7 amollicutes
12,421,965 *015648A7B123B3D783D7F0EFD019E68B225EC7BF Am-oM
12,421,966 *0152463A1777267CB8E8E176079095BB9298BA9F a moment in black & white
12,421,967 *015B92818F444F01C4000FF1E7FAF1C49DA5BF41 amona27
12,421,968 *0159F57C7672F427F5AC9534E127719DCAC949A4 Amondsena
12,421,969 *01585179C3C9654E66D54B0080590547AA25930A amongezes
12,421,970 *01577B8EBB55CA66939856A3C8B6342005DC1103 Amongse4
12,421,971 *015A7BB0446C1EF693F37E992417972B60D0A8C7 a-mô-ni-ác
12,421,972 *01599B951468C4C3DEC20FAC470727F21965BA78 amonites3
12,421,973 *01561DDA4556EBAA35BE1F13832A7B40921E33A4 amon khan
12,421,974 *0155964ADED86DFE610B5C92BA3106BAE7A6DDFF AMOnw
12,421,975 *01561E6549B09ECD208BFD3AA2446A1EE3E1CA97 Amo-P
12,421,976 *015A500EEC812613B0C794B6D8D235C0AF278302 AmOR+
12,421,977 *015F6B8DBA730BC9602139A48F09869B88C5487B AMOR1228
12,421,978 *0158CE4B491249FE445ED38C48F538DA1000ECB7 AMOR141994
12,421,979 *0154E76D3B2DCB5E75043DC125AF88A9E26BCB43 Amoraim.
12,421,980 *015CDBF05EC57410E35C0BDE4DF7514453C26164 AMORCAMORCE!
12,421,981 *015A08913092D3FE994C50B0CDD647D1BC461E30 amor cubist
12,421,982 *0154DF72EB88BB53F74B3683E0762A0BB59EAD95 amordaava1234
12,421,983 *0151C0E12006E5906DBEBA887483C56F30A19B18 AMOREINTRIGAS
12,421,984 *015E05B7AA8289DD828BB108F79BF5CD51A4E5EA amoreiras 25 0
12,421,985 *015CB7A28BB5CE9A3B00DC9AD7C1BFE1A8AD15FC amorenarme
12,421,986 *015AB703AFB3A438991F26A8E18705FFAE21C670 Amorgan9
12,421,987 *01544A16A5351DB4C7A90DBAF878715E44EBDAD1 Amorges8
12,421,988 *0150EB8CD24A36531FCDF9AE803586EE78EAAB38 amornrat2
12,421,989 *01540A55013736CF0C8CB776B7C2F1748E10B8C0 Amortisaties8
12,421,990 *0159C65518F495B129EE465C2DC4682E3E699460 Amortisation?
12,421,991 *01593F970B69E4676A6103AB5B1A0C55610EBA91 AMO’S
12,421,992 *015522E7AEF91F31CAA66EFC94FE369E5E2C810F AMOS1198
12,421,993 *01541A42705DA099C4B651F0658494E58433E7F8 amos.broker
12,421,994 *015C0BB3EB84A7AC47A82C7374054084A3D74303 amos.crapo
12,421,995 *015D1D85B540D18C20F0AAE75C865CF27BD62986 amos.dewyer
12,421,996 *0158F4D798F07191CF4AAB6203FE9EB1C1D2CEEE amos.freestone
12,421,997 *015C9AAC1CFC8CBE68ACE21DBB9437FB1FC67FF3 [email protected]
12,421,998 *015B0FE340D91D90960F632B865A2C172531F27C amos.kroening
12,421,999 *015582AD8DEA2DA20C290275BB328A589EF6914C amos.lamy
12,422,000 *015D2D335C744E35F43AF4785196A64FDB253781 amos.macwilliams
12,422,001 *015CCCFF2F973F4BA396E4FCD8D5BFB0C2EEA82B amos.maish
12,422,002 *01537AC1E021D01158FBF86E27A9ED2A8E2D55A7 amos.peelle
12,422,003 *01572ADF1AC110BAF4F622D003649D2FE4376FD4 Amosrymes
12,422,004 *015141873EFAFE50DF7C19D17867C8FCD696A6F1 amos.sheltra
12,422,005 *015295265E5344035A8B0993CCB6F91044436085 amos.soricelli
12,422,006 *015085823DB3697AAB252F4BC30C105A184C4BF4 amos.spontak
12,422,007 *01563FD5CC657BC487EDE0FF1E731BFF915953CD amos.szachewicz
12,422,008 *01520FB473671E0DB94463BC6320B27087AB1250 amos.tigner
12,422,009 *0157F8AA225FAB89A42E3709B276DF35E3057A91 A-mOT
12,422,010 *015F345FE3C563E0A7DFA94283CB602C3B67ADE6 a motor-bike in afrika
12,422,011 *0152A5A8DE3AA69A9E7800EE2B61412444DC0504 amouamoued
12,422,012 *01588C9B04908E5AE89102650C0C96C9D5BF95E6 amoucarlhas1
12,422,013 *015CAD41D8425702E9E8A4C702FC8A5AC6BB989C amouchado
12,422,014 *0153CD123DB6C7D2B86EA0FC199BB9F431A87C7D [email protected]
12,422,015 *015A8EBF06CB529C494B103D3D8E555B59FDD357 Amour):
12,422,016 *0153A0E4759AA91AFEBE969F42C2B5CD49C86728 AMOURME1
12,422,017 *015518FF1BDF443FC3C00C44D7C2EFD070BD2103 AMOURPHANTOM
12,422,018 *01507773ECA9BD2887085C202BEAED5DFE21C2F2 amours fragiles
12,422,019 *0159B1B4E16EA82CA51E8CAB05B1B02171B3D376 amoutis8
12,422,020 *015A34AD13CBC1EE51968F9639EE9D425B37765C AMoWA
12,422,021 *0155025CB942750211DD3499701E890D79E7A09C amp0000000000000485.
12,422,022 *01517CC0BEB5ADF386272ACD60FB0BF8C44A6EC1 amp0000000000000810.
12,422,023 *015621DA60AA00652048F024410B7842104CD94B amp0000000000001639.
12,422,024 *015C5CDCCBBC21FC09926082720DEEB53F00A6DA amp0000000000619556.
12,422,025 *015DB3EF51C56762493650F50862A48767D22F7E amp13509
12,422,026 *015257E09CEAC12C0251E26D08B48084DDAE91A3 amp16927
12,422,027 *0159378F918472796C1807DCBF28049ACE94B7D9 amp2732
12,422,028 *0152393E9ED22497D6A104AD89B73BA1DE8077CB amp4045
12,422,029 *01578454220EDD62528ACA9762B078CFBF0F6781 Amp9P
12,422,030 *0156D7F73097EFC05F8E321E993C88581C22FDFD ampalaya123
12,422,031 *015CE9F3D1A7A09B296F9B4ACBBC681BA9B62B52 AMPALEA.
12,422,032 *01581F4420DBE4A19DF2BEC5E0D81A970868D122 ampalphaampthetaampe
12,422,033 *01556A182E2E99289C8F512B8819D8B938F3FE64 ampanangs
12,422,034 *0150046C56A9E06EAD837FF63266FB590A6A4640 AMPAUSBSW
12,422,035 *0155A951C4391FA553FAA4AAC53DE12ECE70538D ampbibalus
12,422,036 *01570D96C315319DC68EF0AC68F36C430C8A7F8F ampe1234
12,422,037 *015EE7BE15226431181F28F1F4DA6A55FF05F112 Ampeggio6
12,422,038 *015483071727ADFC32F08B5D6EAA606D3E3EDE87 Ampelfarben
12,422,039 *015FC7AA5B9229B0D4868EA25E79E94F68257645 ampertals“
12,422,040 *01529498AE3A7D5D94774AA3669091DC0EC125CD [email protected]
12,422,041 *01512953C7E01313E96DFF9A8D3596D588F78327 ampff20
12,422,042 *0154C38A0F3071AD3974FE650712F92249ABE433 [email protected]
12,422,043 *0153D9F7BC67D469B912BB75A5AC500F483B06D6 amphetachronism
12,422,044 *01583F87F9C2EBC747EAA1B6F6D05459AC661560 amphibol123
12,422,045 *0158650FCC6CF670AFDC92E494448967047655DD amphibrach1234
12,422,046 *0151C3ECA8CC1C20FAAF5671EEA84450BD7A632E amphigas7rium
12,422,047 *0150E5BCF186C9E98BF2AE9DE179BB61AB22A38C amphipathi
12,422,048 *0157D118055925C68A0BC659C199CC76A368DE7E amphipro5ty1e
12,422,049 *015080462CF3DBAAD17C89F71C4C9FD5D0B8E9B8 AMPHISILIDAES
12,422,050 *015AA0E67C83995611E3D027470733C159A0F0E9 AMPI7H3A73R
12,422,051 *015E4792F6247036CE55DD5FCAE6AE010FD1DCDE ampichino
12,422,052 *015EEF39F1F55C2599D22A19661C24B9E3C56B92 AMPIIIBOUE
12,422,053 *0159C4905FD9FF232ECF2E10046DDBE1F0011391 AmP"L
12,422,054 *0158C8912D80EDA9A3259B400FFEBE94C2AB00BB AMPLIAT
12,422,055 *015D1F17D60BE76E43D58CCEE6FBBC5AD78705D3 amplificarmeei1
12,422,056 *015ABF17924FECAC61E2C72E504F60975577632F amplififer
12,422,057 *015E836C9DC3D9C01E2AE772C1CF356D2F5D7119 amplitudenverteilung5
12,422,058 *0158DC2096D21F2AB7937C62968E23828529B558 A$mpO
12,422,059 *015D98C7D52D977B5A0C67C36717FF75823B3E8B Am
12,422,060 *015C7FC96A7D64CD61104678A3055182BCD70410 Ampoti
12,422,061 *0154B920EF60806A9F61396E0C1369BD548EEAFD AmP-s
12,422,062 *015B2B4297B86AB6DDE5C7A9BBA8D1436BD36D84 ampshe
12,422,063 *015545D0AFEFD4AA7252C6C151DD3F0801C6F715 Amputada5
12,422,064 *01550D6EF3BB99AA5AE7189110BCF809926E122B Amputant2
12,422,065 *015C82B410363202CECE08A7DE50CF9452021DE4 AM:pW
12,422,066 *01579E098B963E69A7871D646258B5F4CECF2F13 AMp"X
12,422,067 *01506EAB6E49039C9D39FEBDDE5A13973C2BA361 A-MQ:
12,422,068 *01522B126721DB8429B69BBA3FDB4624FC5E8EB2 A
12,422,069 *015B1088BD559EF50DAACE31F92B2F19C39EC6EB AM-Q=
12,422,070 *015D8978B2BDF5BA6CAFDA2E91D4FCE49EB04670 A+m
12,422,071 *015DBA891562D49828D734F1ED47A66421B1700A Am$/q
12,422,072 *0152E55AD10E17EFDED26F1485DC7DA783C18E00 AMQ5:
12,422,073 *01542D5520602DF8C6DDE094FE738989FFA29F0D AmQBL
12,422,074 *015F6357A42AEFA5285D3E6BC1A0CFF9BB8D25ED AMqD6
12,422,075 *015EE0F8C05C45AF92EDC075D3F9589C83E15867 AmqH3
12,422,076 *0156106023991BAC3C80A9895354AACF62C36E03 Amql9
12,422,077 *015C2017DEE5B30B8F8D19ED3C0A7291E7C89DEF AmQ_O
12,422,078 *01595247A6A8D6FE6C3D9739E1049E7F4E1F3D09 Am;qP
12,422,079 *015219E7601536742E3B9EA61DF3CE64F2768736 A_MqR
12,422,080 *015242BA0C2A87C51C4D13F0F8DC451EAB00A31C A&mqs
12,422,081 *015A5B474E028C6964407E8D8476A8339D2C0D82 Am__R
12,422,082 *0150249BEB281EC664F30BA9F5EB99F9E817D14A Am!R,
12,422,083 *0154E360A645290DADDFC1251DFCD31CDF783E5A amr33
12,422,084 *0158F982A03E36A9A871575260B326ADE3451F38 AMR4U
12,422,085 *0157BFF5835BE044893168BD6849BE1A18B2632F amr abd el fattah
12,422,086 *015FF8A40F6723A1A63ED3A9696B57EAE6452FD8 āmragupta
12,422,087 *0152EA38223DA34BD7738DDC24CCDC1C5C71AAF2 amran ali
12,422,088 *015599CA45A609B5D7BB313BA1B746DB58F5BE6F AMri/
12,422,089 *0150C6A82BD955085C5ADA35C305A7343CDD7FAA AMRiq
12,422,090 *0152D7A739857E49BD4EEF56A678E1C7496DF84B AMRITA6
12,422,091 *015C9F1DD8EDD61FDD16D3019B7F48102F7A5B50 amritgupta
12,422,092 *01504139D0385B81386148C25CEA78958CC26CD4 amṛkṣata
12,422,093 *015907804A20FDB2EDD07B73AE7BE929E61E7B25 AMR
12,422,094 *015D1DACEDA288A10FBBBAAC3F8718834AB19B95 AMR)o
12,422,095 *015A1F5CDDBE91DAFFEF8BF618B81E27E41D34F7 AmRRV
12,422,096 *015C151D528BD5ED68BB499E95CBA15303EABDC6 AmRSe
12,422,097 *0159C661F7F4FBC2E9F8611A279BF187DAEFDB2B [email protected]
12,422,098 *015A070937AB6A4813663BAF49954F53AF172930 AMrw&
12,422,099 *015B4AFC74D9D51AE6A222D9E9F8E1CB310FF550 A%:Ms
12,422,100 *015FBE82AF55803B93ABFF6F876259B203D89777 Am.S2
12,422,101 *0152B584A4C4E0621E9C5FEA53C57EB0C5FDEAA4 AM(S7
12,422,102 *01540E6F6B6C2C2A52BA4D78027B1B2E50095325 [email protected]
12,422,103 *0155E7578ADF3A69EEEF30999973AE9C490BCEB6 AMSCHEL9
12,422,104 *015D51F55851ED14E8D9183D094FAD00BE2D7731 AmsDo
12,422,105 *015A4D5D48CBD4FBBCA072A75693F04FE0D02F0D Amsinnbff9
12,422,106 *0157BCCBA45248261F79EB01679AEF00AA956914 AmSOQ
12,422,107 *015878BD2AC1E645C26F60F7D839057A83A0C353 AmS-P
12,422,108 *0157DF75D761B4395E8B3009BB65ACE377D158A6 AmSpP
12,422,109 *0151EBD160919CFF879836B49A70C99D54A179E4 Am.sr
12,422,110 *01512FE26149AA4FDF48041ED6BAD46534BA689F amsterdamogg
12,422,111 *015D92ED35856FDEE34125F983C13F6213EA39CD amsteu1234
12,422,112 *015799AC7CD144C8A460DE56B0400599ABB25993 Amstresses
12,422,113 *0155D6F040BC746480592BCD9999218785D16130 AmSVH
12,422,114 *015A445D13B32729B4176E923CF272133241050E AM:=T
12,422,115 *015190E2F1B9537A278121F2F22B200F67A569BE A?&mT
12,422,116 *015F056B4CB3188C4B51ACDDC4A52A01E94DE8E1 A.m#t
12,422,117 *0159D9095D6C08EB6C16C7144CA596A67AD1E620 Am=)t
12,422,118 *015B4CC2FFEFE16AD93B734D2F81C0E020B96863 Am!t
12,422,119 *015B9898092467B5D9D25C9FF84943F6BC563327 amtをサポート。
12,422,120 *01561E795CFAEABCA5BD5B4F351D65ABE3760DA0 AMT6785
12,422,121 *0159311AE261C8E433E660C51151CBC0B52E0F7A AMt"9
12,422,122 *015D70F180AD19A3A4A6550D0E9A9585B453281F Amta9
12,422,123 *01505B2990FFD76AC4A42F79886C34A9763888EB Am$tB
12,422,124 *0154946BD70843FF45DBB42E0757F886C2B6BBBB Amtgerichtsstrukturreform
12,422,125 *015E34F1DD23BF82E9D33EDB020ED63A4E8C16C3 AmtHarbeit
12,422,126 *015B879B207E126F0A387EF808A42CBEC6E81F5A [email protected]
12,422,127 *0150B2CD75DDE693F04506A14DE4FEBB321BB411 AmT!K
12,422,128 *01553B3BDCBDA04678AEBA797EC8411B94588593 AmT)K
12,422,129 *01529DDA8BA60BB2746545AB3DDB6874EE3EF032 A+MtM
12,422,130 *01544F5940F97347450FA46FFE36AF4FFCBD664A amtrak4ever
12,422,131 *015B9B8A894E66E743D11823FD202439DC3A106A amtsbezirksrat
12,422,132 *015E8E65720332884511F7F8BB597BE82F98290C amtsblatt-verf
12,422,133 *0154ABCF77DCE6B578F8608FF6DA621E854E0710 AmtVU
12,422,134 *015D7228B56A8B50B6ED2B88EFDC940E4039DD02 AmT;Z
12,422,135 *0159B7447A35B12257C36D4FBED591B59C0C7FD8 Am#tZ
12,422,136 *0156B815C86F6FD3B8FE7DB556FE702D6BCD1BB2 AmtZG
12,422,137 *0155CEC67C7106DA88C11A16F7CAA05ED937779A AMU$#
12,422,138 *01505464059F57FBA6E254B65782D2EF51A91C35 AM/u%
12,422,139 *01572A6BC91B3BFBAB5881C2E91DC69FBAE6CCB0 AM&%u
12,422,140 *015BA8C1F81C0EE3105CF6783B05FDDCDA3D2FDC A?m(u
12,422,141 *0152DDC095377E672A89D63EC18A00E7FA011DAA AmU1+
12,422,142 *01508CBDA7EC67F576D2D3B0D26863D6B50BBCAE A,Mu6
12,422,143 *0156B3A8A1C9838734AD4AD8C72794648FB8A501 Amu(a
12,422,144 *015B4244CE908C14C7C0AA6865290D2FBE4AF5C7 AMu(b
12,422,145 *0154A740F883F9DC75560813E0682EAD2C1CE6CC AMU#C
12,422,146 *015FA029284B54ED160C72DAA36E73620F1E9436 amuchan123
12,422,147 *0153B6AA8006DA3C20CE10983E7FB9B1F02428A5 amuhrne2
12,422,148 *0153BA2EF9644447DC85676DB9663CF864069723 AMUI;
12,422,149 *015F1B8B856EE4E7F73580C20B2365B6CCD05959 Amuk&
12,422,150 *015CC4CF9911750AB80099C049E7629633B8F512 Amuka-Bird
12,422,151 *01588A726607D4DBB3CB9AC5DF651CA5BB90495C Amuletti3
12,422,152 *015891D2DC9D4C54E4E5AA60BE8A0BD4478E2B4A amulherengados1
12,422,153 *0153F814C60D16048CF76D1A820EBC1139E32943 [email protected]
12,422,154 *015D57FEE599C4A4FE2F58C7A2B31AD21DAAB2C3 Amultivolume
12,422,155 *0151FFC999BAA76F00278C355D0BDFF82AC4576C amunigun4
12,422,156 *015D130EF2FC4029C1E449A5D54085F480503C6F amuntuwandi
12,422,157 *0157F80C5518CD1D76785CA9F98A322010917CF8 A"MUr
12,422,158 *015BA35699BFF0C14356277E72F441753F539B8C Amuraja
12,422,159 *01509805F64FE7DE4E9917B1965D4F8D62BC21B8 amuserois
12,422,160 *015F32EF4B1F8B7AE89974407A1D9BED11D45FA2 amusersed
12,422,161 *015C74A9C65BFE4D1D87C50F6098450767B78F56 amutiak4
12,422,162 *015C19D9B1E56576AA9326324C303A31CD3FB07F Amuu!
12,422,163 *015C824528C3076B99DB1E9183A98D642ABFD740 A,MUw
12,422,164 *015D99DF36A81501D9203BF5A516EA57721E16F2 Amuzaugged
12,422,165 *015A01C267E26062E7C4B53828078AF552DA3C83 A
12,422,166 *0152FF2C257D9DD9EBB5E4086E2A77E0F8B0D20B AMV5%
12,422,167 *01528752A4783D4E4E000A08AF71E78BA6C13AF3 [email protected]
12,422,168 *015438D2D6A6D4D66024B707C424569CF9B70179 AMVDN
12,422,169 *015DED5518E5A005D5A8D490190C049279331051 AMVEn
12,422,170 *015DBFE8DF7E339E526F63DFA128F8EF7DBA4B5D AMVfb
12,422,171 *015984E8FB2AE26DB4C243417DCFFC084DEB3321 AMvge
12,422,172 *015D6A9F67C6E831E7C02C339AC99C4E8D071F21 A=mVs
12,422,173 *0150456ECCF4EDB6B490C706E76F90E79461A516 A#mVu
12,422,174 *0153ADBD5671C6A413824ECE0B34A3967ED6397B AMw5I
12,422,175 *0159EBFAB723966C317A52BE3C8954D32458287A AmW7L
12,422,176 *0152E7322F7E4C6A94588C870B2226073F6DBF6F AMWe:
12,422,177 *015198CEF46B3C62F002548BC2E8860B27B4FEFC AmW#e
12,422,178 *015DC05E099761531A93277ED30F4867A20CAC0B AmwEH
12,422,179 *0158B1BDD5B7825C291B5950C6BE575831F86826 AmWh
12,422,180 *015B0B9A8EC6D677AE9928A9D823AA66A2A8E13D amwili
12,422,181 *0152DC3A4406E5E463323811BAC700875084FCC6 AmwM9
12,422,182 *01572BE397B31E57528A494D46A2CB6D8501AF85 AMWNs
12,422,183 *015294A77EBE11B46C99956E997E4DE3D2C8D3BF AMWo=
12,422,184 *015E2FE848B064E4B7F6867A7FFBAE508E136258 a.m.wood
12,422,185 *015A23AE5E08667A3A45F0F809F163E8CE60BD20 AMWS7
12,422,186 *015CF89CE6565ABF4D92EA3DFB81C7F621FCD828 AM(Wu
12,422,187 *0158833CC24CECAD7B37FAD75E317C92ED0C3695 AM)X"
12,422,188 *015FA90865506F9A33008A745A54A20698A0FD73 amx.comwww
12,422,189 *015CEF63BFED682E6AFF543DF522B06F4FBE76F2 AmXdQ
12,422,190 *015F8C8514454A9B03C40B38CC2EB34105362ADC AMxI
12,422,191 *0150DD942E1EFFED046B52596F005E6F59ADAED3 AMXj5
12,422,192 *0156A9C17CFD6A3EADF206BD04D1696E4AB8AF48 AmXjB
12,422,193 *015B51921EFA1C656B00B66DD84277993209F73D AmXOZ
12,422,194 *01563199D7A55D28F9875747884B362EE65DAC09 AmXZi
12,422,195 *01574BFCA3DD06A0815A7B9AA81919BEDD54BFD8 A
12,422,196 *015A4C197B39F6D909EF0CD95681F1991BCAA93E amy-0226
12,422,197 *015596DF31B296BE4570F1232288F46FEF00B187 [email protected]
12,422,198 *0158EC8A9B90335E7DD60CE415CE9CAD8413E1B5 Amy345
12,422,199 *01518B953F6B53E03E581CD0E0E6D570D82096B0 Amya749
12,422,200 *01502BD3084415DCC03A87B05F421F354AA4304F AMYaaa
12,422,201 *01552CC6E10AC526ABDA0188357B16C4962CDE89 amyayling
12,422,202 *015593731A2144BB37335241B198FE8C629D9B91 AMYCATHERINE45
12,422,203 *015E4D269B43AFD9CA9BF8FF90922A559288E99C amy celeste
12,422,204 *0152DEE6FDED7C1DEBD31A47B91C3894381FD9ED amy chappuis
12,422,205 *0154B57260913A44F5062EDF8F7366140CE32B0F amy chau
12,422,206 *0159C1F7A8CBD39A55D67EAC80D91E2DEE51FA2C amy dietz
12,422,207 *015DF45EB8759B06F8FF4ABAD952896CB297F623 amydollinger
12,422,208 *015B39EE90F2576662BF1AA6D40B7BF6E1CCE8CB amy donoghue
12,422,209 *015401BCF50FCCC2A33BE2804359EE5A9B315194 amy dub
12,422,210 *015B04664DA26F427B6DC56ECF6B04DD365EF989 amyelizondo
12,422,211 *0150F40D5981463C08782FFDB553A2C8DEB7243F amyfeagin
12,422,212 *015895A150DB3F85AF99EA64F4B2D3F9F04AD4C2 [email protected]
12,422,213 *0156BDDBE90E5AD0CC6CFBD7852F03119211EE61 amyhollingsworth
12,422,214 *015659FA2D1601E937FB891ADC74EB54C00B905A amylemias
12,422,215 *015120BE3E48656643F38723211960144F390220 amyLinda
12,422,216 *0152CB79A19CFDCFDBA17906BDB1A5215F4C968B amylooe
12,422,217 *0151265F7EDBCF2D3518606508D52894C2FDA487 AMYLOVESCELTIC
12,422,218 *015600F8EF572C9D6E3F01C512F3ECBC34610071 amy mcallister
12,422,219 *01539801C81A590B9EDE0944B3F810ED836C4289 amy meinzer
12,422,220 *01526EC7B6531C66D86D856352E5D7780EA7DA83 amymurtha
12,422,221 *01531469F21A99BC8A29E9CECE5737D9AB971C05 amyorion3
12,422,222 *015C37969C1C942BE91B3D89BCAA1E8AC1B1256C amy oshea
12,422,223 *01542FEC51F165833A0EC17BE050EB772FB55CEE amyosman
12,422,224 *01586F0C554AA27113604E8B963774DE28B044F0 amyotonied
12,422,225 *0156BAB29C73037B30821FC4B1993B3FC2197514 Amypepper0
12,422,226 *015827D8A0D54259A57F1F537596A001AC8C0F57 amy pierceall
12,422,227 *015B60E922887213FB19546AF7E41B8D3D657AA0 AMYPR1
12,422,228 *0152CAF0721C93C07F88C12D141B7110327681C5 [email protected]
12,422,229 *015FDD5E6B0B374EBCE13A9E852AE0DC48FDBADF Amyroots
12,422,230 *0153515246EFABD662DD7C800E276EFD28C3D890 [email protected]
12,422,231 *01574BA8C49C880D56D3CA963275995D62BB9FA1 amy shaw collins
12,422,232 *015A96F6883AF63F05A60EAEA0EBA9577CAB5B20 amysor123
12,422,233 *015CB033D3343A9F576131B53E9D5633F127509A amytnys
12,422,234 *0159F7DB9FA61C8B5D0B862B3EE64B49DE8F4025 [email protected]
12,422,235 *015135373B602B6B9120DCD99E775567E3351409 A"mZ%
12,422,236 *015081EE4763A80AF328EB1156705FC7E6029448 amz012485
12,422,237 *015057954067695D377430C56592BABDB25273F1 AmZ3p
12,422,238 *0150AFEED045C1714A056EAED161E65D9AF2C816 amz556e
12,422,239 *015B42B26D3D3AC784F8D760442C2A217337830D Amz8J
12,422,240 *01528A50BE3F0CFD541AB543CC800C1932F0E8CB A-N.-
12,422,241 *015350F2FE16AB49F0A50EFE3CBE2B761150EE89 A-N##
12,422,242 *0158C61D8EE0FBDD0D388753FB89EC6A8048CDE5 A(;?N
12,422,243 *0155C4208528F2EDE6B3F2FE28A2B4D369E1DB07 A;%n/
12,422,244 *015943130A6166349F51842B0775CCFCA24EB154 A..n_
12,422,245 *0152886261A2FBAEE634A596F5D58B6B7E2049EF A")/n
12,422,246 *0155D95F944158C7F58293D7DB7A69DAC55283D9 A$n%%
12,422,247 *0158CA597FF7C19F45DAC44BFC88BA4C62D25FB6 A#
12,422,248 *0155CD1C85EB57F861DCC0D290C4B7D6487F1C51 A+n.#
12,422,249 *0153030133234AD32FC4193CC8EFEA764AB6D71F An$,%
12,422,250 *015761A3D4C65C33997401650FB12895C1BC8C07 [email protected][
12,422,251 *0157BE14E6A00C30F2CC1DCC18AAC3680BFA9030 AN$0l
12,422,252 *015A55DC0F9D899F4049975F4A91A91C028B50F6 AN0=P
12,422,253 *015F5A540DF1F6CAA3F6EAE429AD0AB91804B3F2 A$n1
12,422,254 *0150813F98CC019AF04BE4B32F17C36348AF4B66 An18I
12,422,255 *015285F6807FA064E00B60A3EFD16FB60A4A843E an18nut
12,422,256 *015364826370F186739623A7D95522F896E57D8E An18v
12,422,257 *015F69649721C7FE8CCE33B846C823EB1116095D an192
12,422,258 *01558921D79E5B9B97B544EB89085E3F2326AE1A An1B%
12,422,259 *01541B9B017C949521FB69DFD357102008583916 an+1blennorrhag1c
12,422,260 *01530DFD1BB0A8CF6C9335B6F34EBF61FA4E0491 An+1cyclone
12,422,261 *01506523A935800BBBAE9FB3C56BDBE1A445359C AN1-G
12,422,262 *015C44AEF05D9D6483A2B4E02C4AF496825BAA8E An=1H
12,422,263 *0152D67711C88B8794FE96C207A585A74FE02E02 An1I2
12,422,264 *0152443660D9E48C782083FF8AD13F7DFA9A707D an1lle5
12,422,265 *015F2619D07F5985054B96444ADDE0C26A012B7D AN1?O
12,422,266 *015BAE5B9A23DFD923015E4B35EFE61BF26F4E94 AN.1W
12,422,267 *015EE5CEF38AA348B7D9F8FA9F8FB91D3615D872 A"N2=
12,422,268 *0157C048FD9CF2E5E2CC6F3CA12375C0F9629AE4 An
12,422,269 *015B40CCD9B79AD0C6DA923BDE3E30116912DFB8 AN2lQ
12,422,270 *015416D6C1A07B9E6A46348CF8A9E6C5D4F6DAF7 A-n2S
12,422,271 *0153F01161D6FEA0A0FB155184EC63374ABD5E9D A.+n3
12,422,272 *01584B36B7404CAADAB9469AB967D936C44B7DEF An3Fl
12,422,273 *0150FB06C0F2A16774152DC753AB3DC279574E25 AN3$+H3$IO1O9I$+
12,422,274 *015D93652EBC0A6CAC7C890815E7E5FCB77B0D08 AN3/I
12,422,275 *0153CD80BC12B464F2154026976A7CA3E4CE556B AN3kc
12,422,276 *015897942A856AFB77E73B30FA2A2E87F4058622 AN3Q9
12,422,277 *0151B547EC460CB3E7DD730B00EF9299A916639D An,3w
12,422,278 *0155F687B240E962D1E0A7773CCD734AB0033F0B A,?N4
12,422,279 *015B0BC719579A705B6E90947B45A06A5FA3133B A;n4i
12,422,280 *0158B7735DAC8A0805B90A61D11EC226F71F7B0E An4T,
12,422,281 *015F3EC1F295D3670FEFFE7E38B48BB4219482F2 A%N5
12,422,282 *0157EB7FB363E8B7699010E3A3BF2F255FFA278D An&5s
12,422,283 *015DF6B9348696144B4F1BB5F4A2606D3076393A AN5YE
12,422,284 *015B40F6084B314A383BC8B85D5B46198F8EAED0 AN.5Z
12,422,285 *0157D03B6E8BD01218F395F6B7A45B18E12FE0AC A?n,6
12,422,286 *0156D4AE967E425C375411AA56483323F5DF44F1 An6tG
12,422,287 *01503C9161A5E3835DCDE1D1C67D9B61A51BA55F A,N7%
12,422,288 *0152B73A982C304721421D9FBB7A3249E39BFED9 AN(!7
12,422,289 *015FF3C80254245875DF78B2EE3C8CFDFDEDF69A an71synod
12,422,290 *0157E330369F9AE377BCE4C91DCF454D3743986C AN7
12,422,291 *0150822474B9ABDA3AB55CEA844BC38DE5A10318 an7ecavern
12,422,292 *0154195A5563928E3842E023A9298E0B7B19072D An?7g
12,422,293 *015C1BEE7D9FA7F561414E2A1AA3B731B7147F0C an7hraciferou$
12,422,294 *01555943B944A627971DC64C0F938B3997063D78 an7i5piri7ual
12,422,295 *01518FE7F06E5D2C66899FE5DAE1D247F86FB076 AN7I5U8MARINE
12,422,296 *0153F38ACC11EAC31FFFC1279FA24BB7FF4C3DE7 An7l1k3
12,422,297 *0154F6C9ED1CD63339F73ABAABFFD37FB13C8729 An7!!n5urr3c7!ona11y
12,422,298 *015B6E53E1F9C3C30BD12FBEA64CFD826DD42803 AN7!SERUMS
12,422,299 *0152B105FFB9B723649826DB7C1A97C1A0D8834F An7UY
12,422,300 *0156F1CBC7601BC34AD5A55A701DB1CE18563F07 A&;N8
12,422,301 *015AFF610FCD275DF6779C7B0D9E655391F63008 AN8),
12,422,302 *0158E642A08A7C96E66FB04AE3ABB72B8821EBE3 A,(n8
12,422,303 *01545EDA8EB9145861EDC0173669DEE70507372C AN8G0
12,422,304 *0159B60368ED0D17C10CA3C8E1D2399E83421C0E A/n8T
12,422,305 *0156E7246A2DBF2C4853C883482BD1CA71E8C028 AN9e.
12,422,306 *0155213F95A6442FCB2069070CEF1E7D3FEAEB3C An9hj
12,422,307 *01506BFE8167B75EEB4DDD8C3A292582DCF0CE49 An9jI
12,422,308 *015DF48CDD1946901B7A1D1CED03EF90D816F4BB AN9?S
12,422,309 *015275AAD7A725534A0FA85AE53427C16531A92E An9Y?
12,422,310 *015B250778C0C53D0E2E5599ADC98775753C039F A:N?A
12,422,311 *015588D02FDA2B87320DF6B21B293FA091C61701 Ana367
12,422,312 *0157CF6B4065ADBDE589B5081BB8C823A30B5AF3 ANAaV
12,422,313 *0156DF2B09D272D3C7E91B596BB838A14BA5CA7F anabelabarros
12,422,314 *015D61A4B7F507367CD20A836D28F1847F09B4E7 anabelcedillo
12,422,315 *015CB7E9C8529AFC2C685854F74151698FB7037E Anabella147
12,422,316 *01507220BEEC32091E7B0DC329EDA2544927AAA5 Anabelle467
12,422,317 *01566CC59AB0A7B94AAB15BB4BCA13F5C0C3A055 Anabelle904
12,422,318 *01525F458513B580067A5FEB81B07AC4A024B95C Anaberta5
12,422,319 *0150B2149C1EA63946A3EE2D6C0D95011100871C ANABLEPS3
12,422,320 *015C0C71116F1026833DEC73D9DE047C72B92A00 ANABOLISM?
12,422,321 *015C79333B731B43EF995048AAF68BCC673963A6 ANABTGG7
12,422,322 *015C0A40D584658F2C8DB7DDC2007D00F7BB7C3F ana carolina marquez
12,422,323 *015B72B61E50D2A21B70C4C58867BB10E5A20693 [email protected]
12,422,324 *0153A5059839C3DF6111DCD3A98AEF09CD2E7AEA ANACHRONISTICAL0
12,422,325 *01547D4C4F86CF6DCED453ED09341673461B96C3 Anacroned
12,422,326 *01594DAA68946E6C1D894B2008E1326FC82491C8 ANACROTIC2
12,422,327 *01538D68D5F5D6D4E90984D42B4F9C34E54F4014 anactrec
12,422,328 *015272D149CE5A2983FE514DADEDE599A42A031D anadadd6
12,422,329 *015AB39E986BA6D9DE0C3FD1510A18E621FDC615 ANAER0B!CALLY
12,422,330 *0155E51A713254DF28544DC8B3AD69B07E8F24D6 Anaerobiotically.
12,422,331 *015F60CF990BE3436FAB61165AE471596095B2E7 ANAFERNANDO80
12,422,332 *015E3BABB2DC5CAC39355065BC975E1BBDEFB780 Anagayek0
12,422,333 *015436B00DE36ADA4DFE710F055FFE947486831D anaglypticS
12,422,334 *0151C5CE1735B7388C7AD29054C04E36BE3BA73A ANAHARA
12,422,335 *01571CE11642E2FBD1C5C996C770CD73427065E4 anahcna9
12,422,336 *015E20E709315C43E11CA5746131E55C808D45E5 anahidulce098
12,422,337 *01582532E8381056CA2BACB2862AE819BF0D5B55 anahsiting
12,422,338 *0158ADFCE28E31EA360FF48598D8F43A80AD1412 anaible
12,422,339 *015132E682B95511DB7AEE3FB17746F5288E687F Anaideia5
12,422,340 *01540E9312825FE7F283A7B2F3C1C4C802D2572C anailuigged
12,422,341 *015434AEECC3FA5605FF7622DAD1663298FC89C7 ANAINOTGNIHSAW
12,422,342 *01557F6523578DE30ED06CA7DD8A4A6BA1ABE174 ANAIRB7
12,422,343 *015D72FA57368C24FF26306898F30CF3A085F94B Anairels9
12,422,344 *0150EFE77258287FC1356694210A538209AB9BA0 ANAIRENE
12,422,345 *0151DED9728F11B0A48F5099FC30BC4AC79BAD47 Anajaakaed
12,422,346 *015AD1E0A0DE8D2BB7B0DD4C0EF9D24AD1714FD2 anakalea4
12,422,347 *0150C5AE247433746FDFC42611C9F921174F3F1F anakarina300394
12,422,348 *015E1B1B24B187815EC22F1569514E08EF3BE8DB ana karina perez
12,422,349 *0151CF9F068D8EA7333E0E7E1689BD18515C377D anakaynaklar
12,422,350 *015935136C82F0367BA56582415A9966A221121B Anakronizmus
12,422,351 *015014C0CB3244535A4DEAE19DEFCE2D7B599A2A Analafra9
12,422,352 *0158D9EC40248DA65F5A49E25B337B2A71E7AB0E ana lagator
12,422,353 *01591979497CFBD72B526AE1FD5079CB82A7DECB ANALBITES
12,422,354 *015DB35C96B561CA2A2865C78A3775EFA5F2EB19 Analboys
12,422,355 *01506BAAF7B8AC1C3C1C03559539FD9BF4EC9B51 analbuminaemie
12,422,356 *0153E5CD4DCF8BE9FCEBAAA95D859917881579FF analcanalpartypalace
12,422,357 *015CD5D0C3A7F7D4D4ECD5FDB060A109BE1ADA1F analepses4
12,422,358 *015FEAAD750D92DCAF29F681DC987687E59DDAB1 anallagm0
12,422,359 *01577AFCD3C981D26703C0DD2F3B59CE0357B872 Analogk6
12,422,360 *015B9E42D4F0C6778CE16FC106CAEFB3BDA75996 ANALOGTOR4
12,422,361 *0157B1B9FBF2703C26E03DF92E97FCA0EA4D2791 analsfinktern
12,422,362 *0157C96B0FBD845DE67B5E7271C4E88E6FDFA37A Ana Luz
12,422,363 *015ACCAD9CAA05AA920D28646B51435631ECBE1D Analydia9
12,422,364 *0158483AD4AB422120D7C3281A5D122F1FD902DB analynpilleren
12,422,365 *015DE57DF7BA77B214B3395BB0EEBFC4603A08CE Analysis—
12,422,366 *0157C454B599DEA9140375E7EB357880F296A4E8 analysisjalbright12
12,422,367 *015FD8B21ECD3ED0533C3EE4FB613A5DB839F017 ANALYSTE2
12,422,368 *01553BA19661FA5936F3FD881FB2A2C99F9FDEBC Analystenschätzungen
12,422,369 *0157469B60617B4C758F39C0599AF64380C7B507 Analyti
12,422,370 *015F0593F229F62DD3D870F6CDF44A79308A68FD Analyticallying
12,422,371 *015D11C9CC548987C40C6D971A1A65D9EE1EFDBE A;NAM
12,422,372 *015B7D8B2DC710E886C456105FDF5CE2391CE00D A&NAM
12,422,373 *01512A7A107191A6E3FDC6B34F09CDDAB2292FE8 ana_maria9806
12,422,374 *015249811FB7DE5A1E4B7D02A3C38B72A801D310 anamariacoman
12,422,375 *0154505A4B53C16F2F177370BD618A87FC9C6DCF ana maria secara
12,422,376 *015940508CEA97CDAA2A361DE3D3F819C17876B8 ANA-MARIE-COX
12,422,377 *01562E2C20864D2D1C5CED70191055A0A88C77B0 anamaryaherbil123
12,422,378 *015832D57D575BBCF185F17BB7DC89CF6D5E4013 anameneis
12,422,379 *015F5E63BE5163F61BC1702543E16614BA2A91C3 ANAMNIONATA4
12,422,380 *015584F430167636ABD0D99F82DDDDAE36E6B646 Ananasu3
12,422,381 *01528344E9B7134A9AE1474BF044578959451701 Ananbusrosa
12,422,382 *015B4FBC487AD5CCE07FA712C162C6BE4C0BD7F9 anand chintapalli
12,422,383 *015E8C39DF15E9C26F9FB88513C42206E32DBC68 anandjr3
12,422,384 *01518A8CAB766193F3A788C47A6A4CA8F5809EC7 anand vijayakumar
12,422,385 *015F14ABC9404AE32B342C4948EBA98058B481FB Ananuuyz4
12,422,386 *0150E1A61768601E6B4D8B0965A444BE3C723357 Ananyevich
12,422,387 *01527C6A566A47333D3BBAFA57552A29DAB85A18 ANap9
12,422,388 *0158959E778B4F6BDF8C7ACA319B4C8720E17CCA anapae57ical
12,422,389 *015D9C9AC451D552CA83F6F84D1418E8CD14B2FF ANAPAESTS3
12,422,390 *0159F1AD087EE513BAA8CEC26DDD14E3DEBA939B [email protected]
12,422,391 *0157C1E8301565F94B0D865A601E7EA29CECFC14 anaphoria0
12,422,392 *015E6F31A0A4BE57B0956AE42623CD7AF0E43EA0 Anaphors1
12,422,393 *01581771D62762B1A96A18A40931EC6021304FBA anapletòrica
12,422,394 *015E710F4B108B0AE0CF1D734F60C989443A1C88 anaprilsecret(intro)
12,422,395 *015EAA062227B8DA1549DED70D34B89C3BCD9204 anaptiksis
12,422,396 *015CA355405D58341E67040202F0582D3A3CAA98 anaptyx8ei
12,422,397 *0154C5FFA5E3AF43AF30C24713B18470874F4F69 anarchiques0
12,422,398 *015FC97554FD029B3F662B2F7EFDA0B794B1D55E AnarchyinChina
12,422,399 *015B3AD52B013DBA1A6F7D26003C5A923B0AE4E6 anargirismo
12,422,400 *01575FA4779F44566C6930812E47224957DEE97F Anarmed5
12,422,401 *01532DA002A76B2F3068B34BC8DFF0C77662AA35 aNaRoda(Participa
12,422,402 *0158863A89A6C8ACF80E5ABA8FC6AABE12819FE2 anaronquillo
12,422,403 *015A6612513251F0CA0A544435B8758DDD362BB5 ANarva
12,422,404 *01582C59D92F415BE7C24341B38590B33ECC3B5C ANasa
12,422,405 *0150C0158EADF6E4DCC86E3F4E97B8D0E03730DE anas+asimos
12,422,406 *015A34778C4FF430772E327A37A58F3B8E27DAED Anaskafes6
12,422,407 *015839C4FCEAF39C2A99167B282B32B28E329A6B anasonka
12,422,408 *0150F3DDF23579309F2B14092FD0BD4353A3AA78 anasshafiq
12,422,409 *0153A936203AE5DB01C5268CE45240E496ACDDB1 anast0m0s
12,422,410 *0152E6493AA834FE1348A9D744DFF87A875230D2 anastas1ax
12,422,411 *0158F7AC99E8DC9D8DC512BB43CF459852F4AD78 [email protected]
12,422,412 *015A9E2D64A2F5A520E63C4307CEE2CFB8314DA9 anastasia300
12,422,413 *015CFAC35777B76C7205BEB58D6F1E8B82617B58 anastasia94
12,422,414 *0153EE4C7ADC2235910E0EBB78D8BB97E4A57922 anastasia price
12,422,415 *0150ED0BED9A0A51F8847D5792A71F9656CA5D4B anastasy-will
12,422,416 *015A2D0AB7510999894048AB3AF963D71FCC9750 anasteijsha
12,422,417 *015A3F253FCF4D5AF1EC16492EDF5B3BF4F9BBB3 Anastrofed
12,422,418 *0157149D362FDD6741E88D7C5D639C6B6A65F7E2 Ana(teranoid&MCNatsackremix)
12,422,419 *015F3610359EF4BCDE96CF6FF3533BC78789BFE2 ANATHERMIND
12,422,420 *015DA3CDFE5EC465431E90B2C4007639BE20427B Anatlav7
12,422,421 *0152C2E18D0B493E39C562BB35A386B78C94DD6D ANATOLIBSW
12,422,422 *015B80D6C4A0A965C263FAB8F2B60582F0985349 アナトモグラフィー(Anatomography
12,422,423 *015B82FC4A52E75603D9EE7E289D73159F0AF852 Anatoolien
12,422,424 *0156AFCFEE673FB049795772C9631A44475FE701 [email protected]
12,422,425 *015B75B0198FE65BDB64BBAE3EDCA6A2E4C62942 An#aU
12,422,426 *015F42EBC53906E53AFEFECBB69057C658574333 [email protected]
12,422,427 *01545723BAA666863C0A2B454F9E4A564F6AF237 ana vidosavljevic
12,422,428 *015458567E614A8A7EC431A636BDD1947383DA49 ANA#w
12,422,429 *01592FF39B72A363CF67FFFA3671BAADE0B8FE5D ANAXOANAXO
12,422,430 *015D9C02846D5FE5955CC4BEB3949FFCFED5A3AB Anaya709
12,422,431 *01518264DA0E9C8A34F0B721442A2677F2C4D7D3 anaya71
12,422,432 *015F8B0411A80154E843C7DF433BB9C03CCA0034 Anayaadding
12,422,433 *01518209A14205A9F7E07648AF63550948A375EE anaya harris
12,422,434 *01557B66E6FFE0BAE8A84F3D084CB482A7658AD0 Anazhta4
12,422,435 *015EEB4EFE9C59BDCF30EF6A939E467910966E15 A.;NB
12,422,436 *015994197A08C3208445DD836D3C7BED731A2D7A A#N;b
12,422,437 *015D7557641155F1C2BF010243B04B83C09BB042 A+n&B
12,422,438 *0151A44271D3285B207393A53FA4F9D1FD051A2C Anb.!
12,422,439 *015947C1B44891E0804C3B610C256C6F5CA1E351 Anb"_
12,422,440 *0150675290CEAEDE372123259CB05D8C739D9809 A!Nb1
12,422,441 *0152094E99B6C49C9A35805F4B307AACCF48DF69 ANB5W
12,422,442 *0153988DFAC2266CAE2EDD3BB7CF6B1557E19FBA AnB+6
12,422,443 *015893555F47B803C824F6782F1779910B0D8FAC ANB:b
12,422,444 *015AC9DB2BFFE6E6E26D097AA7F43CCF07493CC3 AnbbF
12,422,445 *0159ABABE8800BD4D818C26BBD1BBBF9B82B8032 anbesteding
12,422,446 *0150BDDF04E40D401985977E0F734657289C4E81 Anbetung6
12,422,447 *015EF08AA231EA5DCA8854BC9F556C121B471272 anbetungsdilirium
12,422,448 *01563CECB39B9DCC9753C90786FA58A2AD018996 ANBG
12,422,449 *01589CEDCB89B5321C7F4419DA595035B838AB0E A%NBH
12,422,450 *0150FB7B8A2EC2F9207D10D8E7EE54CE101CDA4F Anblicksts
12,422,451 *015770145D274363D5FBDD1A892078E7252D5342 AnbQB
12,422,452 *01528EEA28916A640609D8ABE0318AC4089A563D ANBUH
12,422,453 *015890D4852B40D43611357012699C4698C32E38 Anburst9
12,422,454 *015A1FAC7E77F53D85878E849E409756FEC40FBE A:NbY
12,422,455 *015A51E8F4F3CA69C70405DD57D626053BA26AD4 A,;Nc
12,422,456 *0154234F1E48C4F77C0B2F8EFF806FB6F84680D5 A/,Nc
12,422,457 *015B121BB1AB65CAA89F3A49E1E9ABC47CF482FE A$Nc1
12,422,458 *01595F11C78DCF3D0DB5FA56223592C0E9105E97 ANc30
12,422,459 *0151C53AED310097B64521375ABD8886CCB8E0A3 ANC!3N$
12,422,460 *015A6A9AFDF1EC7CCBE4BFC881B10A84ABF53A10 ANc4s
12,422,461 *015B7625B71FA5CD9B4F211CCA5FC42D47E8725A anca_hetes
12,422,462 *015FAE703E41D80B00984E3CCD288B4464E5E4FF ANCD5
12,422,463 *01535C387950AF638E0EED9E86354639FFD42B4D ancestors87.102.7.57
12,422,464 *015A20189A2CB19B6806A859186F0E0706BC72B1 ANCG
12,422,465 *0153453A927347C4148759B4122D7FC094C9952B anchases4
12,422,466 *015362F34B40C0B12D3F519A05B777090298690D Ancheleding
12,422,467 *015E453E7B506B2C24B42F9241EA930B6C4F6190 Anchisme3
12,422,468 *01587B9C0480CF1FE75713949B02381EFCAE49BF Anchliked
12,422,469 *01589B0C0F84F827734740AB95A93355C4F8A316 anchor140132
12,422,470 *0159B8B9074E9DF0CC3D2165D191FD915163BF0C Anchoral5
12,422,471 *015CC05A0230FF73B19EED9B57AD534A597D7C1A [email protected]
12,422,472 *0158786596E123C424D02B9DA6DD89CBF0FF6EAE ANCHORITEMONASTICISM
12,422,473 *015440C91747B30945E849597252F6C4E755881E anchorman-script-transcript-anchor-man
12,422,474 *015EB8342DC1491910A06701EDE2A5F5A02CE316 anchorpizza
12,422,475 *015290053D8E2F1964949B571695B7F652EF8124 Anchthon8
12,422,476 *0153FCD82CF7D5D736D4C8A1CEC52F0CABB53A06 Ančičam
12,422,477 *015608B0319E5DC785EAAD9EC1BF6BA3B734A784 ancient astronauts
12,422,478 *015A88DB28A99EB22E4BD35748E78ED4AF2FF825 anciently4
12,422,479 *0150994DEF433B91B42B5434DAD294A740125321 AnC.k
12,422,480 *015C48CD159A82ADEE018A40856589DDDC328D91 anckl
12,422,481 *01579CEBF9C221A40F103FE94E26481045E03F27 AncmZ
12,422,482 *01518ED989C2495E9A7261C8B9CD739453F1B464 AnCo&
12,422,483 *015F4D80A221EFAFA0B93DA3C3E168B7BC65E3AE ancods029
12,422,484 *015045B96D5EB84429F20569DA85875EEF5E7B67 ANCONDA
12,422,485 *01567C574327ADEF0732A058F532A6EE1B9F28EE Ancóra
12,422,486 *01590AB8E521F0A84FF395002DDF268510F6C1F1 An?CR
12,422,487 *015448741D2D961DFEBD58B3A368CB1B6A17B45B Ancreat2
12,422,488 *015DE0402E018E49F3753CEFB2A52054ED72A588 Ancreon
12,422,489 *0152324982704BCB2179D5A3C1AEDE593E5503D2 ANc%T
12,422,490 *015058D1C95219455FC2A088640EC68E9C3CBE9A ancutzikmarta0000
12,422,491 *0155AC8E428CC0ECCD578DD3B9766C0A654A5B81 ANc;X
12,422,492 *0159A5858861CC6C32285E2DBBF4C65E0ABA182B An[d
12,422,493 *015B7E70EC59557011EB5412BBBD1395E2650A8C a=nd
12,422,494 *015A54E53092F62926E08C0E21EAF174066BE959 AnD0p
12,422,495 *0150D788CF07D9664541D1C2E5FCC91C8BC9AE71 And9-
12,422,496 *015B28198CF0F10484407EBA102F624B01E1B522 AnDAA
12,422,497 *015500D005BE352104C588FE348F35C77E10AFD0 Andai
12,422,498 *0156EC8839D0A91570624B770B320D818CCCC713 andallsex123456
12,422,499 *0151DF2CB50C1BAA71C932FED2FBDE3F1804BD04 Andalusian swirl
12,422,500 *015FB0D5F74DB23A1F3FF6DC1BDC3A07902C7D86 Andalusie4
12,422,501 *01569B6ED1598947303BAEC643A1CCD2999602EC andaluz123
12,422,502 *015678E6F08EA157FBCEE7C42FE3446B2D6E8C25 [email protected]
12,422,503 *015E75ACD535231B7A08B655B50A686AD8650EE7 Andambsw5
12,422,504 *01538FA1D2349B937193578650DE317A80B5327D Andamenti3
12,422,505 *015C0987D8C699C9120A0EEBF97BC5DBEBEB59A5 andando com deus
12,422,506 *0157D7CA4CE6EF7F2AEA57BA5EAA4B75388BBF86 Andantinied
12,422,507 *01582EEEE2918D083D830CC10D9C25B12B3F3293 andantising
12,422,508 *01589BCCE81DE96E3EDD08B2773D95A5ABB63FF8 andanza4
12,422,509 *01507EB120B19A1E3903970F902A8B5036FAD713 andaraone:
12,422,510 *015878B97B0D98274955BB550DF2C45B4226A9A5 Andarins2
12,422,511 *0152A57192AF9A3D88A80D02F3691B5A066E46FD andataco6
12,422,512 *015011CBEA8D3D76FE8F80C1A6925C3F5B259ECA $andb1a$t1n9
12,422,513 *01568BE91F651B8B301F7C9BE198A0851697AD68 Andbyrdia
12,422,514 *0151A92875B6DCDB0649EB66FC8E1BBDBF29981D and CLAUDIO]
12,422,515 *0153007D3B5305AEB72452D8B592245F910475AF ANDd7
12,422,516 *0152504BE2087E433A9D8D91A719FF4077DF200E andebbie
12,422,517 *015D96097E8E9FA8DD2F9FB45E92ADB325EE9827 andee123456
12,422,518 *015ED9301EBECD0FD667AC82D21B2FDDCE652535 andefarm9
12,422,519 *0157F7D6485B671A7171CAD0C3B720E43136FD35 AndereHirsche
12,422,520 *015F33B7950D5FD72DFC0FB9215CAC29334F59B7 anders08
12,422,521 *015010307BFC99A19D08CFBD603F5F4B8908F0BA Anders Als Jetzt
12,422,522 *015C496275E2DD66D3AC28D5156B5549023E0A84 Andersm1
12,422,523 *015257EA7F26F54ED73D320D97C8C966C737C9B1 A.nderson
12,422,524 *0152D9B8FA56BC07270AAF719F9BEF9ADA33844D anderson.bidding
12,422,525 *015AFCFD944FDE525F344AF0BC067133839902E5 anderson.brenden
12,422,526 *015EF700C117C64214B25728F1E7AD1E4B36AAE7 anderson.broers
12,422,527 *0152B83B2533197E00F8ABEC4CBE261477536CE4 anderson.dapas
12,422,528 *0158CDB88DA6C7375755BC5B80629389865A1A8F anderson.demarce
12,422,529 *015ACC89D74F3253A532630D8A6977C27F5C7BB1 anderson.doleman
12,422,530 *01599AE94375E3DCD6D298A4319ED27BD91871E6 anderson.dyle
12,422,531 *01555E9A328AD03F0100E8C139826A4A13233AEC anderson.frisco
12,422,532 *015077B68B509169E1D98D18724B32215646A7A7 anderson.gaulden
12,422,533 *015BCD5DA9F4BE55AF5B02A557B8511DDA2161E5 anderson.gimar
12,422,534 *01505D9D56ED6FC733EB7804DAA80444F3464B5F anderson.hellberg
12,422,535 *015B342E5E7FE1A9053372F7C6C3A373F4FFE1D5 anderson.hokkanen
12,422,536 *0152C8C1770470D87B17B31E042E1DFAE8C51C52 anderson.illies
12,422,537 *01549EFD9DDFBA726FB35465B503A2C730A171AC ANDERSONIP
12,422,538 *015BBEE18B791B4EE6AAC9EF7981D0F91C960B2E anderson.kowalchick
12,422,539 *015A01B1A64B97F205A386A31B3356395D8BB6AA anderson.larko
12,422,540 *015E85DB3FD76303A25B77D30E1B2A0AAE6B65C7 anderson.lassonde
12,422,541 *015A4D94316C181B5DC114F055380B83DB78BA2E anderson.mccranie
12,422,542 *015117E53D8CD42D52188BA902CC1532BCFFADD8 anderson.munyon
12,422,543 *015A4414301C7F0F0BC81C8755C31DCE643A927A anderson.nealey
12,422,544 *0156156993E97A387B2B3A69AF06EFED9EAE283E anderson.raglow
12,422,545 *015C60325946E23540BA33F1DC99386FEFAE9BFA anderson.raw
12,422,546 *015F7FA97298E638EDE281AB5B0B0C60EE4FA538 anderson.sontheimer
12,422,547 *01523E8BD67559A615A438EA2FD91606A9B326D4 anderson.stevens
12,422,548 *015F0C6EDCA712B01814850F36D86DCDAE448FAC ANDERSON-STRANGE
12,422,549 *01538B20B72794E8EE93A2E04C9DCADFC8BA0843 anderson.symeon
12,422,550 *0152577F8102A66A49C25596888B0FB7DEBE9B3F anderson.teeters
12,422,551 *015361E17EBEB6829CC6AD78C1A1E92DBCC03043 anderson.williby
12,422,552 *0156339E160DA66FC23CBECACDE17AADEBB06E92 Anderson)是一位
12,422,553 *0150E81C345B741C360CCB0A50BDC9196A613D32 [email protected],
12,422,554 *01542D1A43B0BFA22AE1CAEDC9F854E2287B6C64 andezta1
12,422,555 *015BFA62C546380F94FA3DE1233DF2D22D186072 Andfile4
12,422,556 *01539AB5CEB09AFAC5839D04C34D21D471693E1D AndgQ
12,422,557 *015B93F168F250129FAB4E3BCD74C765B91A37D1 Andhaafted
12,422,558 *01545D6BD7647E2D0252BF7C7692FFB9901EA1FA Andharnākum
12,422,559 *0153F1BDE7F12E7473E846DD266252B8BF24EE78 Andią
12,422,560 *015259F4FE3AF022C331533A5AE85E35874D9D17 AndIFall
12,422,561 *015061940FB4CA86C5001947F9E8B2C1D2FD1759 „Andija“
12,422,562 *015F59B8146CCF3D3849F06E63ED15EA0715E66D andiprek
12,422,563 *0155D7848A4244821C2A8028AB8E1623D173EEC2 ANDISTES
12,422,564 *015B4DE965912429B8CB1310FED9C9AE1F8407B2 Andizzon
12,422,565 *015C951CE40C87539185DA05B8E9EEBFA9F4F59A andjelkailic
12,422,566 *01530CBDA635473EC635294150E1FE3A73764F7C A&ndl
12,422,567 *015CBCE369AAFC04C08663975078FFB6ADACBE77 andlhart123
12,422,568 *015994F2C514E399E2C71E01B708BB314B00CD32 Andlova5
12,422,569 *01517BC9C81D61544E7BF9AB92E9B5C950C54016 AnDlP
12,422,570 *015F74243723AC44BF67B480019E3C44BAA50729 Andmason3
12,422,571 *0155B0C89C3CE7B128F5DAAA448174E2D5F02A50 andmeobjekti
12,422,572 *0153A691635D13D1E2C55C6F1D17F435A225A180 An,DN
12,422,573 *0151F670B1339BBF7C0945B99C6A5D7BDCFE5D54 andokídês
12,422,574 *015362D503B5675999AE2AB5E033BB524BC201B1 Andoléennes
12,422,575 *01517A021CBAF9D05019485C23C6B4F4CDADE7D4 andonit6
12,422,576 *0151A4A53596D3998AF182DCEC64ECE241BE84F0 andorrases
12,422,577 *01501518073635A1F207A37E373A87C5B0E84381 AnDQ1
12,422,578 *0159F664B10A99E43FE6A86768C1A6EF6D40682F ANdR(
12,422,579 *01543E5757D9886BBB54B34EA80F123414787474 AnDR
12,422,580 *0157AB94BAC223B5BC112599B1D83E9C491D6F6E andrae butler
12,422,581 *015FF8B6B9EA423A5BD0D29C9375F2AF29FFE097 Andragols
12,422,582 *015C6E69EB00AEDD684B13325B1CB6276A579441 Andrdat4
12,422,583 *01576EE5A9F79425CFA55B0C8B02A9AF1967C9E9 Andrea962
12,422,584 *01505C80261D4A549115754CC63B38AC9DDA1352 andreabroadwater
12,422,585 *015F9EB67D07193B11A7799D7AE969FE238C50E7 andrea.capata
12,422,586 *0156966980D63040EE261B394F0BE75EE865B3A8 ANDREACENTAZZOSOUNDTRACKS
12,422,587 *015DCA9A30ACFF4BFF459412BF3EB53406DA4B68 andre.achor
12,422,588 *0152F0C6D62F32193BD18E8BC384A30466218E62 andrea.correla
12,422,589 *015F590844CB2CC71594C5BD04CFF773DBBDBE8C andrea coughlin
12,422,590 *015CE035D65E98504F511F0C4BDFB3B5EF079D67 andrea.crise
12,422,591 *0151EF6C6BF394D6A8942BEE96A2A27707312241 andrea.cromey
12,422,592 *0150B2B100DFA71787953329650FEFF4F322C743 andrea.danial
12,422,593 *01508DC256CA78B4E8DAC2EC5E9C792E726459A8 andrea demille
12,422,594 *01592EDB91B57BEF6FCCC1C2327D274DA23318E7 andrea dsilva
12,422,595 *015682EECF3AB3A7A1C999D208668460E8B05783 andrea.duster
12,422,596 *01553AFA1EE89F37A85E175BD4F188FB33A8AF37 andrea.feagen
12,422,597 *015858DD75883BF7C628468BE1DC1870F43412E4 andreafensome
12,422,598 *01573BC342056E9A635AFF385CDF2911CE5CC13B andrea.gaeta
12,422,599 *0154998B0AECD3E516B639EA698C052CE1BBF76F [email protected]
12,422,600 *0157994D2ABFA47012FDDE8A8DD54FAE8C5A37D9 andrea grullon
12,422,601 *015EEE7AB87962DBAC786F1B370D956921A91C54 andrea guzman
12,422,602 *0153080FD976812B3A043BC494D8ECFA8CB2C107 andreahipp
12,422,603 *015EE8540130F10EB901C823D5265F6E95E33A3D andreajacome
12,422,604 *0157FAF8258D363FF5AF104A5DEA30AC8B529B78 andrea k green
12,422,605 *0158E28761C643D3E5F1E15816DD175770AD1A84 andrea.lamaster
12,422,606 *0150EE40759C78B40FECCD2F70404DC5BB9B01BE andre.alvarran
12,422,607 *015BF9041A061C57707940190E2EB9532BD9A500 andrea.malotte
12,422,608 *01501B76B78DE752C29BEFBF299A60DA682B273E andreamarinucci
12,422,609 *015F99129048E5BBDBAC45E9DC07D1F559279211 andreamathews
12,422,610 *0159B7ACB272AA3B6F425C6B532D1BAE30CEA627 andrea.mayr
12,422,611 *01519AB19C437566C3729EE7C015E654EABEDE2A andrea.mcgathy
12,422,612 *015E676709126F6D8145FF249BF67E7022CC6322 andrea.mcvenes
12,422,613 *0158F58DDD5E2DAB9BE11D50DFE03AA2E7D1A68D andreamiranovic
12,422,614 *0159B819FB1EA60CA3069ECBF9F8627AC94C976D andre.ammirato
12,422,615 *015CE3D77B7AAFB20CC95EF385EB0941E3289605 andrea.mohsin
12,422,616 *015EF673631C2720FF1DE0492E8E92323699D0BB andreanorberg
12,422,617 *015FFF1C32A277017A79A2B18113AD5F8D3E9BD1 AndreaNúñez
12,422,618 *01548896A4D0E242DAACDF87239051869FB8535D andrea.persten
12,422,619 *0152C00B987A543EBF5ED4A1F8B7C1137438BE82 andrea.piccillo
12,422,620 *015DB765D188A2B2D8052BB9A4363D9D3745777E andrea.pyo
12,422,621 *0154528AFB2FE566F0A2842217A6F0895253A0C4 andreas666
12,422,622 *0156242A7FD11981B573035B5DE49300C435F6A9 andreas.aiporlani
12,422,623 *015C67BA7A30AC88ED1ED944C0880178D0C4510A andreasatterwhite
12,422,624 *015A8F4E49CCE6084C57C7481E410006B3223D25 andreas.baskas
12,422,625 *015E6A2FE393067174A59CF08707B07245EDBE0B andreas.calcara
12,422,626 *015D19FA36DA7FE68185B7EB70A87F4A7FAB0A7A andreas.cernuto
12,422,627 *015B771BEE82722BC278968EFDCFC2B94A614ED2 andreas.chanady
12,422,628 *015F0D500018B4BED41DB207839C2110D0991865 andreas christian
12,422,629 *0154CD780A00F20EB7EC97439F3F085850247092 andreas.cleaver
12,422,630 *015DDE183F84A08AC1D18E5B394DDC6E52EC7669 andreas.colclough
12,422,631 *0150E0CB6E9FC063793554E894AAD815E6E148A9 andreas.delarge
12,422,632 *01579E5EC0170C9F620DD6527973B34E47BD0D9C andrea.seckler
12,422,633 *01588180E3278CA2D9223E7888989B31D9BEC4EE andreas.eekhoff
12,422,634 *015D48E6C27DD355B1B252597911571DB0AA091A andreas.fivecoat
12,422,635 *0152D3ED39127649896D36B3BBB089ABD24D8AA8 andreas.homburg
12,422,636 *0150BDBE453C0DCD7AEF3B8762189A1E43A55A35 andrea.simor
12,422,637 *015FB1F9B2DFFCD063D8AFB0E2E9760514F4588E andreas katsouris
12,422,638 *015416A358B059697B15462BB51A3591CE7E9619 andreas.krawiecz
12,422,639 *015F5FB689286233BC92E7CC10C6108E5B6C3CFD andreas.lagasse
12,422,640 *015D43E3B52021880C23D9F05240995E233D2C04 andreas.maicus
12,422,641 *015835326A0B9F2265C77E0C1C8502E99B3C9938 andreas.mcnelley
12,422,642 *01541BE5B02F6B8C5672F25FDCDAC58A317571AF andreas.mede
12,422,643 *015D23B087280C54004B495218E5A0CE6C84E570 andreas.molz
12,422,644 *015BFE9B7FEB98F9ED4193CAA5A14DC1CD45246C andreas.padavich
12,422,645 *015CB8D7ABD693AE7D32438759E9EC44C108B431 andreas.pleskac
12,422,646 *015AE0310217622C6CD1EA78ACB99A5078271150 andreas.tamblyn
12,422,647 *01525C97ADDFCA8A41EDFC3F2E50308425A86AC8 andreas.verdejo
12,422,648 *015915EB74A34450528E51C28F1FD2F9387F661B [email protected]
12,422,649 *015BE5B61C1FA70CB690BAF3E325A47D3283CF6A andrea.tei
12,422,650 *015C878552A6BB189DF9E6B78600EAA6FF3C1542 andreavery
12,422,651 *015E48F4A794BF9A4A01A2DA1612F021008C7C33 andrea.wedd
12,422,652 *015C5F285D3E5DA1687380DE70C47714C0611697 andrea.yearling
12,422,653 *0155FF8C3D62D68A4CC7DD62F6CDFB15FAD901A7 andrea.youssefi
12,422,654 *015C2863B3767E54838580726F215875019F83D5 andre.cannellos
12,422,655 *01553F1082C194550FF1A6B60EBDE56592A83257 andre.castanada
12,422,656 *015B81BA72E50DD836A169D2C2EB953BD180829C andre.coffell
12,422,657 *015ED1A3A0B79A2DC4905DC0B8A95D5303DCE9C2 andre.corrett
12,422,658 *015FD3AE615E48CD83A9639874575E6CB51B9E22 andre.cote
12,422,659 *01569F50EAC3428043319E9DCC91C3BE2D4779F4 andre.degeston
12,422,660 *01541935E315761A4556AB5B51EE0243CDCA5925 andreea groza
12,422,661 *0158F22912C2FCD344E6408D664A335E3DDE0F97 andreeamiron1
12,422,662 *0154B708B6EFB4412D3DEA2D2B55D2369B5E6BBA andre.galeoto
12,422,663 *0158348A4A4DA5054019C407AAFF70D9B9540C98 andre groulx
12,422,664 *0157DFEFE270138E7EB53CDC31E6E2B8D3468D58 andrei21n
12,422,665 *015D7C3E1506F9B3B757C0F6BC34EED753361FFE andrei62002
12,422,666 *0157E6BF9A46CBFEBFCE9B5F2315CF9A9D794DAA andreiavarela
12,422,667 *0153FBECA8E35079A90449A40AE3714A18307447 andreivice1122
12,422,668 *0152EA3B7D120FF95B5D71DBAD5A94F266D94FDB andreix98
12,422,669 *0157CC039BD8B2DB638EAF0B6F46F9EA86259786 andre.januszewski
12,422,670 *0150AC6FE8F7C70878540CCD84961432B74BBC10 andre.kosakowski
12,422,671 *01526D44BB5A66FF5A04598B1F759C9E1ED1DA76 andre.lavista
12,422,672 *015F696F67B09584AF2619E7A9C9E4F71C63A11C ANDRELUPHE
12,422,673 *01583621FCCC48F9E6A914CD9E825A28474222F5 Andremarcel
12,422,674 *01568B9DFB842C1999D9C1456A7A31082136B5A1 andre.mayville
12,422,675 *0154082FD6B9C03EFC9CEEA323EB558A0E026B99 andre.mcgurk
12,422,676 *0153A64D27E753053A6C304ECF244D79D9820129 andre.moistner
12,422,677 *01592AE2322F6134352D3BA027F954CFCD2C9552 andre.morua
12,422,678 *015423E27AD28A1FC18E195BE682409B20D84BC2 andre.passineau
12,422,679 *015D0756E9E7E45AE404DF4ED17D95B8D8C18B6C Andres420
12,422,680 *015331BE9E8C3463B6F1FA7616CC260F275E8A82 andre.saltz
12,422,681 *0152C9A360BF91CD76C8768903584A26AF61DC3B andresaraiza
12,422,682 *015FF60ED56E97F1164664B0EA7CC5C1D237AF85 andres.basilone
12,422,683 *015E67585319B3A20E088BF9D10EDA8DBA3650A6 andres.bivings
12,422,684 *015566C62BA3B54864F444225A80E306D8539DF3 andres.carlyon
12,422,685 *0155C40841C7C4420DCDD97F6B57AA2EDCB6F9C9 andres.castine
12,422,686 *015F9233DC4CBE863D7E6B4AA3FE9AD029001B12 andres.chalupa
12,422,687 *01505AFB097F175C94875C22CE627C03DA7853BE andres.chenet
12,422,688 *015DE4F4CFA2EC9E1BF7D8BE726F32B7F3317B3E andre.schwarm
12,422,689 *015AC980E55E01ADD28D1317CDEE9A149B3C6D95 andres.deadwyler
12,422,690 *015FA4E5A86AC2FC6CA38B4DBDE4B3C72E193448 andres.firth
12,422,691 *015AF0AC4626E68C05189D5F4ABBE4E609AF968B andres.greep
12,422,692 *01522E8BF9A948FA6F288F9CE0E293DB13BBC891 andres.hartje
12,422,693 *015207BA3E59E2DF740E279011362488C92AC19E andre.shibuya
12,422,694 *0151BE3DC07DB2EEA2289DF4CC81BC871D899B71 andres.hudler
12,422,695 *015EACC20C23634C4E100C8F044A95DAC54A7FBA andres.kreisel
12,422,696 *015D28061CA78E0C5525B402B7FC2CAF017D73DD andres.lemont
12,422,697 *01532013E78E4721167C723DDAE9A6813BAA2BEF andres.maidonado
12,422,698 *015F9CA74F41E1F34F37873BFC508393A3A7E9A5 andres.maltais
12,422,699 *0152F338A25C142694C2250E60EABAE2545C9D73 andres.nolf
12,422,700 *015E6F807A463962664BF6724CD6D5171BEDA4C5 andre.soape
12,422,701 *01504EBA3EDD5BD8B141E5A3B9EA5B4F9A68616B andres.rendell
12,422,702 *01547CBC92D7DB345F167419BE68E0B54866CECE andres.sapienza
12,422,703 *015BF148874421CE192ED70DD583CDAC250D9283 andres.shreiner
12,422,704 *015F226AC30694820CFFDD49CFB2F09B60CC5F11 andres.shumski
12,422,705 *015FE56222E6817E928B494DE35DE303465605BF andres.traill
12,422,706 *01515E294BD34BC29F920097BCD4BB76E1BF8024 andres.trongone
12,422,707 *0159B05A0239815A2528DB4CA92E36C202571FE0 andres.vanbuskirk
12,422,708 *0157003AF40A1495887F6415F265E9376075678C Andres&Xavier
12,422,709 *0157C7F913C1446A58F9832040BFB2815589D78C andres.zarillo
12,422,710 *015A8365F2F455086368495CFA9E69301AA49F8E andres.zavadoski
12,422,711 *015FF50DA76C7BDB93181CE6F6BEE62C73E9A754 andre.timberlake
12,422,712 *0159C728167B2AC9ACBE534C7B2F9695860B327E andre.tiro
12,422,713 *015275308D3B0B899CAC3993B936309980D1A237 andre.trogdon
12,422,714 *015FE8C66B5AFD3F4A2256604581B3104541C909 Andreusem
12,422,715 *015FA6599F7BF34164729FCBB9E00A9FD5F3DBA4 Andrew796
12,422,716 *01598BF359B2CCA9CDF412DA77A0BA9A48AD6F73 andrewadams2004
12,422,717 *015301635C019863F8E8A98FE36BA5E055E78B79 andrew allum
12,422,718 *015DE707FF6DC98A3A5EE065CDF8FEFEE26BED00 andrew angels
12,422,719 *015F2F2768DBB52D131498D77E3905ED390D6D90 andrew.baggerly
12,422,720 *015CD46C33C12BC2691078723B08026A766C6D98 andrewberkowitz
12,422,721 *01590F2690430E21832C1954B691EE2178DD8298 andrew.bester
12,422,722 *0156766D40EBC80FF8C0283F4C27B132B634BC2B andrew birdsong
12,422,723 *0150CE6FC3D056E3A6491E1440925F284C0E5BE1 andrewboldman
12,422,724 *0153EC62425E4527830F494E7BDEFD9188AD31B1 andrew.brustmann
12,422,725 *01560A292E9AA82558D870DF7BCDC5BE0149E387 andrew buhay
12,422,726 *01532E16A2549133A1F6A83A2654707671E7798D andrew.caldon
12,422,727 *01513A62B448EF3BF4608AE21BD169FF2908CACB andrewcasali
12,422,728 *0157D94CC205B7FE7CE25470F1D245B57EB4ED31 andrewcindi
12,422,729 *015E56A2D3D66688809715D28B22CD838421FFFB andrew.cupelli
12,422,730 *015F8DD56D45A82381EE6FBF5050ABE17E20401E andrew easterbrook
12,422,731 *0150AAA8AE0E8FC37DCD15B3705C674A24C5F512 andrew.elvis
12,422,732 *015C99F7FF98D1D8E1B96724DC548121FF85589C andrew fallis
12,422,733 *01523C9A04D52B5ABAFDAF5BE16E4FAC72662105 andrew.halgas
12,422,734 *015FE0768B2802A8E90F02E68D76C99BF852D32B andrew hamer
12,422,735 *015B134E48921D99282852099B28711F8CAB579C andrew hoggarth
12,422,736 *015CC5A0EDCE97F3646B96D7F8BC5380B34E0054 andrewioannides
12,422,737 *01570ED5653A255785B355AAFEF6EFFAD16DC992 andrewjbell
12,422,738 *0152849F3680F8E7F48B89BB309AC98A91F63596 andrew.jonason
12,422,739 *0158A43FD9E0C2A0C6DF0E4E9B0C24438FF95938 andrew.karamchandani
12,422,740 *01584FB6B56756E7B956D8A660939CDA99CE4EE3 andrew.laviola
12,422,741 *015F990766554A384152C8224FB858B6BA832C3E andrew louis parker
12,422,742 *01525D24A1BCF7E56670DA12A0C05A7480DC34F2 andrew luce
12,422,743 *0153714226456ADF0573B76401CCC68BA3E29676 andrew.macina
12,422,744 *0157BE4734B5B50958DFBA91B6617758671AA89C andrewmackellar
12,422,745 *0152DD18674D148AB31260C296A382725CE36442 andrew mazzarella
12,422,746 *0152192222BB9E007B064D7DB655105568F8DC99 andrew.mcleese
12,422,747 *015CC8582D3C87D9A9FB8F40599F1A66C6C63B2D andrew.mcmickell
12,422,748 *01591BA846769CCFE7BE06D08A2AEEDCD9333DE2 [email protected]
12,422,749 *0153F3617F6225CF07696D7DC8F39FBE00204EC0 andrew.nageotte
12,422,750 *0156B83886467E658851BB795AF1D565D577C8FD andrewpinder
12,422,751 *01584A3C50009C8961AE271532D771F4A9AB896C andrew.rallison
12,422,752 *015336BC6944121CA8EE5B0734EAA31590406670 andrew reidinger
12,422,753 *01527663C7E991FCD659374A04498838FECCCD73 andrewridley
12,422,754 *01548260936753A4267A26B3A95B98A5499C8DE7 andrew robert smith
12,422,755 *01587E759E6A4BA0493143B5A771C2353F56DF93 andrew.shearer
12,422,756 *01592EDC31DF4C17D9527FE046967C0AB2C2B978 ANDREWSHOTGUN
12,422,757 *0150B50EC63DE33D86BE4D23D41200072C4A74C5 andrew.tenofsky
12,422,758 *01512A736A39ABEE4C6C07CCCC47E4E84F6553AF andrew tolan
12,422,759 *015812A8F83954D00D76D36249B9401267C3480A andrewvessey
12,422,760 *015CCE6308E69BA1FA103185F7EEE9227B568B32 Andreww.bbs
12,422,761 *01584DC73FAF1FEABE265CFC537F47ECBDA36177 andrewwildmon
12,422,762 *015A4A43E46CB12EFBB3C795B05D8AC483E4F60B andre.wykle
12,422,763 *01571AD94B338F668193EA57796D9E5AA75C9228 andrewzacharias
12,422,764 *0159E83B228FAD6A228445F8A94FA2503CB9E6EE andrey mikhailov
12,422,765 *0151137AC753BF12177E62AA04C00E40F4391F5C andrialew
12,422,766 *0159CD7D13EA1E3A6D47B7A90CCDAB62881D5617 Andrioled
12,422,767 *01519761FA253189B64CA91BAAF6414CEFF1EBC8 andr-jean-franois
12,422,768 *015B7BDDECB8BFACB70B160DE8451F73DA86F41B androcracy8
12,422,769 *0152970433389E5F5F9B3FC92CBA21B6546F8BDF andro fernandez
12,422,770 *0159E83F9AA301619FCF52A83FD55454FE043698 Androhtet3
12,422,771 *015579B65C2F5A43B37ECB1639F11475EBEE36FB android_lust
12,422,772 *0157CF35857F651585EDF27D395398FADFB5989C androseme0
12,422,773 *015996ED155E27A87D5DF42ACF3613C3968003A2 Androzen8
12,422,774 *015FFFAA9FD822B9835FDD2096EC4806674EB810 AnDrp
12,422,775 *015BBA969C223596FC21CCAA068CC662A823F482 [email protected]
12,422,776 *01580D94CA0ECF13F542811614E86345C8943398 Andrucks6
12,422,777 *015F0A527C78DB5D20601DF09C78F8693B2C498D andrunsing
12,422,778 *0154BC6900678993B219242BDB20699D696D1ACF [email protected]
12,422,779 *015C9E2D7E09D748D5606100A3ADA569F4EBF836 Andrzejowicza
12,422,780 *01504C07490BF764345122B519AB9617968A5CD2 ANDSAARD
12,422,781 *015B53D415DE31632E6D39C5F0BF8EF0C19EBD03 Andscapes
12,422,782 *0150A2BB9EF6239F439B69865F8AC9832CA0BEE6 and still later granted judgment in the President's favor, does
12,422,783 *0150B3148E3034B9213E4CB73EDEB384A4D9712A and...ull
12,422,784 *01580E56DBC32A71B9E3511DABD279D97A25669D And vengeance on the traitor Saturnine.
12,422,785 *0157F20DB524F18E2C7AABAC67333BAEC847953C ANdVF
12,422,786 *015D8F2FFD13E4C59CE60954A41B808588D5EDDE Andwan
12,422,787 *015F1F6AD7B7CB5EFC3E0FE265C1D544258D45CA aND We'Re LooKiNG FoR oNe oF You. JuST oNe.
12,422,788 *015677A6C1217D7DC047BA102716C7F211D43B39 ANDXYOUXKILLXMEXWELL
12,422,789 *01582A02B68E564A5752FA0EA0AED7F1BC2616DD [email protected]
12,422,790 *015B79487B835B465F42860FB462292BD77D6208 andy1405
12,422,791 *0159DD79D190320C1ADB7CAB23978365176AC68E [email protected]
12,422,792 *015CA19D04516C27F107AE98B537DFE96D8661B9 andy58_andy58
12,422,793 *01597B7D8986F630899FA8EC089F7D52ACD2A305 andyadam6
12,422,794 *015EAACAEC52363567CF95CDE3B90780AE7EDA57 andy.alsip
12,422,795 *015434E5D8D9A6D5A2DD906FCED3747FD2CD8DAC Andyamouring
12,422,796 *015145CBD3D4B9517AF3E2B030B606AD21797374 Andyandy2
12,422,797 *015389501E7162735234A723F33AD4B9DF7C8FBD Andyars5
12,422,798 *01547784C50D228C620B9933E6639F1A973B686F andy.arzola
12,422,799 *01535EF995ABE8B91832248835396F05224952E7 andy.bazzanella
12,422,800 *015B8AFE72B207D24CEBA4ED96E962BFDEB52788 andy beeman
12,422,801 *01502AA7EF3E320FA2645C5C4CAE1341C0209701 andy daines
12,422,802 *0151EF25B8A12ADA8CEECFDF258F2247E90BBE14 andy.darrigo
12,422,803 *015B07367B5733C2AEECB866CD75C937748DEFC0 andy.demshar
12,422,804 *015A92B6D38C3D3A9C423BE80B58613FF23CDE4D andydl
12,422,805 *015C6DC328F92F1E61BB27D7280B4D27837611B4 andyfeary
12,422,806 *01556B890B2B94FACBF8479ABEE0811CA5FE2583 andy.fietek
12,422,807 *0152367285434766BA535B6A2DA4C9FA349D0F84 andy.galt
12,422,808 *015B28E00C7E5B63E8C5B88606F73DAAFF697EE5 andy.gianandrea
12,422,809 *01500772DDCB07A810D52C5E741454A7A7DC889E andy.gomer
12,422,810 *015A356F56E8494462DF15C82B17E9DD78AEF204 andy.grosch
12,422,811 *015BBF50CEC3C056B95AAEA3A45BA3B0A752A958 andyhassan
12,422,812 *015BD22BE4C13014339AB80F74998ADB502A0FCF andy jahnes
12,422,813 *01525602E48A70A2A997DFE0DE28F6196F7FB9FF andyjobson
12,422,814 *0155F00C6F66B1E250AEB90A93274214A6828196 [email protected]
12,422,815 *015CF8E97E1BC4BE395B2D8D5CE395F040E69D66 andy.lambright
12,422,816 *015156C0419B0549A0C525D411F3EA974F77E661 andyl.bbs
12,422,817 *015EFA2C1A00E46429A8E53F633172E7531CE5F5 andy.lenon
12,422,818 *015EDD5EB6A0F4934A7585485658B03F83FED906 andy masga
12,422,819 *015EE793648B1A1723A4AD193011867FFB84F44F [email protected]
12,422,820 *015AD86B943130DE0B26611203C46A32FF7BA712 andy.mcguigan
12,422,821 *015203495FC27BF03D17C05C0FC107E55F1BB05D andy.mcinture
12,422,822 *01513F73E5CB24AD8283354AC3B01038B1643253 andy mckellar
12,422,823 *015EF4ECF746C395759F5E5908C2AF0D01221211 andyni pratiwi
12,422,824 *01501535CFFA4917BF56613713C67ED3C7A5CD6C andy.panduro
12,422,825 *015BB529C6B28BC5FD1DBC26B1130C67AC0F334A Andypas
12,422,826 *015334960AC0A685F17CE49C75C1CBCAAF8116DF andy.pernin
12,422,827 *015E6432F2A4BF0E0BBD1B8B24F592ABDDDD0C02 andy.pillette
12,422,828 *01531D6C0CFEF5D7CB337C73C022D9DD56F9210C andy.probert
12,422,829 *0157D3E3A3BE7EB1B20D48D20CD964888589213D [email protected]
12,422,830 *01554A624B981DCB78FB009BC1E637E8F502AA66 andy.rausin
12,422,831 *015FA9BFABACEA1296B57BFDCD94AAB5743420D2 andyroeder
12,422,832 *01556D9021EAE61225133C45557BA07873988EC8 andyroping
12,422,833 *01558323C68C011E774EAC6909F92C932178FF8E andy.rosher
12,422,834 *015B10040E14D5C6D7DD09A0662C0B058029D23A Andysheba
12,422,835 *01504D5814F824AF6FA324EA84F4D4CC067B1E90 andy.stjulien
12,422,836 *01518969DC261E8126DA965ECBE3A4559525AEAA andystrangle
12,422,837 *0152F64A6023ADFDB7E79A395944D3DFFC141223 andy.tessler
12,422,838 *0154F96EBF55DA0E14CB93A380FE89BEB14E80A5 andy.thuss
12,422,839 *015E83A5732355341765593EECDE25C675B9567D andy.toppen
12,422,840 *01554572CC5FA20ACBD8E2F16F66F172F8FCC68B andytrow
12,422,841 *0152A4209525903B35CAC1A22C6C62B45C63596D andy.vacio
12,422,842 *015BD6C531FE3A6994ACC9EC0891FEE04F4C1AF6 andyvavra
12,422,843 *0155F2A4BC07C7D8114FF5493EEE3935FCF21F93 andywible
12,422,844 *015B2D1E2F82EC177A840654936C6AA53806259D andy.willardson
12,422,845 *015780EFAD507AA82AA48F6ABB23C3D0D5188090 andy.witte
12,422,846 *0159B88428D2F87FFB018C8B7A74D6B320B886CF andy yero
12,422,847 *0157B23D74DDB71E29493D503573952326274A62 andy.zunker
12,422,848 *015B15B440FBF6A41BB3CA61CF78B6046D73F9B5 An=DZ
12,422,849 *0154CA8A597E9ECE08B0297754B97F11443DA477 An
12,422,850 *015690CA66EA033C100A29046EEF0BE1FB19D25B AN=$e
12,422,851 *01591F7981372199B9D6AC98545B8271C3753B8A A/n(E
12,422,852 *015DE40FDA7CF82F4CBA9E5503B31D3D95EB27E4 AnE3M
12,422,853 *015A3A3574185786A34EEBB9F10967112999F85D A&nE7
12,422,854 *015EC2A114946AFC3467A222E27B1FB9EED5C62B Aneabana
12,422,855 *015FC8AA16F09D5C6CB7A51E2CA4B18271917CC6 Aneahcor3
12,422,856 *01506057A20CE081727673DC22EB84C9748A80CD ANEAPORIA
12,422,857 *015A70214DCCDE9383D14503669011D94110F08E ANEC
12,422,858 *0155C15992B59B8AA4328883EB12C2E9AF6F78D9 Anecdotical1
12,422,859 *01506FE9D3D6C91BB2CCB772A0D8A8175F954DEC Anefauld
12,422,860 *0159EC0EDDDC7BAAB7449D52CDCB5DC9BCC1A43C anegimif
12,422,861 *0155629BB2106389AD00338B30F9C208437E218D Aneika
12,422,862 *015E8723C111C56993C837CBC79047BBDE41B7A1 Anelante9
12,422,863 *01576B2B8AC91997DBB0AE2B14EC6E813B5305D2 anel bester
12,422,864 *015E90C3714933F52C8045BEE862B76C27044510 Anelddim
12,422,865 *01533338D2FA57DA73C1B19DB3F2A742B8CBA7A7 ANElR
12,422,866 *015F740A39D00A1828BE409CF801986A70A550BC anelsesløse
12,422,867 *015E57E0CEF975C8A738757BC09D9C502A21BF96 anemographically3
12,422,868 *015342423CFB7A8B760CBC5C17647FDCCCE7DEB5 Anemopsi2
12,422,869 *015ECC3FCFA0678DB28F9A66F438A383F1ADA4BE anemptiervoid
12,422,870 *015423427F9A74E842EE6D6F543D58F6FDC5D0EA An Empty Glass Spilling
12,422,871 *0154B42E03455A79FD24CC96261D7486223363B8 [email protected]
12,422,872 *0156817ADE0320E93C05274A3001D8C27D921E60 Anentera3
12,422,873 *015F7B1BDC84DEE1D58BACD0A5243961F39ACC34 ANeogeal
12,422,874 *0158ABD4989EEE587A16F7DBE385AF7453202F24 ANEQE
12,422,875 *0153F5E2B763F056AFC7FC03E630CE87B7D990D0 anerley2
12,422,876 *0154D0A6ADFF66F47905CBD6BE339867FF7F348B anerleyhill2
12,422,877 *015BD73D2360FE3609DE73713B290D3497C67D0C ANES7HESI0L09IS7S
12,422,878 *015DE1E72F6D4CB8A6C37DC608223B48C367E180 ANESCIO
12,422,879 *015827D1D62DBD2D35A5196DCB3853DADA77050C [email protected]
12,422,880 *015D2E950740B68806BB0A6E44AB99E255E84129 ANETMOD
12,422,881 *015AA91BEDB322312F0684ADD2C8BD95B88A800C Aneubnof
12,422,882 *015D7533CCF4BCC6DD069D4D55607EC919004FF9 Aneurydesmus
12,422,883 *01527E68B0B63A00AAE0CFAB2A2E5B7190A18EE6 Aneutneb
12,422,884 *0151F5973FA7B2141D04EEA814D674C0A175F876 ANEWANEW
12,422,885 *0159548309B735C806B98F361902226F88CFC727 a new battle / no name
12,422,886 *015AE87FBABF4583DCCDAB37907FABC636EFDA34 Anewwena7
12,422,887 *0151085DDF0FDBE28AF6013D88E3FC03CE7A4032 anežkino
12,422,888 *0159A55F94187B99D8589C520F8A40E995AC60B1 AN;/f
12,422,889 *015E7DBECE65DBF4B19C5CF3BAEC82267C48EEEB A)n)F
12,422,890 *01533BE9E373DA3C12243307B8DCE4D287CA02AB AnF8(
12,422,891 *015B8F8EDCDB5FD758068D2C486C11A48478A2B2 Anfägerfreundlich
12,422,892 *0153AA4F77A41AF78369AD9E9EBAA6CA1F705872 AnfallHes
12,422,893 *0153160BFAA715ABE6EF31EFEC2F9DBCBEC35F41 ANfBB
12,422,894 *015F600BFBFCA81C147AA6788A410BA45CABB417 [email protected]
12,422,895 *0159B5122D656070ACB9DEF9857AA2936065EBDE Anflt
12,422,896 *01535EEF724904F59586ECEE74F0EFDFE2DD70CD Anflugwinkel
12,422,897 *015264419B8EE38E71D5B7DF5F42E1DD3F65027A A)NFm
12,422,898 *0154555D0B96EE90E7DE7E4D9686AA4CC1B2E734 anfspüren
12,422,899 *0156E294CF098F6FCC5A6B72795E784001499A99 ANFuZ
12,422,900 *01510AB3CBF6865671D89DCA37E86562EA27B53B AN%G+
12,422,901 *01541D9FC84E3BE3AC78518BB072D5BC741B63A6 A.n+G
12,422,902 *0155B528569B464BD8FD097A4D4D29BCF9E1C591 AnG$
12,422,903 *0158DB2A73FAF4DD2A34233482FB58F902ADAEB7 ang1oblas71c
12,422,904 *015081952A3D566BC904DA5EE999306C9E0A79CD Ang-A
12,422,905 *01510985D511F8B0C249F77425CCEC4AF0E0DBF7 Angaellas
12,422,906 *0153203BB17BCB00E99661CCC110BB140D13A08A Angajatorii
12,422,907 *015C30CAC2AECE817A0F3211966AD1E6400630DA angaragatti
12,422,908 *015CF8A52E85C78D3C207FA3762FA4109A4A6D34 Angariaving
12,422,909 *015D0EF1FA67891CA5DAE17CCCBA19BF64BCF61D Angazman7
12,422,910 *015EB695F5F715D74D422059993E291274EC25C8 ange crivellone
12,422,911 *0153D5B54BD04296FBBC349B88B57F298E889379 angefllt
12,422,912 *01593627D6B5472E347789732339BB2E1AEFD89B Angefteaten
12,422,913 *015FC35E3071AAC8A053C7B4DF01C6BFABD47442 angehaengd
12,422,914 *015D17F44B414098DE70203AA6AB4115EACEB62E ange hall
12,422,915 *015F37270A2A6858C4D57421EF2A904547E3843E angehauced
12,422,916 *01524C09F8BCF78A178EA3AD34810AFDB18E2E1F Angehöri
12,422,917 *0156DDDA018EA5674058AE403CC6663DA3FCBC3C [email protected]
12,422,918 *01577A9F18E1EA72557F49924993D824504865FB Angel233
12,422,919 *015590FE81E904FDA3506A5D538546F25CFF1705 angel27481
12,422,920 *015C583250EF99A9805A3BF489143C6CD7814DE2 [email protected]
12,422,921 *015270DDBF9C75169E093108DA7792481D0BD196 angel$53361004$d
12,422,922 *0153DEBEA394221D281D8FDEDA609C3AD526900A [email protected]
12,422,923 *0150F003D830FD80D312DDD83B91364FD2042E81 angela920
12,422,924 *0150B92D18B6CB26C0D3D7C5C6FDF02C78C6EDF2 angela armstead
12,422,925 *01575BEDD09AC3EFBE5CC497394CA3E584371E7C angelacoughlan
12,422,926 *0158A2E4C9A8E20A459FDA145B8456EF1EEAD337 angela deyoung
12,422,927 *015C4579ACBDE03A9960DC4FE2096610DF46A993 angel.adling
12,422,928 *01511B0C045D2E0A9E25D1ED2A9F75ED97F37ADF angela ferdinand
12,422,929 *0159B33CA8B33570A8EFC2B9FCBDA6EBFFC52270 angela grosse
12,422,930 *01589A994FBD74958C6B585521A4253C3D5289A1 angelamahoni
12,422,931 *0153A233CE00469792401F62D88B9D2A1E6B4006 angela marsden
12,422,932 *0151B1C07D4D311662F1E2E746924CEDBC82B677 angela m mitchell
12,422,933 *01547B15572E4A706D0FD5C971A2FF8588EFC510 ANGELA-MORLEY-OBITUARY-WALLY-STOTT
12,422,934 *015E742B2E7F07B80E2BBE655E86DD15D0D1B42F angelapiro
12,422,935 *015B3E33B4E45B083145AAE2E6C0F632CCB97B05 angela ronson
12,422,936 *01526E383034EB0FC8598BC7A94CA2B1D686EEAF angela vick
12,422,937 *0150873BC57C4254AC056FDCC42E6D45137CBF9D ANGELBABI7
12,422,938 *0158ED4199CC812B04C0D9CE687C898F776D2987 angelbatool
12,422,939 *015C6D559489980378478710D810DC526CE9F5D1 angel.burrier
12,422,940 *015E7DC5EAEE20D6F772AD3A9C6CC8A0500134F1 angel caramoy
12,422,941 *015C406AB0024BA39F5FC9E17BF75BFE8562D661 angeldavid26
12,422,942 *015D8F2A3A192FB15FA0C6ED43CFD222A29369E8 Angeldefense
12,422,943 *0151CA65CF80DD5CF5A4A48DD58F245389192859 angel.dibrito
12,422,944 *0151ADDCC68A9F89564B5D47614A902EC6084038 ANGELED7
12,422,945 *01568670AD945874B2AF1073AEEBFD12E71E527A Angelenic
12,422,946 *015901BB89CFCB0BDB7C1864FDFB50EA25AE2CFB angelesae
12,422,947 *0152ADC96A1335B174C147E20F53F2A53D249106 angelesisnotstub2868
12,422,948 *015631F903508A75E85BBA1342720001B8272FEB angel.frenzel
12,422,949 *015E956A4BE22CF9A5B5E97A9B87E6033E7FEB6A angel.gajate
12,422,950 *015C23623E7CA0B43EC8B7AF16177888D7B475D1 angel.galuppo
12,422,951 *015EA18488006D5643D2E1603242C1F5F0F125C0 angel.goldhirsh
12,422,952 *01537260E62C85417FF2563135199E4D554E0D3C angelica ballard
12,422,953 *01520726406D6EA5E651B1CC5C1C0AFC069E05A4 angelica velasquez
12,422,954 *0158AD54B4F887A2E0DD1AF04013447F0D8679C4 angelikaniescier&andr
12,422,955 *015C5F160B2F3F197A331429DBEEEA9D39F56F80 angeline462
12,422,956 *015A531164F969F0D2946AFA1115099FCF3E4C76 angeline882
12,422,957 *0152524C4A90C77878960037B5442746A200831D angelinG
12,422,958 *01528CBAFF70FD4657BDB91FE12A86F6EAD0D7E1 ANGELIQUE09
12,422,959 *015D9F5254518CD47478AB58648DD09CFAAF3C7A angelitakelly
12,422,960 *0158D065B57C2C2FFB1D49F894CE85515622166E [email protected]
12,422,961 *015F249F3E4BB01E8D6BA2EEF3C6ED1B56F013BC angel kimura
12,422,962 *015A1A3122DC6762EC989AD302706844C6AD74B3 ANGELKIRSTEN13
12,422,963 *0158056FF183B5218E8E115368E8A143FC273E1A angel.labitan
12,422,964 *015CF3DFD12646C56E271020C7BC65148C9D6E9B [email protected]
12,422,965 *0157852B4E2D11BBD7BC68A317BA6949A340891A angel.lecates
12,422,966 *015C332BF7A284804C1A18AFD20D15467D199F97 angel.lueckenotte
12,422,967 *015B40690ABE7576462008202AB68FE619864F5D angel.meiners
12,422,968 *015D39A4CD7D2E8780CE086751A4397C5C72A9A1 angelmio123
12,422,969 *015A2A71B01EE5468883B1BE29998E38B90FF8FE angel.mondello
12,422,970 *01589AC5AB0F9D61ED26964CE104CE66BC32908E angel.mumma
12,422,971 *0159F4B299208DD9D268AD734547F63A84C7FF8C angel.muszynski
12,422,972 *01551616749F0594564F7BAB7BD625E34964BF5C angel.nagura
12,422,973 *015AC4698C80DA6314D12B74CF649B705F118E8F ANGELO98
12,422,974 *015C24780A6C61243373886175221BD9FCC66225 angeloadona
12,422,975 *0152C64F235D7DC78FBA6154E36583AD4151A7C7 Angeloalfa
12,422,976 *0153FD139B4BD57484C7AAA6E8A05F5E048DC1F6 angelo.aukamp
12,422,977 *015E76BE4F7F74B5F16D0F13A7A4849A99A32F3C angelobulatao
12,422,978 *015F189713B736BAE584F2F1D7C05A142B081821 angelo.chol
12,422,979 *0154F5BE7244F9A1B720E4505BC1AE2BD9F59094 angelo.cupe
12,422,980 *0153440862F264B90C9EEA05F10E4F9820C2AB9E angelo.dadisman
12,422,981 *01537D96175BE5DEFC86B03E55D67B8FF4C03C81 angelo.elliff
12,422,982 *0151C8CC7521F859A315685CFE771BBD0662FF32 angelo.falis
12,422,983 *015CDEB65972D424F228E4C73B8CDBAF9620CA46 [email protected]
12,422,984 *015C18CA8DA7F194AEEE38A8D90F221EB29D8754 angelo.hayoz
12,422,985 *01514D6B9BE2B5A53403768F357ABF660F790BFB angelo.heffern
12,422,986 *01562C696AA72D1C4DCD75719297A163A0B1F5FA angelo.hy
12,422,987 *015616576796B23383B9AF33140A7D41214613F7 angelo.krain
12,422,988 *015276679BDCE810BC74D9547C9BAAB0371E260D angelo.kram
12,422,989 *01555819978706730DE3676BB63AAAE5A82FEFB8 angelo.kramer
12,422,990 *015E304269999E5EE00B1FF9168FE2E4B266D564 angelo.lofredo
12,422,991 *015F2D2A5494F74F6A752484F021D6C65F145F53 angelo.loi
12,422,992 *01583E66C8D1C0DFC9332D0CE8C26A5C58D52AD6 angelo.longueville
12,422,993 *015716B6CF29AC827168A5FCE6FB4012245E7016 angelo.mcghie
12,422,994 *01527B55E281207CDEA9412CD5CA12538DD8D423 angelo.mess
12,422,995 *01525F2E7B0A458022A3B383ED8B395185D62D76 angelo.notarnicola
12,422,996 *015810392A95E9D96CF269797BE8EE00583A49D7 angelo.pechin
12,422,997 *015D831CFF317C3091BD2D93F8D8900BDC4E4B54 angelo.pelc
12,422,998 *0153EF578446FE0A659DDCC71681DCDA1DF35EEE angelo.rabidoux
12,422,999 *015A7BA2CE0269A270DAC5067965D82B1EBCC9D5 angelo.rinehardt
12,423,000 *015FC4B35F6C2701064532AC045E50EBF159F38F angelo.rister
12,423,001 *0151D695C0A0BFEFDF7FB0395F93A942805ABF14 angelo.riveron
12,423,002 *015613ABAE1B5B8B95DE4C96A5E4EF2C2216C236 angelo.saniger
12,423,003 *015F646920CD4D38E4F9A2D53360691B9F99C1C4 angeloscott
12,423,004 *0156C9CFC734B7553E7214B8CD28140D956C8CD2 angelo.skeans
12,423,005 *0150090A7A025A89A7CCB805DF39E8364D977D5B Angeloslottet
12,423,006 *015B900AFC1C87F48CFB9470579FA47FCF295DB5 angelo.stoetzel
12,423,007 *0159D402EFC1351494A8317C77F09E4DB332E36F angelo.sugerman
12,423,008 *0157F7E26DF9A5011BB3025D93371904C8F66F1F angelo.thigpin
12,423,009 *015653D8C253A0488C3C83F2B6E39E85D82874D1 angelo.urbas
12,423,010 *01514A52D18C0BA32EC61518739B426BAED67668 angelo.ventris
12,423,011 *01529F54D3CEFB706CD8DFAC5D369F78A4FEA445 angelo.werma
12,423,012 *0153927E5A5A8E9FE737BF8B0E6BB7B5A14261AE angel.pollan
12,423,013 *015E3ACABF55D92EFBAA3247A109BAD10AAA2218 angel.reville
12,423,014 *015FC33493CB150FBC8A64DFDA7CBD1B634B2E41 ANGELRG220
12,423,015 *015D68BDFA7B15E3EFBD3AD9645E8FAE07A3E1C3 angel.rifkin
12,423,016 *015DC2C928CA077908EB194F8EB390A9ADEA89DF [email protected]
12,423,017 *01526827ED4B75666B7C933872ECB08D838E49F2 angelroyster
12,423,018 *01561301835C959E9148391AA32A5C63AFFFBFB5 a.ngels
12,423,019 *0154FFAAF3D27ABB3874E6CEF8287BD3F321242A angels and demons at play
12,423,020 *015142A4C9AB0CD17C0BB12F32E5E1F1BFCFE6A7 angel.saxfield
12,423,021 *0153282944D678075695352F4E9E0BFFDF380508 angel.schurkamp
12,423,022 *01534AD88E4D0AA9CC141699E725BA6AE9A31774 angel sealtiel
12,423,023 *015CEDCF4AE6721366C81E387770DEC599C0A2E0 angelsnestcny.comwww
12,423,024 *015A589017E4BCD2CBF77A0472015A01723558BB angel.spraggs
12,423,025 *015034C4A052F6EE0A44F039142C7DA4AE973DAC Angelswizard
12,423,026 *015CF13CEC1128F74D74BC4E02B5C38DE9899E60 angel.szydlowski
12,423,027 *015283BCE33CF234D9A5FA4742B5B0879931F322 angel.tassa
12,423,028 *015C5611F027BE076918EAE0E9560141FC27E111 angel.thompon
12,423,029 *015E98C52023403B9AC26A361F066237394E718D angel.tokuoka
12,423,030 *015BCF7D3202E5A0A5A75B5C900F1E32E0D6F256 angelturley
12,423,031 *0151C700FE62E031494BD40D0C266C0BDB493BFC angel.twigg
12,423,032 *0159F604C95469579DB25A9D9B9BE2B5413488D0 angel.wela
12,423,033 *0158615973A6E4B2C6759DDF07C9ACADD1595A63 Angelwhateve
12,423,034 *015742146ADE8C3B425189663F008F8F72F5565B angelyep
12,423,035 *0151DD2963B19504765958F4CE6ADC67C72537CD Angemerk4
12,423,036 *01531991B75203487DA1BCBE48C77B1DBFB2D101 Angereth8
12,423,037 *015B0EC4716FBCA31B15AE223C0622C94D54273D angersfrance
12,423,038 *0153C440B370AD1592ACB020647B66DE4A5E95FB angeschärfte
12,423,039 *0153DFDA4BBCE5FAA07B2E1755C48D9B518ABF4F Angesied4
12,423,040 *0151A8450988ECB6C3AFF54FE57DFC04774144ED ANGf_
12,423,041 *015A9E80B8AA0F53D4A544145BE7CC1F9950DFC3 angftvolleu
12,423,042 *01570D2893F218D677367BB3CF341FA98A5E9088 ˈaŋgəˌhøːrigŋ
12,423,043 *015A9D6DD4C705FA56569A3D960718CB46D69A2E ANGgv
12,423,044 *0155A0E5D02D2C7FDDAD6472F1387478835DCC5F angharrd
12,423,045 *015230A0C24BE96B3B03F205D41B7702D9C990B0 [email protected]
12,423,046 *015E4CE3A2870FE3CDB48ED648D117558077CF5B angie09200
12,423,047 *015568F0252698945341B47D1B1F23448224E599 angieavellaneda
12,423,048 *01515AF36A04A9C9B64E88A517A52E3D493FA261 Angiebasfed
12,423,049 *015D2544A893DEBD82AE13DB28F256CE8FADA649 angie burr
12,423,050 *015A2EDC990B9986C52934DD631C52B4BF4E45D6 angie cassel
12,423,051 *0150429DDCBD9D0153CAC3FD2EE4942B2153BC5A angie fairbanks
12,423,052 *0156E01393A25C3DBFC7837064876BFA4BAED84D angieheiser
12,423,053 *0150F378FEA885CC98E44CDCF7C2D81C13368247 ANGIELYNN4
12,423,054 *01513EFB62B17AE5FC3E1D3DE783BF5156EA5A50 angieromanfromgreenwood
12,423,055 *015E680E636314EAA87BF068B99E0B0F2ECC1932 ANGIESPITFIRE
12,423,056 *015C74C01124B7C7C6F77445DDA0DCAD89015F24 angie watts
12,423,057 *01551A1679699C4818B4C7854998D8C5546C89A6 [email protected]
12,423,058 *01577D32B91D28B971B999D6240F951D7C294FB4 ANGIOPSORA
12,423,059 *0155AE8193946C88632C77E5D08C7F8A76130FF7 Angle“
12,423,060 *015E9C44DA1725D1470E34A9E77F751C4D6C317B [email protected]
12,423,061 *015F2668C98B2ECAD06C2B1D0A826728B145FF3C ANGLEO6
12,423,062 *015B67D92A3EFA0FF7042AB044B21D3A8193D1B3 Anglerbereich
12,423,063 *0151DE30134809AFB59EAD548127493680E4F167 anglersreminisce
12,423,064 *01579F8AC0E75F6E27AD1815652215B815D42141 angliaailgna
12,423,065 *015E668F1ADC94AC3442E81D6D6AC125175C2A53 anglicisants
12,423,066 *0157265595D549A1A6C4FE74269811BF51798032 anglijskaj
12,423,067 *015A3CF3A899B712BEF647147EBEC8EDAC9BB931 anglists6
12,423,068 *015109045179CFF92421F45CC807454DE43F3EB3 Anglivois
12,423,069 *015D6DE0ECDAC8CA7333423B75250DD80325FC39 AngloAustralian
12,423,070 *0159325C15BB1AFAB8722FBBBC52286FCC73AF8A Angluces
12,423,071 *0151BC0E796C8ADFAA570345F2767FA5517ADF28 An.gn
12,423,072 *015B33CF90585569949D5D43878A054188C9A7C2 Angoissait3
12,423,073 *015CEE9790FAEBADA4B99E21FB5D72B4B8BB8174 Angoisses!
12,423,074 *015B6837771A86E616503A3727558C53D7CD8D27 Angotering
12,423,075 *0153CC32FB78C219D2B555438C75BE28FA1CEF1B „Angriffshelikopter“
12,423,076 *015DC08D9B5CA0C76382E05EA183E1A7F1EF80C6 angryratbuck
12,423,077 *015195955DC75C92E02370559BA6889E5DA50E1B A
12,423,078 *015931F49B24806B290723ED0211A2F5B9B34D88 angsetznd
12,423,079 *0150B7E195D4EF36327E3D3BCBF437BAFC48352C angstvisioeN
12,423,080 *015C305E86708EE809E3EAB9C1B2CEEECC977061 Anguill4
12,423,081 *0153AD8CEEDCDD0CDF885CDEF65BB94FAB01D2BE anguines0
12,423,082 *015D52209F5C60B7D79ADAA6C4F10C6F5201ED08 angul999
12,423,083 *01595DD3591872D635A3613A9386651BB6E72BFA Angular1t135
12,423,084 *0157F5636B7388F5E6EB3EBD6F2BCFFB03E8D376 Angulo045
12,423,085 *015618BBBE4FB3060CC640342F021D06E315A3CD Angupir4
12,423,086 *01525B28AA84984CC762098BC7846CFA6CD22069 [email protected]
12,423,087 *015D3C2D932457BC9001E44F84B6A9CFA8246DE5 angusbroc
12,423,088 *0154A355EDEEC17B311FFB3DDE3155633026A8D0 ANGUSMIKAEL
12,423,089 *015440036CD770207373C56F6B45324E6299418D ANGUSPSALMS
12,423,090 *015F31E7B4F0D1F569A63697BFEF480AFE142D62 ANGUSR45
12,423,091 *0153D649DE5C330412E548A41631D490DE9310A1 angustas3
12,423,092 *015671D240477A0E5C06676D1996DC6E49ACC7C6 Angusten6
12,423,093 *0153CE4A6B166B049E8123E0C13B592137812B89 A$N+h
12,423,094 *01520153B9C52AF6A20F0CB7C55F0391E456851D A
12,423,095 *015989E6DC945DC90E1BE99FE8C83273BFBE7299 Anh/%
12,423,096 *015C42631FE41507BFA2E93D157C87FE09DD649A anh0l09iz35
12,423,097 *0159743BD0CFE139966CE6BF0CCA798803722E43 AN%h1
12,423,098 *0154B7530A3A2299C0BED0F1189F52CB49F82AA5 AnH$2
12,423,099 *015175EE3818C8D0E5010A7302605642A947C0B2 AN+!+H35!5
12,423,100 *015E9A9DA426F6261E7A5E84BFDD2E64542D6BC2 AnH,7
12,423,101 *01585EA288FE824F238AA0B2DEDD4F88D15C4E04 ANH!a
12,423,102 *015215D32E7B975EEBC3AE602F78262D8A503BB3 ANHALAMI
12,423,103 *01506C8FB7A030495E0D6912EDA4308080864B07 anhand9
12,423,104 *015B7F0402D2243F1995F44CDBA484475F89BF08 [email protected]
12,423,105 *0158DED7ACED62648CDB5CA8DE8CB6434B6787FB Anhhong4
12,423,106 *015475149BDDB58039F09CE1B35BE57A06DE5A27 ANHIDROTIC3
12,423,107 *0154F88023D58BA58BE5FADC5AEF4FDC0C04821A anhjm
12,423,108 *015B69CAF9CBCE4B05F1C731F5A2DA8BE302848C Anhjs
12,423,109 *015AA7C17C697BE8159E988808F2439CBB5DBF58 AnhLo
12,423,110 *015596588F4C66BB1C4F53ED78C984DD9022CA10 Anholter8
12,423,111 *015C8E6625E664788945004255461E7A68C992BF AnH_q
12,423,112 *015B32B07F652179DC7D592163113B25F5C586AA AN+HROPOIDS
12,423,113 *01549D4D5DD17853355E3F41978B8ED5CD521090 A!+Ni
12,423,114 *015B1A4FAA01216D632896651DD2587DBED019B7 AN=%i
12,423,115 *015C677C17032FEB9FD15906CA6FED340DB28BCB AN"(i
12,423,116 *0152ED71D30C43D5B2B4E15F4D4604A182D9D2A7 A?n(i
12,423,117 *015DE61231D264A6F381E1F9014E051945690BB5 AnI0
12,423,118 *015A8B268D974D8BA805C5C9C8E34A1B72572AF6 AN+I1IBERA1
12,423,119 *01539DBB3729066E50D2444ED03E6BD6CF5D1428 ANi2S
12,423,120 *0156A0831BC58F4CE4635ADD34404949B6896CE7 ania duda
12,423,121 *015D659588BB76C5394725DAE8165EE5E926B64B ANIAL
12,423,122 *015133E9261B304B1EC5D69067CE58D563FF9A60 aniapp048cb
12,423,123 *015666D5D23DBE5C21741A33FE462DB588369365 An;Ib
12,423,124 *015A9E1131E0865D35FD59DF498F378A14320387 anibal.barabas
12,423,125 *01593E29B7654AAB04AA490DF49D16574C229E3E anibal.chafe
12,423,126 *0158A54EF7F71BF5521BCCA5A05679BC9B911CB5 anibal.diefenbach
12,423,127 *0150F41D270F3351201A3BDF2E8628455D7895EB anibal.dudasik
12,423,128 *0158E665EEA5F02FDCD7FF6F6BE5F3A13B26DA54 anibal.eiser
12,423,129 *01590666145FE29999AE1F1E6D0F6AB51C4BB1F3 anibal.halon
12,423,130 *01544F54B4E0442C288766BA490F853682DC8731 anibal.hohlfeld
12,423,131 *0153E98167C9DF0294584B75F7BBE60A589362BB anibal.hurtgen
12,423,132 *015C61ED0540B0F195F651986D47D7A4D786ABB0 anibal.johniken
12,423,133 *0158706457CF6318AE21129D4E0524D01C12F96C anibal.kinatyan
12,423,134 *015316CBF0F6F2A8F51BA9555A7B49F25CB67517 anibal.lagares
12,423,135 *01572ECE6BE1183BA57EB69BCC6928FA5F8B8ED8 anibal.oya
12,423,136 *01541230EF41C952A348E68CF315C696E3EFC63F anibal.pankhurst
12,423,137 *0152A3D46B261164C9825CFB6E217E8EC88B0EA0 anibal.petrouits
12,423,138 *015EB7550049865F2F0E1AFF3E652A060E8BDBA5 anibal.pop
12,423,139 *0156AA94332733D4AAB3491071222DC43CD8CA6B anibal.primm
12,423,140 *015CFACA0CBDB491BDB18E33DEBB88131113FA81 anibal.purifoy
12,423,141 *015571DFDCB58D1FDB68FAA66850530019CE4986 anibal.ralko
12,423,142 *01550B4968AE55260874957D90CE53F1BEB4AE45 anibal.thomae
12,423,143 *0150244CDA55B7A140362BFD25FACECBC7445450 anibal.wohlgemuth
12,423,144 *01571A1D8CB8FD7A234D597626059A95DFBEE021 anicca.
12,423,145 *0150EF7EDCE92365FF54BEC1CEB80D4E3EE01A25 ANiceGameForTwoOrMore
12,423,146 *0152C132AFDE4555020D18BB706AF09E43A74AA2 Anicolas7
12,423,147 *0159DA0A8748ED8604CAFC2E95E73D8BDB50E456 anidiawed
12,423,148 *0157B215595BA33BB9184112EB322A745EA6E7EF Anidrusb1
12,423,149 *015FB21F86A2E36767F1E3AB8B94595458393949 aniele20
12,423,150 *015151FD6AE9023C1616DDDD8109BE4E53231841 Aniemyyn2
12,423,151 *015D1C4918D08181358CF4881BB0111C8E0B0AC6 Anientes1
12,423,152 *0158EBE8D1AC73868B353D57D48F2AA7C050CA06 anigboging
12,423,153 *01591D2A16E341009FB4903B5FDBA2E618200442 ANI=H
12,423,154 *01591357C72C2C21A7A20CFD466269530133908E AN_ih
12,423,155 *015C62FC9C8015F77587DBEF3337691B5755A956 An;IH
12,423,156 *0151007BDF7A86A95A91CB0099A093AB149812B2 Anihsoh2
12,423,157 *015321D33CA710B84D5006313FE27C6C67158868 anihsruP
12,423,158 *015D886CC91471ED89272484F8B5DD721CC39C22 anika253
12,423,159 *015BB55E6A88FDBBC497238D8BB80DB7B933D166 anika kessler
12,423,160 *0155F1966B162581CD34799AC8AD4E04EBABF3CC aniketbanik
12,423,161 *015D88470EAA54E4621A1EAC3726D440F8261563 Anilodham
12,423,162 *015BD341CBB1BDAB1ADFC7A4EF1BA828104F1D8A anima+7ed
12,423,163 *015480D893716E7AEA38175AACA3BFDBD6753D8F Animaciita
12,423,164 *01568B12B211F19E4538002E7619F4B2E967BBC1 animag2
12,423,165 *0153F6061E0D2611E9ABB8A900E885EB43706588 Animahne1
12,423,166 *0152008D74E5F760FF8929FE612F349AB41AFC7B ‘Animal’
12,423,167 *015E05F2B4F37B8DF4DBE9BAF5F7475AC2889EAB animal-interactive
12,423,168 *0156991D327A2F74DA07EDB155AEB25C443E5C22 ANIMALRIGHTS-STUB
12,423,169 *015C39C4B6CE024B36F9D5BD1002ED685FEE0EFC animalrummy
12,423,170 *015194A2FEF27C7EC2A18F202A330A2AEB6A0F13 animal-symbol
12,423,171 *0159375985573277CD9CA527E7D88C935400228B animasti3
12,423,172 *01555F375BFDF51DBE51BA4A341C3C02651B7787 animatedanimator
12,423,173 *015564A92CF169ADA83118F6CE38778390E159B4 [email protected]
12,423,174 *015B493DFEE00C904F2A8890E9162718693E2434 Animhsap9
12,423,175 *015A6C646C2230A1880D1E81FBD74E8DC52A6540 Animuruc8
12,423,176 *015EB58FFFE6AE5574F732C81FA54239CE23280F animv09dHTML
12,423,177 *015A47DFF2D548B8FDB31468695D34BDD9B3EC80 Animyst4
12,423,178 *015B67F657238F49AE09F3A2027056BB31289066 ANinane
12,423,179 *01541E0ECE945040BAB891D7A10CA31C932C45FB Aninhos2
12,423,180 *0156E0C30841B66DCB4D188112C132383C255572 aninianini
12,423,181 *015560D041C59E228EF65877DD8C33459E50C480 Aniobsw9
12,423,182 *015E7952F6CD8179578C1813C4175AD3666F0D75 anioloning
12,423,183 *015133B057A1DE0EE9870152962E59D3F39D98A4 anio_novus
12,423,184 *015F8A7E5C0DACAF1D6AFA7F5CAE4B23E3347367 Aniredef
12,423,185 *0157AD0B7033C85AA5BA33B5B38708D7736B242E aniruddh's
12,423,186 *015F9D49B22E3C059FE7126DBCF44EC845FF4396 ANiRW
12,423,187 *01598A7B2D576FFC56AE924B457D3ABA888F4DC9 ANiS4
12,423,188 *01538B1975A9A808C3A79AA5E36D36917CE3F4D1 ANIs6
12,423,189 *0159887CAD6B2C904FDD9CA46AD5B70962ED5624 Aniseriez0
12,423,190 *01554F85DAAB830AE04EA54C19AE4541042B084E ANISERONS!
12,423,191 *01546E1240EE22DB745F19D63D50ADDD9B35583D Anisetti1
12,423,192 *01522182B1D60FC099355C431F4E2A09296D87DC anishabiswas
12,423,193 *0155BADF84C003CA4E16CA66A66117A0C4F8850B anishalalani
12,423,194 *01558CE568F9516C61ACAD5028D85407C1083243 anishally
12,423,195 *0157C45119A62083034045875A01301230B2DEE4 anish bajracharya
12,423,196 *0150293482705C2DB9066F34806865199841614C anish sahu
12,423,197 *0158EC759EAD7B6002A4B1905A29A78B63F0CD50 anislao5
12,423,198 *015E83F0F8C7C262623AF10AF9D7BD91A98E6109 anisoaraed
12,423,199 *01507E92602D907FC98DA1DD5A8F0C595AD5DC3E an+ispr3ading
12,423,200 *015502D0EB589E66DD8DE3CF7319E210DBD5A8A1 anissawallace
12,423,201 *015A6450181B749522C05245D047AC66FB2E54AB Anister1
12,423,202 *015C86E416D07C13062F78002A84150D118EF940 anitabecky
12,423,203 *015FF1E33010BD3640407CDB591CEE4456F402B6 AnitaCarmichael
12,423,204 *0152C87CA3832A04CCE0C6E5DA476D8C63EBBDAC anitacathy
12,423,205 *015B13FC884B8C50CD12D6424D71BDBE4817B51F anita-esstiegeinengel-carolinakomm-steigindasboot-weinvonsamos
12,423,206 *015FBAA9650627F816A9B23DFBC6EF2BFC42548E anita moyes
12,423,207 *015110F0592E5A4E4F7518CE9E688B6C178D1B89 anita solorzano
12,423,208 *0158E78CB7243E24047AFB8677B3B108B68CF2F3 anitastanfield
12,423,209 *015FAE63116471EB1CD8D7C94E27059924120383 ANITHA1234
12,423,210 *015ABC2E45C52452A73D2619334EF165A6C1CF0A Anitnals
12,423,211 *015A1F3F0FA3FCB41ABC9E06DA7755C17559B8A3 anıtsallığını
12,423,212 *015275E7A2CE82105D6B8EACA39EA8238473B0AF Anitsupas
12,423,213 *015E58343BF1B90EA87DF31D34C6CFD3F39886AB ani.tv
12,423,214 *015652D61F9BF463950C02F7DAB58ABA2FF9E539 ANIVELEN
12,423,215 *01518177F9469B8C8B4E57D17CE12CED6FC2308C anixter.comwww
12,423,216 *0159D2709BB650F8C382DC7496ED90BF9ED188EB Aniya122
12,423,217 *015023AEA225B6CDAD18312915A3DBF5C84C5A5E Aniyhtin0
12,423,218 *0159366783556CC33ACBD264064FCDE18BAD116E aniymggh3
12,423,219 *015423A46AE5861EA177224F3B5F2342EF0547BB Anj02
12,423,220 *0156EE1172FB325A729089E823F8FCDDB3F4017F anjali lall
12,423,221 *01545AD9C85344139AE3A22B64252FF566EA7114 anjanEtte
12,423,222 *015C06CAB99D3DBDFE2A61A35C87685DADE5BD0E [email protected]
12,423,223 *015EBDF4C5F0CE8F7FA1BF1178FA0F0718486D2D Anjl
12,423,224 *0156F28537DD0D0E43F2A5977520B982748892CA A$nk$
12,423,225 *0159CD79964D4CFF016E323F6A14638B67BC415E An"k
12,423,226 *015457F8CDD0BE083F7778056859F0E725984BDB ANK&0
12,423,227 *0158428CF054D8748164BDE478DD418A7E85E7E3 An&K0
12,423,228 *015969A66E029B03852414B1C4BCC2827BCEE551 AN:Kb
12,423,229 *015B8E543622E44A453D073FD5B579E3B1776E16 An?kd
12,423,230 *0154C19CDC72CD349840A905A86F4490906E4F3B Ankerkden
12,423,231 *015834D8D83B65E4C94F124E8F15A1D2476E5599 ANkF?
12,423,232 *015D7A371D901F2AFCF599CC1EB00AB9600A7D73 ankilas
12,423,233 *015D49102789FD833B8137976484818B1381939F ankita purandare
12,423,234 *015BD9E77C667981A6E7FA92E344E03084C73DE2 ankitkanaujia
12,423,235 *015F8F34D30880D506239ADBD7FAFABA849D4B95 ankitkatira
12,423,236 *0158469B9A565099F4A7AA040D04A493BD2CE98F ankit thomas
12,423,237 *015541D7B01C29A562E4CB80720D298F3ACA1FF2 ANKLED9
12,423,238 *015A06699D3BEE620470A9DD9660C2422453F91D Anklemmu3
12,423,239 *0151C3BA05D2FA2C938A7FDB64134E0D7E94A625 ankoppelt1
12,423,240 *015A9754C89AE704049DB3A11EE46E830058F65A A#nKQ
12,423,241 *01536DC491569B3896C12C88D4415D3188FE9F00 AnkTm
12,423,242 *01594F995BF8503414FC7447DF32E49A0CE905E7 ANKtp
12,423,243 *01599F182E96C2478C6D7AA8C4F02B0B20A6FA80 ankur chourey
12,423,244 *0153B47ED320F3FC4F32DF860261F213B932E2F9 ankush deshmukh
12,423,245 *015ADB2F58D1ABBDB4C974D223B5DC4AF6F65AFD ANl;#
12,423,246 *01525B41CAA58D7CC71E296C7365CC63CC70C8C5 A:nL
12,423,247 *015A1E496AAF96BC59350DFC8C3110F6496C99C6 An-l(
12,423,248 *0152B4A76D60316166C398BF7D29C5BC4C262017 anlagengegenstand
12,423,249 *015EC0E6A9D415E77F6B17040BEB1193E7729F33 anlagevermitt
12,423,250 *015360F69841125FEC11BD7A0515A1B2A973A808 anlatımlarıdır
12,423,251 *015EBA03DA0AF8D19FAED41FCF0C60DDEB08E5B2 anlatsın
12,423,252 *015C7C7EC522EF4E75CD512C80F34F2EADA5D408 anlaufging
12,423,253 *015A016F58AD2F093299F8F5142E31FE3B8FAE9C ANLbO
12,423,254 *015B3F85472DE21DBFAD597826F4E2621667EF7B [email protected]
12,423,255 *01596DF0C6CB3676E1B8A0FA4782FDB70E5F10D2 Anligste7
12,423,256 *0152D7F9307A3B3C3D01BF30E500D342DC062E08 ANlj1
12,423,257 *01561E8C7F451EA666A35821F5C1A35B4F76144D AnL(M
12,423,258 *015D223DDE51810D596977895C54F5BAA60C02DD ANlO)
12,423,259 *015A512352A9F2CB37EC342862AEF5842AE4D795 AnLoP
12,423,260 *0157BA395F4946D0B4191A5741A367298FFDC80A AnlX$
12,423,261 *0159E77B045191C9FBB8830F10DF28F2CA672A66 An.%M
12,423,262 *015B567C3D4AE6C8A1FA4DFCE3A4BC8452FE3F6A An#
12,423,263 *015DCCA6A47A9D90C088E712BC2C2DF5E96F2B75 ANM_2
12,423,264 *015C7A4B3B8C5DE324B8A0EF287896FC03A933BD ANM39
12,423,265 *015582EE62A37214A7964A02D92D26CCC7E6D97F anMailm
12,423,266 *0150C027848C096D74ECCD2C4E8CD2CB1DFEA7C6 ANmaQ
12,423,267 *015F38F0C38EA3B358DFE174E748092DB2466254 ANMELDEFRISTEN
12,423,268 *015427AEAB91FF181CB934507EA353CE7AFCDEFB Anmerkungsband
12,423,269 *0155F311CA6FFEAE1B4E12C12CD95226E779307D AnmFE
12,423,270 *015BCCF6C6214FC5CBDDE322230CE77414B56599 ANMONITE
12,423,271 *01513082245A4EE41DF33EFF4E9A346042031C15 AnMUA
12,423,272 *015DEB70F86524B72ADD5774E4F126F867502698 ANmXB
12,423,273 *015D6BA9BD7C85ED3E8CAC2321CF1506D9710745 Anm"Y
12,423,274 *015F3A1305A417F8BA5D7F7A7B72C3BC275BE5AD A=nn
12,423,275 *01530F4B83A126BAD9594CC005312EDF40A3E1D9 Ann!!!
12,423,276 *0154B7F6E6FB46C11AC8CA022F3416BC5A8272F4 Ann";
12,423,277 *0158D7B1A8B57C45319FF110425B0271F2940F09 ann1en71
12,423,278 *0159ABF638F586999601BA2C3B72F28B5D2AD9C0 Ann1h1la+3$
12,423,279 *015119A97045CEE016702D95A99289B703B9883F ann2307
12,423,280 *01545B206C5FA93AFEDA78F7EBB9F7C84FADE5C0 ann3bbiam0
12,423,281 *015D6A1B6E69F7999E0A4C5AC0CD9930B46F6FBF ANNA180486
12,423,282 *0151A6230B538A10927899D66EA157A915216D75 annaairam1
12,423,283 *015FDCDC8D8A67B17373599F364E3A9436580704 annabel555
12,423,284 *0151CA5FA041A52F13A1557FB3E978EE87BE466C annabeldean
12,423,285 *0157D7D02568771CA32C8D51A2DC8DE1410AEBDD annabelle482
12,423,286 *0154CFE1E1BB623D49922A764DD3A9802F0A1D65 Annabelle872
12,423,287 *0158833BAA06620A177CB55160F12539E42F600A annabelle del mundo
12,423,288 *0150D4B592E93733B5C18B81CB64390942675B83 anna delara
12,423,289 *015F7AF66926FB1AC26D55DFE4356F3D31EC9464 anna dire
12,423,290 *015D2B37411D2028F7787641876BA1761A113AB8 annadunsmore
12,423,291 *0151E3A7619F0A18D2F495B501ABDB90EE17A076 annaevangelio
12,423,292 *015B682911E60040DF0C1DA162B1B28CECE2A45A annafabrizio
12,423,293 *015EC13B2307AA70F1905247C2234018BF252F0E anna fix
12,423,294 *015E0335138EEBF5721CED195811D2ED8EBCEF98 Annagreen4
12,423,295 *015CD4348241D0D09F8709F97320AB0F14318DA1 Annaheoj
12,423,296 *0156B2E0D5A40B3BBCBF2531377D9DCFBAF0DE40 annajee0
12,423,297 *015B293A5720B01417EF983612FF35E9CF037FBC anna lau
12,423,298 *015FB3041B4933FD5327AF342399AB9AA36D5C15 AnNaleE
12,423,299 *0151AD67236C4F7521498F7D00B76CE7B2D3A641 annales8
12,423,300 *015937916C57279D680F077244B8194E18C1B233 annalib1234
12,423,301 *015EDB1B92D3C1B5BD74F13273435306D4E81CF5 ANnalIsE
12,423,302 *01558BE017F316C7ACE47A6856ACBC8988C66D9F annamanndi
12,423,303 *0157168AA9DB43776889DE5AEEB5DBA041F9FFFC [email protected]
12,423,304 *015DD683F86F06BBCB527B7AD1650890C2E7B407 anna musso
12,423,305 *015E8E7E9F542280A79675DA771C9B14DD4C0012 ANNANDAVE
12,423,306 *015EB9097852652E7BA7AAC97352843BB6A93F6C Annappan
12,423,307 *015995D54C27A2EA1C00348CEF7CD100F13E0AB1 anna rackley
12,423,308 *01536F89C59566B99F919DE80650A06B88BB4419 Annarakasrajuhetki
12,423,309 *01549CDF38CDA4694ACECA5DF55C713ACC752815 Annarea1
12,423,310 *0156772C0029A07755573A20D51246112F0EE9AD ANNA-RUDOLF
12,423,311 *0151308689FF7CA3DE790DEBF64B5912D5303320 anna sainsbury
12,423,312 *0155DBEFA5C3D58CA43A77BCF95081356C1FCD79 anna stouffer
12,423,313 *015FF4C48AD6151FA16536167BA271989A759430 anna thoren
12,423,314 *015CA7A48BB89D634D1392909973B2E33D3E31DE annatiting
12,423,315 *015EEAD7A304166A6B60DD55767C3D91B9C7210C Annaxor6
12,423,316 *015834A86100E75F4FC24B0FE24C2AF783FAEAA4 annayh
12,423,317 *0153B04E01008C448227E8EF701DA0988E424080 AnNb6
12,423,318 *01564175C33EB8CF43EBFE29E50B8871CA04915A ANN_CHIQ5
12,423,319 *015A19811C5987B21F29E858028C932F72B21C1D anncosens
12,423,320 *015C47E2AFFC684B818311EDF5C1EB940E8ACE8C ANN-COULTER-GOT-WHAT-SHE-DESERVED
12,423,321 *01507D09C153164AA903D12C0F2AEE1C20D0F33F anndretti
12,423,322 *015401DA4563E01E526602BB3EE8B3A4C51B2D03 A-NNe
12,423,323 *0152DEB767F975C8E97FF3A9D5042155ED432A55 annealmodovar
12,423,324 *015EDD4112E0A9F89934CBA109A05D55EFC1173E annebloxsom
12,423,325 *015104D008BEE12EBE704D9F50167D5822F61079 aNnECorINNE
12,423,326 *015BCEC572E89A245B2DB896AA2064F164983367 aNneCoRiNne
12,423,327 *015966957F4E29F6258FE7AA112586486B6B03B0 Annehsok
12,423,328 *015FCB9609DACF1FE507CCB074A0080C9EFD4CD4 anne kaffekanne
12,423,329 *01595B96198CB7E054BCDC1FFA232BEE70D0A682 Annelerimiz
12,423,330 *0156F5CC24CDCE131078E0F887DDF9516C848445 [email protected]
12,423,331 *0150F2B0CD45ED8ED9A70FF176F36E55828D3461 annelnielsen
12,423,332 *0157F05AB485C7E3A20608C246B157F7C954FDDD annenbr
12,423,333 *015A99577AB22B37A8FE6A844BF4B496028DD99A Anneorlando
12,423,334 *01504385B249D3F0B26D5B74907E6350B9041C2F anne peacock
12,423,335 *015612606DBDAEC1F944FAC1DFD6DF899D23D500 Annerare1
12,423,336 *015A5B7DFACC6805294F075BF89E4498A1445E6B Annespike7
12,423,337 *01541891BCA049806240E6E4930F928A63DAF706 Annet8
12,423,338 *015E58DBED1781EB7055F875A668D097384D7432 Annetaffy4
12,423,339 *01529894622B49960920E5EBE2B863C0F507596C annetessari
12,423,340 *0151D6FE6DBBAEE0FCC6325CAC44CA00208ACE7C annetteliesegang
12,423,341 *0153818C3E5FB3941A1D1DDEF9BFA2684BD6737E annette pettigrew
12,423,342 *0151208EFE124CC500910800EFA0D06A956FDCA9 annette sosa
12,423,343 *015C5005152598A49859A22992BC1E606E071184 Annettet2
12,423,344 *015CC87C4B565601A1ECFB3A815B158CD0EC8266 annettevanpelt
12,423,345 *0156AB1777CFE8D763F268681E8556F9D13EE574 Anne Waits
12,423,346 *015D25DEFF356C22E11FDF45F88C2656604AE8C4 Annexaie4
12,423,347 *015344DA6B5E597AADF9CFB56AC847C52B4DA736 Annexero8
12,423,348 *01508C812F49B289938BC023E6F9DE4FD29D28AD annexionsgedanken
12,423,349 *015EC6610F2EF536AC38E057D9DB77D5396D9E68 Annexive7
12,423,350 *0159CA3BDBC222232C1CF39ABFD824FC9C82FC0A anngol
12,423,351 *0157AB2D7E434E6D43795D218CA9ACE64CE4C5FC annharaldson
12,423,352 *0157B3266BBB745AB4D3BA68F11C6786B64DFD4E ANNI201079
12,423,353 *015FB39EBA796D941F97229FC063CBF246B7CF2B annibal's
12,423,354 *01598623747991A6D63A141626294537555D4C18 annidi9
12,423,355 *01500BF5858775D2C57B7ED0F4DF3CDCBDA7B962 annie191
12,423,356 *015C9F738D77BFB9960FA6028CB746CC5CABA3B2 ANNIE2386
12,423,357 *0157350AB577662E0944553138A6B2180D660FDF [email protected]
12,423,358 *01539C7C3BD81B3D6D0D37B988D416A04284D51E annie carson
12,423,359 *015FDDB37B1B440CA6EC92AFD1E7E65A70FD764A [email protected]
12,423,360 *0150E64DF8237B8213E9B0E9C50140AA46D7A148 anniehohne
12,423,361 *015DBD33187A21914C648F4F7DDC94B0249AECB3 ANNIEM06
12,423,362 *015CD524448F847322581F3251EF5CFC4546BC95 Annienite5
12,423,363 *015B431ABACBD8412467B893FACF03DABE371AB4 annie plante
12,423,364 *015E609E7D69AEE1D97D68354667791C5FEA28E5 ANNIETIGERCHUCKY
12,423,365 *015F2D7DC1B3EC7F76D2A80DF047B1E3E9037C0E [email protected]
12,423,366 *015B03D4CAE7E4E8096BB5E07AB5CD845C2A420D annieventer
12,423,367 *0153D72C34A79819317DDF64B41C95A8D555316A ANNIHILABILITYN
12,423,368 *015E189E09DC9E33194F1731C4770A258F6EAEBF Annihilative3
12,423,369 *0154D8B784EEBDBBA1C49E4761F5E20879EBAB5A annika836
12,423,370 *015954B1E7C64B61D74F2AFD8AFAAFCB593840CA annika hector
12,423,371 *0158A4675F11681BEBED531984F0F68FA279FE52 annika lawrence
12,423,372 *0154E8B5BD326A577ED6222940C5521AFB2CB854 annika martin
12,423,373 *0153C158859D32DC32A0CF545BDB53DFB268AAE3 annitto9
12,423,374 *0154F486DEEE864F39A5480F3EF9AE858AB5C82E Ann-Katrinfarv
12,423,375 *015613167388B680845811C3750046D35DCFF3D3 ann leone
12,423,376 *0150EB4DE410DD8B274325C42957F522BA8ABF22 ANNLq
12,423,377 *01584AA874B5A1BC5D21BFCAE7B1D5A49B2A561B ann michelle cacar
12,423,378 *01500C532D2E2EE61386DC8DA8275CB4DB8FBADE annnmari5
12,423,379 *01587BC9FF780E71949C3FFE3D95568FECBCDBBF Annodand6
12,423,380 *0153039C7E2357C7B40B5375418D858A780B0C81 annonceproduktion
12,423,381 *015E5A0FA11A3B4F171A89C22A5840088E350D53 annotammoed
12,423,382 *015A081F8F21EE3824A415055B10CDB36AC80715 annotata4
12,423,383 *0153AF7F103EC6FD50AAF4646E4B4F146F2ABF3A annotatie9
12,423,384 *0150E043E7BA460982D091AC27806F0CF4DC19B7 annotavo5
12,423,385 *01508467CF9A87D88D57C7048A470D46CBA35F3A Annotraked
12,423,386 *015D818104CEABB313B507CB435222AAC123A485 annOUnceR
12,423,387 *01554C75FA201D306ADCCB96BAEDE398C0448014 annovazzicharles
12,423,388 *01512280C669361AFD09CE8D7054244342589FA1 annovera!
12,423,389 *015C259142A25744D6DB25148F561E4F955AA13E annparasram
12,423,390 *015FF6E960F68D2D4D059F827E88093E2A8D02E6 An:Ns
12,423,391 *015C5FDFEA6927E79B2576BCE81F4EF4C7CC2B59 ANNUALINFORMATIONFORMS
12,423,392 *0150DCD4EA1F04AE725B19124249E091C0DFCF20 ANNUALIZE2
12,423,393 *0153A88F304F3FD57167F2C79636FD4E4E28223A AnnualSymposium
12,423,394 *0157F3D8C8AFAE67CC21047DE62FBCF5A823725D ANNUELLO
12,423,395 *01564A20C107E9242239CB6D5DF26DFF34297F15 annuga
12,423,396 *015AF54FE738E52B98937876DCB9C5DC69EBCA4B Annuitätsprinzip
12,423,397 *0157421202233D85E0F22D8CE475916A5942A722 Annuitetslaan1
12,423,398 *0158F9F9723CC4D1DAFD173C7599F5EE007A3B45 annulet12345
12,423,399 *0158D17BA1A36FBB373AA59018F8048D717275CE [email protected]
12,423,400 *0157341C7B1BEEE34DDB824C774E6A5D6AA3E4FF ANNULLING3
12,423,401 *015A024CE209509729343E34352519D62F851F74 annulses4
12,423,402 *01582197297546351F4C6CD8021AC6AA8D4A0CC6 Ánnus
12,423,403 *01581EC6C6D65C246D1303B83FC3EEF5CD3A6F14 anny:
12,423,404 *01514424A0BDF7ABE4D73A20AD5A84B1BA3014EE Annycca9
12,423,405 *0152B0A288DC41EFBF441F4FBF9992E90461CC15 annzoanni
12,423,406 *015B872FCDA2B32ED15EC5F79D97903E398F0879 AN=o:
12,423,407 *01503C267679C72D9753D740972C8EEADAD6E54B ANo(=
12,423,408 *0151CF2B44B4F3B9BEC72762628F6A8D3DE35ABC AnO01
12,423,409 *015F992AF464BB966DF790B250CA2A27C0B7535F ANOCARPOS
12,423,410 *015651B11B1FCBC074CE2482CA8B7E17ECCC30C0 [email protected]
12,423,411 *015CB1E661D9B8DB9DAEBC09E6FE2E8CF9F15FCC ANODIZING0
12,423,412 *015E6A207CBBB8AE5D814F774EDB6CFE0D17C4DC Anogatco1
12,423,413 *01572036AD71447A66305C1779B3831D0E94AF43 AnohA
12,423,414 *015B7801D70B306CCE604B0A7CBD93BC3F16B859 AN
12,423,415 *015D130C91FC2A2A9181B4299536A0E495AC3A21 Anointed9
12,423,416 *015ED099292C878B580D046CE1411CF90FEC4C46 Anoitiuts
12,423,417 *015307E8A43133A0EC14F250D0186508C7CB63E7 ANo.K
12,423,418 *015A31E8DE728E1A3A90F7FA7AFB610C7899FE76 Anologique9
12,423,419 *01516B77740A2D1ADFD2AC7265AB1AC5F78FFA6F anomaBSW
12,423,420 *0150DDE1526C3A29F2E4A47CBF959130AE22B3A3 [email protected]
12,423,421 *01531F064B52AB58844DFF807ECB4344F19D49E8 Anonaceo0
12,423,422 *01504868AE87B26BDB3D7A0380EE0E846070CB1E Anongoffing
12,423,423 *015ACFD47200A324AE418CE17CD5C5CC71BE8913 anonnerons8
12,423,424 *01512DA86355081AEA6018DA56AA40F22ADE480B Anonneseses
12,423,425 *015C4E710F3B6BE2BC102322CD8B1853353CFE17 [email protected]
12,423,426 *0157337BE1B3541834F8A8132ADE4A0565C81374 „anonymisierte“
12,423,427 *015F29E3023CD315A121E9A60115B3E5FB618078 anonymousbr
12,423,428 *015F60688F0389009A64FACDACEEC03C81740703 Anooigel5
12,423,429 *015C5376A77723CC88485E8CC0E1A922EE4580B9 [email protected]
12,423,430 *01537AAAAD1D00AF40C06843D35EDEDBE2D74584 ANOP"
12,423,431 *015F835E102062DF5D86B1B487A5B61376BFC07F anoplotherioid3
12,423,432 *015BFC0EE7F6A795DCEE9210263D963546F718F9 anordestina
12,423,433 *01581A6BF57700565D295E9EAA1E3230DEDD7595 anornit8
12,423,434 *015868E80F48EAE108BAC85859BBC8EEF6AE4914 ANORNITHOPORA
12,423,435 *01578D8568AA09ED3E4E60A2FA5A3319B8A6247C anortosít
12,423,436 *015684779BB4FBA23F8C25037D9100DAB3344852 anoscimmia
12,423,437 *01567F3D2A9307849EF4F0B0A6E5DA207175EFD0 Anosmiac1
12,423,438 *015F8FD3190BD9F1119F46D52D047B2C1224E881 ANOSMIC4
12,423,439 *015995D53EF08D5B06B07EFB65AECF3C44219D9F anostrament
12,423,440 *015C89740BF3849B3D28D353F48F1698982168C2 Another Game
12,423,441 *015A4A278C69DAE0DFADBAC4C1AAE81BC80AA9E9 Another Heavy World
12,423,442 *0157EB86369C1BB7DAF2AB99022E9A468012C770 Another Month Yellow
12,423,443 *015F259D202D9AE78EA4DB872DA84CE563ED23E4 AnotherMurderSong
12,423,444 *015C84D88A397F58A7DAB312CFDFC49BDEE8D888 Anotosta0
12,423,445 *0151F3587B29E1C2836E515F89759A88B2C5AB92 AnotP
12,423,446 *015B693B866DEBA43C266AF932FDA7C0216D1B4D Anoucel2
12,423,447 *01563992A264F4A87100DDAFC8BC21D60B9D460B Anourer6
12,423,448 *015161485E6753F22264DC06CC0540CC091689C8 Anousheh6
12,423,449 *015B08041592B9364EC9BD59CE919212B2B56F82 anoushka dikkeboom
12,423,450 *0156ED7CE58258FD27FBCDBBBE2833F4D6696D28 an outdoor planetarium and...
12,423,451 *015F173A68633C3C4994CF9EBB7C404314801F0D anovelarte123
12,423,452 *0156B0E7246C0DC837B87A00C5C39A0CAC6FD4A5 ANOVfem4
12,423,453 *0151DE44CEC3C2E37631BFB9A4D400CA8CFB3E9E An$p0r3r
12,423,454 *01512FF7B661769843B4DB229F3626A862FAFFA9 Anp1p
12,423,455 *0155BD41BC31DF06F767C35C95F452884A0E1F28 AnP=2
12,423,456 *015E31BC795E1BE781CA7BBB9997BB4EF9AC440C ANP%A
12,423,457 *015EE97A91A9203AEDF811365A6876DCC976816B AnPbR
12,423,458 *01503D114DC74B728000DB4D15D603CABFFA7964 Anp"D
12,423,459 *01539E3E2C6924E08715B2A82A3FF1385FBFB049 AnPDK
12,423,460 *0159949EBB5A98C226405E5926F4EB71FAF78CDF AnpEl
12,423,461 *0156BCEE7E2D93779C5E4E835D4B8E1D5FE2DD99 A)npK
12,423,462 *015D10ADBB3AC3C1960D7A0B4D8FE487C16B7756 Anpoikia2
12,423,463 *0159A32A69CCB6239E0EB4251B7283CA0072A43C AN+PP
12,423,464 *0155AFCF8E6AFC8C3B25DC98183528330898EFB5 [email protected]
12,423,465 *0154BC79A8BCEF59ED5583FD81296BF1B884B66A ANPw7
12,423,466 *0153F978BC6F7A9E5E839234620DB7995392F1CF AnP:X
12,423,467 *0154420E1CE80931EE707FD9361D1719653A323B A-NQ-
12,423,468 *0153A71DADF052E6CB22A458296AF966E07A4FBD A$&NQ
12,423,469 *015B1DA7F14AE9724502998E653C2689950516E5 AnQ$/
12,423,470 *015A5B25195BA020A398668D01A97A17D43B1EDC A=nq
12,423,471 *015FC216D50EF69C8DAED406B093B91FCE9D9EA8 An-q4
12,423,472 *015AE1A847BA720FEBEF3D2E62CDDBE5892D1C09 ANqa+
12,423,473 *0150AA2141D1902C1D0EEEAD28B0B3D94363798B AnQaD
12,423,474 *0158477845128A345C086B58E55DCF8E012E2C27 Anq_d
12,423,475 *015B2F34A0529EDF82FAA0AD65A9B7189F70CA81 ấn quán
12,423,476 *0159AB33B6DD64A506EEFA91C2CEAF706AD9EC18 [email protected]
12,423,477 *015DD5E4D15430DEEF9B654E1908F8AA92811F4D A-nR=
12,423,478 *0157BE7FCBDFB8D84B156FE50D4AF83B8E7EB72B An(
12,423,479 *0155D0E070F16F5BCC1EE7DF49386025B1BC49E5 AN#r4
12,423,480 *015ACB23A0014100DD7221847D1839A5443213AA A
12,423,481 *015AB99C344806B63E188478A5DEECDBEB49B156 A=NR7
12,423,482 *01501B29856EB8F9BEC7AC4D3FE64A302716AE68 A
12,423,483 *0152CE28306E3879A8E39C4B533BCB3B9C464C5C An"Rb
12,423,484 *01508DBFAF48E7388CE6D2319DE0E717DE080726 anrceti1
12,423,485 *01510C7D49AACD3327FC4DA1870836D67DA10401 ANr.H
12,423,486 *01562D28D598B46CDEDC3D08DECF7BCA840846A0 ANRHRENDEM
12,423,487 *01542A061D26B23752107F6F95C9639DFC58F16C anri1106
12,423,488 *015FF5097F0143FCD6FAE062DEFB5916F6350CDB Anriefen
12,423,489 *015CFB0084D353A4D26F7F979D80A1C0624DF40C anriquez2
12,423,490 *0151E6C75E9AFF3A3BB6AB64B5A0877994BDF229 Anritsu2
12,423,491 *015BA0D85C1FAD87C91C6410DB2E957355565E8F ANRlW
12,423,492 *0153829E5E2D8E2732F7DC1292DCDA70FE57B7DF AN#Rn
12,423,493 *0154B5E222088A3EF273F2DACE36AADE1079C26B anromorc8
12,423,494 *015A5294A7239B1E57E0496515EEFDF63521AC7F [email protected]
12,423,495 *01589F0D790FCEEEC88F48DE2475134CB42D5E1B ANr)p
12,423,496 *015F60CF567B08A2C7C51B0D33829529983446D2 Anrrems
12,423,497 *015133C1880A26CD8C42D6F1B24B8AF0BCC2E725 A_NRU
12,423,498 *01582A1F9A60DC2C684F902E7D9995964F701D4F An;rZ
12,423,499 *01559D88389AB89CF3446E87EA39B8A27D405E20 A_Ns)
12,423,500 *015A6F5F2EE28EB7C3A0C44B75309A47C9B609E7 A+(Ns
12,423,501 *015EB3081B2C7CDF99A5F09D113F68D78A3CA1DE A#ns,
12,423,502 *0158B6BF29C088079D0F09B3057E1E01605C094F A%ns.
12,423,503 *0153D61F08D036FA2633BA7C1F85D5E67006A047 AnS2_
12,423,504 *0154151782CB74FB8EA04087ABAD66D14B6D3C26 ANs6d
12,423,505 *0158369CDD1F8D1336A8EE400901BD55FDA910AA Ansagern9
12,423,506 *015E60E5FC557EBBD94394C332CF15804BA5692F Ansatzstcke
12,423,507 *01573BEC1763F9B901614A72CCC61525CB439E2A AN.Sb
12,423,508 *015FC71F4107FB638176F0119747F8394C99EF61 Anschlagsversuch
12,423,509 *0151569B2775A5997303B63F4B0CA0B4FBE12F72 Anschlos1
12,423,510 *015246C04E0B7D46E6BDA542B21BFF7FD06261D9 ANSCHREIBENENS
12,423,511 *015CAB5570D435D0071A07093B0E4CCBCCD0CC0C [email protected]
12,423,512 *01559036917EEBDA623B7A4BE886B2B2F03C27A1 anselm.edu
12,423,513 *0158C60D2F0FD2972006FE274A5FE221578F4899 ANSEP
12,423,514 *0154D8D08D47A62CA13E86E7C5676DCBC24EC1C3 Anserdennen
12,423,515 *0157DF341F5B59AAC2C6C03961CC71FF1865186A „anseriformes”
12,423,516 *015ECAD1887C3EB132B5623D40E8C923804BED3F ANSf9
12,423,517 *01534D700E3F2C7FE716BD79E94C1B363E248D31 [email protected]
12,423,518 *015DC75FF0F8AC23A2EC0A1EBC41630333D92BA0 ANSGARIUS3
12,423,519 *015E85C047458D0AB6A9B3B51F4190C041AB179E ANSgt
12,423,520 *015E8A6FABB141ED2B49237FFAFF678DFA02B14B [email protected]
12,423,521 *0151679C9CD9D5DF9D6CFF38E48EDAEE52FA39B0 ansherinapabilan
12,423,522 *015AA97C6F03BD4400A3F43C26314AB276E8067E anshu2006
12,423,523 *01522106C23E747CC9EDD5D713DABB1538E2B01F Anshula6
12,423,524 *0158EB19261B38CCEF0FFCF7AD0A2A13D45ED22B Ansichtk2
12,423,525 *015F9B2C9544E71738A9F529A337DC659DD17862 ansilma9
12,423,526 *0154071535CFEBD30131A0817C5A1926C3805346 ansitzm
12,423,527 *01595A078BB129F6EC7098815FCF5611EBF6F3B4 Anskatta6
12,423,528 *015B606B3F488A18CF8BC82750DE2CBE8805E799 Anslagen6
12,423,529 *015356BD2FDAFECFFDC7110550F0463F0F6FE7D3 Ansmuter2
12,423,530 *015552C002643D510B61B4B5F035C4EA59C1D71B Ansökningsprocessen
12,423,531 *0155389D40D25EEF80056B55F1ECDD3D135D4AFC anson roberts
12,423,532 *015924E6730F102CB3490EB6778F0DF6C32F31E4 anstängig
12,423,533 *01521EEE3FAE529D470B0BB153E92B47643AC54A ANSTEPH
12,423,534 *015B632DE94B05C577F2D969BD4A81D712767090 Ansteuerboard1
12,423,535 *0157C0715BB291321083AF8F00DD3CD54FA49E77 Anstiftu4
12,423,536 *0155CC882C9B6DCD576B581C3DE06754575F9750 Ansvarlighetsloven
12,423,537 *015A085925824C1D6DC1C223C6A7EC31EADA0F64 answeredwil
12,423,538 *015CB9D02FFC5099F69BF14882688A2B85AA4674 answeringmachinemessage
12,423,539 *015F52E187F88310D1B4AC81B81BF1837ADCF15E AN(-T
12,423,540 *01559515CD86058D722C5474ACEC0A0135CE81AA ant1cou5
12,423,541 *015D6EFEAB50992F310D20A11D8320CA0B1954CA ant1warl1k3
12,423,542 *015A49ACCE1DE177D3F3DFCCC29EC1AAF761F61D [email protected]
12,423,543 *015333347987FEA055C19FD56F4B4E2F99D4CE11 ANt.5
12,423,544 *015B1235C52EDE883EE64B55DB898AACE4292657 aNt6a5xFOnE
12,423,545 *0151F23BAB6FAD3F94675AC68468529561A6AE95 anta1ge$i
12,423,546 *0150FB71D1488B8DFB9342B81DB59B04D50AD750 Antakari9
12,423,547 *015FC5CF0E41A10DF25200F64025A5D0BCFD8011 Antamien4
12,423,548 *015E269E3C2CAC93BF24758E5EC1FE49F4A3C484 Antapodo9
12,423,549 *0151DF887EC307BFAD661E54B8894EB044129360 Antapoplectic1
12,423,550 *0156AD12AE305F9BBD79E8B95D917AEA74B7C54D Antaralases
12,423,551 *01513407DB619DA14561931E2C64672FF4C4CD2F antarctica.5
12,423,552 *0156279ABEB4F2BB17605B39BDD91AD2D955E3C8 $an!tat!on
12,423,553 *015F6A1EEA162FD81C6B71F2D329184CD69F27F4 ANTBAB4
12,423,554 *01594DA2646064511F0899038B32766AEE2D132A antbuster
12,423,555 *015D3999C28E22FE6A46608F8D7025BE8568E92C Ant!c0mmun!$t
12,423,556 *0155BA7806DF1F78B4C7E1B054D5C38A79D224D5 ANT!CANCER
12,423,557 *01596A4DE304EA3A50AEB323C24939FF2FB6C583 Antchin yag
12,423,558 *0155BF2750798B6D0947F8CF2853DFC40CAF07C8 ANTE518WRIT417
12,423,559 *01532BC655E08A5B582149385B83F8D1E6599506 anteacts
12,423,560 *0157814971D9F64F0B982F6EF856E0535CDC22BD [email protected]
12,423,561 *015972FB3AC980F4FE2E6FC94FDDEFBB61AF50F9 antedarolhos1
12,423,562 *015A2CA8ED3CEDCCA2FCA25CDC0CBEF9C7D11A27 ANTEDATEERT3
12,423,563 *0153239214B4CC51D78D0314980A629E3CCA6AEC Antefen2
12,423,564 *015DB7C2D252106C4F10A7075792F5B208B524F2 anteil22
12,423,565 *015FDDD8382CCFC1F50C001D38A51D1CDFEA6355 Anteilma3
12,423,566 *015AAFBCA766077605098232C409A8A1830B35D0 antelacion
12,423,567 *015C28D51081A30C9D795BA427082DB74D5A118E AN-TE-LO
12,423,568 *015AF4D70CFC0F40EC10CDA061A06A94594FCD9E antemari6
12,423,569 *0154A8D5C6579C1A28E89FD3162496CDEF6ED7DE antemovestes1
12,423,570 *0159A20397D764066FF97BFDC2AAB8DC67472138 antennasdirect
12,423,571 *0151A232C2BA8E47015D792BCA08E245466E7F10 Anterioroare
12,423,572 *0157645BB67C7920312EA483CE375FCBEAABCD42 ANTEROSUPERIOR0
12,423,573 *015188B5BC18406207A5F2B82E1DB7E1FFBE2BBA ANTES1994
12,423,574 *015DC08A1972A8C90B4FB84BF53E213850C0F39F antevejame
12,423,575 *0155255711B5B4DAA6B9B6893ACC31A86144CEB0 antevireste1234
12,423,576 *015AEDBD13793845CD495029B9AE458AED8EFADB Antexame2
12,423,577 *0155BB26DB6F9336A7F2D7C46D1EC1D0AD8CEBD9 A=NTf
12,423,578 *015C920A94808197C0B93F61F2BFC729A27FDB40 antf45.adventistscho
12,423,579 *0158F35E962EB1965EED933CF3E74FD97F7322C5 ant-Grossetortue
12,423,580 *015BD31A846FBBBB946C4B9E47E77C23F28BC270 Anthē
12,423,581 *015F61EE06CB6F8E90C75E7FC57FE329AD134D57 [email protected]
12,423,582 *0158005DAB9CA7FDD5182C81E16AEA42AD9AA384 [email protected]
12,423,583 *0154B39ADED0C53604CCD39BEF39171B73137F57 Antheriferous0
12,423,584 *01530B3C0008170DE20BC5B6429AFAFF61B26EDD [email protected]
12,423,585 *015AAC686CA31CDEB3C6C836C45D40855C822627 [email protected]
12,423,586 *015149B5207960ECC83B36E920923EB5EF999907 Antholyza0
12,423,587 *015DC02732B5E976E93AF393E4C521FE133A8A87 [email protected]
12,423,588 *01549314A90BE09BD6C013265E5FC50A5B46F496 anthonisu
12,423,589 *015DB5F6C059FD48544C1AC038B79561AC666C88 ANTHONY2180
12,423,590 *015E593D6DAE9AD7028C729EBCE1BDCF0452466A anthonyakin
12,423,591 *015093540DD6038EBAE7C626150B39F55874CEB6 anthonybarbarino
12,423,592 *015DCD67370E8900E5E3118A6CE92E4BCC867104 anthonybeverly
12,423,593 *015194009EF07693F9B195E40E17BDC76C252BB6 anthony.bolten
12,423,594 *01565833E6A89B7D40762E587E66B2598BF1C666 anthony.bourek
12,423,595 *01522E41C518BF049A3982098001731F8A679B33 AnthonyCalhoun
12,423,596 *015689EB07D91C5F41BBBA2C87F3A9BEB3DCC330 anthony.challen
12,423,597 *0159D79701DDA0712A239F535B59649511EE05CD anthonycialini
12,423,598 *0152239A8550AB683F3FB9A7B3903212BAD02BD6 anthony.clukey
12,423,599 *0153F309138552E138DC29667962306293F4420A anthony.cohen
12,423,600 *015AFEFBFAA7A708EF87D46E539F80028F0EBC0C anthonycuglietta
12,423,601 *01529125C2BEBD69A09D800C355E4A4DCC62DD7E anthony di stefano
12,423,602 *0157B71F51E0A07DEAA882943609B2F7DB6CA3D8 anthonyelijah
12,423,603 *01512742984400D3A208E36B4FA61EE06BFB612F anthony.fait
12,423,604 *015FFAF2FEC13EAFA439647180DA4155B34F074D anthony"fred"white
12,423,605 *015494398838CDD15C6523409C069C45480AD57D anthony.froehle
12,423,606 *015C0C2B20EF4F6241844B165CB643EA5B047866 anthonygaskell
12,423,607 *01586BAFEE0B021C0F13A8420AC9E014208A1DE5 anthony.hamberry
12,423,608 *015D1BF89F6EEC20067EB92758995C4400F8C9BF anthony.katzer
12,423,609 *015CF49C051D426070254FF9A2402BC3F4814E8B anthony.leiper
12,423,610 *015F97E75742CF750DBCA18EC320DC87E53BE730 ANTHONYMARLBORO
12,423,611 *015EEC0FAE259557390277FF022073068A856B60 anthonymaulorico
12,423,612 *015876BC265911A7041D31BB8B47A4AF7A48C20A anthonymichell
12,423,613 *0157ED467C0644E585A117348A985AC3D06748FE anthony.mood
12,423,614 *0159C8F06E3E29E3DC0796B0B9D7E93AEBFCD7AE anthony.naumes
12,423,615 *0159199DD47E24B8A235AB14B45524F4AE98ECC5 anthony ngige
12,423,616 *015476C1F22B5DC9CA05B454FA1A3DA507D30E3C anthonyolvera
12,423,617 *015A7E27373A8269C63D8A8D2C45B5D5ED10AEA3 anthony pacifico
12,423,618 *015EFAFC3E39255295F26076ABE4C9BBD7C2479F anthony piercy
12,423,619 *015100CD39F3334AC7F2CD945A6415D2D456F2F2 anthony.postemski
12,423,620 *01576BB8125598E1A0DBE365F61C1A21112184A3 anthony quintana
12,423,621 *015B6B66E6AEBFB3F311BC5737AA5376C52B03DD anthony racioppi
12,423,622 *01572C3C0D367A571BE3919010099BB0CC9FC6EA anthonyrentz
12,423,623 *015892492F2E5FABE65B0AE42423C86EB20CB991 anthony.sachtleben
12,423,624 *015B18FAB74431418888F21D27A0DC427626D672 anthony.sgammato
12,423,625 *01573022262694D5E0C87EB9B6AA55E51524F5F6 anthonysorenson
12,423,626 *01555004EBF189C4F9CC23A23F9FB7CC0D7B85D0 anthony.stormo
12,423,627 *0158DE2B60B6D0B522484578B86A1E86EB94254A anthony.street
12,423,628 *015D050294350F448F9FDDAAAD65586E18A13A6D anthony.swinson
12,423,629 *015BBF7B8D46A45BB692FE95AC94FC46A37B0CDD anthony trinh
12,423,630 *015254985C53A8FE0209B2AC783DF6476218CA1F anthony.wilkos
12,423,631 *01578B85EF5F7B34B8BE1A918E7DAC7C294E801C anthony.yoder
12,423,632 *01557BE5EA427FACB2386E20D0665EDA83A4EF10 [email protected]
12,423,633 *015BDC50F4C1B0D8157D9528BB4AC300622D44A4 Anthropopsychism7
12,423,634 *0159D17D66CCC7F83D128B3A68E8861E6CDBF6DD anthroporadiamétrie
12,423,635 *0153F6F51864BF691039E52180DB91E9719162F3 anti_163
12,423,636 *01506318140AE18FAE0969AE484227E6BC27A144 Anti-$1ov
12,423,637 *015E16A2C4CADF687C9B02EEE9500795694BA15A ANTI3NVIRONM3NTALISTS
12,423,638 *0158BBD63A4EB02ECC3F1D438ED3D1F1B60DA288 anti3pi$copal
12,423,639 *0150B7DB40C128E7B94E6A6B2CDF6C673F19987A antiaerien0
12,423,640 *015E97A646FDFA97E6D5F54325D91158FDA79374 antibizkaino
12,423,641 *0154AAE06747DC4BF8F490CAC48D20EA24353FCB antibolsjevikske
12,423,642 *015D9BA6C1AB2061CF51A2611C777C7D5929F08F [email protected]
12,423,643 *015333D0DC06FF91C177EFEE9F4C04D4DD4BD7B3 anticanced
12,423,644 *0157A8B5AFB9F765173412DA644C37AA2C016EF3 Antichlorotic2
12,423,645 *01587F4BD6889660EFF61373898D61E2FE63CC49 ANTICIPERING
12,423,646 *015094B87382E8FAAFC1A48BEB9200A47620EEFD ANTICLERICAUXES
12,423,647 *0151A1B97F0ABF084F9CFC3574FA9C71BD13D3B8 Anticonfederationisted
12,423,648 *015432F17BE9E79815CA48306594A543EC14341D anticops
12,423,649 *01510B1F9381524E42C8A35BF0577773D5F3FF09 ANTICOSTI!
12,423,650 *0158EF1FFC91FFDE41B6E52FC59F1AD3F055D683 [email protected]
12,423,651 *015537370D8DA5593ECA7C5475562084F564F1ED Anticris3
12,423,652 *0155533A9536A6F8C705EC8F16197B72443481BC antidhmarxo
12,423,653 *01572556852A708247BFAA029BCA0034F7B2DD17 anti
12,423,654 *015D05EDF494F9589DC06DFC2BC50DF73A62A02E anti-ecumenism
12,423,655 *015D54B1B148DD44C8012B093F36B3B90EB8A268 anti-emigre
12,423,656 *01572B0BF509F353F858B60863E54393ECF6BC25 antieuropeias
12,423,657 *0158529BA6BED49F8F61C070CF4708E415647F0A Antiferes6
12,423,658 *015429F06AB1DCBCDDA00CCA385495B497B91C4D ANTI-FOOBALL
12,423,659 *0158B9A75CE98DE9A620143E8A7CA9D4B8D83615 Antifrastica
12,423,660 *015379D507C340A25A68308CD7D456E7A1F30810 ANTIG3N3
12,423,661 *01578D05212B5251EE98C488BD8A7B99FB247867 anti-gazumping
12,423,662 *015DBE39C132CE4DB0A73CA863444A4EB2E09503 antigenesanticorps
12,423,663 *0155EF9011271CF1795BAF6C9375F2E48956CF1D Antigrindină
12,423,664 *015E7F0AAE930A85148559AC31EFAF7D8276C7B2 anti-haven
12,423,665 *01519AB61E9DF812362D6EC0E762258A79924318 antihumanity2
12,423,666 *01516FC1FD8196F913C19A526AB2DF851AE8DE50 Antikinėje
12,423,667 *015BB8EE2AE977D880419AF35FB407B5FA196BD4 Antikriegsbildern
12,423,668 *015D7063F1CDAB67BB1FB3B073A7389C33878A06 anti-kugutsumen
12,423,669 *015A27F295C967951C16925AD71C379761A33D3E antilapsarian?
12,423,670 *015A4EF44E1EA188A93DA3B63C7A690C4D925EC0 [email protected]
12,423,671 *01518CA6EBE10209EAC3B910FBFBADA0848759BB antilysin7
12,423,672 *0152C74EEDFDFE2F6BF074751B3500ADBFBA8176 antimaterialist6
12,423,673 *015EFB664067BBFB172E2CCBB3511A1B47C2EAEC antimensium2
12,423,674 *0154A6029255B55D2BA3403697A724C23D667147 antimicrobica123
12,423,675 *0154DE507F3919275687BA8920B70DC769A84F69 antiminsias
12,423,676 *015E68C5221DA3DDB1DABD10449A16CA1955BE8C Antinarcotic6
12,423,677 *01525F7F937AE2C3D9287D36E2430B0B14C5F0DA antiobscurantismul
12,423,678 *0155582C6E8902D04FAB87352108496264A0A9AF [email protected]
12,423,679 *01502C8F3852E58F9171FBB287499AF257A987A1 antioch_tennessee
12,423,680 *015B635A44FBE1EFD798B039B952D2AE20ED5B8D antione.alexanian
12,423,681 *015471E250AD4A254270F57530BA5809375D1DB2 antione.blonsky
12,423,682 *0155CA71A5FD458C1018F7F1339B8AA2D63912C2 antione.boothman
12,423,683 *015F601CB1619899EBAC4E981F5B1FD4E5AC7E3C antione.boothroyd
12,423,684 *0158CF1AB7D972DCCC6B1457A225AD1FF2A16E8F antione.congrove
12,423,685 *015523E8EED15E904298DCC548C19B199207B253 antione.connoly
12,423,686 *0152FEBC6693CEAA69D3C3B11C77AA8AD7800492 antione.dederick
12,423,687 *0152BF785C00FB94F300DC052CB346170546A274 antione.graham
12,423,688 *015067E63C1F80E87FF28B0C0BC19A07341F1063 antione.hinesley
12,423,689 *0151061B0497342ABBA272BCC2CEB169845D227F antione.jeffers
12,423,690 *01503B41EAB965171D89B4C14AF1D6749EC3ACAE antione.lindinha
12,423,691 *015393E884EE2C717A6A91D67C7D27C8E62FF83A antione.lombera
12,423,692 *015CA382056C3F7C66880C7F857F87702F034507 antione.mally
12,423,693 *0158685C72D9B5FC333E3A343769376F337CB2E4 antione.rufino
12,423,694 *0158E314FD5B39B71F48070EBF07DADC41814AB6 antione.shifferd
12,423,695 *015EDD5C19541D70C31CDE172085C89A77723419 antione.soo
12,423,696 *01540F3F07C16AA2D7A1E4A93CA8304B49F30F25 antione.susich
12,423,697 *0150BAB37F8C67B2BC808439B094D489515732F5 antione.uzun
12,423,698 *01521C209E2543EF0AC05261FF7C85F6DC7F5064 antione.weinrib
12,423,699 *015B1C288884B1F1A1E323A133AC17E7BC414D9A antione.wilby
12,423,700 *0155E3046060BDE3C0BA1D743822069FA27882D1 antioquia-cuandernos
12,423,701 *0151B890A955DDCE95A81CCBCA2A68D03383BEAE Antiorthodox8
12,423,702 *0153B3B059CE419E3898A5C6CE7028AC743EA878 antioxi
12,423,703 *015AA2DAE153D2F8A5870AD8F8313AC4ADD588D8 ANTIOXYGENATION3
12,423,704 *015DBF8938EF0ED51AB365DC982833419D04A047 antipasmodicas
12,423,705 *0155ACBD7F8C6CF9EEEDFD26D04CE0704DA560D8 ANTIPATHETICAL!
12,423,706 *0159C218E8B65341FEA08889FC67BED1E9E63855 anti-pedofile
12,423,707 *015263D25985458A3DAE42CBA1458BD9B4AC47CD ANTIPERIODIC
12,423,708 *01571EC15E383A0F911C3ED3FF1CE6B303262A1A Antiperistaltica
12,423,709 *01572AC45371DFEB8DED7350A51FC042BF8B2CB4 Antipestilential1
12,423,710 *0151801B4AE79549612602893638811E9642308A antiproj2
12,423,711 *015D89A72CCE66B0F19E8B53B90FEEAEBAF5A75C antipsoriático
12,423,712 *01569DFC0DB22A75BE2470024E7CC500979BE4E3 antiquar0
12,423,713 *0156D388B277E80329CBD6C4573D6D752791F5B7 antiquarlha1234
12,423,714 *01534581208504E584649840A3B8ED3FD37F45B5 antiquaumschrift
12,423,715 *015880D3D9F83892697F82663652379785CAEA55 antiqueblack
12,423,716 *015180DC2D4DB9188B7359F6C2418A65A87F6369 antiranger1
12,423,717 *015C87662E72551D940DE9DBFCDD22995CD293B0 Antiraning
12,423,718 *0150D2701852404780001F1E18E2659ED5CEDEE0 ANTIRENNIN1
12,423,719 *015CCD6427090667F025100DDA2F8CC0712517F7 anti-semites.21
12,423,720 *0151A2B3424589E35200E44D21C4DB1FB392EEBF ANTI-SEMITIC-SO
12,423,721 *015BB6D3B33E65E4A26468F221F2E5A2B577EAAC Antisensuously!
12,423,722 *015A4116697129B2A018F93BFDEC05AB18BDB2C3 anti-skeptical
12,423,723 *015BFFEF1F0B7BAE84D7E5FB70266831811D85D9 ANTI-SONIC'S
12,423,724 *015EEA23258E3F0B3246F27896950C795BEB10E6 Antisoporific7
12,423,725 *01583EA3CDFAE6DA024B676EC53416E4FA1BE8B8 Antisple3
12,423,726 *015045FE87DF76CE6B781F0C45695FE7002790C2 antissociais
12,423,727 *015D13705C7952ACFBD6CF4BC6AD6A689D441ED8 antistalling123
12,423,728 *01500586F3E101D1316F76DD82EB226B61253F17 ANTI-STAR
12,423,729 *015D058E925DBE82F500950A0E20B4895ED21392 antitassomenoj
12,423,730 *015F411D39A9962DB9826AC99C24AE50114B68EF Antiteut2
12,423,731 *0154CF1727E998B6D02FD812290769DE129D04C7 antithef8
12,423,732 *0152B12C7465D1D74BD395B48DEEC83C4E34DB36 antitistum
12,423,733 *0151013FF30B50EEF7B48B4219A4E6389752C3B3 anti-tithing
12,423,734 *015465EA192BD3EF30B6B4F2AB98A23C4B471DC1 antitumoral0
12,423,735 *0153A8785A6D0587E443C01701C0A82A54EA9137 antivermicular9
12,423,736 *0155AE95D15C0D44C000A940FDC9AEDC9983F78B ANTIVITALIST.
12,423,737 *015B2C17CBA5B2172A864A5C3C63A9E891038691 anti-ward
12,423,738 *0157163D29F3D7BB300D533059436903BE409653 Antizipis
12,423,739 *015728001C8516339EBB32E23E9FF150D5445BD2 AntkW
12,423,740 *015CF29DC1872D70AF33504442D2E66473D02BCB Antlike!
12,423,741 *0155458E9F53EC9401D3A2F9AA1D37E198B234C1 ANTODES
12,423,742 *0151FB52F54FC098E2ED273C105A4BB62477413F antodita
12,423,743 *0158E79D9A6164F8EF3EB03720CAC2042070FF7F antoigny
12,423,744 *015BDC2147E647350EEDAE1A2413967BF1F373AD Antoine700
12,423,745 *015A23FE8499BD034AC02EDFAD6A9147D04251D6 antoine.allvin
12,423,746 *0151853ECCAAEA68B1EB9C1CBA4F631635B379BD antoine.bevil
12,423,747 *01565A6E359EDE9C9CEB3E5672E4E3B549423CCF antoine.bormes
12,423,748 *015A81ABC18265E8F72EB78363B40959622D66F3 antoine.bumford
12,423,749 *0157F826D786F2AEC9FBEE3590135AD5DA355964 antoine.buttel
12,423,750 *01563809E2E4D416DABD160DAECBA0B20C4EC389 antoine.cerney
12,423,751 *015EE78C1D913DDF4846DA0F2F721C97B929DF0F antoine.chaulklin
12,423,752 *015844E59ED58794B6B0EADDDA16C48F4BEE0D4A antoine.cohron
12,423,753 *015CCC656F16415BF3EF2D70A397658ACC3EF792 antoine.dajer
12,423,754 *01583900B7BB04787F9279200261B5DCB7728004 antoine.dazi
12,423,755 *015483163350312109C1C6450234B82B3359A87D antoine.dorrough
12,423,756 *015413171A49ADA4E04D97857CB7861F6B07F72D antoine.dunkinson
12,423,757 *0156861507CEEA428D08661590E87135999903CA antoine.evertt
12,423,758 *015B2FBCB9741C4A7935066FB8946CCB86ABA0CB antoine.gius
12,423,759 *015A7A59DB4DAF51A74AC81CE9015D40454E8AD1 antoine.gounder
12,423,760 *01593B1FBDB856BB13F3814638840C1BF02C7DBB antoine.herby
12,423,761 *015BF6D727BEEB4E3C333E06D6162E870B8A98A8 antoine.hernanez
12,423,762 *015768D53DB32F51FB69DDF15E543CD8624CDADB antoine.jeswald
12,423,763 *0159F35CB4BC39D17C0D4BFA778A6B0B6245862D antoine.johansson
12,423,764 *015B66BE4499E95ADD0F98A1119E43B0DC504CD8 antoine.justian
12,423,765 *01577A86289786159E85AEC7B5680CD74C35C3DF antoine.korte
12,423,766 *0158F3F1B2084D17AC96A1220FD2EE113BA274DD antoine.lanuza
12,423,767 *015D8B93322FEC0252AC787FE7C9486EC44376CA antoine.linenberger
12,423,768 *01501836C51234ED3285CCCCEFF26B4056D19360 antoine.mccline
12,423,769 *015F35F1E88EF4DE6A7CF684748DEA17C56DE461 antoine.novencido
12,423,770 *015C16C8B027ADB4019BB5FF8AC989EA53833159 antoine.tevis
12,423,771 *015EACB0EEE53802F80563541ED47CC1857D2DC6 AntOINETTE
12,423,772 *015631043199DB2564C7AEBA5286050CEE1BBCA8 antoinette sheehan
12,423,773 *015F34443CE8ED20497610F62D9B49A532EC486F antoineullmann
12,423,774 *01502D59CCD2E35680813543E083414CEE8A0C54 antoine.workowski
12,423,775 *015347216343F2FD9447F499AFEB25B8D42D7C88 Antoliing
12,423,776 *015E4564F22A27ABDA7CC7890655E89B6F8388F4 [email protected]
12,423,777 *015C26E5D10B3279282386FF8E1F1BF0EE63433A anton.arizaga
12,423,778 *01524CCB76192BCDF04C411AD573656B06D25D5F anton.auldridge
12,423,779 *0154EA56783E075E95638A30298BA4B88C600CC4 anton.baas
12,423,780 *0157A04BD593EBCAA3E024BF5BBF78B389F8F6B8 anton.coldsmith
12,423,781 *0158D61D519AF3B06390EF215514F8BD1334E297 anton.degidio
12,423,782 *015A8B67ADFCB9368CA1A8C1555DEAA88573F65E antone.alfera
12,423,783 *0158AAE18A6DC994C5B6D3DAB7502C40026A0EA0 antone.arismendez
12,423,784 *015AC2F6620473669AB0D8873F2D7D3EE527E5DC antone.bairam
12,423,785 *015C67CC4FCEDDDD11B505F335F1E48909E56DD4 antone.behrman
12,423,786 *0150AFA59A91ED846CB5E2581C65BAFF3C003ABD antone.belangia
12,423,787 *0155B1656B5C67F70127B9F40568E104291A7FD0 antone.beuchler
12,423,788 *015E52D4F9819AC3C5C2C15E60B44D77242943E4 antone.bustin
12,423,789 *015F3F396198A0271939E083F1923F93A85EC4A6 antone.capello
12,423,790 *015884F46E3EF5B44CE112EFDAA1E3C7DAF80039 antone.cegla
12,423,791 *015FE6C164F8EC4693FEC923CCDA1529445F658E antone.clavin
12,423,792 *0153853EDFFBACE7A68E3CB96D5B92A5A26F4E1F antone.conwright
12,423,793 *015F9EF491F41CC66111F1406541079BF8E676F7 antone.costner
12,423,794 *015B42ACE038FBCBEEE11D988169D6749CD979CC antone.gowey
12,423,795 *015C2F6A4A55D9A37DFAD4F3D5666E4C61D71397 antone.hartert
12,423,796 *015E1FE7B093504A2D09B8D7B3D841BD15C4D525 antone.lallave
12,423,797 *015C85DCA9E9EEE44A5D6800871F866055413EA2 antone.linsky
12,423,798 *015665D47993220141A0AC5072731BDBA884EA5F antonella.maiuri
12,423,799 *015F97845769A2F468111994B96ADC642EDFD2F0 [email protected]
12,423,800 *015A5AA82C6778279E0327D9F49878F7F2684E2A antone.miyashita
12,423,801 *015F898EBC6CB792D0567F3A7E8BCB733E9829FC antone.podesta
12,423,802 *01589792FED36EFD58CCB148ED8547EA51DC194D antone.quiles
12,423,803 *015D64D4FCDF511FC073518DBB5E4032BC25F5A7 antone.savo
12,423,804 *015FD569261C9DB0DD787AA1BB53E8FE4A0492C7 anton.escudero
12,423,805 *0153A0C5F8BDE9DC665472219E079841C3D88FB7 antone.sobenes
12,423,806 *0150CBA61B7B735C84588CD47894692397022575 antone.sonnenberg
12,423,807 *01520D1664834899D1FA5D78D4E5702E0C1B3D34 antone.timothy
12,423,808 *015CBEFD710E7DDD62731D01553498008B49AD1A AnTOnETtA
12,423,809 *0155C76D97315B8CC8AA923213689122DD514A77 antone.tyska
12,423,810 *0155A5ABF49566017C85DCB1C256DA62A45CFB37 antone.weigart
12,423,811 *015FBCE47B986622C3A3FBF6AA01976E41C62FF4 antone.yauger
12,423,812 *01520D755B172A4A0B44AA3432E5F0387A48E753 anton.frump
12,423,813 *015FCB8487BFE89282CE7CB0ABB1526F4791D2FC anton.gerardi
12,423,814 *015ECA34EE519A35EAF922DE03813B2A262A695E anton.hanrahan
12,423,815 *0155BAA6046431D7C877E396394B2F21BA08E03B anton.hellickson
12,423,816 *01571976FC9B139A1FC7B3EA2D44B2A7166FF7FD anton.holznecht
12,423,817 *0152686708EA868257C9EE9FC9879665AB0A19C3 anton.hospelhorn
12,423,818 *0154C74BC4D68B75CCEBC184FCFF32F3106A92AF antonia.birky
12,423,819 *015CD7F0FA9FB2F36DA77689191362D208D55375 antonia.boccanfuso
12,423,820 *015EFD6FD27829AE25B6F9F86EE70C76BCCDE568 antonia.cairns
12,423,821 *0159C8ED0E6D0F09131D4EDC3FA2AD5F93429886 antonia.delce
12,423,822 *01508E9AF49966C17E28EE289C436BF776C884CB antonia.filan
12,423,823 *01505BC79AD962F987C29D3B1DA9C64A3B312279 antonia.fought
12,423,824 *01543FB64E0C1E4B7D907A0CBB31F6F246A0176B antonia.hoznour
12,423,825 *015DD697F4219C5B93CEB5517C9D52B5EB1B4A34 antonia.livermon
12,423,826 *0155A6CBB10267D59EE83F069F94206F29A1C3CA antonia.lochan
12,423,827 *01554164DCB777960E0572B7F0299500D5E47BED antonia.northcross
12,423,828 *015E7422736D541653CF4D60E251BE7422061F2C antonia.rodal
12,423,829 *0158A47913EB6C6A8C2C74302F71C75A8F9BCE0C antonia.scattergood
12,423,830 *015E6B8675CB4F6729605DCD949F1E79DBCD8BD4 antonia.scotting
12,423,831 *015AEF69D8E6DA835BD3DA78D09A990B230233FA antonia.versace
12,423,832 *015CD38C897D1F62EAAC933821E1EF490F0C869A antonia.veteto
12,423,833 *015BB7D93B95CD7249ABAF243359EE6D72B0751B antoniette leah abellana
12,423,834 *0156DE752DAF7F0181369FD69DC9DE5873288757 antonio.agustin
12,423,835 *015F61ECD3F91471C9B05B9DF62D72D938A9E5B4 antonio.bickerstaff
12,423,836 *0154FCE3C176FC364AA55EA36D2E9422B74A00E0 antonio.bustard
12,423,837 *015E07F641ED2B1204E68BF1D07E6D29F8D0917B antonio.cocozza
12,423,838 *0155E401F42906152F892EE55A390D4A20202673 antonio.conliffe
12,423,839 *0150F579A61374B0A913D3F82E5DE130A57EF109 antonio.covello
12,423,840 *0153CB765135094A6359F5DB338C24E4C550D41D antonio.ehrman
12,423,841 *01502F9EF33DC6940F0F1AFB8CB03CD71999D3C0 antonio.espalin
12,423,842 *015B9A709BD1821AAFECAB7CF091886D15C8A759 antonio.fells
12,423,843 *015F82FE629808A777B9974F604EA7575D239EF3 antonio.floch
12,423,844 *015D40C010F1A42CC229A48CAAAAA0D96D8C6ECE antonio.griffitts
12,423,845 *015C817D4FDFD59B73C49A9B60089821ED576E54 antonio.kalawe
12,423,846 *015418D11C0583E57DA3F67FC73C132E81484C9D antonio.kind
12,423,847 *0156E783E15B717BDF03AB6E09BB704D4A16327F Antonio León
12,423,848 *01548964571CCB3D978E99B64AA7E893AEA41C74 antonio luevano
12,423,849 *015FBC8BF484D93CA2F8011E975413B17EC4DB21 antonio.mackell
12,423,850 *0151680C6A2D3BF1F22E72FE1F8A2553378EAE36 antonio majano
12,423,851 *015CDF5423AB71882FF7BFF169E96F04897D483A antonio.martain
12,423,852 *01565C00E26F9EE50C9239F789A06F0B17B89C1A antonio.mensch
12,423,853 *0151E1F59E9970263B884968400C03FAD049D74B antonio.mottillo
12,423,854 *015817BDD81F0371BC80A5E4E8DA16B12C173E30 antonio.nockai
12,423,855 *0153A0817FF6E53E51C1D51CCE9E07D59A2ACEB4 antonio.ogara
12,423,856 *0154437AD9761F2FEB60C8A84DBE534D0AB4E82E antonio.quicksey
12,423,857 *01504BD991BEF269979B7D75335BBE575EC2D0BC AntonioRicardoDeCampos
12,423,858 *01582D55305BAC6C88E99EF214392A11EB9F67AE antonio.westerberg
12,423,859 *0159DD61A9FFDA83A9049AF5CBBBE4E9B8D20401 Antonioz1
12,423,860 *015E16AEC43E494900CAA6B7096AE7E52AD2772E anton.kranze
12,423,861 *015F356526D69DF4E8B16884617E0BB20F5C781E anton.piceno
12,423,862 *015580138908E2A3CE11DBD2C034A99BD900B8AE anton.rath
12,423,863 *0156BCD86EFCD5B537A191955B0EA605A9686DE2 anton.rippin
12,423,864 *01586AF35EF3B41CE1B3D82F8566B033388E28EE anton.shott
12,423,865 *015EB2EA757F203657F0A82D812F55154A73B8AB anton.snape
12,423,866 *015C25EA5234983F480B41FB07B47B5000B4987D anton.soler
12,423,867 *015AB2D690B1CF2BE65642BFF61ACBD3F666BC00 anton.suckow
12,423,868 *0159E814A8ED6C0D6FDB26D875E1C95462EBB17A ANTONUCCIS
12,423,869 *0155DDF9EA616627C9106BB1748E6CB4947720F6 anton.upole
12,423,870 *0154B1DBEC425657D464BBC608DEA00668544F74 anton.vegas
12,423,871 *01571FBE0833D9E6894E6983112EBF395FF8A086 anton.weasel
12,423,872 *0152100BE4DB58B5807F5AAE78DD7E97C8E070BE anton webber
12,423,873 *01582981E2F21D7820F47DAF6062ED37FE4D398B Antony715
12,423,874 *0154B8E804E96D3B9DAD3B77F1533AEA1E1C8EDA antony.agoras
12,423,875 *015169EA48CF48AA4289245CCA3DC18495E75B68 antony.apyuan
12,423,876 *01571AD9EF909EEE2CEE8B5C157D46DB0FBF0444 antony.clearo
12,423,877 *0154269ABDD9FE506EACA091E793C1AD597D5873 antony.engfer
12,423,878 *0154D4310C5A51B3BEAD1D523324670DCCA093DF antony.espericueta
12,423,879 *015D725CEB3E2BD5BCB2663656A119D112588B32 antony.groehler
12,423,880 *015E59992ECB0DD6D7F91112979316839F3C53CD antony.hambrick
12,423,881 *01573721508AB76588AC2E2A8F216FAA9CEEAC15 antony hargreaves
12,423,882 *0151586AA149B2B5C1C69C1ED67B563B0D2E636C antony.hornbarger
12,423,883 *015D7729575A43C1275AB890C5DE8AF480585864 antony.kinan
12,423,884 *0151547EA22D1A91CE04BAB68E94CD971BEDEA90 antony.lamacchia
12,423,885 *0153DE972A3482CD3D07C5E3E99E19E89FCBB39A antony.maxfield
12,423,886 *015C5B5485B914157D38AD0D123CD6F7B7BD35FE antony.meenan
12,423,887 *015A092A2B27FB8A172ECBC883A66F5FC6AB6448 antony.merril
12,423,888 *0154073E33D56A22CF6C010D13511F57AF4082D0 antony.middleton
12,423,889 *015E3735C714FC940925B2D84AD99F00DFDF2BDF antony.mihalek
12,423,890 *015EA7124081D4C695126A3003FC40C812710E54 antony.niemi
12,423,891 *015F3C5693E37282C88C6BE6183F44CB8E5CE277 antony.nolin
12,423,892 *0150FAE2A744EB465151EA0645BC5208974353FF antony.orner
12,423,893 *015CFD32DE2DA8EECCC38377E2F4B4269E027607 antony.paczkowski
12,423,894 *01587F2B84D4B0CF90D503AD1EDFBBA64BA21111 antony.purtell
12,423,895 *015957C6B89A8913035FB0A06601F215DAB944DA antony.scollard
12,423,896 *0156E2361E51A5DA39FA4A9533EFDAD48462F27F antony.stlouise
12,423,897 *0155FF599E53F6CF507D60EDDF03F35841C2091B antony.tartamella
12,423,898 *015D285FE4AC4B8FB6A65304C6609F3DDE02396F antony.timmer
12,423,899 *015C6CAA6C3FA6372432BE25AA69419A1A0E1969 ANTPN
12,423,900 *015D4C5DDC1E3C36B927072598A6952B2C41A416 antpolly
12,423,901 *0153F2DB4448DFE946124CB6439FB9FFE9106637 ANT!R31!G!OU5
12,423,902 *015ACDCFF7E3EF64415C89D4AF92F1DCCAC6F269 Antraeff6
12,423,903 *015EDD0DF392D8DBE9DA1102B801D4C39651CD71 „Anträge“
12,423,904 *015DDA1AB4FC2756C9736121C6724CD16A8961DC antriebe3
12,423,905 *01502938048A8E661A026B9629A2F1F4F72605A4 antrolpologie
12,423,906 *0153D950E18EDA308F516A4ED3A0CA83BECA188B antropovgiovanni
12,423,907 *0157484FEED88E197D8A60C46F11D250FE392054 antserana
12,423,908 *0150018AE900767C3D82FFC6E48EDC6B44D69372 ANTSHRIKE5
12,423,909 *0158D34433E4C8044C090895BF339E6E20DF3580 anttilankev
12,423,910 *015AD6B38974865E614CA806FA591998F8B844CB antwan.chiz
12,423,911 *0151F11D046E93B8CAFBD913ED4D354164CF8FA1 antwan.jeanfrancois
12,423,912 *015AE6483C8A5B1B62EB52FA91A2FBB322F64146 antwan.jurewicz
12,423,913 *015EBC5C6BF407F46D5D202897CB9CFED51CC6A2 antwan.levandowski
12,423,914 *0152D5298DE95B775ED0EDF8463517116F450786 antwan.lucidi
12,423,915 *015ECE7FB3B66078DC48369475431D9817B97752 antwan.moshos
12,423,916 *015EBC634C50A2F97FD97416F24D51382159AE5B antwan.puma
12,423,917 *015DAD2715373EED4CC615BB19BA0EF67740EDC1 antwan.rogillio
12,423,918 *015BCE8FD6E612A584C8D826DCA08A8BA36C8BC8 antwan.schonaerts
12,423,919 *01558C0ADAD153AB0B006BD31FB506C527503960 antwan.slowik
12,423,920 *015BA250AA3284445C619F01CFD8252261B9D385 antwan.weglarz
12,423,921 *015959959805B8D657D90B5165FF89E8622B2A92 antwan.yampolsky
12,423,922 *01512329C831FC28A357A38BDA0887757E419B79 antydended
12,423,923 *0156E27B37E5B921414A153BB290E91624948201 ANTYNIA
12,423,924 *015071E3762995803525C3BDCB3549B3B0576755 antyphoner
12,423,925 *0157492CBA271E1D9FA09AC54B5C1D3CF8FF0E64 AN##U
12,423,926 *015BEF37B37BB7A58FFB32E4FBA2E0482889046B A/Nu:
12,423,927 *0153CAFC09FDA4CB9AA525CEF84DF66D0980158F A/Nu+
12,423,928 *015D27B04BF0880C7DB7CD1A61BBED45274E0372 A%n-u
12,423,929 *015D492A70B6217FA8F8BBCDF30136AADC52723F aNu6ed4UjmmvVyhOzgE5WZ9yvxU
12,423,930 *01533EB5A2DD79A9155D47192979928A4FF3EA4E AnU(A
12,423,931 *015912FE1F68CE5048DE6FB254F20AA3173250BF a-nuaimi
12,423,932 *015CD4EC5F3C9F381DBEE616C1C6E27420143CA3 Anubbsw5
12,423,933 *015707EE8E1617B44B559D2E4DC0EF6508F8068D Anûchirvân
12,423,934 *015776807996D4FF9018D60FD983FC75CC11EB9C ANuCv
12,423,935 *015F1CD47192DC9CE24410E327F572E68CC7ED35 ANUDEEP
12,423,936 *01553086DA9F04ED3B1B7CBD263D5C4D031E6682 Anudnsp3
12,423,937 *015FF952EE6BEA796C78A921F9A1ED0E98BD0A1F anujaane3
12,423,938 *0150C1D79907AA47D13B0DC4B15B069B016648E3 anuja kamat
12,423,939 *015DE437C3EA11E8396F047C91289212B7318D85 anulasen1
12,423,940 *0151FEC8D0A46BDE80546C3FE8B14E969724FF62 Anulh
12,423,941 *015BBD7DF9BCA50CCF30784145627E961D7DA382 anulife:pacman
12,423,942 *0150BDD48188A832F272F7A802924D6EC8E05227 anumodati
12,423,943 *0156D599E21262074F9779E76CF56B64B58A5145 A:nuO
12,423,944 *01584A5FE556E6D63409D6E24A0F7C077AF8BA5A anupam bhengra
12,423,945 *0155A650C1E0255B3AE279B0A81A50654B84F587 anuradhabhagwat
12,423,946 *015DEDDDB9630D19D0C925A6046FF0BF3748F29E anureetsethi
12,423,947 *01561333D2008A3CF5EBA868708C931F4EF60AB8 Anutletis
12,423,948 *015AC3EFACB7502ACC919E7F8E522311EAAAD26A Anuttikl9
12,423,949 *015098ACA4AF7ECCDEE8D5CC801DB3750E198060 anutzaangels1234
12,423,950 *01568AB70087B7D3A2A6DDF8FCD1361E8416887B ANU%U
12,423,951 *015FA7289424E903E88ABC11A432102399631115 Anuupam0
12,423,952 *0155804E46DF07B1C7393957A2B1BE063529CEB8 ANuwW
12,423,953 *015F78005E9410D368905356971BD2432EBBC7A7 Anuxit
12,423,954 *0158E0911BCD185BC0C38BB9BE3C68770D5DE200 anuyway
12,423,955 *015C24C05BB9BAF26C4EFEA65F1E61F0947764ED Anuž
12,423,956 *015992FD90E6CB735A43B73D574BED27CF176704 AN:V&
12,423,957 *0154500808934B68E1D250133006BDC68B63FABA An%:v
12,423,958 *015C3F7B681113AB490CAA2BBFAD333C4DAD70F4 anv11op
12,423,959 *0151AC52EF48A70957F01B9DBE53DDA053FC69C9 An$V3
12,423,960 *01572BB3CDC1897AECE000CDF5ACA9CC0F6D485F [email protected]
12,423,961 *01599AF6E524603E395F1712CC1C6340480329F9 A-nvC
12,423,962 *015943202E53F08E4613789F65F0323392468881 A?NVd
12,423,963 *015E51A2FF424853169FC443030BB746EA4289B0 A_NVg
12,423,964 *0152684F2D6ED43F1CF951CCFBF6D521E9AC97A9 ANVHB
12,423,965 *015EA0583D7BC80CF6271B2DE97B419AC6D87DC8 ANvHP
12,423,966 *015C9CDD12E8245507674346E2E6D6AA1D88EA91 Anvienti9
12,423,967 *015241462A4B7BAB3E5760698614814DEA0A21C5 Anvizarba
12,423,968 *0151B44071218DA33E07D676C912EB49135CF779 ANvjt
12,423,969 *0152B4D5B23F4695F4CE6225A352C6E35AA716AE AN.vl
12,423,970 *0159845673FF5CD8F5A0211832F409884B40EA01 AnVp_
12,423,971 *01509BEE702AC27FB2C4BE79A96ED1F9E32EF7A4 Anv-p
12,423,972 *015B8513EFE2ED1640087F2868370E3E584D8B5D ANvS
12,423,973 *015864984A92393B8A3AD327B4B712642851302B AnvS+
12,423,974 *015027C8E0981405E1A52241D088BB6D46B1BEDD Anv$X
12,423,975 *015DB4E247C3FE5CF1D10478B59F0A53975DFEA3 ANvZ2
12,423,976 *015A2BF7AC85258BE82C40A6CF164A36C69AEA77 A=(nw
12,423,977 *0154A13805F2F432997B59A7B428A352BBA747D7 An_%w
12,423,978 *01525938842289BD37BEDEB6443ADEB5170A1981 An$w
12,423,979 *015BB437BA23379A7A984A64E23BC85BEEF317B0 ANw9A
12,423,980 *015ED6B32C28736763DB09D411DE75A83290ABE6 Anwaltsverb
12,423,981 *01549A1689AB0A61FD7E6EB8CDC137FBC22080FF AnWE_
12,423,982 *01520B28F2769D59512DCB9B9342218F80F074C6 Anwendungspogramm
12,423,983 *01507FDB72434500930B636244057B2874B95A2A anwendungsproblemen
12,423,984 *015F5D0DF2FEACAC8049DBBAA2DCAABF212C0FD5 anwendungswunsch
12,423,985 *015628B29EB3D667FE8E0C05CE2311620C50BF4E anwgeioy8
12,423,986 *015D5C8335172E7CBE16DB85B9EF1CB2499C7E9A anwheeler
12,423,987 *0152E19779F5D4455D3895426D59883D315E36B2 Anwinkel2
12,423,988 *0156DAB002588D74E22E8CC5674C2D6542761209 AnwN3
12,423,989 *015D51DDCE48A520C59634CD831DE302CAD1ECCF AnWor
12,423,990 *0157A164A6607534674F4E6176BF4650EA6CB4C4 Anwt+
12,423,991 *0153FC7E52A79B04037453276DB234865F87C46B An?wY
12,423,992 *01571A298AC6E6CAC166BA0C7EA22BAB7A7E66DA ANXa6
12,423,993 *0155991BD25A256C0D4A59F7B502A97440D0B07E AnXGT
12,423,994 *015B8A025051FEB444D11AC0ABF6884A5ADEC8C7 Anxiety Neuroses (Bastardized by Cryogen Second)
12,423,995 *015173DBBA48D855D885AAF28B975BF93EAE8B16 ANXIOLYTIC-STUB
12,423,996 *015B7F5DCB3E31FCC87330580734C353BBD3467A A.nXw
12,423,997 *0155932403506E8318D470B0341657B91B8085C4 A?nY7
12,423,998 *015063374C92EC7F193F97E8A721D3C09B50A52C AnY:8
12,423,999 *015186791277A8492BA43378AD00151B207D0DFF Anyapining
12,424,000 *01533E5D17E27DD9F014C7C115EBF61495EBEF70 anybaby1
12,424,001 *015BA45C563706275AF23932B8F2F5043DC1A369 anyboddy
12,424,002 *0151B483E62267FE8AE8FB7714BF1254AA7E0A0C anybodychef
12,424,003 *0153F95B29DCDE47B285FECF549D6C6E85D25676 anyhoo.jiy
12,424,004 *015E711D0C9583DD45BAE29C79F6B5969E1EB6C2 AnyHotDay
12,424,005 *01571FC8C87C4840F320E77E747AFF1EEE4CEF1F ANYI:
12,424,006 *015358482229A2049FD1EDD0B3BF7CA4B5590E08 Anyimlk4
12,424,007 *01569D23E4CF8F30FCD517076F7CF4397A7BAF60 ANY-j
12,424,008 *0153DD7CED8F4A1D4542A8B6738EB5A4E31C2CED Any m0re
12,424,009 *01528C1584F1C134BD55EA2DD340860A19B6A5E7 any.methodius
12,424,010 *01539B4081D77653D3838CEDFEA18966AA0D66A5 any-of
12,424,011 *015F954F7ECC8237E07A303FD23240375E497E8F anyone.anyone.can
12,424,012 *0158D09B86462009AC6C5F8497180ECD68B6B81A AnyoneWhoKnowsWhatLoveIs(WillUnderstand)/TimeIsonMySide
12,424,013 *0150B7C687C62A0DFC6FFBA7EE36997D20B3342F AnYR%
12,424,014 *01504535E09177BC2098602CD1799C35B23B8723 +anys+0ma+0us
12,424,015 *0158AA4659C8C80D5ABDF2F9D0E473B9D9C6B734 anysiad6
12,424,016 *015DE418B0533B5346E4CB0CC1ACCC54675AE25D ANYSO
12,424,017 *015549093AF9F0DFD52A1B25C071E27FB196CFBC Anythinga8
12,424,018 *015B60139D2C47776B8DADD076169F8834208143 anyway.giovanni33
12,424,019 *015C0FA01EFAB259CA8271E1E3239A8E3641BFDB Anywhered3
12,424,020 *0156B346E958D14D61744ABA6440A0C957E672B8 AN+,Z
12,424,021 *0156251A4537EBF4B2CAB166801E52B6848BAAA7 ANZ?a
12,424,022 *015048C61E4322DB67C7A7293955D8D97058799F Anzdiele9
12,424,023 *015EA902101A6EA3698D62226F761BA87B61F7A8 anzeigenformat
12,424,024 *0157FAC4256D2A7A5CF18B06CB2A058B63C0B1D5 Anzenhofer
12,424,025 *01556175177A04782F3A73AC0C307DDF6182301B A#nZH
12,424,026 *015F8D1678CC35D2E148719CAB672DD62193C764 ANZ+M
12,424,027 *0152C914164F4D526AD7B02F808E28F2D5B8B688 AnZ"Q
12,424,028 *015C98656DD0A7A0D96815055F8037FF80897F01 AnZ!T
12,424,029 *01544422A8DB9369BFE81E81D12E55A6AE4A40C4 Anzusbsw4
12,424,030 *0157CBB6D0E41B983EF97C039673ED4F9C899866 Anzuschl5
12,424,031 *015076A83CE666392DD3BC9090E780FC6C23C8B4 anzutreffen?
12,424,032 *015D472C4DA095BB099214FB892058A7F110C4F0 anzuzett6
12,424,033 *015BB1BC20E38025C54841FB0E528E0F202B1CF6 AnZW
12,424,034 *015AE4022F8D43C4E006A6B20E7E9F0CF5F76F9A anzyanz
12,424,035 *0153AAD2B6B5C5C32568BC2A1AF23EEF3625EA38 A^O#
12,424,036 *01532518FE6D727073251F1610FA7B57FFE44B0F A,,;O
12,424,037 *015A85757AC0448F191BB651BD86235AC0455A01 A:$-O
12,424,038 *015B12325035CEB999CCC16E8C621185A613BF33 A#O_-
12,424,039 *015FBFD31D201F4FB89ED12BDB7D7FA3433366A2 A;/
12,424,040 *0153E519F2D253065865BA4D1889BEACFA6B3223 A!&-o
12,424,041 *01578E1DFDF1653D26ED04CEBA32C27FE2BBD5F8 A!o+;
12,424,042 *01586AD5A418B6D1FA5944B91032116958CE52DB A?o&.
12,424,043 *0156EEC1BF0DF5A4C12567AA7E2990424932D53F A/o%.
12,424,044 *015BFD50254615EFC9F232B0181DE216767F815C A.):o
12,424,045 *015B62D89E67D7EA6BC5E7E9843AE35837DE48FC A#$o!
12,424,046 *015E98683DABF90E2F47ACFB3CD0BD2937C31074 A
12,424,047 *015D2B4DEFE66A7AB408E294CDF0D72E713EA3F2 A
12,424,048 *01567E93AC6DCC8B862720C3718F7A5E2BBF9F69 Ao0)0
12,424,049 *015D6CD8EBAF703EF1D9E1D3F34646B00FAAE07A AO0EK
12,424,050 *01525CE112F90CA5D5367191A9835F460D55E04F Ao0)g
12,424,051 *015284F3D16102CF3165FDA31439B575ED19F7F7 AO0&l
12,424,052 *0154FA91DED169C4D7EE739E196CBAB89452C57D AO0m4
12,424,053 *0156AE2634C6C6CD0B6C0E6F0A4C713DD90722DB A#O-1
12,424,054 *015716B695676CE31EFFEA0A3935CD10136B4057 ao13
12,424,055 *015D9D5288E4DA8B292EEE7F4A26759DD823986E Ao1
12,424,056 *0156A9841F393839D5AA10BE82F2FB9015823DE4 Ao1al
12,424,057 *01518C910B07BF061EF7030443045A434C8FD868 Ao1mH
12,424,058 *015E1A3359584EC82E3B25572EF9CFED48AE1B0E AO1Oe
12,424,059 *015AE5687E1475677EED3ED0AF6CD9A24F6F3C88 Ao1u4
12,424,060 *01522BA4F7683CA6AB2EFF277A6BB4ED31DC819D AO2#&
12,424,061 *015585CB2AA54233912311D0B5239B55DEFCFE44 AO2Mk
12,424,062 *015C090505EE3310693DCD8D24204DA9935B4EB2 AO2pv
12,424,063 *01576D402325E8BBEF4426092C3865ADBB0A2347 A;O2R
12,424,064 *015A3A85584E3D545C58E265869CB35912542666 A"
12,424,065 *01588BD5F97C12B7BC57EDE6666C647B2A152A98 AO3
12,424,066 *015A315750AA825F672C4909580E9F6C237BC0D3 Ao%%3
12,424,067 *015EB915D8F66B3B656FAD6A276A9C2615533300 Ao3?E
12,424,068 *0150372BB88D52EFEF9B11369B3CC0AC05F96D1B Ao?3Z
12,424,069 *015D506912A8774BC2A6055CA730AEC3DB9EBFC1 A$O&4
12,424,070 *015C221750E8626E7BDD695D66DC8FFF96A1CDDF A
12,424,071 *015D2A593340882D39C10FC341D816E1A4256C27 AO.4=
12,424,072 *0159CD0D37435568DD4A4A76C33CFD1E81B9096A AO4%%
12,424,073 *015B7E44EEE5C078916E64280941DDA2F9244F6B Ao4jI
12,424,074 *0157682CC9E9C3D99677AC7ECD03CEFEF08C25A6 AO.4m
12,424,075 *015CD1E658B86C49622B66946E106111223FDDCD AO4/N
12,424,076 *0151EE2C40678371B92C20C3D59F62E5480336CB AO4O?
12,424,077 *015A96EDE6E634A938E2F501248F576B389C570F A=o4U
12,424,078 *0150647E93BC6090E1066F3C0A8BE8E776AF3A1C AO,#5
12,424,079 *0159FF2FD8BB80B6C3A839228635F24243744F1E Ao5/U
12,424,080 *015F89B2FD2E250383E2CE7B4EAE5D2CE66256C2 A,,O6
12,424,081 *015C746E73FB851BAE6095257E0B720BF247CF5F Ao#6;
12,424,082 *015F01D0D24A1B73115FC91A88B72CC1DCE0D05F [email protected]
12,424,083 *015EC7E8BD9CFF741E030BCBE1C2E4CE64315C0C A-o:7
12,424,084 *015F919A265E07F8F8E7E9CC71AF4DF5AC05A10F Ao74F
12,424,085 *01551AEB0C3B27FF3053F4230D3D04F8E37A061B Ao7-9
12,424,086 *015D2D02976279756EC6163FB0EEDC4B2BC5A275 AO7+a
12,424,087 *015897AECA5DE3FB7A844C170B0A0B1E13343A47 Ao7Ei
12,424,088 *0152D58276959DF26C03CF4E1823C82CB99D74D0 Ao7M?
12,424,089 *015100CEF19F0D5543DF5877C133AAB12D4799A6 A-O;8
12,424,090 *01591231194AF60E58C1449495182DF6F81D406E AO9.
12,424,091 *0153D465F3B766FD238F6769FF9645534586DAFC A_O9e
12,424,092 *0154430066DD893C0187FB17C1FD280699AEC629 AO9eo
12,424,093 *015530BF30561892CD71F089B19F8D33D6F5C004 AO9sO
12,424,094 *0156BED058DC257AEEEC85564BC2D84C68FBC8C9 Ao9VU
12,424,095 *015CB165BC9E44B2FFE7F0DE56057A974A3E2BF2 Ao9Xr
12,424,096 *0159FC093C5FB389F2956631FE9F08CF7D48D52C A%OA=
12,424,097 *01567A37E716EB6BFEA59BC91EDE9B1996C12B19 A%.oA
12,424,098 *01580A3FCF68BA38FBCB12B6582E0647543D40E9 Ao/a0
12,424,099 *01592F50264BB976AB89D33CC6950106342455CC Ao!A2
12,424,100 *0151642D0D6367D33B48F99E5F3019D5CD526495 Ao=A5
12,424,101 *015A1A08D73F4A87F7542C11E913DF9DB13CD5E8 AOaHY
12,424,102 *015B78F22033C621CDF115B0247BF6A7358098CC AoaMs
12,424,103 *0155C0A8DF40FA183CB6460479720386E04C7225 AOa"p
12,424,104 *0154691A38F6F594B7CA17637519546203C8D5D1 AOasB
12,424,105 *015E4F26DBE1DCC5760D31F0A84ED6C1ACF257C3 A
12,424,106 *015435DCA262B40332E8A986E8A5BAF94E1E7D93 Ao?AY
12,424,107 *015B69DA2B7A63D7857423D1FFAB358020BFE502 AoBI=
12,424,108 *015DAA7515F03A48469373F4C7B1AE70423CC62C AOBIKE
12,424,109 *015645D75353CE23F3E0CE8BF7BCF20D439362E4 AObm,
12,424,110 *0159085AE5BE0878B060629FC8A56363F7A65089 AOBMK
12,424,111 *0154301773E089E62530472F05ADF8A9596C18AA Ao!bQ
12,424,112 *0155494AB2B505264B70F09332D7B09793F29D5F AoBsS
12,424,113 *015DECEC53D5ED10D39C71388426195E5B66CFE8 [email protected]
12,424,114 *015C19DB8254B5374AACA4F7B25CF423E0966E6D AOC(?
12,424,115 *015554432D62419F7879EF4071B9004DD074DA8E A,Oc.
12,424,116 *015E1756705C516131EF3CE720A6B0D8193209D1 AOc!/
12,424,117 *0151A5A2E4E95049694C9DA3D179EFF44EAE17D8 A%occ
12,424,118 *0155264DC4AEFE592729FAEB34AD672E0F9C2717 A_oCI
12,424,119 *0153632EDB6D8298D4EDFD5702680C38FAB3D4E8 A$$ocia+ivi+y
12,424,120 *0157EEDC4E61ECDBCCC8C3E64B6C14F23BD32BA8 A_oCQ
12,424,121 *0151FF211F5116199F5043707366DDB14E1895E3 Ao?cS
12,424,122 *0154801142B604ED941FD86492A762FEF35E9E74 AOCSHXLFL0NM9Z
12,424,123 *0158DE0CD58B1A770EA798B77929FAA2CB43311A A#ocu
12,424,124 *015E2F97A31F4D35ACFE51D3D33D79D9543FC23A aocxaa
12,424,125 *01530C0D76BEE8636D3518787D42D3F872490DE6 AO/dF
12,424,126 *015239BF0EFE831FA7B57E8D0417359702A75422 Aodh4
12,424,127 *01523D50724759E24C087407A876538F3CCA316C AOdho
12,424,128 *0155426A6A3F9AEF96168BBF8EE58B3DD0B8F883 Aodk1
12,424,129 *015EA60466438045AF5CE5903402CFCF6CF24418 A)oDl
12,424,130 *0158748252CEEC44FD3D23616325AC9C13E85AFD Ao)dQ
12,424,131 *015B377D18FE6354482D5C74519F489EF64942D2 [email protected]
12,424,132 *015CC27C53F2A9FD49F935CF62D42D6DBA984A54 A
12,424,133 *015EDDDE5C40D8DD84D2A53D471366A349AF2272 AO/E=
12,424,134 *015160DDA098AFC93655F0D3C5CD19CA16FC526A A#&Oe
12,424,135 *015D91BDAEF67BBF69675AEFA2E0222E79C167A2 A
12,424,136 *0156547EA02BDD2D40A961A35416345714BA36FA Ao_E_
12,424,137 *01519DA642283F30809C926884EFAE886D85C813 Ao#e!
12,424,138 *015D4E3216BDD4192C9B8AC6A478187EB42F7F53 AO"En
12,424,139 *01508324718672130BE2D9EFE0405B5DDBEEC416 AOEq-
12,424,140 *015A70A8A1D0DDCC3DC80870D3344859BFA0E73A AoeRO
12,424,141 *015002AEE920740DD05C04C668499A6973F4FA21 AoeTN
12,424,142 *0152367716A45FD4ACD28F004519EF590D630EEC aoeu:
12,424,143 *0159C24C8CE81DE7C4CED692B04A54693DCF127C Aof0L
12,424,144 *015B6A8455209602D2B41EDEFDCE461BFC325B7A Aof26
12,424,145 *01561DD2C4AB8303E85D30CE27A659E29BD153A2 AOF8U
12,424,146 *015BE5E39A639237BCDDD58A61BC60123BA7CED0 A%ofE
12,424,147 *01596AC32335E7DAAA2619F0C21B5057638EA172 Aofenet6
12,424,148 *01510A82DE1E630BAE40287969675899DA6BE473 AoFhA
12,424,149 *0159A1EFD802DC068B22323B5BBA64358C6B14DB AOFHX
12,424,150 *0152C68A66E564312A9E1BE22008007F7989734A A&oFj
12,424,151 *0153B4B9D708079819CCD7D9BE9E34ED6C0843A5 AOfl6
12,424,152 *0156D0411C96A04BE89C5AE312C99B76DBE2229B AOF,M
12,424,153 *0158719CB0C3582B313D5DD3AC9332929DD55892 AoFpk
12,424,154 *015C570D1B21AE5BABF6C81D78CC11E1E92AF4B9 AoFr3
12,424,155 *0151F8BEBE237716A98594D490FEF2F4EE1BF422 aofriend1234
12,424,156 *015C0F20B78458DC89E0C04A07F8062FF852D6A8 AOFrX
12,424,157 *0155ADB6FA0971F5006613A6C79A15AC2CAFA421 AOF+V
12,424,158 *015E81EC0CE007DD7274E63E5FC668FD898A6D9B A,!OG
12,424,159 *015E2D1C79A10372365DED062EB81B78F29769A5 AO.G
12,424,160 *0151C50805A7A02A8C79677C5734C8C00AEE5EA5 AO
12,424,161 *0154B50EED5CE7A089227B8A6FB0AA34549D75AB AOG%
12,424,162 *015A113749E0D1AEB1D2A53401D3962EEB5558F8 A-O(g
12,424,163 *015368F4FAB169D3FBBA359BD9A9CA1A323857C6 A("og
12,424,164 *0159F70F98FB14DA34A1EF89236817B4BD86ABF7 A&!og
12,424,165 *0158736DB2EB356A7F65EEDD748521A4102C2776 Ao.-g
12,424,166 *0157D5085140BA6F679DCF97F57A964725EC81AE AOg55
12,424,167 *0150263942855A815E15FFA8E852F3B5C2A15EB5 AOg?a
12,424,168 *0156D1B2C838EAE5385840FD55295FE9C404632C AOGIX
12,424,169 *0152A1D8D1556AFB191723B20D6D0C0180574F4F AoGl!
12,424,170 *01573478D84C0FCBA9828CD6B869FAB9931E4873 A/ogL
12,424,171 *015B8A573052FF53FC09C4E164F54478F76ACEC0 [email protected]
12,424,172 *01575CEF8A4869BE70C3ADECAF230898507559A2 AoG_q
12,424,173 *015934CCD67CD34A44F01074D08C39546C6D8B61 Ao,GS
12,424,174 *0153613CD70D619134647D9D65689ECFC47D6261 Aog_S
12,424,175 *015F97351F959410A7D80292E753A4316F050D83 A"ogv
12,424,176 *01580A1A7991C36A71331C45036F41DE8C041431 A.o&h
12,424,177 *015517C3802724664D0818AB89BB1C13AFC9B9F9 A
12,424,178 *015B230DBB6D25F11F095363D6F8FED33B6CD8D5 aoharuiro
12,424,179 *015EE9E6E88659A19D6B68DC4EE7CB4584C58665 AOHid
12,424,180 *015893251435E62097432DF0A03F42F3B98F8508 AOHjc
12,424,181 *015F052AB874D911AAF1225D1D2A3D78A5F43DCE AoHsi
12,424,182 *015276F66332CCDDBAA3C1A301F4FEDD29349AE0 Aohsmela
12,424,183 *015FDDCD15B47958129632E390EE27E5EB9DA14C AOh%t
12,424,184 *01541B038DCC0B86191AD58A71CD7E92D3CCDD7E AOI1_
12,424,185 *0158F780ADB07BA2446C2CD121B66E5BA924F666 A(Oi3
12,424,186 *015184533EDBFC00976C0327EB9DC16F6494845C AO"I4
12,424,187 *015EEE4F833A846413CD5EAF64C1021B333278F6 AOi4f
12,424,188 *0153FE3C9880458330E7EB58572F96DBC2B0608E AoI6P
12,424,189 *01577E39EEA709BAA9702D2F7C62632F1D479342 AOIj=
12,424,190 *01539AAA58A153BD3E560C6CEE56462A342F5068 AOIKY
12,424,191 *01574F20C8A1DE712A0226079EAF97C0D59EC1A0 Aoitmos
12,424,192 *01543A1F59B0A250B9717B0E3F43D95DB9F467BC AoIuv
12,424,193 *0158B27B755717F818B1A3C630461B008FE22166 AoIX-
12,424,194 *015D2B267699B41B22C8FD8F63A0A3D7DD772983 Ao%,j
12,424,195 *015D64C00919736A3E512DA6E007EAB2CC5B7D02 AOj58
12,424,196 *01514DE5460A2710D6A5FD083ADD93175323E992 AOj8T
12,424,197 *0159FEF1EC7755B02D0A66BF80A9D8E2F7465383 AOj=b
12,424,198 *01529912BD9F9E22F90E2FC2522A49C18D32684A AO&jI
12,424,199 *01510C9A43A95D04A8906119117D9390092C5D51 [email protected]
12,424,200 *015A18950F88245F6732424F59E99EA06E09A53F Ao:jp
12,424,201 *015D0E4171CAB38B6FD72C720A47646838C3EEC3 A_ojX
12,424,202 *0151CAE160C01708494648D0E1CF0ECBA79189E2 A_O.K
12,424,203 *0152FAE65181F5361C823BFCBD90D9CE51BD6AAA A..oK
12,424,204 *015188357C912D42C66841FEBB5F43F802050004 AOK28
12,424,205 *0155B91C6760BDC0FCCEFBFE3AA84C7439E39BBC Aok36
12,424,206 *0151073F1DD9012051C08AE368F5D8799800CF13 AO?K4
12,424,207 *0155C3935F3719A533D0029E9059BAD1BE2197A5 AoK%5
12,424,208 *0150E3C4A2C2F8B776D5AE3292001E0E0745BC0A AOk6+
12,424,209 *01505D1BFE9D0D7B921322A64E9065E20C8A7B59 AoK8-
12,424,210 *015BC98E520059AEEEAD3DADC9AEB4F5501A75AE A$oK9
12,424,211 *015BADED8F97ED5415247BA29D337B92E3DFCF46 AOKDZ
12,424,212 *015C0D0228F082AEF31C613678CDB78D99C7A087 Aokkeir8
12,424,213 *0157EA62D135D4C1349C5DFBC9B2A503B633C6AD aoklepn3
12,424,214 *01594F42DCEDC100DEEB261739D5BC83D8380333 AoKlM
12,424,215 *015D2CC09FFA93E78DA57B4F236CE27283B9DDDC AOKM6
12,424,216 *015A0A90D258BD95426CA70288FF04C83FCA89CF AOkMq
12,424,217 *015CF7C9FA935D07F295AC3395676D7FD14980F8 AoKNU
12,424,218 *015C3298C7B55477DB59498AE044CFE99A2DE035 Ao/kV
12,424,219 *01561E79E8CC538CCBCA8BF54D7512A345847DB9 AoKY(
12,424,220 *015C9939B328D5667BCF404E003B78EA39204785 A?o!L
12,424,221 *0151E9F128B0B29CB66CFA4ED41518B84013D7E6 AoL";
12,424,222 *015B311EDE0E73233102E6D350071F28DE3DF28C AOl1j
12,424,223 *01506C847518DD41902FB0EF5C560F8E861AD100 Ao!L3
12,424,224 *015A12259AE977E7D9B3403CA368E2EDDB1EDDEF aol382
12,424,225 *0155F6F13B08110325B0E7ABD4D888DC773F5C6D [email protected]
12,424,226 *015EAA14D10A8EA25DFFCAC3456C0D4C156E02A2 Aol$k
12,424,227 *015BFC5F8E75FA171C8F4316DAB84F8FF85FEF65 AoLl)
12,424,228 *0150DAE80240668DAC7E8576ADCD57E03D1D63D8 aolsuckcom
12,424,229 *0155BB0B8B17FD7CE19822E315FA3FE3BCACC8C8 Aoltf
12,424,230 *0158A3784405747786A3D57441B70B7D11A898EF AOlu8
12,424,231 *015E526C48995C41B297BA6F75F689FEB4AEA644 AOLusers
12,424,232 *015B38B0E3084DB1882ACB3F5CD3FE49D4193131 AoL"X
12,424,233 *015445E97FF466DF37AE62A5376A8EBC54C63E0C A(Om!
12,424,234 *015DEAF26BD64E99EB1F5F7B37066762BDFE0F25 A+O)m
12,424,235 *015ED1BE7136FEAB19B3E2E9776D64F41BF41732 AO_(m
12,424,236 *015AB762675DBA8119FF37E331FE80229337A881 AoM"(
12,424,237 *015CAE589BCFB03D71667CD67B604E6E8248A8DA A&!om
12,424,238 *015C8DA3395FCC6F470AB90AA73B1E1F67DE57BD Aom(3
12,424,239 *0153628602204BCFE6364DA7251601CFFE0B400F A)om4
12,424,240 *01520B40D1E17D7BD3D6392F71F3F8C4D8478804 AoM4P
12,424,241 *015A2D74443820665335D3620F668AD3B3D004BF AOm&C
12,424,242 *015590EEBED07028174245D840BCED3CD4923120 A/omd
12,424,243 *01546A67E60291F17A5484C8A79E89970AEDFEEB Aomd1
12,424,244 *0155014EC8363AA07F1EF4F30E69504A09F376B3 AomGO
12,424,245 *015A84EEBACE196DF4614E815A5FBF7B8075E5A4 A%Omm
12,424,246 *01576BC182A08EBAFB9AAB147F30140CA3F732F5 A#OMY
12,424,247 *01577129F4C4B254A3041D29842A97A679B6F576 Ao/n%
12,424,248 *0157A7900D69059F503C2EE7A668AAD061442FBF AoN0L
12,424,249 *01589C4F549E425EE4969D890E24A151C2855F22 AonBH
12,424,250 *015E3EDD9DE56E57E88C864300E38874F42FCAE2 AOnfM
12,424,251 *0157FA62B6E8D27BF89BB2A87AEEDEF0BE8559D8 AOn&h
12,424,252 *0150E477656E89A10FEF533978EE0CF04FCD7509 AoNMA
12,424,253 *01500A1BFC44293545F04AA951A8F4B9C7F434A4 AONokXPD29
12,424,254 *01515B7584A60BD91EB6F5D79C221BFC3E3FE275 Aonor
12,424,255 *01532EB3983E52330D43DF5D8A43C384490068E7 AOnoX
12,424,256 *015FFB986678464708BBB2F68645EE79024C5CD7 AOnu8
12,424,257 *01524504FEC7E7C3179E8A8CD24AFD461431B0CF aonxx123
12,424,258 *015123942072D8683379D3E1923D8E362CF109E2 AoO1n
12,424,259 *015ED39B73B84DA4D6BA2E9FE2AF5B0C94B3F5A3 AoOaT
12,424,260 *0153A860F2108739BD7D53F0A1DBCF02EB9D4535 AoOAZ
12,424,261 *0154246A593AAFD9418B7CEBE95E92A1ACC0516B AOOB2
12,424,262 *015F888669E92F6FF94D8485647D0C80B38F449F AOObD
12,424,263 *0155BFBDCDE139752BF41170C65577B94C7FB29E AoO)d
12,424,264 *0157797CF3915EF5314AAEEE6D0A87A0A4F9D6C7 Ao_OI
12,424,265 *01549317D61C23205E5EBF35ACF44F941C77BFA5 AooIK
12,424,266 *015BE669AA77629AB6E85DB9DBE1E0C1F693CB87 AOOkG
12,424,267 *015EB38BCEC5DA7860D9E64B83DBF1F34C39D322 AOolY
12,424,268 *015FF4F20E91CD05FA8801080F95C1698CA1D50D aoowmgwy
12,424,269 *01560F6761530ADD6F73286C53220B8C92684016 AO+OX
12,424,270 *01526C59EF3D5046977DDB62E4DE6D174CB06CF6 Ao,OY
12,424,271 *01528241FEF0E7CFC5FBC5C9C8651D590FF5B40F A;,Op
12,424,272 *015877B65BDD3960BEAAEA6DB4D9B23ADAA9A58D AO/p
12,424,273 *015E0652A8246D18F7464ED4D37D8DE98C93892D AO+=p
12,424,274 *01591A18D953D3A7D240465E8E2944F664FB0B84 Ao;p&
12,424,275 *015D071DDDD2B4E533199D1AB948C096B060C848 AOp5q
12,424,276 *0150C987520959E7B7E886FF0406A5F8DEEE604A Ao:Pu
12,424,277 *015D413D54B7B9BDC7517610DA9F6D77533E709B AO!Pv
12,424,278 *015CD6E504CE1DC902524255D3038370E1B931B4 AopW2
12,424,279 *015B30508243DD37B33F503AA965D5DD921F6EFF AOPXo
12,424,280 *0159A7E3997EAB6A6C3B55DBE2774893DA64DA20 AOPZN
12,424,281 *015FAED0B091A193DBDE70EBE39832B4A1F99086 A;_OQ
12,424,282 *01573755B6893A8685F9E04C353E0874DE121B25 A;OQ(
12,424,283 *015E3F987ACFB147064F05E7B19147B9F5CB7861 A"OQ_
12,424,284 *015DCE9E661F30347B9234B4B013A04F4827EE58 AOQ./
12,424,285 *015EC8989BD9EF6B72FD5E8D85475F7A23B447E1 AOQ&=
12,424,286 *01521B5C25178BE655D15F3820BDB8C8E6A95106 A?O!q
12,424,287 *015C2143E6624A784D7CFDDBB8A5FCF6944FD724 AOq-5
12,424,288 *015ECECB836D1D34623734AC9910F6E175DB771E AoQ"e
12,424,289 *0157319DB4EFA5DC5B17B732196768D81D0CE09F A:Oqf
12,424,290 *0151D3B4845D8B54F3846B299129192E98209EFE AoqFH
12,424,291 *0158194D5580EE25FDFA447E41048D5D882F9A2E aoqg7vu:uwbee2p
12,424,292 *015B51C60ECD413DC8C471785B69D3B661EE8E21 Ao(QL
12,424,293 *015E4B2429F237A5BC164A32A6CE7D0DFD9806C4 AoQmW
12,424,294 *01504C6999DE3B901FADFDB14BB01BFF986A7C79 A)oqU
12,424,295 *01527E445144265E25B58595B421165087EC283B AOquP
12,424,296 *01507E616D08D2379F4293B4D1C774723FC99F49 AOqVc
12,424,297 *01507C1949B203C9A9398482F40B35BC1AC73761 AOQZU
12,424,298 *015E7E51223AA2B73B60C253F38BA19FB3275366 AO[R
12,424,299 *015724EB30EF64B834FEBE682A59EFD34B09A081 AOR%
12,424,300 *015098AB4765D562212543DBB325BFAF39A488ED A,+Or
12,424,301 *0159C1DB194A38C3D5A3D018B7CAA7B71B88E20F A".or
12,424,302 *0154170AD7A16C9781DDE8835552E066F2BDD6DA A?oR1
12,424,303 *015D683A5EC0F3B3A61A71BC4B61D7EE3F81004D aoralphumi
12,424,304 *015E40C599DD1188B19C673424676C6EF63863FA Aoriland0
12,424,305 *0151819DE3BDE7F1EE8FC8331AE1DB630240734E AorK4
12,424,306 *0154475E9341E2FFFE16B1EB46DCDF4D8E5D2724 A or N
12,424,307 *01543B422329DB7A70E90A78A5B5C6CFD41D79B6 AOR$R
12,424,308 *015DD905438647D92529C4D36B9DF80975D6AAB2 A-OrR
12,424,309 *0154D82BCC367ADF38BD3B7EFF40843B848A7C7D AOrS&
12,424,310 *01596487B695EFDA9CB38D69427984A8EED39795 Aortoptosia8
12,424,311 *015D08BAFD1255B7256FA3360187087CFC05C4CC AORu9
12,424,312 *015948119DD52E8267D682D80A57D2657AB76736 A:o(s
12,424,313 *01511E21F6CA4BAA838FF580798870A2864BE966 AOS0o
12,424,314 *015260AADC5C8FBF652E6AE5EF3783126E7EC54C Ao$s1
12,424,315 *015E1633A25BC50BECD5CDFD77C678233B649444 Aos3p
12,424,316 *0151CE9041DD6C1D88DFF6D20773F5E32DB23A56 Aos4n
12,424,317 *01561CBC62DE4256D0104492E6A88F561AA6F338 Aos
12,424,318 *0156CEB2B3015718F16C4913D2D133FF8AB9CDF1 A:oSe
12,424,319 *0156E5D558919C8C900C74E340A4EA4A092EEDE9 AoS&G
12,424,320 *01501160E1D48FE4935448A3D0519D0290AE982D aosjupbb40
12,424,321 *015DBF3C3467937740B10EBE285B1C331A12AEA7 AOSkb
12,424,322 *0156412305081FB0F908CCD9347C312F3E080150 AOSot
12,424,323 *0158AE5FACB201BF8340D0B8FEF9FF190E90AAB2 Aos/R
12,424,324 *0155870678A9C8E6516778860C0803D7A624FD79 AoSSs
12,424,325 *0159755DE53B417E135FFD5377E66E9BF5270687 [email protected]
12,424,326 *015418691BC580D85C3AA2D44586923BCAD32516 AO(St
12,424,327 *015000F360E1CD94A39AE516C202AC3A166AAFFE Âostralasie
12,424,328 *015287F2583556200D8B18161DEB99745E01AE0C aosxstj31
12,424,329 *015DA74516C38077F2B1D6A06972F9D4698714BC A:$OT
12,424,330 *0156BCDBF40E1113E8B440D13710CA11D47C2D2A AO#(T
12,424,331 *015597C4430FC2F82802DB38A1364559E4E1D603 Aotasuving
12,424,332 *0153757E4452ED053A68A8B0F457F0229D4B99F3 aotawema
12,424,333 *01551B3B9E96F1DFA521E314F79A74379F236CA9 Aot#D
12,424,334 *01512C7647763A2642C46E4046066E62C0FACC22 Aothuuhing
12,424,335 *015AA771313E70ECC1EEBC905395FCB685D1B6FA AOTk"
12,424,336 *015BA08146E5AE9EA7090BCB8EC07585C1FF1CFB Aotnaisk5
12,424,337 *0154AE3794472CF2CE31925C1A9BCA03D01A212A Aotoulin9
12,424,338 *015963ADB4C15DD48913606B90C598CAEF658812 AoTYF
12,424,339 *015E898D682E5E279B7F38FD1D4EAF61F324DDDC AO_%U
12,424,340 *0152CE2536644F442CED6D677D07F1A270D20868 A#)ou
12,424,341 *0157ECD5E4C86ED12890F7AF5BD2B9DD146DB5EF AoU6H
12,424,342 *01582EFF0C0D86AC0219FA2B3AE48BD7BF9B269E AOU=B
12,424,343 *0152CC9FC165B962D20E071CB6D940411BD14056 AoUCt
12,424,344 *015A0FFD89A27E047D437DD295DEB4CE0A6A14C3 Aoudadses9
12,424,345 *0157C0084AE005550BD03D5A041299697A62ED99 Aou+E
12,424,346 *015E4343AA26A9598E0479E30B80EC8548910B0B AoUE2
12,424,347 *015E69CF7AB6D502EEEF33244450747EF20A6C97 AOUF=
12,424,348 *01539AEF1E36FDF69C4CCAB53B46B312B938386A AoUF:
12,424,349 *0155A89E74A06B5C1313B1C158C286E74D9DF462 AouIm
12,424,350 *015735196FB76CEF2756101EFB3D35A14C520FAD AoUna
12,424,351 *015C2C1777AE966665E5D01505CDC965D0C05AB2 Ao,ur
12,424,352 *01582444C7EC80E1A7944F8A425B5F59A481F88F Aourakip6
12,424,353 *0152D6E22F1676E1BDBB58AC0B66365729619B10 Aoutire3
12,424,354 *015931D8BFE1B3180E0F6A6370FCD8473F2CFA26 Aouuf
12,424,355 *015E41C7EE26030C6E92057E8666FF999FFC9DC6 AouUu
12,424,356 *0152F8AF9C3B40FD9CE0AEE8B914F62A07A5BE5F AoU:v
12,424,357 *015BC3866865D2F67539D9A13AA19BA46C7B1EC1 AOuW6
12,424,358 *0150D39A2981E584391CC5BB2B700EBA8A3F8C0B A(OUY
12,424,359 *015CF560F6B44CC8F4E2136E1DD10758BF50CE57 AOV3U
12,424,360 *015B8CF5CC0A02C2792122153C17B093B7B00AF6 AO)V5
12,424,361 *0150067E586D26A8650A69E676E6D8250305B718 aovfrosajfvzuzvdrqvvbru06u
12,424,362 *0150ACE5346ACD36A41C2ABF4C11B0788D8A1EB9 AOVM
12,424,363 *015B19F812376072B50D73A19B32EA65911F2C3C AOvTW
12,424,364 *015C8FAC58791AB936773456B794732586D1ED10 AO+W_
12,424,365 *015D5B7063ED0ACEA9EB25AB27DC1B2554BDC0DD A-"Ow
12,424,366 *0152F12200936795957A7034C41A1D61B62755E6 A??Ow
12,424,367 *015FAA94239503A23E22EF0209C427B10CCDD21F Ao;W-
12,424,368 *015961609C708B096983EC6A888C721CAB15E977 AO"w0
12,424,369 *01534412611DDF2B38BBB526CBDC8402FA9B28C9 AO(WB
12,424,370 *015C70E3A4C33495B4F28C89300EF97655621ECE AOW(E
12,424,371 *0154CFCFB22C248279B2BB1F9C72E86AE18536B7 [email protected]
12,424,372 *0155E44F3D031853FB7E3074E03A23523D1C7489 AoWKr
12,424,373 *015F807DBCE186725530AE35BE46CCB6EF647712 Aow(N
12,424,374 *015389F6578EDBC8DF019B9BE7EDF249F38A67A8 Aow+Q
12,424,375 *0156CC5E8847B1F297160A6E9C638E2363130169 AoWq0
12,424,376 *015D0090D74DB988B4D3E82BE32C49B56F2373D8 A!OWr
12,424,377 *01588FEA76FD759B954B301C7DEB80A7DA6870CF AowRS
12,424,378 *0155B77A7C09C264B81A0B413A6D09C98854B8B1 A,OX4
12,424,379 *01597C9D8C72F8D43B8B1762BB551F5A08BAF9AE AOXb:
12,424,380 *01502E353745D331862D43789DF6376BDC305772 AO
12,424,381 *01589CF69A418149F6CBC4EE281358070BFB8CBC [email protected]
12,424,382 *015476F1E32E60F589165C54241C2BC7ECF58754 AOX+Z
12,424,383 *01503D68EC2664CF1C6094E54112BD4812AA7FF3 Ao;Y_
12,424,384 *0150328F450F2D189302EAFEE302392BF4EE9886 A/oYA
12,424,385 *01586BA59CB1EA5F7CB162E211F0FE84B9CB9371 AoYkW
12,424,386 *0157F30C49A68E8D9BD25ACA2A5CFE9E7719F6E2 [email protected]
12,424,387 *0153439AD3C6F6BAD2563E256F688379849DB30B AO.Z(
12,424,388 *0157FD168B8B3755D68174810F58C3403F1188FD Ao.?Z
12,424,389 *015F195E41DCF7A260AF08DA451FF812FF1F9350 AOZ8j
12,424,390 *01525BE7CEEF458C2EB452627C2FFD660BDAAF04 AOZf?
12,424,391 *015DEDB7DD8D96B18778D89407F52B6B181EC785 aozgc
12,424,392 *015B0FB0F525E1DA5DFC154CC1202888C8278F45 aozsi
12,424,393 *0152DFD4DE1425414126D1B8F3419513CDD86A56 AO:ZZ
12,424,394 *01560761E5AED1A3DB9C5FAD709263C3E37133E5 A,(#P
12,424,395 *015C98AD956E716003EF949BC9A7FEE0CEE63610 A?;/P
12,424,396 *0159A220CCAEFEE47A3A89D5EE62918F227DDA7C A.,)P
12,424,397 *0154EF6265CDF1D1C62685ADF5DD43DC6909589A A%P$%
12,424,398 *015A09E1EF79AFDC6ED67711CCD978BAF075A786 AP;%$
12,424,399 *0158920825DC4F50B4B4E128D7571EEB02C166BA AP"%$
12,424,400 *015CE08517945131284D20ADAB347EBF55452E16 A!=p,
12,424,401 *0157260A1CE7F6D0CDA1BE4F638594A771DD413B Ap,#=
12,424,402 *0157D4FBA9FFD5EB75ED56278E71A45525CF09EE Ap:#:
12,424,403 *01575EB492649CC0DFA699C0930EF24DAF9379AB Ap).(
12,424,404 *015846CBBB410B748DAA5873A06269BC6746CDA5 Ap#:/
12,424,405 *0151A84AE26AD7A82DFC7A5B6514FC64127C34E4 }=aP
12,424,406 *015EEE8DCB6B0EC7DDAE916E10F1A026BA48698E a?&P
12,424,407 *015AD5E1A9D33499398C315904E3C3BF9B811A8E AP-.0
12,424,408 *015C389E9B469F8EEDED10EADF8430FE702B7AFF Ap02P
12,424,409 *0151D8CF4C8B069C6B0C6596FC7051424AFC78B4 AP06M
12,424,410 *015FAA8AE5BDBBD4EF91E4D2C6F720BB83FBAD00 AP0L0G!Z3S
12,424,411 *01512F6C1AA1C3F88A91F66D80C754F1625D2C84 A/p0r
12,424,412 *01504D63EFBEF159A40270D2B77B56598CBAD0C7 AP1=
12,424,413 *0152BF30FBEB9603235CEEEC68EE1E5519CC9E29 Ap10=
12,424,414 *0157DD22D137210756D76673D37738631AD4CDB6 AP1326
12,424,415 *015F97DB531E9E75830A036851D9B99A014D2BDA AP1Eu
12,424,416 *01501CB37810105314B8728000038B8092A7187D Ap#1p
12,424,417 *01530AE0EFF059726741355E25D0DF540981151D ap1ra7e
12,424,418 *0150E1712712BB28A72A2DD538FF1326D22C73AD A&p27
12,424,419 *01552974E3441DDE89077EAF2B2322328AF8D382 Ap27T
12,424,420 *015846AE4AEEBDC16D93CB16E6430DBA3BC7E9A2 A&P3?
12,424,421 *015DFDB83D3A82F1CF9F14E79AFB9CDD0289E879 ap3504850
12,424,422 *015FAF71ECE67F576FEDD9655FEBDD2E081F7F7F Ap3mC
12,424,423 *015F0C67458BEF03AFD415D99D07AA1279A34863 Ap3pT
12,424,424 *015885F5F7F105BB1BD511B272A5312BA2AC6D88 Ap$44
12,424,425 *01575596A449DD227CB6F5AF91C6540BA5CCDDD0 Ap4Aj
12,424,426 *01592F0C13B79D549F08891C7F7F983074246849 AP4kQ
12,424,427 *015B23AD7DD5584D01E5B2F3D20978768079AFE6 AP4Q$
12,424,428 *015FA1AD21552E7EAA32F22F243CCB6267D43262 AP4r=
12,424,429 *015A0B3DE9B4B83D5AE97F2F600B785B116ABB92 Ap4r
12,424,430 *01541B8A2A738A0C7E35B5F4DB40EC651566CE4F AP4v=
12,424,431 *0152B00A2237501A366D5ABEF035277FA1419395 AP_5?
12,424,432 *015174AD19A159A3D7E8A65F34FEC3F04102B035 A!p51
12,424,433 *015DC51D266FF0C47CFA7DAD0B985B015B3EF82B AP5dGTtMC
12,424,434 *0157D0D1BA8C99407CDB6BC212CC1551787B1C33 AP5.h
12,424,435 *0158676994051489DD11AD03DA1BF81884C2EBFE AP+5i
12,424,436 *015599E188273BD6B8F692A659F6A3B367A0F9E8 AP5S#
12,424,437 *0151BA6317B5DE8E42E714D75431238326AF5A64 Ap5VV
12,424,438 *0157F0E91A4F64768F03FD554267123145B1C8F3 Ap5X$
12,424,439 *015A96274FD3FD74619F440A960CBFEB32A3A65A AP5XA
12,424,440 *0153B8CDFB8EF3B2CC95D106953E83E5CD77F24B A:p6$
12,424,441 *0157A0DDAC31B6A4D4ABDF9BA949C9B2C59CDA57 Ap6RG
12,424,442 *0156CDE5E809AD75C25836325742923F1C34CBF5 A;p70
12,424,443 *015D639EE8A5FC6CD86DD4DBD9B8C5FDB56E9B63 A(p77
12,424,444 *0157F36B3D63FDC060149B2CA1D0097FDBFE32A5 Ap7fD
12,424,445 *0159BC586F719DB2D07F8DF1D6D84DBB6CBB73C7 Ap7PL
12,424,446 *015260AED1BE94E6F3976BB0F41378F0A1F1199B Ap7rc
12,424,447 *01599146B3FC5352C9BD04C113D1013E9A2B0190 Ap7tt
12,424,448 *0159D6B797645E555E1F54837EF0D0C305480546 A"P8%
12,424,449 *015DA0D5EC92CAC575E64FDD04202376DA467379 AP?#8
12,424,450 *015929768DC38C760E37B0AE149AA28C44945CF6 AP;8M
12,424,451 *015FB5B2F1A018EE811B689546B5875B0E5FE0DE Ap8r)
12,424,452 *015CFB280FE7F013AA7D62B445EA9BA31F0A9E98 A?P9$
12,424,453 *0158F28D5CBEFE46167A9FAC8676CB14192ADD68 A.P9?
12,424,454 *015A9C2103D2BC442A2411381CE3E51F7E1D183B AP=9/
12,424,455 *015E3FACEDFA531109D10B1E9F6E427A70DEBF87 Ap9#;
12,424,456 *01512F47A57E63AC0014FECBFCF858F1E8CA6A66 Ap91o
12,424,457 *0151F1A9007E0FAB667FE64AC3E03A7937058DFB AP9dP
12,424,458 *01528C64EE5EEAA33C57EC369CB979C1ED6EE470 AP9;f
12,424,459 *0155C468DE368A0E0D789DACCB07195703455140 Ap9G?
12,424,460 *01565C2A8C9D2B95BC7DAC54AD0D356AEA67C5AB Ap9W.
12,424,461 *0157CCED45B62344B276BE9DDF5E87421668A399 AP_A
12,424,462 *0156C9FC0A778958115219CB5BEDCBC643E65F0D APA2H
12,424,463 *015EC0975B88D8C2885836108B9DB356F68490D3 APaAv
12,424,464 *015EE90CA65909A1CB2A0D01BAF767E9B18653DE apaccolips
12,424,465 *015CE635EA1D20223819F0B4AFBD9C970AEE899B APACHECREEK-CRUZVILLE
12,424,466 *015F67AD054ACCD9099B4F69C2FF7C6ED5D75259 Apacidnahed
12,424,467 *0150B4BC5C707D6FEF10EB84F5A5129235E54EAD Apaciguamos
12,424,468 *015950812749F5E733BF3A91714835519B491250 apaetoday.blogspot.comapaetoday
12,424,469 *015D59B29C7457056089C75DF1D0B5BD43C5EFBB AP,aF
12,424,470 *015CDC750EEB47357C5A0F8FF37879C9A4F754A9 apaise.
12,424,471 *015B7E88D10B42CC555B69B679293ED291DB3741 Apaisour9
12,424,472 *015D594DA807F9586AF44A5C2A3B54C9BC3D8F55 apájának
12,424,473 *0151B81F19461EE8A31E062CD62AE804B7B6B153 Apakvaanis
12,424,474 *01546CBA10D750AB47B883D226848C268812613E A&PAl
12,424,475 *0157834581460EC136DB9C45941294D73DFEFF43 Apalapaling
12,424,476 *015C73E3F9B7E3453D2BE5510378426E3CB0EDA5 apalpar9
12,424,477 *015C1E68CDEDB196848A4496F6FD69B22BB79F85 ApAM4
12,424,478 *0156717C291611C7B12C68476C54DFFBBD4D6641 Apamoiwa
12,424,479 *01526033F096250AB8F3D6B410146A520176E726 Apán
12,424,480 *015FC79117E6F92446C4207007AD07B8DC702BC2 Apanagens9
12,424,481 *015D91A74FF59037C059AA028CE261BB09F9AB91 Apanages8
12,424,482 *015B30010E2268594BBD665FEA6DA74291DC3EB9 apanaJ
12,424,483 *0150117806926898475C38B6BBCE55A3B3B08626 [email protected]
12,424,484 *0152724A2213680F75755868D08A7BECCE36BF3E Aparatosa8
12,424,485 *0155CC808C815D41083BCB3C5F132AC1E8F0F107 aparelhloei1234
12,424,486 *015D538792B62E16C4FEC1ED5321EE7A5DCDC305 Apariu
12,424,487 *0150BB9EEDD82A396EDBE089EEF414C559ECDF98 aparnaarun
12,424,488 *01556895DBB5978218F70233923238A47FEF3AE5 apart.historian
12,424,489 *0157E9F1A7A882C4E907B309A9137ED37292D63F apartyto0
12,424,490 *01558AAC74203B3F38217594AF3A3BD03D8E57A0 Ap%as
12,424,491 *015E9D2584D7C6B6718BAB14D780E9E158D9302C apassionforjaywalking.wordpress.comapassionforjaywalking
12,424,492 *0154E96933FAAF7F555573CFA4DEA2DB0D9B381F apathlibbing
12,424,493 *015A6830A2F20C5BD81711FE3B5C3D81168070FE Apathy》、《Tyrant》等作品,如同
12,424,494 *01593037A5231798B03C672481223D53678660A9 APATICOEL
12,424,495 *015BA0480F6140BA82D06F033221632BAD0CB310 apatifloemos
12,424,496 *015AE76BB655D848666347599257418BD9A34A38 Apatitin8
12,424,497 *01521FBCD1FA6534A137014148C24DDF0BFF7566 a patriot's songbook
12,424,498 *015C6EADF6744FADF578D342E96013D96C56E6B4 apatrulhe
12,424,499 *0151AC61B0872BEDDAEDC48207CC46445CEBAAF6 Apatyaaed
12,424,500 *015BACCEDACF8E34C5288FD2568A7868324EDE67 APAVAADAH
12,424,501 *015206F1742BB055DFD5581A4B44E94F95A3FB58 [email protected]
12,424,502 *01563FA2C6FC7BC600240828CC6D9E0C753C5DE0 apaxepia
12,424,503 *015C5B9221745B639EAB39CD20B109EA7AF1D00D AP(aY
12,424,504 *0154DB06A99D4595B55B23DFBC1BC49ECDA58A9B Apayere6
12,424,505 *0155537DE47B409BBA9D34CE1B0533C192A0EB4A APAZIGUARDES
12,424,506 *0154F747535C396D06944277AB5CBDCABA739880 apa格式摘要(pdf)
12,424,507 *015D226D1521DB49D144516C6F92EF4EE4C99675 A=$PB
12,424,508 *0155CC8D8B61E6F09BC2CF878F9B9C70D74F82B9 AP"+b
12,424,509 *015B641311B5967F2DEB42B2DD20C80672EBD6E1 A:pb
12,424,510 *015EAD0D41B422771C97416B64657356C9052C40 Apb/!
12,424,511 *0151CAB3D3B2608863D37BFC64C4BE69815E227D Apb4v
12,424,512 *015122F02DEFD7D207E4B42D13A9EC95E8C44AB9 Apb8L
12,424,513 *0156AEB76D510D3690DFCE49EA4336995FECD515 ApB#D
12,424,514 *0156D550531BA7C5275F6D1F612B8C2C1C36B51B ApB%F
12,424,515 *0153E8A5FE8885440F6C5FF6F4D47D1CB1903AD2 Apb?R
12,424,516 *0151B538600587148A89E3D76417F229198D038A APb-t
12,424,517 *015A45899817BAD3D765C85E1C12C29803ED1CFD APB:X
12,424,518 *0150C4FA823129BE9D029E7F356F3E4421C75B15 A_P$C
12,424,519 *015C8AD3D2161FE39C6C268CE7E87FA0FD50A3DD APCFV
12,424,520 *0153023A72E991B76DE81158D140299D61424040 [email protected]
12,424,521 *015F28CC66A7A6D9047B88166595E6CFE67FB020 apcigar
12,424,522 *0151A1F6F34F6F225790C1C8C9FF14786DE60EBE [email protected]
12,424,523 *015C42DDC33B85C518779E5B2F064E8D21640158 APCP&
12,424,524 *015C2B1A2BA5525CB63EB5FB6C453F00C4196D59 A.Pcr
12,424,525 *015E069941E28A55A9F917D5FA08C40F9983904A APcrA
12,424,526 *015283DFDD7596800A98559F8978E0D00CDD9675 ApCw9
12,424,527 *0156FCEBCA28FB360A0518B5BC80BC7CFED4582F ApCWt
12,424,528 *015335DCCDEEC9EF72629E30E9200EE2597CE222 APD:;
12,424,529 *0150665BE9806325292D01F0079063F3FF492D38 APD)"
12,424,530 *0153057C8F85109B7A0F9DA0DF78142C9676C304 AP
12,424,531 *015CB36FCA9B8824C1997BE893442C2E7A718D11 A?pd:
12,424,532 *0153B143FD7EC767C4FE63918C4604A2E74F9BE9 APD8p
12,424,533 *015A2A822733A91D32C1E4361EDAF10C7E4363B1 ApdA0
12,424,534 *015325AE82C709EE04A55FC008D7176F126740B5 APDEV
12,424,535 *015D26C0F88E1DD24290998AD473D7297D788346 APDH,
12,424,536 *015F36F74047861DBB86D3DDD575568761A0642B APDH1
12,424,537 *015BFF5C0C19DA32A1DBF77796EB44A84192FFA6 APDmw
12,424,538 *01591B2B2001E6F239F237C384E398439E2D01A0 ApdNR
12,424,539 *015CE7A0C3CD47A7AF298C0F313D976A41925F10 Apd_T
12,424,540 *015C63D2DB235955ABF0EDDB13CA86D603CF1F60 A)PDw
12,424,541 *0154916E5947C4DBCD27BE794B600260C44AA48E A"P:E
12,424,542 *015C0CE084D2BA2207FDDC98734E0DAB51075569 AP"E-
12,424,543 *015FF016D0630F657719E7F535C5F68A29BE17DC A-pE-
12,424,544 *015D95517F293109FD16C235DB50D612161F2A72 Ape?0
12,424,545 *015B4264261717990B68D10BC8053FA3E024E9B4 AP)E4
12,424,546 *0158EFDE1841A7B6A8137FAA1819B4DE005C3EEB ApE4E
12,424,547 *015C0A78446EC21944A65D57592CFB21C78961EC Apearon
12,424,548 *015A38DDC47B421BBB0EF62DBA2418BAA3C1F80A apeciti
12,424,549 *015D1774FCABF1C1FFD44C844D76C12D4F61D867 APEd=
12,424,550 *015AFA957E350A31DDDBFFC08AF12AAA4D35441A apedazar3
12,424,551 *0156F68ED75B6D48D1700110CD53FD3705A1CECC Apegaran
12,424,552 *01511CA09049D5411617CA8FC6571D61EC6951AF apeilhs9
12,424,553 *0152CEC2480187C0D9BB3A0AF1EEC0DE88539977 apektem
12,424,554 *0152EE6C6349A79993DBA350027D85392321F1C9 Ape,L
12,424,555 *015C599A5DDDBB8F1C7B714910ED4BEFAFD8BC6B APELDOORN88
12,424,556 *015130F43A113C46F66BB8C798AAEDB9EBB5A5B6 «Åpenbaringsdag»
12,424,557 *015990981739C2206DD7C1248A83DCBFB6B68630 Apeneima0
12,424,558 *015ECDA926F17E1E0BB080251CCC60B9427986A7 apepq
12,424,559 *0155B7EB33DA72501EB9DB4BC7CBFE9E253CD233 APEr=
12,424,560 *01589440D524D2399772ADAD8A966406B8966C65 Apercsid6
12,424,561 *015FA8E42C00A9043C887B4F3984CC5EEC9504D9 aperfilhe1234
12,424,562 *015F0514A772AE583401981EB4771B177C374E10 aperrear0
12,424,563 *0159BD67864D5244D0C5D942BA10A406D9BA6F06 Aperripsa9
12,424,564 *01575D859FA98E48CDC3A5218B5EA973202E8339 apesaje1234
12,424,565 *015EEC745959BD8B182F2DAC669FA1F33E4553DC apesgar2
12,424,566 *0151DB688E4F323F1EA4056F951947167FB5F637 apesthes9
12,424,567 *015A88BA3ECB382F91FDA852EA14C9BFC8F1DB1A apetinch
12,424,568 *015BFB225D530DD1CC8E89F8AB1D7900A77B68AA apetrea4
12,424,569 *0156F3B871AEE79F9498B911926DBC324EFF1A8A apetrechreis
12,424,570 *015566A8C767D0580BCA15D316E926670E6B3A33 APE?Z
12,424,571 *015CCD458CB0A11ACC83D93013EFBAD2733EA384 A;pF)
12,424,572 *0153757B16C38865FCAC1646A3A51222CEC8FABB A$p/F
12,424,573 *015625F8EA01507748EB4A851800A06BB897F49F A%p$F
12,424,574 *01555A69D4D3D8AE4F144C71065A361F81DAE356 Ap#&F
12,424,575 *0150D6EA504A9875CD274CCCF796CAA182D08D8E Ap+-F
12,424,576 *0153B882992AD4F8D70A928AC990204AE75135E0 A_-pf
12,424,577 *0159B68F92CBE5249EFFFCE2A027208F12596CA7 ApF8b
12,424,578 *01529F88149E25D7F0250F4BE2E514CD9C945238 ApFA!
12,424,579 *01558F173F73F90938E4AE42384AFE8AD4C2BD71 APFff
12,424,580 *01551FE95F221BBC645EF0181B07C8CC30048A1E [email protected]
12,424,581 *01574A15C1214B9244D72DAE0C7680B0209956EE ApfGd
12,424,582 *015596503F880068635C8EE63B77501F8F7996F2 apfixqwaldke
12,424,583 *0157F297B1DBC8BD792FF5D06913BE407DDCA26A ApFj7
12,424,584 *015412FE0B09B88902E12D0381B6E47AE12671CF APFkn
12,424,585 *015217DBA449765C29CA831B201897CF425D7639 APf)M
12,424,586 *015267B7E971A7C8DBACE197955EC46C8AF0D39F APfSl
12,424,587 *015E5166249F1AFC5BAB2777DBFAC1C8DABA2F88 ApFsX
12,424,588 *015F5103ADA34039016C0836A1591A111A5357F2 apfve
12,424,589 *01570F9D44736C155C1E6A5A8FB7BDA93A28C4B6 APFX%
12,424,590 *015E2CE7A3519624FA16850C229C43723E9E9CCB A"P_G
12,424,591 *015D7E471691FC268791E690C91F0969F1B91E49 ApG)%
12,424,592 *01543A8573167DEF8FF94641BDA38A5C6E2C58E6 AP)ga
12,424,593 *015F96E3FE151CC51F1157D6BE9F96BBB5652EFD A(pGA
12,424,594 *015475495A769A1A85BE3C8EFFD6C8FC5D25DAF3 ApG
12,424,595 *0155CD685EF154DDD69279D5CFE71F1A64C0FBE8 APggo
12,424,596 *015BBB6796064C9B9A2306427C978376CF961B91 ApGmn
12,424,597 *015C5B7DBB2C44B8B7817605CAE3F5A791E2052C APgnD
12,424,598 *0159EA2FBBEA4D481E83F9796C5B8FF12946463E APgoo
12,424,599 *015CD3DACCAC3550E0606F0D6063A7C4FB2BDA55 ApG!q
12,424,600 *015046AF4AF1ED67219276EDFF9F032853A47849 ApgQO
12,424,601 *01546FF8BA797DA2A19DCA2C52260F52A36A2B00 ApgRR
12,424,602 *0153E260957E6839B19F32ECE6B25E92C7327CD4 A!#ph
12,424,603 *01585C1F5DBA249841FF76BF73E20BF74D6EE178 Aph
12,424,604 *01581E10AF96A1786DA5A8E3315EA32FADA5A908 ApHcC
12,424,605 *0154F8DBEED01CAAA042C4837A617706DF913552 AphD3
12,424,606 *015FFBC5292D8D0DC5D0F3D96C70AA55A1381E0A APHELIOTROPISM6
12,424,607 *015207D704AAE4A5500E48F0C9B677976DCCA476 aphgj2pidk
12,424,608 *015D5C4CAC0D57E5C75AD166DD235FCF18909074 aphidicolous?
12,424,609 *0154F26DB35467BAC9611C28F9B8248608063033 Aph"m
12,424,610 *01517730F972A153C75B65CF1979331DDBE314DA APhmW
12,424,611 *01544A4E904A699A6901B30879BB9E1F74635F8A APHODIUSES
12,424,612 *015700EE0C4387886A65A83236F1CD2C063E1418 aphorise7
12,424,613 *015D461EE7DDFFB5538C5278EE756552E8B91726 aphorismuos
12,424,614 *01561CE05DDC44B346A66FB73F1379EEA1E976CD APHTEN1
12,424,615 *015A3B47733D1DB4E115673C9A2B0D72124D12E7 Ap)Hu
12,424,616 *015C2EB853ED857CF9940C8541BCA384BC87120D A)-PI
12,424,617 *015E545919C9190F1EF1F34679F8FA48B047E68E AP+I
12,424,618 *015ECC4FD3C047FA1ECDEFB50A32F213ACA19D2D APi?#
12,424,619 *015AD40FD4B7587F23FD7F6F5C78849DC718BD6C A:p$i
12,424,620 *01537C379C256F89D83099912760EA87D3F32F1C Api+0
12,424,621 *0152C4A378CA012265021E0CC43956E36DEB9F7A Api2v
12,424,622 *015A06C88515268E3BF8D054EF9D9D702F3C6D67 ApI8i
12,424,623 *0158B364E626173280586A02337C79593B3C35E7 APi)A
12,424,624 *01546C31017E5B6D9800694F05F990CF2274257E apiakama
12,424,625 *015DFA04AE93F952E960BAC6AE71477A2FC07592 APib7
12,424,626 *015B85A0C6FF54516991639720A93D437205BE33 APICALS2
12,424,627 *015057E909C4F1425842D108943D042EA6B75118 Apician3
12,424,628 *015B7CAD2AFE234B101776BE8298C6F6E66DA8C7 APICULAR6
12,424,629 *01555475E660D391DF35F693478A70889F90D57A [email protected]
12,424,630 *0159BC93C7116577E8562423DE515B5A909DDB49 Apidgian2
12,424,631 *015DB1208D37CF221FDA9DA00289994C1FDFDD40 ApIel
12,424,632 *015DB1A71C96300EEB51525698E4FF029F54399C Apikkaat7
12,424,633 *01586225C7F789CB3F65D520C363269086B2D4EE apilhlo
12,424,634 *0153124ED40EFBC0D4DC1EC54151794E1153F264 A Pinch Of Distraction
12,424,635 *0157D9084180336719B9067029976F911F519E23 apingentarei1
12,424,636 *0151165708A57C41BE0ED977EE5AC35A2A9682EE apinhoreis1
12,424,637 *01523FB78DE1EB1192DF1BF2652A074596273CF0 ApiP1
12,424,638 *015FA7C0ECD66461428C075123A3736E26F534ED APip7
12,424,639 *0151758D884742AE21C23D4AC8F419DC938CEE16 Apipebsw2
12,424,640 *0158608DCF56B1337773D6847B7A6DF57141C3C3 APIR)
12,424,641 *01574C639F2C48C597B918C46815B001917DA823 Apirafdee9
12,424,642 *01590A47A2FF34222C42C7A152B9AFFD9714E20B apirokalia
12,424,643 *01535A648077895C7DA2EE4015FF0EEB07DEAA5F apis3
12,424,644 *015A9D7515E92348FA4BCCB49B3142ED053F6A43 Apisteyth6
12,424,645 *015AEB03064DC5AB31FBE07517986B8097344A37 Apistoloricaria
12,424,646 *0155F9EA6C3B594104D72E40B89147ACED3F3B2C apitoyaient1234
12,424,647 *0157ADA5D5901571FE9CF1E32D9680EB4BB14076 ApiX3
12,424,648 *015DDAC2561EE0A7657F7AFA9041837DE4051854 ApIXs
12,424,649 *015A5021AADCA1A73B60A2B1E82FD1171474A2C7 APj#!
12,424,650 *01572B18EB8A59F69D1C4BA953A80F203913A94B Apj/?
12,424,651 *0152B66B9DFFB845F9357B185D296AB4E3C3A7B8 APJ3MJIWDSJ
12,424,652 *01593F3D6B6389D2C435857AA48644C6130A67AE APj6P
12,424,653 *01570CFF1878FE4677E8BF17FE91FB8DE83AD306 Apjb?
12,424,654 *015E70A7DA2D3D73C1EFEB0CDCCC6BF3D8397590 APjdE
12,424,655 *015BA4EC91DB27F11071B98F16254CFFFDA265EE APjMq
12,424,656 *01508EDEA7433BEBA690BB94DE0A36F483A55993 APjQd
12,424,657 *015221960AE2F35DD40872CA9E2E6023F408E132 ApjTR
12,424,658 *015E0AC4FE6C7B20E42A03CF7D14C3C0B9288534 A;PK(
12,424,659 *015DDA180A663C6EBFFD4192885723DA8FD467B7 AP&=K
12,424,660 *0158EFC9AD4DFC7953E331CB8E2DB0B3C5E92A90 AP.;k
12,424,661 *015B23AD99061B59736FFE588273C3B261DB1701 ApK3D
12,424,662 *015AFC86BF49C94F8FC5562B1511DE2D85E78A95 Apkaltinamuoju
12,424,663 *015FCF49F98E397A1FE87264DB0B9B17D0CF95A7 A+pKb
12,424,664 *01536E477648FCF3AD4F04D0FDBB1E4657ECD48C A?pkb
12,424,665 *015D9428D314FBB42509162BAF3C61628D4ECD61 APkh?
12,424,666 *0154FF7164B7C1FAADC8D13CD80318EDC4F6E8C3 ApK$I
12,424,667 *015526F7B468BEB7FAC9B7E1402BEBB90F55D267 APko0
12,424,668 *0159B09CE78831E9582C281F6658852052681E1C AP"kq
12,424,669 *015104698B738B7FBAED8A977B5B0E89178D3E92 ApK%R
12,424,670 *015C4315E5B59082CB36050F466A20CC4A4DA8B7 APKS
12,424,671 *0150954DFC3AD9E81888474AB12BCAC7C7B1DBCE A_PL/
12,424,672 *0151F3351703670B0B3C902566D026B251762DEA APlaceCalledSomewhere
12,424,673 *01551008AFAF69D49523589B99ACCA5028404511 APLANAR
12,424,674 *015808D958C6A2A6BCC5B5FF80DB6BB0F96FE53E aplanobacter7
12,424,675 *01529963523CBFA09C12747141E281192FD0E51F aplatore
12,424,676 *015F105C81C94A8F5B128BC0925B82A836ABB339 apleidžiamųjų
12,424,677 *01531365BD3C04AFFC068A655496675F873ACB00 ApLEm
12,424,678 *015B54669A23E6A72FD22247A0FA826B64881D9F [email protected]
12,424,679 *015DB064865CDAE83249A502E3DC2D4E90355250 ˈaplezɐn
12,424,680 *01578F8DD91DE55BFBB8F8328FAAB9F923317CBC ApL
12,424,681 *015715684DBBC8186FBFDBDAC7F34866A936D4F5 APLiR
12,424,682 *015DDF5A717C0FE6727E84B964D3B2F25B1BB5F2 AplKA
12,424,683 *015723A2D6AFD0CD0A7626F17CFE7282E88C2F63 AplkL
12,424,684 *01566F7F9B24F898FA935FA93CD4CAB8F6437AC9 AP!LL
12,424,685 *015C14FF5948EF15C1CBCCA6FBCAE44758F1DE69 A#plm
12,424,686 *015B0294237E06F60BD25794979CD1620722EF6F aploinsufficienza
12,424,687 *015648A484827002EC39366360243A3DE739F7CE Aplopoihsei
12,424,688 *0152BF0398154E0DC4B7A22D15E55390D90DC790 A
12,424,689 *015941A9FCCD4D5A5826A8D85D38B28F9AE038FC A?PLT
12,424,690 *015DA2543F04012D861ED5A11A7481707B657E87 ApLuc
12,424,691 *015A9DF5FD6E205F4181F4AA8CF84410AA244AB5 Apl?W
12,424,692 *0157DC9EBE4BBB9EABC3CC24F24014CC0DF427F5 Aplytwn8
12,424,693 *0153203544CD4EFCA5A618DBFB6F6DEEB4D946B5 A=p+m
12,424,694 *01551DBEA60428C88B99753FDDDE535AD7FF07FD Ap?m&
12,424,695 *0157F9B0B3B0C8E316642C3EFA085AE6AFC537CA Apm(1
12,424,696 *0151C2465D5B842D47AA865630B528914DA72B90 APma0
12,424,697 *01587B5EFF834FFB3B9D9457381E4FDD28637868 apmastergreat
12,424,698 *0159FE920AF9C048B5642B51BE35D7588E784E82 APMC"
12,424,699 *0155BA8C29F553993418EF2277B4F62802A42846 apmfebpvd
12,424,700 *015631EC8EBC7EBE174C5878AB663C71E21915E6 ApmG_
12,424,701 *0156900BAB9E438331B7ED82DBE38E1E75EDD13C Apmgl
12,424,702 *01550A5BD22F66A5C4BCE549C769FFD0CF70E5B1 APMli
12,424,703 *0158031258C8CF059D91EBB2F3F39EEF108C5712 APmn5
12,424,704 *015244B4BB03AF4F37FC4FC6925EFD63234F2288 ApmQN
12,424,705 *015F1958177EB2FD42A1EA73153CCA73F46438FE apmrz
12,424,706 *015A025F7B20880769B2552F3DCE0133086CD963 ApmSD
12,424,707 *01509036815076D53CAF7A47A60B041BB3DFB0EC ApmSn
12,424,708 *01579B340D61FA0892D524FF4A0893B96F9474FC Apmsn
12,424,709 *01596F1FB80869BA8AECBF73A2D80A31681DC675 ApN2;
12,424,710 *015EC77093425F0A0514C8FD6A7D9E4F8EA728E3 AP:N4
12,424,711 *0150EAEA3332A4DCFA8E51A78E16B92F10C6425E APN,A
12,424,712 *015216ACD9FF344382FD9E577C70C4E809B6AB5F ApnaY
12,424,713 *015879245126768ECB0DAB3D834A76C3B8376BAC [email protected]
12,424,714 *0154FDC959ADF9A8C4D26BC86BF45A13F145FB2B AP"O)
12,424,715 *0150728DDB82273B49F24B37551F69DF8BC60CDB AP+O$
12,424,716 *015AB973DCD5A9B93893CD25FA4192D3461DA7EE A)pO$
12,424,717 *0150439552F1FAF5433A17CDC39AC2F404B31531 ApO(#
12,424,718 *015F47CE9C003164C9963C0534AC6F62C1E310C6 APO$71E$H1P
12,424,719 *0157E1FF337D9ABDEDA18A470518CD73546E7134 APOASTRON
12,424,720 *0159D53BB436742106AC4ACD4F671E6BD3C04C78 apocalyptically3
12,424,721 *015498D056A9949BC2B4CF51CB144E14287FD692 Apociterion
12,424,722 *015945A7855B978FC2ACDCFE49C3A3058F8D8B26 apocryphon:electroroots1982-1985(disc2:prophetswithouthonor)
12,424,723 *015C946081D101CF4EF7872F5D9131F6DDA4C74C Apo)d
12,424,724 *015BB038B43CAB92E5690DC862C05B8195DC8F82 Apodarafed
12,424,725 *015E65D4A942E5991D80226D759B5405DF6DB3B0 APODENTINODIA
12,424,726 *0156253B7A7A7B44AB16CCEF24448F9E229D533D apodhale
12,424,727 *0159F414644F58B02D6D8948CC2A983B78FC3FF8 Apofoitoi1
12,424,728 *0156141B2EFBBDD4CC548F3ED1CA3C63F81C66B2 ApOgS
12,424,729 *015A1FA57BD399AF06DAF5029FB04F73515C49C9 APOjC
12,424,730 *0154FF04398EFF87BA819F2771DC2FC8C6C4E42F apokbsws
12,424,731 *0157735664F70D3DA98D534DE41125DA8A220801 Apokrhmnh6
12,424,732 *01537C309A88C8C866155FDA7BFDA64784A87C78 apokry
12,424,733 *01569303E8FB54BE9E34A9629015E207D5217195 Apokthsei5
12,424,734 *015FB6C5C8D0C70741E067FC1F7FC21F2C501343 Apolhgoyn
12,424,735 *0151399333F9E53859C7B95E19EC0E46FFDA606E apolhpsh1
12,424,736 *015FC0F123EC1FA3DDA781D93E610F33986D6BF6 Apolinárovi
12,424,737 *0152DCE08AE9E5BFD0B9934E8D08F63D0A6CD8BB apolipoprotein_e
12,424,738 *015828B600622C85ACBF6961919CBB36847446A5 apolline1
12,424,739 *01570B0673414F565681D2AAD48429D128876F75 Apollinee6
12,424,740 *0156A8B1D49F4959F1B9144A75F2F4EEAFB7DE3F APOLLO13BRIDGE
12,424,741 *0154D2ACDA72FBBA322765BDC040178780974615 apollobooks
12,424,742 *015021E9245B02A542570BBED3C516C7AF843EBE Apolloniosstelle
12,424,743 *01571825B6416CBC81BC9CC43C1FF4EF3AB5653B Apolloniusnak
12,424,744 *015A6CE3AE5F6AC50221769AC2781B9F86C65EEA APOLONIA27
12,424,745 *015B58D3662889977081E10DA1CCD99EF364AC0F apolo's
12,424,746 *015226CC1ABB5D0CBF0D478B885686164895C67E apolu.bbs
12,424,747 *0154EAB846FA5089484445AE48D9C166F1DA67F9 Apolytoners
12,424,748 *015F5662C6ADF5F48882EAA5C3ED6CD009563CFC apopescu08
12,424,749 *015A67E179E59A08E5C72B3AF799D17A2784DED0 apophlegmatic4
12,424,750 *0159621A8B080DAA9C9404E8308C4467ED0B3084 Aporetica3
12,424,751 *01567C424B5235E55249C96228D3ED674B63DD06 APornography
12,424,752 *015E964DEF43C2D837E8B86C281785525F45F20B aportuguesveis123
12,424,753 *01556E41888BD9B71393EB1DEC708F362DC32D11 aposimbiotske
12,424,754 *015435F1FFBECFB22D217043D64822B35A555598 Apostaban3
12,424,755 *01595B5ABDD468DC539AD459C96A4C1C19DC70CA APOSTACIES
12,424,756 *015689FC99E5CEE0FA8E11CBF843BDEDA3A52B98 Apostlising
12,424,757 *01528CD4D089ECFEF532DC888FC66CBFCA52FC04 APOSTOL''-CLASS
12,424,758 *015B73CA60404BD18D19B9F31BAE0E0654E68A29 APOSTOLESS
12,424,759 *0151118F2189D9C253C6E108AB2C1A4804D700E7 apostrofándoles
12,424,760 *0155B59FF3640914864D47BB96B6766DD7F06572 Apostrophise6
12,424,761 *015ECFE253209CC6CA7A245969A0C93EAED19F4D APOTEKERDISCIPEL
12,424,762 *015BCF34447409F03185772491F9D067A869CB60 Apotelesm4
12,424,763 *015A5B39291606263C92A20FE87D0E7FFBBA6220 apothegm1
12,424,764 *015D17BD212C1BD943B31A8A899C83CBEA468933 apothekerssassistente
12,424,765 *0150DC006B76ACC801C2977782B3BD43246BB9A1 apotroph5
12,424,766 *0157201A2751DF63E1BCCF77AFB58565C64C7A4E APOTYPWSW
12,424,767 *015B49D54DE47CDFEE24ACB32D43BC07EF8FA90E APOV.
12,424,768 *015F0EE37CDC4A3E7CC2E97ACFBED0DEB4265F4B APOw,
12,424,769 *015E86876DABE0C056E5BC31B13F61A154DEC124 apoyshs7
12,424,770 *015210DFF8DAB218DBC4DF9FA9AF80FAE1550640 App.&
12,424,771 *01572524AD76109135FAAA42FD20AB562E008F5B app0gg1an0
12,424,772 *015F2BF7BDF62F39F7C476EC3AA622E3C740A0BC appacci-anthology
12,424,773 *015F853DD529D2BF7F36B6B1D55E0EC3F49631B0 Appalrev5
12,424,774 *01561D253193F4AEC784F58AB92A2B611590B7E9 Apparanetly
12,424,775 *01521D9550B8BFF26A8034D86BD1FE6889579A8D apparelsing
12,424,776 *0159D1EFC3FEF83AE7048AADF532D5A92D8C8B00 Apparenteer2
12,424,777 *0157DE26C660AC69731C76A6463F039D4A05DCCB APPARIEES8
12,424,778 *01515DB578FDE35B1CCDE41ED7645A298EFB29E2 Appariers7
12,424,779 *0151D0F86CBE7C21502B1D2DEC59FDA8474DE3EA appartegneva
12,424,780 *015BB6C84FCE0F9A804C42632927918A60E5D259 appartsi
12,424,781 *015679A7B3C989CE37DFF9F001B0D3322452A550 ApPb)
12,424,782 *015877ABD4644A290B3E658D6BF980148A1CDD6F AppB0
12,424,783 *01544D8523F029CB8E1D0AD122CD222D20D14AD7 ApP%D
12,424,784 *0152D126263DA270480422D286528DE6E53696E7 [email protected]
12,424,785 *015DCFA5C32D21DFF7FEC83F67D5A40DB822494D APPE11AT1ONS
12,424,786 *015FFDA68535760A321A0C063A4B0282546E74BE appe4rz
12,424,787 *015ABC7CF8C2662D5BE030A1746E74C535F8FCE5 appeals105
12,424,788 *015897F6B0CBCECBE9395EF101626279FA86BD5A Appele?
12,424,789 *015D020F10B2139B237596EF1FB96DFD712F0366 APPELLERIONS6
12,424,790 *015937F53A4729DBB356BAF61D48614CDD8A596E APPELTJE!
12,424,791 *015319D54567B2D5774ED45FF395D1A194E70F8E appenare2
12,424,792 *015AB202CF14C8394C43F6BECD9069EA36B6FAA3 Appendicectomy1
12,424,793 *015F6534813BE9D6557793F507E47C81476401E9 Appendicite
12,424,794 *0150C1FDD0B055416184F15BF45EBDA34EA24175 AppenzellCattleDog2005
12,424,795 *0157EBAA3053FD6529E1CD04E17486540CD715D2 Apperaing7
12,424,796 *015C469EFF1642E1B46408AB015506E472A9F563 APPESANTIMENTO
12,424,797 *015CC92A3B8A04E8C3F4E5F54788164C60E50135 APPESANTIRAIS
12,424,798 *0159BD82FE29E15A3515B5BC5B0D69C81A39717D appestassi0
12,424,799 *015FA8B59B96BE3C3A644BFE5979766660A2146C appetitefordestructi
12,424,800 *01585F83E8957FFFD459B1C7A38E78E1255498B6 APpIq
12,424,801 *015E5E6B74DF55EA7FB1CFF75340638622BA3AF4 Appirakkavil
12,424,802 *015A9985538BDF335DA27C787275FB69DD08EADE appistkoi
12,424,803 *015CB38DEFA56E18C294E16046AE1378C54FFE86 APPLAUDIREZ?
12,424,804 *0152B7D64EE18BEAD9A85F940EE2A76292DB308F APPLE1FRANCOIS
12,424,805 *015DF8BA9A13C8BA00B954C2F73EF87E260BC7D9 APPLE1PALADIN
12,424,806 *015B5DF8335390FAEE774494E7C221E27C59C43F APPLE512
12,424,807 *0151A7A5EA1B78A73205EA347EDB4E0E9DC1528E APPLEBEATLES
12,424,808 *015343D2960199EF807F2DE6F9C7F42BA6B898FE APPLECITRUS
12,424,809 *015549A931D811DFA402280B4BC3FAD46784CA83 APPLED0
12,424,810 *0152821BAE7542B49B4A28CC51DFAD733FC71CBD Apple Girl
12,424,811 *01591C2D84EB1EC2A3C9D3BBA84CA3A1B951DE37 Applepie71
12,424,812 *015297934D6F4DA3EE99EB06EE207B73793B1855 [email protected]
12,424,813 *0154C65E5350A6A170E9B1AC5B02CED80584D0B3 appleses0
12,424,814 *01510CE4B04ABF02883B8D22084478C54E356F13 APPLICABLES7
12,424,815 *01529518BB19F91436312478F984070888EFBC47 Application2
12,424,816 *015D7FBE863E7948471448FE148A5FDE5E433C2F applicationshow
12,424,817 *015AFD0F0B588FFE60AC67DDCFD58EF41823E0BF [email protected]
12,424,818 *0150C6F35024B6D42F883B84B07A4737401E0C23 Appliconing
12,424,819 *015F1A0C3013F67E919847D802BE7728F1DB598D applikationsdomäne
12,424,820 *015ACA75240D6A3EC27EA163AB993774113EFCB5 apply.cyberghostface
12,424,821 *015A085C2D08FB83AABA65E0F6267712BA8BBAFF appointa7
12,424,822 *015DE0DBE22AC17731751FBA1DB61E9B30B2B676 Appoppati2
12,424,823 *0155D4AFC9D6B195DBBB26E4962DC975AB3B944B APPORTARE0
12,424,824 *015A6FF66C1F5C7E171A1284E0FE4F824245171A APPORTENT9
12,424,825 *0155D15077D839D891FA239DDBAACB91AD7D1890 Apporterai.
12,424,826 *015C8786A4CAAA2E07DB37B6993D3CB6314B2836 APPORTIONSES
12,424,827 *0152ABBB110D6B478F5B74812E0A05401C550EAD Appositionally?
12,424,828 *015700C736E558380C585A13DC255CC7ABAA8AC1 Appostam6
12,424,829 *015D4FD062A0FB8D7588AEF4E9711408986C1532 Apppia
12,424,830 *015E89150C5621BBAA3880807C110B44B955B3AD [email protected]
12,424,831 *015B412FD99061F5AD6EB276A7CB0A98409F4A61 appréciateurs
12,424,832 *0155F12ABD942AA3338C251C763F5FFBB722EE6F appreciation (tatoom version)
12,424,833 *0154E6562014CEF2F04C6D80216851A1413F8A67 APPREN7ICE5
12,424,834 *01530963FF105D98DEA6F6D9CA88D120FC44C2BA approachmg
12,424,835 *015ACEE2A6C69865233C6AB1684FEA2182A3DB22 approdass1
12,424,836 *015BA1FE4908271461B142D2B21E45A0F3F95CA2 APPRODAVI.
12,424,837 *015AA19C43CB7593ADC27F85E1150256B0255C23 Appronterebbe
12,424,838 *015DA35E20C450C2C1383D21DA2C065980079EF8 appropriately.planet
12,424,839 *0153A1CA82335A7C4E9D6BE4B2A7D7B2F7D5F622 Appropriation$
12,424,840 *015F2FB077DC54DEBCB19E0E973E91F289CCF1F4 APPRORACHED
12,424,841 *0153DFF7D62F521BC1B5A92153D0AF4D02FED425 appsmore
12,424,842 *01592A18CF85E5D7A8DEEE51B59CE27C82B038B5 APptD
12,424,843 *0150F89AC720F0DCDC40385A26D603C581089EB5 Appuakni2
12,424,844 *0155E9ABAFB90763FE5A6CD9FFCB495F2E75C28B appurtenant3
12,424,845 *01544F6CDB3C674356D4239E68CBE041904A91C3 APPUYAIS7
12,424,846 *015F798A3A8519CA7A90EDA5CF9024E5541788B5 APp#v
12,424,847 *01595780B04C25422D80DFCBD7A3C044F8EA66BC Appyppp2
12,424,848 *015AA17A77616AA4CBA40FE9D82A7A6585226AC9 A.P&Q
12,424,849 *0158220A477329B868F6A54869E30CF69E75A6B3 AP-%Q
12,424,850 *015D9A9179AC891CB84A9A3029677D1354D5C44F A)#Pq
12,424,851 *0151B4AA740AFEEFB14933A237161693FF0A313D APQ5
12,424,852 *0157C251E97FCCDCD8039CBE84CD315E73AB3019 Ap.Q7
12,424,853 *015AACE1E454FB079F1F7FC28EEDB5528A864FC3 [email protected]
12,424,854 *015912BD89386F8A2BBE5D40BC8ECB128C1C35D3 apqclaw
12,424,855 *015BF8FFD821ADE6A3A64B889016B82286BD5D61 ApQGC
12,424,856 *01565F4D9F7E2BC7A8922C062485D50A72262EA1 APqIA
12,424,857 *01522CD19035E341EA16F2B5DDC5C8CB779DDF07 A_pqm
12,424,858 *01556465C82625764816CD1DB5983EBAFEFC18A2 AP$QQ
12,424,859 *0154569EE5BAAB58B46072EF4FAE91E1366C03BC APqQ
12,424,860 *015A6C12FC1112D2A0D1AD9067DEDCD8448AE5BB ApqR)
12,424,861 *0158C0F38061FF754D5B731CC2D16C29A9F2D4C1 APQTo
12,424,862 *015898BB3F06B2F17D857A09C3A62577CC3D9D08 A/p!r
12,424,863 *0150A7B57FF32DD2CEA71957587DFBFABF0F3C3D APR112006
12,424,864 *015E7ED6F30C5121A807AA9A537384295E48F048 apr16031602007
12,424,865 *01525A401A8CC5BB1956F2D11A3EADDC9FA5B8B9 APR1804
12,424,866 *0150EF752C0D5C8A4811C4EED78E0470D29B9E84 ApR55
12,424,867 *0152BC4DE5E6BFD1716F0FE2E28A53DE676447B8 aprahamian73
12,424,868 *015F6B92DDBD60572E03779438CC15F8DCC62096 Aprameyo
12,424,869 *015F970F745D6BC777F90D0BB4C4C4B1BB6250A3 Aprashastaih
12,424,870 *01546403367DE16B6F9E88B8E7DC6E180961ACAF APRB7
12,424,871 *01576E7549385E2E70C157CEEC05FB54C86B3456 Apreensao6
12,424,872 *01542D5CE2ADB8F492FF3548E3FD167C28E2D1A8 apresonament
12,424,873 *01577B76AE142F4EDBF2FFF38D27A6CDA75BD758 ApRFF
12,424,874 *01510F459E6ABA401A5D34136CDE1BCF38D4D0A2 APRIL1366
12,424,875 *01583B6B9EDD01725FEE5CF17B4E26DAF45161BC APRIL211990
12,424,876 *015AE6E96CF9D353D75F7D131F33EBB261CF155A april armenta
12,424,877 *015704FE0324E88A33A1655FDA9ABB9CD0858129 aprilc.20
12,424,878 *015D5F6ABBC4C450543A9049597847AB762C615E aprilcollings
12,424,879 *01534C58EBCF7F5BC8AB3B6B3BED6349FB2A6941 april dawn jones
12,424,880 *015D1A6A75C8D30C6AE7061D2AF243F17B6D81EB Aprilee8
12,424,881 *015CC9F5D056CA3F3B8561C41F64E7EAC9B4CB63 Aprilfalcon
12,424,882 *0158E779EC37D41BF9F026C325BB3F58D6B49375 aprilia fitriana
12,424,883 *015AA19C72187A1B938C27C04B12C77392E3AAC6 april loring
12,424,884 *015720AC61BC42EA20A209CA74005D9717A9FFE8 aprilrenea
12,424,885 *0155F7D31C0D9DD38015533F9954D86789C853F0 Aprilruy4
12,424,886 *015DD112F176E9F1E6EFD26F4626CC86DC268071 aprilsouth
12,424,887 *015A514AE5E56947964ADCEE0382A50E2F9A7820 april steiner
12,424,888 *015C5C3818CC47D0BF8DEFD48F29FCB5A0701947 A-PRINCE-BEATS-A-KING-OF-POP
12,424,889 *015085CA087939F27CF91CDE2C9C2951B00220D7 APRIORISTIC0
12,424,890 *0154C086C1302063D7CBB2F0F1E0B5E45759E1C4 Apriporta9
12,424,891 *015F19D8C446474477D144E145EBA5B9D17F1E21 aprirli2
12,424,892 *015A7F41058BFEB42177BFF612B4889EF01C8615 aprivoisee
12,424,893 *0154D0F870703E7D9541B3DD35BFBD11E34794A8 APRIYANTI
12,424,894 *015F1D782A72E62EE073ED94298B5C4560AC8B44 ApR?k
12,424,895 *0153B5EF15A09D80F57940F6541C1A5937934297 APROB
12,424,896 *015F750E040A3CFF9F1CD265A3394E2CE92782B9 Aprobane8
12,424,897 *0152C7970556B0C0EF4548821CE5A11786945C4F aprofundloeis
12,424,898 *015F57D309B39B6334BBB08D01C6E5C0655FC870 APRpK
12,424,899 *0157E4A42FEA5AAC6B5D8FEBDC60280B453EDE53 A
12,424,900 *01555728F6138B71FFD2FED44DB0161621D092F8 AprXf
12,424,901 *01520D14CC2ED29B831A19BC6B46F3704AE95ABD A.Ps-
12,424,902 *0157E0674BAB53CBC33A143C5C026720A092FF49 APs,-
12,424,903 *0153D48DB3A6CF0D2EF1FC8F09E67406AE85F767 A)&ps
12,424,904 *01502F45EBEF5CE38152CF0C9BAC1287C3F4C560 [email protected]
12,424,905 *015C193AF2429E027CF11E85E326B2731855A608 Apsactie5
12,424,906 *015B9DF8CB5E4A382A0A9AD1303AEFB78C5E9027 ApSdc
12,424,907 *0154CF8BB05F64381C79B8F5FFB7F21B04EB71C6 APs?G
12,424,908 *015B7EDA604D694B39FE944D11ABD1DC3D0FFAB8 ApSH5
12,424,909 *015713B0AE53EB9A4B38EE1C5D86246867C09810 APS"i
12,424,910 *015DE34116DB513222FD82365DCEA78A040807F9 apsiaustis
12,424,911 *0152E44826326EF0D2EFC5F119219889EE0D75D8 Apsilist5
12,424,912 *015672E6D1C9CE18023D38F0E81BDB5E49E0E5B6 apsisis
12,424,913 *015BFC8853867E63F0683B87987A97D2014E7E5A APSKj
12,424,914 *0152BF914F501DBF03C237A1C79AF778476DBE83 APsLb
12,424,915 *015D83E6F182A3C4F78707CAC87E3EEC9E20A8BC A/psn
12,424,916 *015E9CDD5FC405EDDB26AE8355B435848E67B261 apsnūdimas
12,424,917 *0155B6CE02B4D062A2B5BBF214DA9CF70DF2986C Apsolgnas
12,424,918 *015C7F1A6AEFB9EF06FA0DB4BD22226B7911EC0C Apspi
12,424,919 *015427A16C3465B657346872C4F418421A7DD7B9 A%psV
12,424,920 *015CE1ADBB48DF37809F080CD9C79D03FD99099E Apsv4
12,424,921 *015A4B05585A66645A34E0EAA4E941825246FDC9 APSWAGGERINTOOHIO
12,424,922 *015A3E7917AB158E7AB12860F236C730AD953BB3 APswaggerintoohio
12,424,923 *01522EC00193D7E9A1FC2D7022165D08CC9C9580 A$+PT
12,424,924 *015E548819793D8EE0F2709212FEAB15349F18FA A:,pT
12,424,925 *01534ABE182E21F92ACDB72DD00FC40B9955A6A9 Ap=T_
12,424,926 *0155600ED910ED1623A1FD59D8396203763D00EA Ap"T
12,424,927 *0154D1B4DCE0F29CEAD9878BFDE80AFBE74AEEEB ApT#+
12,424,928 *015A149D88BC195C40ADE83E7F44F253961AAAD4 apt-4-rent.comwww
12,424,929 *01565E363F7B2C6B8A01B7020626702B13D24BF9 A$Pt7
12,424,930 *015C711DB2F85B46445073A431A7EE5F34BE466D APTa&
12,424,931 *0150EA2B6BB98A167C7800412B4E359838341F2B APT#C
12,424,932 *015D2591914D0171022F1E9E5DB9030497B10D20 aptenias
12,424,933 *015F5F015E103DB7D22D55B83623702DF21D3144 apterysock
12,424,934 *015F720EDFF53B3444AA233393B4B09EA37473FD Ap&Tg
12,424,935 *015946320FEF558814D057E0FD20373D513EF9DD aptinas
12,424,936 *0151417E2B755A0317C1DFDD508311C806E14245 A%PtL
12,424,937 *015AFD99F65E223D9BFFD88047F17A954057C37D [email protected]
12,424,938 *01513848D710C6C04C48F5C50F296BBD744FAAA5 AptuZ
12,424,939 *015FCD1DC516659DAA698890FDC6CE48471A083E AP+tw
12,424,940 *0153E9A5E107D2FF3049E526F11EA0AC4B78954B A%P/U
12,424,941 *015ECB7CD50C40ED0DBD97D10167D1785D2A0983 AP/U.
12,424,942 *015D076A5F6FD0DD944471EF854E93FFB8A68AD6 APu=/
12,424,943 *015B2AA484F4417232B9610284A6B690D500E298 Apu)-
12,424,944 *015C6A3FE579B76834620A80AF3F95C50922D590 Ap=u5
12,424,945 *01547C985FD05008CF478DE7EDB803530787CFFC APu$7
12,424,946 *015D65396C1221535BB802B18CDC35ED87F2AF8D Apu:7
12,424,947 *01575DE7AE92B34CC7B7D354D549E466FD1260F6 APUBLISHER
12,424,948 *0157CCD33F8DA9B5B20D72EBCFC8CD0C7695DD23 ’Apucival’
12,424,949 *015399BFE53CB20D9A93BBDB7CCCAC7B53752AF6 ApUdD
12,424,950 *0152E860BCC9A46C3B6BC7AB058E7484D4499601 apuelahi
12,424,951 *01569A1AE25E963E299428FAD88863A0D5DC7BFF ApUhC
12,424,952 *01549441200B028BCE9FBAE4DC8CEA3F08A362DE Apularising
12,424,953 *0154DEFE3589B9707439EDAE6619C60166B81CB9 apuleiok
12,424,954 *015EA48A95D596E4985F63008F4380E80804D625 apuliens“
12,424,955 *0150D61D1986982D09B068EDE81771E36AB62B87 ApuNB
12,424,956 *01503DEED3C6ECD0B9AD3B3B5F9B02DD42F64DCC APUo#
12,424,957 *0158550A5AC74E6F28067FDBE0BB59B29E9AFAF4 apurement1
12,424,958 *01546C55C33454D453B4F2BD19C1E97294F114D9 AP_uT
12,424,959 *0150020C1C5248AA4493739AE6F1C4855BB34C53 apuwongo
12,424,960 *015C8298CE429C4CF3630D75A38C7F09937590F0 AP.v&
12,424,961 *0151A5E3B0309EACDCE728388CD85E521F883122 A+%pv
12,424,962 *01548C5D6CF269874FA91D18CD22B58F2AAC45C5 Apv1&
12,424,963 *01511A0A688B484518B39E8FBFC75123394E90CA APv6l
12,424,964 *0158BBDF8137D454D47B83D492391CBB5C5FC280 Apv/C
12,424,965 *01578AEDC768C06CD6B710A181399B47446EC1AD Ap
12,424,966 *015E5566CE1B8E26DE4B0D07A68EDA43539F489C APVda
12,424,967 *015426381C74001EAD7AC78988FEEA59CC6EF377 [email protected]
12,424,968 *01533A56E340F10935707EE60A10DFAEA7BF7368 APVl
12,424,969 *01589C59E28DC9D2672275762325A9C53DE546A4 ApVR)
12,424,970 *015539C7528FA9EE6B892642710AC6FCD69107A3 APvSe
12,424,971 *015BDDC7432B3781D3091B0E42FD9C8CC287A68C AP!vT
12,424,972 *015C4503F50B15546D684E048F32D8FFB2561319 ApVTn
12,424,973 *015F73322B857FF5123292250C13986E27BD1432 ApVuF
12,424,974 *015D0D37ADCAB4D815DC02CA0FDAE127D52F03DE AP;W;
12,424,975 *015950CEA44CABE3D4EAA8E98B91A87DBEA47919 AP-w/
12,424,976 *01537C967037C9BD25A8E285BE02F31EC11BD2F6 AP&w,
12,424,977 *015A925D342994F786CE30FA5B5D1641FF5A07DC A:"pW
12,424,978 *0152C6445C9357B1FDC6B9339C7682AFC1C2D3DF A"p
12,424,979 *0150A17E4C84811A03BD8AA28A8A0DA93BB47A30 A&PW9
12,424,980 *0157134B4BB33D69D13EA9C44E1C0C90E348C7F7 ApWdg
12,424,981 *015C2479FF4ED4AD586ADE38F603E45A6316F6D0 A,Pwg
12,424,982 *015D1301BAF85F3C62CD5C64D91E35DBB8D764E5 ApwIS
12,424,983 *015585956DD6058441BA31AD6F1ABB8AF9C4182C APwlQ
12,424,984 *015A5255AE3A10BEC0EA319ABC84F89A44A2FF57 ApwuY
12,424,985 *01530376AD25BD2D016BE69548F60FD12F7EA625 APX.&
12,424,986 *01553B2AC4BC28DA1FE3155CDE81F2382291ECD5 A_p&X
12,424,987 *01596430B113068D54076F8662FC974B729911DE APX0R
12,424,988 *015E4057250249C2DB248B6C5921D58028278CEC ApX8.
12,424,989 *0150B0BB665606D6DD960BC5DE7EDE2B99963FB9 APXhZ
12,424,990 *0150CC87EDCA6406DFF39E6F3BDD8986DDB90B38 A!pXi
12,424,991 *015A9BE7173344EDD88389868C0489B1076CBB33 APXIAGP2L
12,424,992 *01558860407C63617F3E1F4BD982715F24975471 APYABHYAPATAD.H
12,424,993 *015ABCF7A169B942CF3C56529613E623057CB263 apyajitaed
12,424,994 *015EB223914123106AB90988D26B715FB4F21AA2 ApY%E
12,424,995 *01563587C9583DF535A973078446F524C8200BA5 Apyeshhaas
12,424,996 *015B5D7F9971DC4276CA6BA834E6718F5932C6E6 ApYGc
12,424,997 *015C1123BFD5B60D79022F6E88F4906E33982F1B A!PYN
12,424,998 *01536ED49D7FE1FBD1E9BB0B650F80CD081F32F6 ApYQ;
12,424,999 *015780423F495BDA36A346F7211A852070A6A9BF APYREXY5
12,425,000 *0150CBB88A55C554C5BC451E9918733410A10319 ApZ#
12,425,001 *0159A31A3972BD34F805974D794802B0EB94EA2F ApZ7/
12,425,002 *0159FB2F7C257C8F1DAC89CFE0BB5715BABB8CC2 APZ7Q
12,425,003 *015B6B4D291E28FA823F193A7A08B2E16F96B36D ApZKe
12,425,004 *015D72BB3416E12C4686A2D557CF3AE6D5BDF56F A,Q+#
12,425,005 *0152477B3EB834BF352F2C70690568272A9C972C A:&Q.
12,425,006 *0155CA24AB445984AE3894F8D4E1B1FA75F2F74F A:Q_;
12,425,007 *015A08A2D123554C4678B68F00EF022FD60F09A2 A!=!Q
12,425,008 *01553200F22DC4E52003EC1B54260B80592A8BC2 A"!Q-
12,425,009 *015CB63640F78C2DBCB383BF0CF8571609E006A0 A+Q^
12,425,010 *015341FEEAFA48AB3AE03AD4403CB311E26D0B7C AQ--;
12,425,011 *015388A3AA6ADB61CA8FA234748EA5ABD93219FA AQ.:!
12,425,012 *0151CD22FAB238FF9947E99BB94BA8B92B826A87 AQ
12,425,013 *01573A64789A06EBE5B05D72BC7F9B231E41FFAC A-;q=
12,425,014 *015BEE48FDDADD855335C8FDA1ACA7CF1D9BC050 A,=$q
12,425,015 *015FC1BE3D0C62A4F6C124A7838070D66792BF2A A,q_&
12,425,016 *01595C36DDC3BFAD5547CD65A2ED83D7CF0FF933 A!q%
12,425,017 *015E10589B8977DD388237326A6E893EB2B1C519 A"=q$
12,425,018 *015D684D206008C41DDED82A362619BB1604CFD8 A""&q
12,425,019 *015ECCEF65AD8BD3C9F33A6F4D04890255216E9D A&q:!
12,425,020 *015C033A6A4BC78C8FD2FE60BC4B7320D7A5164C A&q%&
12,425,021 *01570E4CAE0D8E736031F2F91BCB135486D6FA14 A+;q+
12,425,022 *01517B47FC16AE82ABB4F29F88B6CB10E3E6142B Aq%)$
12,425,023 *015EA1F6927ADB95BAEE5E9E310E0A88C55CA003 AQ/=0
12,425,024 *015F66F899D15F00F9C9A5BA85FAB12BBDB46462 A,$q0
12,425,025 *015F507871CA45402D73EE3866B4DD8DFEC422CD Aq06-
12,425,026 *015094F5A8E0AAE30AAFD1938F6BF38E6D9B4EAE AQ0$7
12,425,027 *015A250B47604C78B13494BE10B881888AFE1A4A AQ"0D
12,425,028 *0150F61E4679E9710F9ED7AF437F2CD5D27850F7 Aq0M?
12,425,029 *015FA271746A367FD9CFB41BF6C8733A10465AC0 AQ:0t
12,425,030 *015DA3CE233E9F74B8030E21DB068E2354EF1CA2 AQ189
12,425,031 *015B5839463F7DCFDC906968D544AD1A3046414E Aq=1B
12,425,032 *01544AAF0031478B326E6C51C92A2B529E870DD8 A#q1E
12,425,033 *015B7AAC71E8F232B6FF255F1495C6EBD40E9054 Aq1-H
12,425,034 *015EC6B70B9F7E611FAFA9529A78661CD136D3E9 Aq1iH
12,425,035 *015EE5088CF2A39BF9DD1EB9A8FD97FC4C912AE1 AQ1,O
12,425,036 *015E4780145DD97BD41810BCBDEB8F9A02BFA786 Aq1pC
12,425,037 *01517098EC6CAF1DF45479B2CE63232355E76993 Aq1Tv
12,425,038 *01596AB59A034095F5E813F6EA2775A1C8C43DCB Aq1=X
12,425,039 *015863ADE0A974B7270150096E5315153AD437EF Aq2:$
12,425,040 *015BBAFFCF87A21ADAFD6184DC8BA65FBAF1749C Aq2s"
12,425,041 *0159B300A4A12F1759EE2382BA2C691528417C37 Aq38X
12,425,042 *015E8726EF3D55425D6F3BD81C5886A79E6A44AD Aq3h0
12,425,043 *015136D000D757996EBC665F477F7A4AAC8B7A5C AQ3IR
12,425,044 *01538737B034C8C2EF822538BC9BE51140288D55 AQ3N$
12,425,045 *0153684C17B07EE5D6765029AE8B41C516881594 AQ"3O
12,425,046 *01507222BD98B2C52E18DF5A3C4E8A8D9B2B941A Aq3PG
12,425,047 *015EC2C042A91C11808C1F58FCFA84C172006012 AQ3S9
12,425,048 *01541B6FADF2E0E12AE1D54965974F878F688F5A Aq3wm
12,425,049 *015A791A138D36F701983EDFECBA7797CEF51E7B Aq4du
12,425,050 *01573CC6F0E603A26699F0D6B0CB9F1C15EEE4F1 Aq4Gd
12,425,051 *015D83EE56B2FE2E1F8FDD20DB11AA0E2675B190 AQ4gg
12,425,052 *015B503E4A35987F864384CB5C0292AB2C9A6E1C AQ4PZ
12,425,053 *015E16025F79FFBF94E981E82BE4EBB8ED203D2D AQ-=5
12,425,054 *01593990615ED63A82FE22251306347BD0D83EEB A(q/5
12,425,055 *0152750D7D35408074B20843581B580C2BB576ED A$q5B
12,425,056 *015BA03D7C8F52FAEC4DA7E1D8AB6EE7F6AFF6E6 Aq5fR
12,425,057 *0156D1388920043306563F791D2FADC99AC97AD1 Aq5&n
12,425,058 *015C19603F9E77620E5CA14B8D7FC8021F4312D3 AQ5(U
12,425,059 *0158A35C7C3CEC52E4FE5F0B0AA722448EE7C774 A.q!6
12,425,060 *015FA3BA0A1561296F44E819E9119B28AD828C68 AQ6K"
12,425,061 *015F9920B2B1ECA83607027601AD8038BBB8FA2F Aq?6q
12,425,062 *015AD07E70290438A9914611724261EBAB6F68DE Aq7Mi
12,425,063 *01509964F3400E2019F3FAC67EB26DD14FBDB54E Aq7Wm
12,425,064 *015730EFEFC26BD37FE80885E01370BB401E384D A;.Q8
12,425,065 *0150341B755843D23C31959CE122D2F439F3284B AQ?8&
12,425,066 *015BA848C2F72ADD613EC90CE4C1A99DAB09C541 Aq(&8
12,425,067 *015B359559DA5FAEDE7A1CFCAD6D5EAB3E66C83C Aq80i
12,425,068 *0151DDFCC89CBEF3D774C1ABB5DA18DECE5C91E4 A:Q9=
12,425,069 *01587342C2D61F4600A7D8DD96734FCC2D4A5359 A%Q9:
12,425,070 *015992B4C356D32F2A3E970E1E365763BF767A26 A"q9&
12,425,071 *0156DB37D9BF6B519A56AF6E8354B637353BC653 AQ913
12,425,072 *015FB2579309264B682F6A7F2D6EA9B0A3FAC1E5 AQ99e
12,425,073 *015435E289DFBB40D1B324E462E5C34360805FB8 Aq9H$
12,425,074 *01556A5F131B3BF989A1E34CF3845F785680D76A AQ_,a
12,425,075 *0158D5F82BD094B4F99367A0AE7B6C66BCE3DB10 Aqa2g
12,425,076 *015C52498A337511829DA480AA26CB2108421D5E AQAhK
12,425,077 *015485F2262C1BA085B4460AF530308FD3DC9670 AQAMS
12,425,078 *015C00378550E9B144912302B4BCBA624A3BE9E9 AqaP0
12,425,079 *0157187E032BBA1AAAC78A0F12E5B3D7B0CE9A81 AqaQv
12,425,080 *015FF1BDCC2FD1E2EEF8E34BA022B31FCE7EB725 aqawsedrf
12,425,081 *015DF3D12D20730D211678DB90955557365BF850 AQ;aZ
12,425,082 *0154D5E7B1D6B5B4558D725B7E5F770BFBFD7B3D A;qB!
12,425,083 *01596F944B12B2375A31D77D3C9A3359FD75F9FF A;QB2
12,425,084 *0154C60A722577E6F4F5FDBDF6B8B6B9C28BCBD7 A&Qba
12,425,085 *0152B5E487C70D9A8AB4E7FB563CA14220E59E44 Aqbh4
12,425,086 *0156363EA4C2009FA39AD59D52C7C659595928DE Aq,bI
12,425,087 *015161E730818FD611EBACD2D8440232199621F5 AqBoG
12,425,088 *0151655D958D1BC6AC2509290B1A8221E488D3D4 AQbuC
12,425,089 *015A90C1ABB2B425C4BC5B51301724D0BF711592 aqbye
12,425,090 *015209213F0483C6B30DAE18CA57868749E9666F A?%Qc
12,425,091 *0151A5BD049C5188A0192FD21D569486E02A4D5C AQc23
12,425,092 *015D41F7430E86A68BD18042BCE9755AA1E2D4FE AQC3?
12,425,093 *0153C9F09ED56B6581B30850274F3AAB40C58D1E AQC8"
12,425,094 *01584A4F45D0EC34410CEA9048D081CCA8E1D0DF AQ)CC
12,425,095 *0159797BC9988C895678BA8F00DA128F283DEEF3 AqCCT
12,425,096 *015FEFBB9A7F1F7C8C4EC1B7C7DF60356B02D941 AQcE.
12,425,097 *0157FEEE8045565593C0B2FFE6B283DAF2F0AC0B AqCg8
12,425,098 *01545BBAE0DB50687997062D1B83D8AC3F581864 A+QCI
12,425,099 *015BD0C99AB31DBCC9F741183BBA7E0BF04ACC05 AqCPI
12,425,100 *015D7BE72952C9CEF8C6CF46E42D10DD02D4ECE1 A.QCq
12,425,101 *0153E51E4017B892F8C812A7FEFFF56844B709FD A%QcT
12,425,102 *015BA7CD6DAAF19835F9103D325E871DE5C8EE67 Aqcud
12,425,103 *0159D5F6CAB4907D08D36C25CD2083C468527B45 AqCw1
12,425,104 *015669D8645E438714E068F702B91098D1F15B27 AQCWX
12,425,105 *015E5D397F66C6207EEFD68D61349AC61BD5A050 A?Q.d
12,425,106 *0159B72D85BC2529A0DA2849B283F57A46CBC905 AQd1s
12,425,107 *0155BCF0F191EDB1C59B7FF40E8F51CE07390905 AQ:d3
12,425,108 *015440EE6B59D0C4B6F2CF02593009E0C00EE63A AqD4i
12,425,109 *01572FDD69EE01F03E2962E8A8B2179EFB29BB6E AqD5m
12,425,110 *0154808D00CB5E6203A2EA34C33342821A1F86DF A!QdA
12,425,111 *015A9B9B67354509D0E339399BC460D5CE03C768 A%qdA
12,425,112 *015903633ECC5EB0E24D32E18C513240EF66CA4A AQdb.
12,425,113 *01566D4B2AA0D7AE3C7520A2EC8E35CD3D83D938 AqDe!
12,425,114 *0155E4FD2FA7B6DFEC5E939EAA692BD1B7DBF889 AQd(L
12,425,115 *015DCD055286E2471EE0DA51E21B1FE00740400D AQDMU
12,425,116 *015EE12C4E082929C19A0175BC58A1D0F8DE33B0 AQdN0
12,425,117 *015699E877404A17827A5F55411B6875B5FAA5EF A--QE
12,425,118 *015B8A64B373E8130C0899AE6691499A4EC53D90 A.Q%e
12,425,119 *015AB52F60C94E21B4ABD2CD1DD13AF3238F1B37 Aqe%:
12,425,120 *0152C4B83A5A24F85FFD1A85776790E9367DCEE4 AQe.4
12,425,121 *015EFF2EE69BC3165B0ABCACF49423AF7338ADB8 Aqe9k
12,425,122 *015DC85375312D4E1754107C2BE3231BEFA4803A AqEc7
12,425,123 *01550E9B917689C5B1CF60EDDF4E23CE8EE00A74 Aqech
12,425,124 *015E95C42920AAC32100D6FCFA26523F085FE00E A=qEd
12,425,125 *01556192692FC52FABBEEB5C60532A88E78FF034 AqENU
12,425,126 *015004115F88E963F2CE16B069D2B9ABCA87E632 A.Q;f
12,425,127 *0151975ECFE9A0F3E091F033D8B69D3C7505AE23 A=q
12,425,128 *015B5BF1E64B11B8E47B77C342FFB657AB68CCDD Aq(f+
12,425,129 *01597759051DBCD9F7A05277D271809ADA05227D AqFBw
12,425,130 *0150B966229C05C88D4F7A3686022299D92A664F AQfdA
12,425,131 *015DA31AE9F1616A88A6B064110464CFEF200A39 A_qfF
12,425,132 *0157556CDB7BB5C2C787208A8A417F331CADE66B Aqf!n
12,425,133 *0151D30F3FA3F04F8A477C46E571949D0F749F9F AqFOk
12,425,134 *015AF31496DDFF9295E229534A72A41AA5A9D887 AqFrC
12,425,135 *015EA5DEBF69E5C54A2DC4BD16B4D5C7B853784A AqFtS
12,425,136 *0152E6AB45EF1D8E736F4B2FD6D5D51C8AD79FC8 AQf=v
12,425,137 *0154217D33CF98A586DFC1D56ACC326825F157C5 A+_qg
12,425,138 *015647CCBA9475DB88FBB39C462AB26A6052CAC7 Aqg31
12,425,139 *0153EE754B6765834A4679622E25A7B3FB2DF9FA AqG4H
12,425,140 *015AC72A4FE6E7431BB9B13D8B5DC51B66DD092B A:QGB
12,425,141 *0151F0BE66DF655E25CB99BE97A89DADAD6F7FBE AqGB6
12,425,142 *015C1336496390BFD8E8C28E164A487E6002F83E AqG%H
12,425,143 *0155924D964EC357AE35A8B7B9EEA235E5D73443 Aq
12,425,144 *015F35B4E998FFA62032E153B38CC847C63A8CA1 A:qGL
12,425,145 *01562E0FA6A1F767FC000472CB099B75AD9AB375 A)qGo
12,425,146 *0159CD1279C7EA4E08D289DEDC698E696EA7A557 AqG%S
12,425,147 *0159D528279D9CCE7A0F1C85407E3E700B120FBE AQ:Gt
12,425,148 *015523B53260D7853FAFDD29808C6384D5C05A45 AqgU1
12,425,149 *0151C14510A34477542B67FD040D776121C2C0DD AQg_W
12,425,150 *0159C4FAC0011973CC857A6EF0DBB89B05ED9469 A+Q+H
12,425,151 *01545CA1BC1DB438C12EF9D6C40D1C3B1D667A12 Aq"#H
12,425,152 *015FEBF7495FAC415CEFA5D026D659FC715F404A A%
12,425,153 *01568F7C56C87F0B0E4EB4CB058C452D573468AC AqH2/
12,425,154 *0155DD6956953E0FB63102379A60E75D4F00DA52 AQH94
12,425,155 *0158D52E8EECC078D4C518C445F1B9E025B0E22D Aqh.c
12,425,156 *0152A453077D571F454EFF72E65772ACB8B2235F AqHDa
12,425,157 *0154EF1993AF988C4C5597019D63AB514BE0ABAE AqHEU
12,425,158 *015795395996D771886D7CE190703B178545BA2E AQH"g
12,425,159 *015E160F104A375A701380D37A00212209130EC9 Aq?hI
12,425,160 *015F12CABA21B268E22041CA21DB6124FAE9731C AQhS(
12,425,161 *0155740A99853192A6407876A95DBBBD7EBC9FEF AqH(t
12,425,162 *0152E864DDCB04215763A017A8721A71464A0D84 AqHvo
12,425,163 *0158300FB720B83EF2FE7AB1BF1E9E50EDCE67F4 AQhY0
12,425,164 *0155F4867FC0397BD51543749E6898F0B6ABFAC2 A(Q=I
12,425,165 *01526E3341C3514807E9D41264FF1F5A8D716A79 A;,Qi
12,425,166 *0156B57194D56D19DBFC63AC9A8B62EC18D1E3F2 AqI4w
12,425,167 *0157143986F9B3EF91738CEFAA1C362531D79B0A AQI(b
12,425,168 *015AFC565D34F5D92F5ACA833959E5EC97FEBDCC Aqi(e
12,425,169 *015D0C69A6EE46A535E6E49CDF0C3955A7E2CE83 aqieaqixgaakcrcqwtmx
12,425,170 *0154B7DE1F8DD2500A0D3B7BFE76B9AE3343B2F5 Aq-If
12,425,171 *01559C5DDF7B551EB906D80171050BAB64463FBA AQIkK
12,425,172 *0158893FC5E5752C762B8E02071B0DB66E450539 AqisL
12,425,173 *015A3CB2DA42635CDA772F847829502C02C0B39C aqis’s
12,425,174 *015DFB95CF1AD96236585FA574DE20712A1E7CC7 AqiZD
12,425,175 *01578EF2135F948590BBFABFF6EE341123799656 A!-qj
12,425,176 *01529C9A93BC0DDC01C3DCB518054B22C5973083 Aqj9L
12,425,177 *015D297DF573464403EC411840A4A884A76E347D Aqj&B
12,425,178 *0153550CC508BB8CD4D6676A3F219F12D982A0FF AQjtF
12,425,179 *015F2FE5F53F92D9092BE82D012A94828485A376 AQk#$
12,425,180 *01572BB442E76A7D862AF922CC8357E36C954465 A;q+k
12,425,181 *01532122E72C2B4128057B2DC40DAEE4B03D0C51 AQK+B
12,425,182 *015D02135B805F206B7D8B13ACC7CF636C47F1BE aQkbEHHhRZd
12,425,183 *015EE13CDF5D96B15787F30437F7D1E549E57028 AQ%Ke
12,425,184 *0157394876F3CB7C5471593076A6E5218FF883B1 Aqk_e
12,425,185 *015415B121007C0FDA77BE8541340C676D08C45A AQk)h
12,425,186 *0151BD2D23013E3A0DC9EC5A63AB1A2D8B34BEBE AQkp!
12,425,187 *0155F63A876D4187F9A8B8BC774526C702B38D12 AQKrc
12,425,188 *015FC0F2A03D487D375AC93A890BCCB25521BD5F AQKTE
12,425,189 *015411DDB3F61C132BEE755CF34807793E01BE60 AQkTQ
12,425,190 *015E802878274523B7E17554745F49EAA821D431 Aqku2
12,425,191 *015D6BF05F6B189365DF743023B976CF71303A19 aqkxv
12,425,192 *01508FBAC7E37FDC2F88A044B193FF8246572428 AQ-?l
12,425,193 *0159FF52738B4EACEF3CA1EF0FCBB821EDA089C9 Aql#/
12,425,194 *015385F3F8E2D227814BA35410B2FE9897424CD9 AqL2m
12,425,195 *015B6EDF5C24E955BD6CB601F3FFD8B3709538D9 AQ.lC
12,425,196 *0154B1DA9D7CF25FB2B85007D6FE4DF118C52446 A:qLc
12,425,197 *0154F0B5646443A8CE60B9C56F15CB5419F130D9 AQl
12,425,198 *01530669EB3EB038DCAB5E1E873E9B1FFB829A88 [email protected]
12,425,199 *01556FA4D0323798DA5CA92DB69F5F9144A1C64E Aq=lj
12,425,200 *015AE1BFAAFBE779DD8CD5698D399D126098A304 Aqlkyvpr6
12,425,201 *015841AA0A32C7C3DFC3511483C7FCE50AA15593 aqlmn
12,425,202 *015DD9825F7DA16E74885D5C9D5E5FFB114D01F1 Aql/P
12,425,203 *0155090ACC5F0BC6EF8650F1478E00E493EF99FD aqlpa
12,425,204 *0159E524EE64C7B4D8DD49A0128B6F9FF813D5D5 Aq#LW
12,425,205 *01546714D3F1E168B474498C2D0CB8B626AD7996 A/QM!
12,425,206 *015D8A6C16B68FE6E56673414A85542287D113B4 A.:Qm
12,425,207 *015115D9D357B98588BE1FB79D366CDC748E23EF A&Q;m
12,425,208 *015FBD5A18E487956DEB1D3C94BB3205570DFF4E AqM%+
12,425,209 *0156B4C9629EC98ACC2A672D62EA53A279F242DE A>qm
12,425,210 *01519AF7F6F178C25EDC80DC351B5332A5CEF10A Aqm?)
12,425,211 *0153EF3B7DE73ECE3C61F06454111DE465038CD3 AQ+mC
12,425,212 *01550C84614BB003FCCDE6487F81A3B7A110B320 Aqmfv
12,425,213 *0151955F16DA7C32D305030D5B386BCE2AD08D6D Aqm+g
12,425,214 *01540A4B1D41466C1A089F451B79A72F598784FD Aq#MH
12,425,215 *015FEF465C10CD7C640B4C7BA5C4BE392DD7E4FC AQmI0
12,425,216 *01560FC5F6C2DBADE88E79A52C9C7FB0126D3203 AQM
12,425,217 *015217BBD0D53685627945B8ACD7E34AF4B19D7A AqMr0
12,425,218 *01591FA49EDC9EFC454DD2EFD6EDBA7492903D0E aqmuq
12,425,219 *01573A7C85BB890EC0C986C79EC3832C4FB9D873 AQmv#
12,425,220 *015FC1664032D87B37423C035A1A121B23E01782 A)QN;
12,425,221 *0158926F7AD8CDA7263CCF52EABA54E89223DCB2 A"!qn
12,425,222 *015F9D5BB45364F7894939C7A656BD34ED449B16 AQN05
12,425,223 *015964E7B30421AD81F0521C1B442520A859B470 Aq:n5
12,425,224 *01509CB57EFBDF1C609A3D2C87D433B2F98DEF33 AqN!C
12,425,225 *015D72FD24064D2E1B28CDADDEADD2E4AD30EB7A AQNgM
12,425,226 *015993F749686B005F3C86CBE7D4A5C746DD7A30 Aq(No
12,425,227 *0155260C510A240E0E7AB58B12265751E90CD3A6 AQNUs
12,425,228 *0158DA9B3B6859174A12952645816F003BC9ED83 AqNw!
12,425,229 *0157AB1AEBC438E0B7787AD8C19B002A6ED3CEB6 aqnwi
12,425,230 *01541F85624E6C1B3311FA03412CEA460C969796 A?QO#
12,425,231 *015C0970646B8B065EDD7CB59BAC66610086A0D0 AQ!:o
12,425,232 *0158B77AE9831182468805C6BA3E10A9BCF1E1FA A(&qo
12,425,233 *01589FD01418179B30D8C961F1213DFFDE70B290 Aq_.o
12,425,234 *0157A53244CC57FA6ADF413DADAEF45D1893FE77 AQo0U
12,425,235 *0154E221928F1F270BFC800737F28444D5AE27C8 A,QOA
12,425,236 *01502E031D9E5C71CA014D8E6E44A3A53FC5D11B A,QOE
12,425,237 *015D3F1F40645FB7987493C2493B58F9F0863957 AqO/F
12,425,238 *01560638BBAFF12E68D76DADCBF02EC761B1E398 AQom%
12,425,239 *01551C21B129816487763B890B1B49038150D7C6 Aqos4
12,425,240 *0152755FCC2CECF06EC180EA140370EED0053EF4 A-QOT
12,425,241 *015BFD43944BF71241D4D51FE243EF7F8049C285 A:qOt
12,425,242 *0158AEA6EDCC30C619B76EEC6B95FDAAFCB0A92E AqOwV
12,425,243 *015A9FEC5D61A8C87E6A3A3A3391CDCA3D9EDEA4 Aqp)$
12,425,244 *0154AA311CDD5DA85BBDDF5908D49374542E8FAD Aqp0#
12,425,245 *0159510A53CC1CF6F7D7329E41A660A2795538EC AQPcN
12,425,246 *01546D641328C1052C634A0A8E0214DEA9327F50 AQP:e
12,425,247 *015BD78ADDC351ECDDB4B00DE4A28DC8AE9B3B33 [email protected]
12,425,248 *015799C600DC5FA1E309C09820AFF910DFF94539 Aq/pp
12,425,249 *015AEE4483F59D61344C6A8CF227E261DBCBD89E AqpPp
12,425,250 *015FCEDE144F588CF74187902557CBA7983BDB21 AQptw
12,425,251 *015BE0A73F5DB874CE5A567C2C95C61FE8246EEE AqpUX
12,425,252 *015B5537D803F73EC8F77D0858055FDCF64035F4 [email protected]
12,425,253 *0155B42C1AA2976A5CFDC9194A5BC3E80925B8E7 AQ)/q
12,425,254 *015F3824DD89FCE1D10D442B00A122873AB58DEF Aqqaqir
12,425,255 *0153C6A0B0968F4505D1B24B245C0816403B97AD aqqdo
12,425,256 *015747FBEEBC0F1F3C5E4BA3868C0708932DF950 Aqq+E
12,425,257 *0158A51ECE958180C96077CEC1C8D0A0D4F898AF AQQG4
12,425,258 *0151E841E27CFCD56A0BA18FDFFAC155996C3B71 AQQh7
12,425,259 *015516F29320B7F87AAA40FF4C63DAE353F277F6 AQqm"
12,425,260 *015CE4DA80F805D9308C37B9B502C17405C41825 Aq$QM
12,425,261 *0155F2A9F79EDA8CD44D993F806522998CD3BD92 AQqO;
12,425,262 *0158F464F1D309CA15EC53671BAA1B685AF6F9A2 AQQPA
12,425,263 *015684076EA1BBCDD59477D70A404E59136B6F2D AQqwB
12,425,264 *015E243CEA64ABC68706191A83C4DB1E3B05CB90 Aqqwl
12,425,265 *015CD82AF98CDB6C4D90ECE08EDAED38228C44AC AQqYb
12,425,266 *01527F726045B8C3DC655631C859D65CC432DD38 AQrab
12,425,267 *0154D7F7C55C08E30DF7D33297FEDDA73E47367A AqrAe
12,425,268 *0156C6CD7FA64110FA60007C3CDEEB8E2AE9AE26 AQrcE
12,425,269 *015642AF3BAAEA55548E2CB94ED89C021B2D8C51 AqrFO
12,425,270 *01508BCA5038E4AD3C38A49097BD9D6A9BCD3BC4 Aq?RN
12,425,271 *015D5CE310B83C308117ABF2E512D05780BA52B9 Aq.Rp
12,425,272 *0157F76999DBB3EBD79A2E9758519D153A1EF0E0 [email protected]
12,425,273 *015839F4ABE1A68D02A72B33E2A7DF784681CBA4 aqrtv
12,425,274 *015B20C4DFBFFF15E2C1BE6E2ED7DA0D7DAEE28C AqrZ3
12,425,275 *015B34BF18BE5B1EA9D1C5BA51E13181505C7110 A=_QS
12,425,276 *0157B1EA274D69CE0E4CAE62D434FB3282FF7F76 A.Q?S
12,425,277 *015ED541992BA92C3F6FAC4FF48035EC883C8F88 AQ,s=
12,425,278 *0159251BBE2E46E765D6090A3AAB055FC6C4C8DF A
12,425,279 *01558CDBB746E712F6556BF42DF66E95917A1CF5 A,q=s
12,425,280 *0157B8833505C51F95BC0A6B49F2CA1EB616ED2B A;q,s
12,425,281 *015CA1D393BECB6CE29098349F4E42F64509534A Aqs&=
12,425,282 *015D89CCEC8E3DC89CC80AF0AE44F0F4ACEA75D8 [email protected]
12,425,283 *015F8794C9E74F149B1701D6A803F4F50A57AABC AQsh
12,425,284 *0151D18E0053882A48E65DBC8AFDED6CA2529727 A&qsl
12,425,285 *015958FC95ADD75C0F577C4C4FDD3EB53A95EABB [email protected]
12,425,286 *0152AE34A5F262A3E9863AC75DFE0534A53F0309 AQSQl
12,425,287 *015DF5B5E2C9B9EC51E52E6A8723C48D6881E534 AqsRE
12,425,288 *015EC11CA4524BCBC257CD211CCB415D1ABD99DF [email protected]
12,425,289 *01579C37EE46D2FF1B1547650503B7E57617A29C aqsug
12,425,290 *0151FF21100C3059337E7757D94DE76AC1425829 AQ)sX
12,425,291 *015C09756EE71FEF0FBF26764199B8D8F682758C AQSZ8
12,425,292 *015A3E095492268970DC87692BEEED76E7E74330 [email protected]
12,425,293 *01576F32B7686F36F82C680945E2847303EAB22A A_/Qt
12,425,294 *015294B20CDA43FEEE52F9F7ACAC7497FD983DF0 A$q#t
12,425,295 *015D347A12D9ABA99A188555D010056F788EB61D A+qt&
12,425,296 *0150742FF6CBA1FB88D908563C366D300293E912 Aq)#t
12,425,297 *015ACF159535A478CABCC1544CBD15539876948A AQT4S
12,425,298 *01546E1E8CB3AE455BA063519D2BE18D5B2F2C00 AqT7c
12,425,299 *0150D8697C61CBF67BA316F4EFFF8F158C46F1A4 Aq.Tb
12,425,300 *0152F606E128D36CE32903E995377EA0C183A099 AqtEt
12,425,301 *015BB21463B08A47612D3AE7DBA3451E84D5E5CA AQT:I
12,425,302 *0159E7911903A0F1E8C38A312EA5AEA5D19CD6C8 AQT"i
12,425,303 *015674BDE20E22FA6833890463E559F6EBD73008 AQTl2
12,425,304 *015BD1E70953D5F63E431B1567D15243B3A9B73F AqtL5
12,425,305 *015B38DC1AC81489AEEDC4345D1B126363E36DCF A(QTO
12,425,306 *0153EC64ADB4A6CD05FEEE9663BA1D9A48B43B19 AqtQ:
12,425,307 *01544672E7CD670078A528CA7ED3D088ABCC0CD5 AqTtb
12,425,308 *0151ED2E5FC8C9AE7265A8914CBFE0EE3FE4596F Aqt&W
12,425,309 *01538657F1D11D98F520FF1890519485FECAB3F4 A+qtZ
12,425,310 *015E7B8ADC10C536F3784033F14CAA911335AB30 AQU+(
12,425,311 *015EA911962234A43018A6862EE6ABFD8313D185 AQu:.
12,425,312 *015FB054799539963BEE82B24EFEDC10374A58D0 Aq_U2
12,425,313 *015BFEC34A09D22026BE09109D65756276CF9EB5 aqu22
12,425,314 *0151F6BDDA94A72932842CB15932478151E21162 Aq$U5
12,425,315 *015BE5C29037E45547093F1B4089CAD5D6747748 AQU7Y
12,425,316 *0155F01A309EF25DEE3CB4831786037E7FCBB04F [email protected]
12,425,317 *01542224DBE6BC9FD7414D959301623E2BD0193F Aquadita7
12,425,318 *015C075A8BC4E2469BD36EBC861D9EFE6C7DF775 Aquaducts
12,425,319 *015FF1D1352B12CFE4590DC9EDD37FA902973604 aqualand6
12,425,320 *015720FA4A6723F013F9B5199F931289FA011B90 Aqualiner
12,425,321 *015F860D5A1394BA7FCB96ADAB44BA11DE007A0F aqualorius
12,425,322 *0150A3E1CCE39946026243F6B149B485877BCB36 aquaoana5
12,425,323 *015BD33F5B038820A053A733E1DC55235E1C42D0 Aquapole8
12,425,324 *015A717BD95CC6D821612AFD0C3DEC6E0E04BCC3 Aquarellkomposition
12,425,325 *015008A175F43670DBF858B03B4834B0110A7D7C AQUARIAM
12,425,326 *015A53EA2D5ED3463BE1E6596C274485C8A7270C aquarian mood
12,425,327 *0150FCEA6EFC3DE42F13F141DAC13A944DFD289D Aquariias6
12,425,328 *0156CF6A06884EBE50FC1C4E5DD69079E82233D1 Aquarizoo9
12,425,329 *0156F0D4F4776955EB8356A6E2247562B329EED8 Aquarums
12,425,330 *01520DF7F99326381B54669B768E6768BF357F02 [email protected]
12,425,331 *015A4A0686DE025DA1F36AE1CAEA6F2586FDDA77 [email protected]
12,425,332 *015FFAA67BACC535808CFD436F849ED14205570C AQU
12,425,333 *01562AE82C83E4ED8AAC3FA3ADA5BA5A1DCA7DA5 AQubs
12,425,334 *015BCC2EF67BC895E5EFBFEC929BBA1007FB0361 AQUEAQUE
12,425,335 *01519B4A89C3846A72854DBA98D687829A6CC08D Aquecia3
12,425,336 *01585922ABAB791B8EEC5810DF5AF03D91B23936 Aquecida1
12,425,337 *0153B0802D7BA557FF7FD6702AB29229F3957F99 a queen's bedroom
12,425,338 *015522D8B4E029B5FA4A697DCC266AD7DA453434 AQUELINO
12,425,339 *0151C92C8DDA40E8321F1031998E3244E36F94CE aquellosdurosantiguos(tanguillos)
12,425,340 *01559235ACD4AF1D7EB3F950ABE596FD3FABD705 aquenopped
12,425,341 *015AA3234DD63C723BC3F882C4C2BBF6D8AA5057 Aqueoign2
12,425,342 *015D7938F1C8C05EC171AC87BE221181846E8A4E [email protected]
12,425,343 *015D7FFBA8906896F20E654D529E125A8D889E57 aquilà
12,425,344 *0157697C841994787E79031A085DFFF19727465B aquilagens
12,425,345 *015E0BD82E899B9FD9E937984151E8F235897A75 [email protected]
12,425,346 *015D2EE8B447D43F1A0BD60839E5D6D1CA62514A Aquincubi
12,425,347 *015141D1DFBACB99443B3556335764B0BA3A79A6 Aquinoih3
12,425,348 *01516874EC89361D50F728A74A14C6E352160283 AquL0
12,425,349 *0150C8434C4E9E9DA9A74C810536FD4621D78EE1 AquMv
12,425,350 *0158652A089D85D765A224C46EB43D903A60CF89 A(QUQ
12,425,351 *0150FAE0DD80511D24D36BD6EB972F43B30CCFE9 AquuP
12,425,352 *01554C92830C7AB470C9C962A60B8F0C63B19FF1 AQ?v-
12,425,353 *015753E3E2F69216A5163359CC2D58E668192332 AQv}
12,425,354 *015EB894E5AFC4EE45B3DE573FF66616ED3CB80D Aq/V
12,425,355 *01578BDD30E9CC51F1582EE03CD4929FD5F1FF42 AqV0L
12,425,356 *015C884D4052AAA101A98802CDE71CBFA4177785 “Aqvae”
12,425,357 *015B72426ECB8841DD8B95DFB364193D5696DED5 AqvCC
12,425,358 *015BCFA99A4A9A08303252B7E3D6CA844FF7B5F1 AqVFw
12,425,359 *01553539C648B90B65AC83BFB0262EF377E3D8EE AqVg
12,425,360 *015841B79B93EF3021CA9B372F5F32AEC4A76CE1 AQvi7
12,425,361 *015DE194E48DDCF046EFCDE2F8BDA3BA5D9EC098 [email protected]
12,425,362 *0151974DB5B791476DF17F5606C0528B49F9EA0D A$qVK
12,425,363 *015D82F47942671EBC5DFF8297DFF9FDD128CB4A A&qVp
12,425,364 *0156E3868690F32BF8B40704CC9E807C88B37E72 AQvwh
12,425,365 *0156783E17F118198C0A90A518D8F826F7835B5B Aq:VY
12,425,366 *015B1DFACAD84D773244C0A08F3C46F86591311B A.Q+w
12,425,367 *0155F75EC1A62A22FE5ED8EEECBCA409F520C10D AqW,,
12,425,368 *015E6B88392CC4E51D4593645E7913F804345D47 A#Qw0
12,425,369 *01511C72DA9FD7976FF1F3EEDB7EBBC0C70A997E AQW;E
12,425,370 *015BA6810429D1072A539F7F7C61BADB7B95DAFD AqWL1
12,425,371 *01535038B034F4EA6CFFCFFB4AAD08EBDE611135 AQWmp
12,425,372 *015B3D210C441F3BD4DF730934B684BED497E4DF A/Qwp
12,425,373 *015E156EDB6D73DC685389E0B4D8792881DF6C79 AQ#wQ
12,425,374 *015CA113B2D17D7A97FFE7740CFF7154184BE505 AqwSo
12,425,375 *015A97C4FA796861BB4A5B642E64B9AAB865834D A)_QX
12,425,376 *0152909C32BC4A3AB12B364CFC4C81858BEC8DD7 A%/qX
12,425,377 *015375C0A529BACD7B37684BBDD912C39803FC57 AQX=M
12,425,378 *0156D5DDE377ECACB122F006407E7D05259B81F9 [email protected]
12,425,379 *01569CB6330100EB8EFE46532EB88501B3C85E50 [email protected]
12,425,380 *0159005E24A11A22BCD68B7B76E6D2E9FD213F19 A-Q"Y
12,425,381 *015352E3AC48916E446DB9D3028E1B66D015899C A.q.Y
12,425,382 *015E82392982051C9A4746E5CC2988009C63501D Aq?Ya
12,425,383 *01504B5476F491224F82976B93B7AE85352B25BB A$qYi
12,425,384 *01544E1995A47D5C435348DA776206D404BB810F AqYLP
12,425,385 *015AA073D65172BDE72F69F1CDA90947CD32B1F7 [email protected]
12,425,386 *0157EA612677F19CDD50D9F57E2806A9E5A2BE80 A(Q/Z
12,425,387 *015348939D8A3CFB8ED1F76CE81B8D2312B594FE A=%qZ
12,425,388 *015394556E7A0BD76A1473B8AD6C50436B3D625D A/QZ2
12,425,389 *0153F2828EB2CD7B7F0411A92EF89ED6DE2D7496 AQ?ZQ
12,425,390 *0158089E4CE1B6284EB0C146D6A95D65EDCC347C AQzs147
12,425,391 *015FFFD3F88BCCEF08BE505FFC6D24E481BD3E85 AQZVb
12,425,392 *015F88014EA462092AA467F3E3DE5CF1DCCFEBD0 A+qZY
12,425,393 *015FF7BA6CD220D487E2E9808DC2A1654CF3C375 A:R!!
12,425,394 *015AF675A711D9A3B1FAAAC02BC270BA909ECE17 A!+(R
12,425,395 *01565E9EE75ADE6CC77C3180E905AB7ADB787179 A".R?
12,425,396 *0159235D2ED17AB18D85302FA581A7B7475D073C A$#&R
12,425,397 *01597EEB5E219319B2B6F42800DCF9F6DCB5A587 A%.R
12,425,398 *0154EFFCE9697A3C55737F87DAC65B047719FC4F A%"R=
12,425,399 *015C0F40ABD53A1B8E4E0DFCF7E96D176ABCF69B AR&),
12,425,400 *0154400E3ACE54B324CA56D9DE868092C4510EC6 A;r(!
12,425,401 *0159CA4FC5050D64CF2237DAC7021C2775737395 A/"r.
12,425,402 *015EE404F58190655B9515E960B689AF146C6B56 A$r#?
12,425,403 *015F81E2115103C5D903FBC4C0531D5DF0FCA7E7 A#r;$
12,425,404 *01546E5444D5A4DC9F5AC22406337CEB825AAA7D A%!r=
12,425,405 *015CA2C6AFE8D5BD9EB2D6B0EB4A890F1B6C78DF A
12,425,406 *015790DD9C441D10D93EDEA76BEA80E02D5A3835 A
12,425,407 *015A9E37D01CD7DC7CC7462E69A52B1955240337 Ar::)
12,425,408 *0159B10A784ABFBCA88DA285C9BBF75CB7AF0E8F Ar+=&
12,425,409 *015F2C969F2718B3283B48E5634F4CC06ED94E7F a?R'
12,425,410 *0157C5C5648C07284BBF8F641D42B9B2476E48C1 A?r0_
12,425,411 *015063070693318B956952E3AC982F21DBC6CB47 A}r0
12,425,412 *015B384C89179B77A977D75C840ECD0B3BE65129 Ar;0_
12,425,413 *015170C3E7FF51E08AD49F38F96FD35AF5A7C22D Ar)"0
12,425,414 *015782F216576DA84E25B531B9CD2A522A6831A1 Ar&07
12,425,415 *015EF2DEDE93A896021AD583F6564C6A64A668D1 Ar0#a
12,425,416 *0153ADB08E8239414A07440B7515A1E90186E4E1 Ar0gQ
12,425,417 *015F9FDBAFB61CDC7297CFC1A4B47C9ADD8BF04F AR0sA
12,425,418 *0155BD4C040E9F1ED751B001852FACE4B8DD3F21 Ar0Wi
12,425,419 *01531ED0321E791F2F9C44C2EAACD1A720996DF9 AR18?
12,425,420 *015084DD97688FF24A07F20B66A17FE84689FB91 AR189
12,425,421 *0155BC6813C71FF3CD7703C3BBF0E92324860B20 ar 1980)
12,425,422 *01521DC8B20CB730C723C8B0303F0AA892325025 AR1m,
12,425,423 *015AE75F0E77F8D88F541017F3C07B840852ED58 Ar1rE
12,425,424 *01587F772887E89E26E733CD7FCBADBEFCA36E50 Ar1-Y
12,425,425 *0157F3BAF828E3B9AB7625B6DCD8F7760F773E65 AR_.2
12,425,426 *0155EFE7BE68BC46588A2C289360EA4615C73962 Ar2=$
12,425,427 *01587606D746B0AE13E8806106D1E380EA86C4C2 Ar2:;
12,425,428 *01581E3876BA8B609E5CA506B55B5CC75B037258 AR2005033116336
12,425,429 *0152103A2DCC1927BEB1E0183776806BA2E63B6B AR2005060401319
12,425,430 *015416ED59FFA2E84EBEC1D42DBD75B7F9A96BE5 AR2005100600455
12,425,431 *015A11B87F91BF00CE9C895868A7080EDE2F3D8B ar2006040401958
12,425,432 *01509F9D1CC294A14FBC58B8B289D291E5F07B7E ar2007081702145
12,425,433 *01564EB51C438FBE6E3BF82D694BB9840EFD7D31 ar2007121401809
12,425,434 *01545B4652A1E3199BD2121FFE00E3CFAE952FFE ar2007122600781
12,425,435 *015A4027B7A1BBAEECF35E048FE8D9400DE575F6 AR2008071802557
12,425,436 *0150F8A58BDF43B1FACE1C588427B5246C5325AF AR2008090202973
12,425,437 *01595CCE0FBD185B207BA12365C5CA6B59DB2274 ar2008112300789
12,425,438 *015C1C478F969CB200DE79EDC228DCD8BEC04E34 AR2009101902128
12,425,439 *0156867488CBA083861F2A6705AD462948FB0B01 AR2010031806233
12,425,440 *0152AFB708D5C17944195F8E328DBFCB0C4D03FC AR2368
12,425,441 *01564062738621020C08D756E616EC1C0FD19793 AR2KB
12,425,442 *015790FC3C429C7CC79C97397CF51C090C00DB03 AR#2w
12,425,443 *0151091E00F002263B657E92F8DDC807CAF0CC6D A#r3
12,425,444 *0150F8CA5DE2B98332EBA7477F92736E022ACA9E Ar3-?
12,425,445 *01562F267DF7296E3ABE54873B17625F3D03CC45 Ar3aC
12,425,446 *01576F408E884D02C075E30A2052E6213A2D495E Ar3C"
12,425,447 *0150F42B74AC00E3E1548A9849C8496F1FAD2160 Ar3EV
12,425,448 *015472C1FF7ECB53E9E3431B2CB00B3B9F1C5E78 ar3g3n3ratory
12,425,449 *015FB769EABC2B01FAA985A314822FCB46EE8A82 A%r3p
12,425,450 *01556BB6A816DE950E31B4DDA56F3E86D40A2ACD Ar3V/
12,425,451 *015D3558CB483D9445135BC9900A5E63D641702D Ar3?v
12,425,452 *0157C48DB47D0FBA4638BEF246014492AF5A54D2 AR4j
12,425,453 *0159881A6B727D4B5D2A3C89E8F2F41DFE20325C AR4Rd
12,425,454 *015AAD689EED9575C96483D8057D860BBFB40702 A+r4W
12,425,455 *0150FCD4AA2D8D7F7D84E42E5625414D2794D336 Ar53n!t35
12,425,456 *015409F0509BBCC7FCF6A3F5EF9DD560A90DF4D5 A%R57
12,425,457 *0151E67E7E2C06A55B466FFD470A2EA0568DC0E3 Ar5bT
12,425,458 *0156F14E71699AFCED2E33B0234B0944BB1CCA3E AR5DQ
12,425,459 *01526984BFF6A83816FA7521A09A3F4A3994D86A A%r!6
12,425,460 *01541E1A77CD7CE2BABF6EEFB6BC2AE16C066C52 AR67T
12,425,461 *015D4DDC61FBE620E27D69CAE243E175259CE9A4 AR6&A
12,425,462 *015AB2E2C16B5D9250A9340F1734DDF06B59A8B9 AR6PQ
12,425,463 *01517D8DA997520ECFAFC7B84A73934011CE88A7 Ar6v5
12,425,464 *0151BF2C830CC64A2DC3D2E01C0DF48BA3AD36CA A(R75
12,425,465 *0158EF17716F01A2613703512C284FF4DDF6C749 AR7v2
12,425,466 *015315DB681B489ABD3F82D2FFA25FF9AB9A9A1C AR8:(
12,425,467 *015B2D95597FBF10033F88E27D64513CFD35495E Ar8%s
12,425,468 *015D509F81E48BC0FDB7380C7D6D23C31013DE68 AR8S0
12,425,469 *015AD388A9E3703CE20E6361A4EAE39F828A263B AR8T&
12,425,470 *01570995CF00ED45A23E6B8F56EDA2C33E00DFD5 A#RA!
12,425,471 *01551250AC910C8611B23FCE4765ADA2B11D8AFE A-Ra%
12,425,472 *0150BCA2AAF90989BFDEF536724ECBB6DA8B88C3 Ar$=A
12,425,473 *015C9587A76755EAE0F1709E3E590F1A214A4D3E araa34
12,425,474 *015115217B31A8DADEE6D98B6069999471DA4CCA ARABADJIAN
12,425,475 *015E0AA47566BBD2E6E2B4F3A2AD53ABA9A3A041 arabbed3
12,425,476 *015CCE45858C1DC878BE860556D7F024DB30EFFC arabeck2
12,425,477 *01596A372F962156FFC15C2BC183E4F6B5E0311A ARABEla
12,425,478 *01565957BED5EDDD05AAE6D15B5E9FEC4533EB8D ARAbelLA
12,425,479 *0158C5BF0236B40417B56944FE1F8541BB765A6C Arabesks6
12,425,480 *015EEAB71C34F191F5ABE0E90E1D0FEA55B9799D ARABIANO
12,425,481 *015D44510A841FCAC67C9AD4DC7CA9C9EE5D351C ARABICALLY
12,425,482 *015426D5904B8578AA79F2AC90A01308100F13F2 arabikhaji
12,425,483 *0155BD3566B383D8E78D93FA6722C8FE944B5D28 Arabiskes1
12,425,484 *015910C6EBE121DDD3216B265BD81CE7D9E12E5B arábisku
12,425,485 *01543EF97F80AC0927CE96E33938199CDA5599B6 arabistses
12,425,486 *015B5DF35602A49D6F60B23C6D69E6B97D76E1FF Arabizacja
12,425,487 *0156A15AE3E38D3969AE69E79B20D12D03FB82A9 Arabovych7
12,425,488 *0154673D420758B585C9FA355A8D5FE7974B41B9 ARABWATERCOUNCIL
12,425,489 *015B5A623683486EF7A0D1689001E7737A4E4F1E aracaribright-rumped
12,425,490 *015F0DEC3D695EB9DB67DC9F8CA571D165268D8E Aracehi4
12,425,491 *0152EE4FFABE61F25AA95CDA8F7360A4CB25A451 araceli403
12,425,492 *0150002DDFB339B249C59A40525AF6601E1DC3D9 araceli garnica
12,425,493 *0151CFC1387E416D5431AB0DA3C86B74B3BD9571 Arachaga
12,425,494 *0150777332AF491C5AC832E8FCF246FC3391E287 arachidonoilglicerolo
12,425,495 *015701DAC8C7D6E343F9642AB1AA2DD449A74CF0 ARACTINGI
12,425,496 *01514503454A502620D3CA2D8CA659A935DC10A5 araessap
12,425,497 *01524356FFD3ADC354AF68947688D2F6091B2F76 ARaFW
12,425,498 *0151DB1AA4D25C33C803238280DBF9063DCE0640 [email protected]
12,425,499 *01598306BCE1C943109EC98538BE214380E08514 aragon-martin
12,425,500 *015EA60C907E25D31C1672AE5C66C140ACE43B61 araguira3
12,425,501 *015FFA372FDAB60392C7C94DECF5A50037CA29E9 Arahcnon4
12,425,502 *0155DBFFD50A9BF09544206EAAB1B42D35578D3D Araidama9
12,425,503 *0157D97E67860D9F8AE3C02C4A74B68486E0D758 AR$aj
12,425,504 *015A9599867C01702D5DE509F7FC92C156F51FE5 Arajtnuh8
12,425,505 *01529D1B8A8E66BCCEE10929FEFBE1832D1E4BE3 a rake, a broom, a mop, a shovel
12,425,506 *015C485960F2239DCDBCB67852C787A13B746402 Arakhcoh4
12,425,507 *0152AB50362D7E5B85115A85A8BD47A28C19A86A Araknidoak
12,425,508 *0157C2A66CCDDE50984BE894679696C24B468B9F Arakois3
12,425,509 *0158525B6546B40E41B7ED3AEAE86343D1C949FB aralkyl6
12,425,510 *0152CE6D1718608501F5E1793BB9DE89A4042FC2 ARalphbaer
12,425,511 *01579F19F42E1BABA0A338D822D08BB8728F041A AR/Am
12,425,512 *015F12D37B5703723E106FA1A7EC01633C9A56C8 arameases
12,425,513 *01514178A83F8166119D3B5489CB9EE0AFE4B744 [email protected]
12,425,514 *01599740861918E905F013D4281DF02ABD6F2090 Arandény
12,425,515 *01599122B498349876D50114C10FD1B283273D79 araneins3
12,425,516 *0154DE8A0957C946852EA7BBD1FE7C90738418A6 aranjaţi
12,425,517 *0150C5716ED87EDDFE940DB398EBC328A62AF230 Aranjuez,monAmour
12,425,518 *015277D8016DD7A2AD92773624A5E4CA5643AD7E arankb
12,425,519 *0154A4447691C4D0B3B43C325F79F6DD0A266DBD arante 1 0
12,425,520 *015D8789194CE3701280B58B6150A6D2435880B7 Arantiva7
12,425,521 *01586D627731CF17F2E7BD209687FE085E8BFD8E ARANYHAKLASNY
12,425,522 *015AE54405CCDD2AFD53D1CA9966B934AD45A8AC Ara/o
12,425,523 *01520611323C26FFC45EE581C3D48399CB16C60F [email protected]
12,425,524 *0151826A6A9DE49FCE4B36C6828C81734BBB687E ArAol
12,425,525 *015FFCD20CE6D038CF3BCF2AC20E4C999A85A8AD Arapoceo3
12,425,526 *0151F3413D4D88C27F42EB4555ADBA2941542E3F araptoring
12,425,527 *015F511B31EE69F69B3E2A256701497671D4DA0B ARARATAWW'-'ARARAT
12,425,528 *01534E30FD2E940E8B48B89673840529AF4EC1B3 arasated
12,425,529 *015AF677A95EB1070841EAEE7E8F15176E2B2C4D Arashtri5
12,425,530 *0158B3E9E003A90ED1ED6BE07718B03904BABF52 Arasuka9
12,425,531 *0150BA59735C021E0F8E913C1803A0336B9D5358 Arataraba
12,425,532 *01557FA70EBA8F4255EFF26B3F2ADAB1EE4A0C7D Aratekas3
12,425,533 *01559D333B648EBAA167CA4F205B8FBCBD6EFC1D arattak4
12,425,534 *0152CB14C2527F780151F9AE1095E891C50D865F Aratyram
12,425,535 *0157404360272D718E24088E5AAB7A474666A00B ARAVN
12,425,536 *015D21FB76F613EE373381C7AEBD99BFE18BE192 AR_AX
12,425,537 *01501188A3A95382A0695518BBEAC8B96EBDCD8E ARAYATLY
12,425,538 *0154D05772CE5F5C24D4B2A411691EA6237ECDDF [email protected]
12,425,539 *0150078636D04A39075DD3AE12353DFA1FB81631 arâz
12,425,540 *015970810D8CF56A116E37C2A46D3B11EE85F5AA A=/RB
12,425,541 *0158A6055E46AFB1831172EFCCF543F74C2624BF AR;b
12,425,542 *0151A784F99AD7AD8BC671CDF88FD5FB9818E87F Ar)!b
12,425,543 *01591E81DAF6C5AC7BEC7DC00611D5E9EB35B2CD arb0r1c0le
12,425,544 *015C3F0B7598BF773A3446371B14892E2A482077 arbanna4
12,425,545 *015DDA605FFC47B3DEFFE88C60B4AB79DFF05898 Arbeidersjeugdcentrale
12,425,546 *0151372D554FCF145A11C5CFF20CAA50CC3E5E87 arbeidsgivar
12,425,547 *01581AD1E233117C0E7C6D2FDE04F05A73BD4DED Arbeidskameratene
12,425,548 *015E5F4A3D30B320D82BAE3EE36DFCA8FD8F7D52 ARBEIDSTERS7
12,425,549 *015F2C652CC0ACABA27D98FD853CA571D8E08DA2 arbeidsuføre
12,425,550 *015A18DAAC5141B0008226134B64C204B75F8B60 ARBEIDTS
12,425,551 *015A1848CB477DAC74D0A0BA9BB9177DF4A6F636 Arbeidzas
12,425,552 *0159A4397FE9DECDD6BD7AA8DD84D616BD94646A arbeiterkonfe
12,425,553 *0159D4F01DB1EBBF110EF83A64710D6EE34E2D08 Arbeitern“
12,425,554 *015ADD6B85896E258ACA811DEC5D2BD598A78751 arbeitsanweisungen7
12,425,555 *015AE57EEF863BAA14C5477DB012E1B59EA48C2A arbeitsanzueg
12,425,556 *0154B27FD4C2645D2CB3108888EB30C6DDE6326B ARBEITSTURBINES
12,425,557 *015920AE21A9FEED0AAAC7B2C0D3190D9F27549F ARBEJDSHOLDS
12,425,558 *0153C553F1DFCE481C3A2ED38CC5FBE100AB0EC4 Arbela5
12,425,559 *0150B6707CC7A319AE15D6AB62DBF8DD4067DC1C Arbeplapping
12,425,560 *01502D7D65DEE778A98F41EC7E5E3DC6ED69ECA1 arberest
12,425,561 *015D424B9736D4CD7AA55CAC68F4DCED7884B0CE Arbetsförmåga
12,425,562 *015034A74BF782B7E0492D45FFC2B65410DFA88D ARBETSL
12,425,563 *015556B4B10367757042B031E74361E6512616F6 [email protected]
12,425,564 *01595E4ABF4762C6A3129B3C03ECDABA8A4BC970 Ar"bL
12,425,565 *015E2A890A35F4D85663EA25C7CF0914C628AD34 ARBmG
12,425,566 *015A565F8E62388DDF378A9B38DBA61A9B4C1387 [email protected]
12,425,567 *0155B8D34774E4693EB4D3F63DCFA581E28FF85C arbored!
12,425,568 *0154B472FD79C3D7AD16E321B6332EA50FB527D0 ARbro
12,425,569 *015BE08FDC425D7A3FF3647378ADE1CF0C9DE2BE Arbstoffing
12,425,570 *015DE0B1AF28D2521C1B6D201DC6C51D260321B0 ARBuR
12,425,571 *0158B38785511CBDED85A47D5B199793C8BCB621 Arbutasesing
12,425,572 *01535179A6D54993A5FF7084C2049033408D01E1 A;R!C
12,425,573 *015E77B7F72C20C8FE838187D8815749C7F2D110 A
12,425,574 *01588AB29CB4887B9DB18D098539726AE45B8BE6 Ar/)C
12,425,575 *0157B1D101F2B02DF11C98BD9993CB2F892D1D80 A%rc)
12,425,576 *0158086169DA6B0AA03428718DF3586C22A552CE A%RC0
12,425,577 *015D02AE4CDA7CF29EF8D417DBAA8C4A08DBAD3F Arcade$
12,425,578 *015BA7187070763D3EDAC3580F5A37ED0D49A1A2 arcadelt3
12,425,579 *0156D1EEA9BD13C1D3C2C92168C6EB888964A8CF arcadenform
12,425,580 *0150436715FD0A656805AD381979E6CAA2E4458F [email protected]
12,425,581 *015423DBEF6FF63193BB383A1A03A28D72E13A41 Arcadle
12,425,582 *015C27840BBE5610FDD012BA81AB81C734E6BD86 Arcadusing
12,425,583 *015DAFCD4069B89A98E38339F22379D4669ED433 Arcanges
12,425,584 *015FB087D5B49E7CB9FDFED6959CB683B92C3E4E ARCBe
12,425,585 *0153FF0EF9753CA659AC3929E338653365B61035 ARc!C
12,425,586 *0152E23BFDA47C637A047137451292B93239FBEB [email protected]
12,425,587 *015827806134DB9C7E6AB286DA23F618025D655C [email protected]
12,425,588 *015275D7C60F24F327447971E801A9ABC6C10580 ARC-DIVERSIFIED'S
12,425,589 *0154ED805298523E5FEC34B3778742E2EAB39383 arcenekirby
12,425,590 *015DCC0F74CFD70AE4B5E671810CCC5B09824FA6 arch1p3lag03
12,425,591 *01517EE16118E6525DE971F915F9BAF4D59A2F34 ARCHAEOCYATHUSS
12,425,592 *015055827FA9FEF4645778362FAEB2E1304301BE ARCHAEOCYTE4
12,425,593 *015148BCD49559784CAA645E5EDEF948B0F72462 ARCHAEOLOGIAN
12,425,594 *0153B5ACACC8F12F519F9F4820C2043AAAE3AAF2 „Archanjelsky“
12,425,595 *015CE43A82C6F29CA1A99A8982E2BC981CF59402 Archbelled
12,425,596 *01525C3EF9D5504B7EC6F873DF9EAAD7EE299840 archcountarchcount
12,425,597 *0157716C67CA7AD68382FA833A207C229997D776 archeis5
12,425,598 *015A56FDA6818C88D2EBCBE657A90F7992F2E009 Archeogenetikos
12,425,599 *0155BA5FA2046428973B4CF74D26B8176C702D3C ArcheologyEnthusiast
12,425,600 *01592846E0B266EA0D7D67198F11F944A3E68599 archerfedorowich
12,425,601 *015F22466E93F021FF2221F78E936694CD830D52 Archerin4
12,425,602 *01548ADA844F73A447937DC7E826581CFFA08142 archerycyprus
12,425,603 *015624A9D565FF6BE6798814A484740D506C0922 [email protected]n.com
12,425,604 *01533D1FA0232C976655AB3504D3E39B7B10C20A archibaldcarlos
12,425,605 *0159472D00DFECDF3468336AB6F512B9145CC81D ARCHIDAMUS I think there is not in the world either malice or
12,425,606 *015C2B8D4589D7B9E30CCE864E8E1831F5E032E6 archie.atta
12,425,607 *0153A563A44B24E47A078E4F94E25A3C31926F32 archie.beadell
12,425,608 *015F56D6386609215C2FAAB00DA05C8AC9910B43 archie.boedecker
12,425,609 *01550B4FE433B93AC8546D223BCEED8880B0F425 archie braganza
12,425,610 *01523B9C11A2D8AE8798ED1DB6E7BD3201B28C5A archie.defiore
12,425,611 *015A3B28FA2B23628D2B36E47015E5A982AF386C archie.delmolino
12,425,612 *01583721F7EDC1E06B0CAE4F2573604C63C497A5 archie.diederich
12,425,613 *015FA19942E0D8BC89C1FB6434C610EB2156FC9F archie.falterman
12,425,614 *0150E276EDDEDBCC6BADA2E99092933FCC4E200B archie.fournet
12,425,615 *01582C4DD15CBA6065A2573B9F78AA2C75E7D461 archie.gruenberg
12,425,616 *015AE3815FD3184855D46A5CF8B7FC95FE17A68A archie.hollenbaugh
12,425,617 *01572AEAC5319D83B863C8DFFF9C3FF11CC73F4F archie.huaman
12,425,618 *01596789B54FDF838351E1E6926D8935ACB9D741 archie.hysong
12,425,619 *015027CB4F3D56DB61821374F1C1E0F9A6D4B39B archie.latiolais
12,425,620 *015A63C296654374CE3A51EF4156A141E9B67F84 archie.liebold
12,425,621 *01593FD317855ABAC82A5DAC66D0FBF8F0FF77A6 archie.luehrs
12,425,622 *0155DADEB4E0B9E6C29F7AD4568B31E6892C23E9 archie.marcott
12,425,623 *015D9A06B60B0850B7B5375E1462E81D385749B2 archiepangilinan
12,425,624 *015A54FE68F1779A1D0D0B709BE76EDDFF347FD9 archie.rawley
12,425,625 *0152D028AE83B4B810CF97E6CF8CC4EA8E9ED901 archie.rotenberry
12,425,626 *01511E55A34F702EA4DAD290FAC4BAFBED188E2D archie.saelee
12,425,627 *015595DF3920BC1C8B185022523AABCA18DD17FE archie.shilkuski
12,425,628 *0156BD4122602F0C487A13624528FE758450C5D5 archie.smolski
12,425,629 *015881F44250B86BC4E96FE3AF82DFD34573E112 archie.sokoloski
12,425,630 *015E1620A0E27B6662F4B52CBB29EDC5123AA613 archie.surbella
12,425,631 *0156213F024303A161FD2A6B8C67BC711443BA81 archie.urrutia
12,425,632 *01571F31A9A092D6DEE599593B0DB9F87C9E867C archievirtudazo
12,425,633 *015C6D849EE0F3E8728E3DE35372AB193FDCE0BC ARCHIGASTRULA1
12,425,634 *015D9B2DCED8716A275C28A15D73A1DF820758FB ARCHIHERETICA
12,425,635 *015E34A28BE820CDF9D96FC1E68BD928833F665E ArchimedeanValuation
12,425,636 *015DE36A9734D7E9881FB6638BDE9E6145AE1289 ARCHIMPERIAL?
12,425,637 *0155947D577F90E14707D8199853D39045A330A7 Architaam9
12,425,638 *015042DFD5A0487E3F3886334700B76F0C694190 architects-without-borders
12,425,639 *0156F9ACA664D7544EB16471AD8BFF0205AA3839 architecturepasargad
12,425,640 *0154DCAB46796D768BD43D9DE8E32E738DE51348 ARCHITECTURE-VIEW-A-NERVOUS-PRISM-OF-A-BUILDING-FOR-MANHATTAN
12,425,641 *015C5756D91860D32C3B7CFA497649124D8FCD04 architekturocentrycznym
12,425,642 *015DDF30CEF2401CD4D1F3894C6B8210B1519288 archive01facto
12,425,643 *0153092C7A0309082531779F21DE379AB2C8A3BF archiveaa1rkay2v
12,425,644 *0150AE08288A37420FF03A8DC924C4BCA7237025 Archive/introspection
12,425,645 *015F3BAA32B8DA1A3BE0ED4455C7E6267C858BD3 archive (Netscape 2.0 pages).
12,425,646 *01586864CCF2C0CDD2991CDB8327FD9EBABC8F7E archivol42
12,425,647 *015053520DD361A9B5A4ADC7F0F2016D6737B869 [email protected]
12,425,648 *015E81D90881A9A1BEF4F86346CC1148C99896E4 ARCHNAMEBSW
12,425,649 *0152614D9A40A74C01D04ABCC253C41E47D5B297 Archplotters
12,425,650 *0151A91E0D56F4CBEEEC1463421500005D9E986F ARCHPRACTICE2
12,425,651 *015B9B1359072E79ADB379CE806B3750F6C1B388 archseducered
12,425,652 *01502BD4F3DA07A467713DA16EFB57BCC0FDF7B6 Archtest0
12,425,653 *015083095BCA11783F461EEFF8B83B9AE166D7D6 Archyvas
12,425,654 *015FA1BB99712C760F78BCA3781306026A3A5418 arcibenissimo
12,425,655 *015CD53DCB23966077F8806C928B07A544EB599E Arcidio5
12,425,656 *015E549A797BF90A3F190B7D1ADA06813545116E [email protected]
12,425,657 *015FB4270E9D57BF0B414FA814E53EAD874499EC arckeron
12,425,658 *015586935C56CC06DF43151F6DB183985B097B15 Arckings5
12,425,659 *015BD6FF6E51B4B856184511CA187C5316AC3624 AR%cm
12,425,660 *015147C72A16EFF156D4857835273DA8DEA87C32 ARCNIDAS
12,425,661 *015C4FAC6F7A865B0A773DAB94E812704DCCC28A Arcolie8
12,425,662 *01539080B2E67482F349229713BDAB0022EF5110 Arco–Zinneberg
12,425,663 *01505648B7B6CF0D16C3884AD78E64344DB7548C [email protected]
12,425,664 *0157F3C636887DD3BCB91083C3AD57BB0135C215 ARcSR
12,425,665 *015EC72B7A4E15757026BFE65847227442B39CF1 ARCTICGABRIELL
12,425,666 *015E0DC9EAC4A309A1E9E1461974F66214FF1CA6 arcticgambit
12,425,667 *015359154E9D4B127377FDAB7BDDAFA47B162D01 ARCTICREZNOR
12,425,668 *0151CF6784ACF5D55908D2182D6FDBC71F6B7056 arcticsidney
12,425,669 *0150A5F68C2B18A0C1255A54D851AA80A8CECE25 arcticsnowman
12,425,670 *015D9A966566CE66DB5B76002023BD2D311C365F Arctiled
12,425,671 *0159AE3699D2CA0E8D2DA17928DBAC7A74954C5F ARctO
12,425,672 *015E81F868ABC6C12DF9EED42B224C1FAAC35F1F ARCTRIG
12,425,673 *015632783D7A0750F6B7235D963F1A6EAFC937D1 A
12,425,674 *015ECF8294521DF5A7B0D960626A1DD1775FD33B A.RcZ
12,425,675 *015A764D0174360835E6A9199FA0836D1A49AF07 ARD;_
12,425,676 *015A8ADFC69D8EFC1EDE71A46164AD59DFE2CA11 A_rd)
12,425,677 *015A3B1B9AFE0843F332DB63D2F0F53B72FD4FD3 ARd:0
12,425,678 *0158AC0CD1EA175DBB6BDD1E3CD5D75269384FFB ARD8U
12,425,679 *01562860051918BD12A40FF2E82602D9DAF63792 Ardayamh
12,425,680 *015F6C5D1734FB1CD049956DBC22EB60C657EDB0 Ardb:
12,425,681 *0156C002D1F9938961E3B7F7A050185B3DD27304 A&RDc
12,425,682 *015DEC7CEAAB5206DD346E18858B3C4870AF3DDC ARd#C
12,425,683 *0150D0E5348804B8F27D74080F460C66912A5CAB ardchilalin
12,425,684 *015C9C238A16FE923A081D27EC1C8124FAEA478E arddwr
12,425,685 *0157F52C27E0511F302CCF00CCC1985C21AC8A80 ardeaes0
12,425,686 *015F7BCC5F3D6E6B7DCFA251D7A955D6C3B5FB3C Ardelar
12,425,687 *015538FB2C4F6F9EE38840BF5AFDD7F9D147AA2C [email protected]
12,425,688 *01546DA168CE894B68FD0B6AF812E795A0AB0260 arden.anglum
12,425,689 *015332EC8B76A6AC8FEEB14A5C60386ECC9AE0F3 arden.bagent
12,425,690 *015923C231347B75349E763AEA1BF3A73EE60C08 arden.ballif
12,425,691 *015418A05D9F6865501C1B57FF904987BEB4F339 arden.bendall
12,425,692 *0158C92E05BFE03A72BA4F5EE7B07A53A5D7FC07 arden.busacca
12,425,693 *01581E56E9BA11579FFC21AFBA8434258BB91897 arden.cristina
12,425,694 *015964759DA9D6CDED0E9F184448D45D7CF77BA8 ardencys5
12,425,695 *01515AA975EA7927644E5AB6060C3111E9240AAC arden.demarini
12,425,696 *015DF4E399131F747664276DB6BFFD34C6447954 arden.duell
12,425,697 *015E89E214EAAE295364CAB5D0C713F0DB5FE785 arden.edvalson
12,425,698 *0150BBA5B5A97BF8FD0EB98E4ABCA24CC7ACF1C2 arden.guarisco
12,425,699 *015434BEAB96B537F01313EFB22002E77DACF857 arden.guyll
12,425,700 *01575D6D3395F33E103D297E76748CA0F057AD47 arden.koor
12,425,701 *0153763B86DE8BFAA2FC0AFC72A4108C9CBD6630 arden.loar
12,425,702 *015C8160729F7E3814FC532EB100030AB1971E72 arden.mcleon
12,425,703 *0159348FC38955B3336D1D62461E0C4E728F695A arden.mehler
12,425,704 *015F6A3FE8C4EB2231DE616BA78B5F4F8AFBAD39 arden.panzica
12,425,705 *0156EFD3DF7E92C5EF800CE00FFC0C302230D1A9 arden.peveler
12,425,706 *015A851660DC3ED79E148D25D91BCBC4DE07169A ardenprincess
12,425,707 *0156DB91C23B3F9BB14F30D659EE819FA88FC5A8 arden.rachal
12,425,708 *015E0253C3ADA63CA97F857C54F8163807E301EA arden.sirak
12,425,709 *015B52C669CFCB688DC58EC7C5D031B36316E5E4 arden.skiver
12,425,710 *015FAF08B9283669E647E1770047279B1A4C562E [email protected]
12,425,711 *0156B3574A6BE1DE439923B0DA4D5E89E018C5EE arden.thackxton
12,425,712 *01501240927CEA8B34E548C95BCC3C5F248CD4B3 arden.thouvenel
12,425,713 *0153BC29E4259E32FF60135E897D3A75ECBC21F6 ARDESSES
12,425,714 *01586FFEAB75891EECBE8F6029F62F7E552C2BFB Ardetta0
12,425,715 *015630BEDFFFF92D327171A62317E11809239EDD ArDFl
12,425,716 *01547FB0172C755847265CFA0264365E4D0DC051 ArDg=
12,425,717 *0155271934FD502772F8324012873BA40D4338E9 A/RDH
12,425,718 *015895044F95BC366228463FAA2F5CA97501AEB4 ARDH:
12,425,719 *01510F03189E9326DD7AF45F9CEB1E24968E1E60 ARdh4
12,425,720 *015297ECD83FC185E58EA7F65E177FCFE3FB2059 ardhaad7
12,425,721 *01589E3EEB5E8B2C9E9C208B1F1C40113402DE41 ARd#I
12,425,722 *01507EC89CAB6B7F60DDB681D09751B78464A7A3 ardiacas
12,425,723 *01587E11976008442B13128A72A21E7A779CFB81 ardian rexha
12,425,724 *0154016628BDB8C049A4B21DD8EC6A8D0E7A1C2C Ardinda
12,425,725 *015E299DD5FE5FC42C57E67DFA2E06886C5DC0F4 Ardinelle
12,425,726 *01558EDE12D6BE3183C8E4801C32C68B14F96189 ardisa1
12,425,727 *015A1AD2A2A7857A5990F790DA044378CAC70008 ardisperkins
12,425,728 *015CFA438F9627E52061EA5AF243B5E743338128 ARD#m
12,425,729 *0157E25034295F3D1C1BADB327AB7BC70BA9ED00 ArdMr3qt4
12,425,730 *015ED50FCD11204B3BCA87EB10BF7FA808F018EB Ardomas
12,425,731 *015F6E2288BB9E9277C1D977D92C84F1F11A43E8 [email protected]
12,425,732 *015D3BCC26A81192229585C697452A6235FBB03A [email protected]
12,425,733 *015F09B347B3654AA9761EBC2FE4391BF4D53F8B ardo satria
12,425,734 *015D205EA71374EE5B0C22D08753AD6B907620A4 AR
12,425,735 *0156934BC5CC65B9FD2E95C888F93E9D408BF8B9 ARdQt
12,425,736 *015D3870254BF5F9A5729BE6624E6450441970E4 Ardrighesing
12,425,737 *015205E5686FEC14F860B25D26EEA112318A97EA Ar/DT
12,425,738 *0157C6A088E851D540C45A9F2F57930233FCF05E Ardue9
12,425,739 *015F0856B1D120A1222CB6D2FA5B579D0E0D1B22 ARd/Y
12,425,740 *015678C9EE723A8391CD56F0096B1489CD447D02 ARE?&
12,425,741 *015D01701291DB5FDCA069A8E476EA0E24F75212 A!"rE
12,425,742 *0156E82A9809B5F77588B040801AF38F2CFAC3AA Are010gis
12,425,743 *0159D26BD802FC031F3B61D2C44243F7CE5E6CD3 ARE2c
12,425,744 *015AB4E644EE57562DB9A38E79F24E8E728F7FC5 AREAFRYFULL
12,425,745 *015788499D9D0CA6C0432676510D300F775D8449 [email protected]
12,425,746 *0150F0F93F927CFF1A09B0BD41EE0F99E7DABDFD arebiled7
12,425,747 *0159F921B73E120D0E08F84A9302C3805B935359 AREBT
12,425,748 *015D816E1BA46FDD6B35E3ED7A846E8967618E2F are child
12,425,749 *015A341B0EDFABD5FE61B05C0D2D7198B84AFD38 aredaval
12,425,750 *0155F02B4FC9D164AA2660D94AAAE11CA732B9BA Areger
12,425,751 *015485D225315C355766C73E8C39BDF9DE52E9C4 Aregerga4
12,425,752 *0151217B617F14777B9145E7323FBAE6E75AEF01 areharrybabbar
12,425,753 *015668E68A918D6D5297421A67D4F51D2D7AE19C AREICHLE
12,425,754 *01524404ED0397E51921A680B1E6ED419E65364C Areigeli5
12,425,755 *01576550DFD64E1A4B5B0A549A66880513E9DEA4 areinconsistent
12,425,756 *01587A7CA8F71EF7BCC65522AF2577A4E44EDBF1 are-kristian
12,425,757 *015FF1B3211E08D442B93BB1D83BECF26AEDCD24 ARELECTIONS
12,425,758 *0152D1AE5C327279A757883F8F5309E19C89F413 ARELISYJOSE
12,425,759 *0152CA6DC02D82B3DA1164809559BA1AF6B11BAA Arellocn1
12,425,760 *01573CCE552150A623663A6C06BA0DFEA7278F30 ARELONG1435
12,425,761 *015DAEACC2C4D5847789FD55D59143E3E35E8F6D Arely274
12,425,762 *015B5BF432059231A23E42BAB263F1D97BE4BEC3 ARem+
12,425,763 *015B8DB8A35F2E8A0036E29A576136A73CCF0F7D $aremmo
12,425,764 *01559BC1846253781EFE8C149B452E61665A9BBB ARemovedwatch
12,425,765 *01545981A61731092F36EB3CD463C9F47FCF87D9 AREmT
12,425,766 *015BB3CC46D2C373F52C6087CD7B3A26E9911CA4 ARe;N
12,425,767 *015A7DB0D07F8BAAC3E6018202FF283D6453665D arenablancamarazul
12,425,768 *0153A1B617DF8DDB4AC4AEBD4FCA0F736C589841 arenados2
12,425,769 *015A40F5B44A28824F4EE2266F014CBB50D8A2F5 arenaexpo
12,425,770 *015FD967376F02ED4BBEAF872F7E2967E85A0893 Arenalp9
12,425,771 *015E90A6EFA48BBC33DD2C01FA78DCFF26E2C82D arenasal
12,425,772 *01545FF6FBEE5C992D739D9C6DAD1020E3ABE661 Arenatos
12,425,773 *015359C433D4327CDC19BAA2CA7E9677435F82C7 Arendaring
12,425,774 *0151B6623EB7956BC35FE1D48FF08E97D68CFA46 ar$enob1$m1te
12,425,775 *0158989E4E44F503143564A1B810BD8BE1940550 Arenodno9
12,425,776 *0155FDB7BC36B3E95AE103A2EA2C9A5A09CC9A1B arentzdelos
12,425,777 *0155F197722537D913CE29F36CD124195F3FD80B Arenumer
12,425,778 *0158939A3FA37EDDF495B5309A0C821964B0BA31 ArE!o
12,425,779 *01583D51F84192E357AB8E5EA61CD1F037D05FF5 [email protected]
12,425,780 *015E8DF700B8CB58E37888C5A4E0E2F4669D8895 areola tolulope
12,425,781 *0150EEC20DE9B646423942E4451F7FFD7953EAF6 Ar.Ep
12,425,782 *01598E4D24E2442B7050D3DB0E53C73407FC543D arepalya
12,425,783 *0151113AEFA8307964B4B4DBAC32A48085F23C35 AREPORTCARD
12,425,784 *015651D747FADA1ED2828BD0347D12771FCAB27C [email protected]
12,425,785 *015B2D7E6386CD8456722FBB2110ADCE793F37BC arerenev1
12,425,786 *015D07BFD3D6C0F9D2F01AB09C8D1D9AC33363E7 arerobra3
12,425,787 *015D6434D156C074BB161EEECDE99B8A7BC9BFFE Areroifs9
12,425,788 *01525326BD9525F56563AA1C24E243EB40EB67F5 Areroscope5
12,425,789 *0153CB6987AA0624BA79D2BEC56548B46713B4D9 Arertsno9
12,425,790 *01523B21047B4C709CB14EE91F3203B087E49817 ARESAN
12,425,791 *015CA100FA317475344B582AD29E6EC4CE59CCAA aresane4
12,425,792 *0150846FC86F1E14A30B695C21BFCCBA5134B32B aresbuchanan
12,425,793 *015CD89A7EE073182D654614AC10DA4F1288692B Aresirper7
12,425,794 *01514C342624F99319F8EB6D34E83D62FB88ADA9 Aresoppa0
12,425,795 *015A5AD5BDBE8C38FC5985EC687EEE846C159AD0 Aressefn8
12,425,796 *015DCCC72B7DD013310DB217E0FEFBF58091741C arestless
12,425,797 *0159E93492DF86AA75B7A579FE5B5350D47D42F4 Aretabus2
12,425,798 *01507E714D8CC2D17C335F6FCF306792AFABF7E1 Aretsav0
12,425,799 *0158A033008F92E3985FBBD9DBAE852CEA58D5EF Aretterger
12,425,800 *0152BE9778CBCB6D2419A7BEA392DF506B0C82A5 Areugver3
12,425,801 *0154FEB9FCC68044B391B65AF687F1D1C361C889 areulffa4
12,425,802 *015E80A7AF5C724F4D431D8ABA27268123A946D5 Areuqilp7
12,425,803 *01541D7FF3010F0C04DBD9787B6F26C937810734 ARE,v
12,425,804 *015A9040FD4AAC64E5C93DF0B75D8DAEC5C03377 AreV.
12,425,805 *01542AA6F202DB03B659F7181550A3FF1635574C Ar!EY
12,425,806 *015AF8769767F780A5C4B8B23101F252E6B9A85A AREY674
12,425,807 *015E918663B3C9E2BACA637011F622B0C9FBEBB6 areyate5
12,425,808 *015280C4A1B91959E9255D4CEB18553B3EB00B42 areyouaniceguy.comareyouaniceguy
12,425,809 *01561D477A800A65EFE440D9199C4D62A491ADA6 are you happening?
12,425,810 *015240A94B9E9BAB33D708B0053F4A1C9E81488E areyouhavinganyfun
12,425,811 *0157EA96E002B87229A18986E5155D871BE49B15 are you over her
12,425,812 *015488BFFEB913A61CA44CBFF33795C9D5F38246 arezrof5
12,425,813 *015A8C8612DBE254D82D5100A492EC95DA8FC565 A)
12,425,814 *015A67CDCD11B49D3F4EF2789721C21D85E9655E A$rF#
12,425,815 *015C260BD518498A1BEAF9A3D83583635DBC2A4D Ar%f%
12,425,816 *015568A1C2F8639466BAC8CBB5A780B5718E12A4 “arf
12,425,817 *015299A573BEE395215E50340A7B2887B2ED489C Arf.6
12,425,818 *01519A1817565716B360EA1A99CAF91689CA626B ArF:9
12,425,819 *015DF49A47DBA6B7339CC095CE475B63FDCF5093 [email protected]
12,425,820 *015518D852688F3FBBE32C80803652F74B7DD8BC AR_ff
12,425,821 *015684BB1619AAB3BDA9C559EE155687BAE236C6 ARf%f
12,425,822 *01563CFD72AC1592052DA5A82EBF1FA71A47971A ArFfL
12,425,823 *0159BE32C64655D5534873520BE4DE6FAACB2294 Arflying7
12,425,824 *015BD34E77AD3B40839474258660A8A2128B5DBE Arfneduj0
12,425,825 *015CDABE35A4CA317DA356C9E8502680E30A1FCD ARFP
12,425,826 *015B8ECA0C5312259FEE9154E4F78785CF9B9FE3 ARf(q
12,425,827 *0157850DDF74F915D2A5E43614A1ADAE3F1EF73E ArFWG
12,425,828 *01503333FD2045811B15E227BD2F48CFC37C2A77 Arfwqski3
12,425,829 *01504BBF2B28D91A48CBA59E13E2C0C696717401 AR.G#
12,425,830 *0155FE54F964CB1791844E32BDA305C40DCBB52E AR%G
12,425,831 *015974ADCD41E576E33C7BA28B28A7B9F317EA96 Arg01ian
12,425,832 *0156CB03A75A52532C25CE5EC61828A645173EBD Argamla
12,425,833 *01519D1EB8C4D12BB99F09E232F7B06C196FCE55 argandissements
12,425,834 *01522D92A25607412D2FA506093F3DD387706E52 Argasidses
12,425,835 *015368C77AEE3AE65A3F53D599CA4700DD6B2EBF argazkien
12,425,836 *015D13C296A51E9EE201991A1D2FAF167D93AE7D ArGE
12,425,837 *01584D641B1C230B73A9A5611C088AC1AFD90511 [email protected]
12,425,838 *0154D9CE9361BFCA7762CCDEE70E18C9AAEACE59 Argemira7
12,425,839 *015095EA695B6799BD122C9784B372F62905DA0D [email protected]
12,425,840 *015E6513587F1D6161B86F4F0AFE1784E2A8B930 Argenteam6
12,425,841 *015B59F4EB49A55ED8F38A4A14FD187B1BD347D6 Argentié
12,425,842 *015619985D062572468962256ADA2A7D47BDF322 argentinianexplorer
12,425,843 *015AF747B98299865D003947704BE166F4CB2AEA Argentinize4
12,425,844 *015A30225F9740054DB49DAF3FD2F55C240131C2 Argentry6
12,425,845 *015AE89048B874054C3C7AB5F2351C426CF41CF7 Ärgern
12,425,846 *0156D169EE3F29C41C247B244FE06807354BDEA2 ärgerniserregend
12,425,847 *0158FAD8867902C328182E616AF777AA5FC1D0C9 argeşului“
12,425,848 *0154E7E5C7D191DBBC78CF675D952FEF3EEA5256 AR,gf
12,425,849 *015AE2603F6524C8574AFC5FEF1987FE32F722DA Arghtxis7
12,425,850 *0153C1362F499B0C36F1560A04816BE01C64C109 argina55e
12,425,851 *0157130977EC03D6B8A1E2E07D4884458531D538 Argipäeva
12,425,852 *0152391C4C843DD2BFC69CD7ED3D2CF92634777A Argisrod9
12,425,853 *01543C234BB96E73F92A6F4743D0DBF4688C3042 ArgiveArgive
12,425,854 *015CD1BEB1420A03B67BCE70C1AC0B631CE855C4 Arglistige7
12,425,855 *0151B78D3E7339517C36AD14DC2180649AED319E Argoksella
12,425,856 *015FC76C3102FBEA6F0DCC18A18C51827E71FFD6 argolya
12,425,857 *0155B55D2D4C4577D6BA230D9091F2E9ABC035AB Argonaos8
12,425,858 *015C7A0462AE58B4EA84D8C395B94FC12CE7FF99 argo navi
12,425,859 *015CA319BE3DF68F3A2D41D4E42E3CC1ED0EC5EF ArGoW
12,425,860 *015E793C76367B3B0F4B83CF25AD63F8ABD9B9F5 A(RGP
12,425,861 *01547119058341961AB3C4A44345221580317C26 Argsnart7
12,425,862 *015CCAF6C5EF7E3A73A6E88829A42E4B6278DB4E arguirteias1
12,425,863 *015128ED8D1F36E158E6CE8393836AD8604E218B argumenterez4
12,425,864 *0157197180C5E673EDA316DFF306730719B13BEF argument.irish
12,425,865 *015C19AA83FBB2F4F45131C2C847469A764CE55A ARGUMENTKENNZEICHNERS
12,425,866 *015ED670426B9391538101C045BFA8866B0D2D03 argumentlashlar
12,425,867 *0152C2C02E06352F9815740FAA32BABBA25F4529 ARGUMENT--ON
12,425,868 *015D5ED9294F99FE94C2BCC43D1BA194F3786068 argumentssteven
12,425,869 *01530A5A1B990ED8ABE8A481CCD018A0A5BDF0FF ARgvd
12,425,870 *015A1240F748C57AC9156030A526A666EB17F4F2 Ar#GY
12,425,871 *015D5A9DC5DA72CF5B26CAC2D63B673BE9756E97 A%r!H
12,425,872 *015234DE7E60C4F1375FAFBF55DBFB1E04DFDD5E ARH5m
12,425,873 *015499DCB60AB38DBBBB423AA048B06364165217 ARH5W
12,425,874 *0152B1D76ABDFB2724F495B0757A94E218112FCE a.r.h.a
12,425,875 *0156238563E5B61BA53591D9D55F37644D59916B Arhaizmu1
12,425,876 *0150C307A55EAB9A1C8C6CC49FFF39CCFD430C6F arhivare8
12,425,877 *015ED56A2BCD5283511139CEB3946926F377B672 ArH.M
12,425,878 *01599594F7C2E458FF2165934A54408BECEFC356 ARhPt
12,425,879 *015B82DD2D4D33217713C6D46969222240C0D2DE A.rhQ
12,425,880 *015F8C621879A8CA2DE2A7CDE4C847A1E50BDEF4 arhtivaP
12,425,881 *0152BE583DD89466F90B5E974CF36DA19DFFD20B «århundreslutt»
12,425,882 *0154EDC0DC06537F4E0BF4002956A8DF5E42B7E7 arhzm
12,425,883 *0156B3457D74435D96532BF8B10D54E25D2FAE46 A+%rI
12,425,884 *015D35794EC8010B1C0F7EE2B350B190605A8981 Ar?!i
12,425,885 *0154CDF70766CD15B06D9CBE242384A82D5F5C5C ArI1K
12,425,886 *015DD1BC3419B6C9AA1F1335B16CA78B2E256616 ARi3"
12,425,887 *015A6B843530B73CB5A8BF280FC856F6BAD42423 Ari769
12,425,888 *0155FD6157A3F60D629D953D2F5068A9EF956402 ArIaF
12,425,889 *015567D67C68A30F3ADE625DE3F1B93D47FCC474 ariaicons
12,425,890 *01533F10B0329F92F158779DDE6F1E101D39CDF3 ariana818
12,425,891 *015D98062DD90A2821C278A2485F1E990437DB0B ARIANE]
12,425,892 *0154C26258C5158F170EDF80DEC6160F53ABAA80 ariane mosella
12,425,893 *01562D5F8627D0AAB3C239D8F0FD6B761B3672C2 (arianisme)為宗教。
12,425,894 *0150D406680AF7F24496E005A12B6214E28D6F75 ARIANNE123
12,425,895 *0150E33E730F72B708E2F8D097D2929C86ED3230 aria:sullaruotadifortunavagirandolasperanza(eustazio)
12,425,896 *01559FC0DB1D20A563A69D443EC4C8E40EB62DA9 Ariateur3
12,425,897 *015831D2F7867609FDEA45E7A96617374EAEE41C aricilor
12,425,898 *01523B145A05E5B8B31005A505AAA14C1BB040C4 A_Rid
12,425,899 *0154C84DD9E4AC4E600C859B67B523AB71320401 ariD
12,425,900 *01530CA4A218D798B6698279954FD6FBAECB5771 AR%IE
12,425,901 *015D84F5A3B3626F417DBEF09F3D256D37294260 Ariedel2
12,425,902 *0153198B305F6DDEAA8E898FDA009E50A849E6B3 ARIEGE1
12,425,903 *01578B445478FDA588F8C8F1B2E13463C36EEF59 ARIEGOS
12,425,904 *015472202A375105CD7FF3297C7849DE71265799 ariel.boyum
12,425,905 *015166CFFAD547CD573B676BA12EC4225206387E ariel.brangan
12,425,906 *015C8C765555F9964514A142AE25A23FA2F6568E ariel.bruscino
12,425,907 *01522F596587118A8FE83AA456836F5DCD707A74 ariel.burkstrand
12,425,908 *015E444A9D29996982A44AAAC1E23083B9B2169B ariel.davidowicz
12,425,909 *0155ACFF7C0D9CFF8BAEB47BF4E4281FAC6DDFC3 arielfritz
12,425,910 *015A31BEB25B918B1D3004705281D11B443F5109 ariel.garthwaite
12,425,911 *0158206AF3E52C7B127D8A5DAF947A297CC602D2 ariel.greto
12,425,912 *0157FF690B7C61FEC6888BE5A73DC76D416F248A ariel.gunkel
12,425,913 *015D627465D6FA2361A19ED319B4A9A9A8563349 ariel.hrbek
12,425,914 *015C2E23491424E57D2A77CFE157B87298B97CA4 ariel hutkowski
12,425,915 *0152038FDD7E38F05ED289532F1C2A35BF6BE5CA ariel.jeanbaptiste
12,425,916 *0155A57472571B0783EA959637841F7601A0E199 ariel.knisley
12,425,917 *0156091F7DBDD591C637BB74F360044721DC84D2 ariel.ochwat
12,425,918 *015A546BF3FD3F6737C6261C5CBC7CC3D61DD135 ARIELOTE
12,425,919 *01510B3B5F08ADAB90E1D9AAFCC35CAA02F58C41 Arielpauling
12,425,920 *015EE136A27E0B255DB98D9A0C26C2FA2E693624 ariel.rosberg
12,425,921 *0153B51AAA99E5C39540DB68E51BC2FB0B1389D9 ariel.schaap
12,425,922 *015362BFA87859915FF59B2BD7D411D59DF52C9F ariel.sniffin
12,425,923 *01527A19AF2BD0BCB4A4891DA4B6864D271234C0 ariel.sterett
12,425,924 *0154F2938B5B7089F4D2635CBBC8F93816B4002D ARIELWELCOME
12,425,925 *015624BDE97F8819C47C76A6BF50F84FBEDAA93B arien12
12,425,926 *015674E18B993AB504A7B8CC23A1518AEB9D9EA8 ariengarda
12,425,927 *015535DA421BA53EAADDC405FF9B5025E8552B58 [email protected]
12,425,928 *0156EAC62FCEFC3BECBCCB5C757274C693FCCDA3 ariessig
12,425,929 *0152AD4DAA9C864F1B14607AAE1931C1C080D47B Arigatou(instrumental)
12,425,930 *0156320332298DE0337EC03C518C169499CD7106 arignita
12,425,931 *01515060D955E5466B3291FE0045BFCDFB5169DC ariigawa2
12,425,932 *01513E2DA65E952E14EDF26DFD7D1188ACAA6BB0 Arijono3
12,425,933 *015DA4F9E9EA759989BDAEF58F92E158FEFEAE66 ArIKP
12,425,934 *0150CF8C05C4E9BAE5DF08571377F7E8658A1721 Arilicis
12,425,935 *01582679FCA6AA5E2FA0DFD4ACC33651A5B33057 Arililja6
12,425,936 *0155456967F7CFAFF99643C9C55C8A7A0FAD8FB7 arimathea1
12,425,937 *015B1F130550DD93A82CD7CE98955BD956063E8A ariminda7
12,425,938 *01588D42C2A5952A1C9846521EDEEDD5174B0AA7 Arina Borunova
12,425,939 *015E99791F46B3936AF55F8A14470DA643266F14 ARIP#
12,425,940 *015195F9BBC222CACB7174A9EE0222C28DD0EA94 aripare1234
12,425,941 *015BE52E36C649201319E8099A07A973A64FC86C arıqlanu
12,425,942 *015C22615F5613EFCC7C7BB46A14311A369E81F1 ariskrisna
12,425,943 *01533C519ECAD5B2AF50C54CAA563FEC50EDC8B7 arispanos
12,425,944 *015D6A37468322C58CD0D3B21200D47106464E35 aristenes
12,425,945 *0159126A3D6606627B333BBD2195746208F15CC5 aristogejtona
12,425,946 *01592A998A3243FEC121E6E2F42957C0180B1CD2 Aristoklès
12,425,947 *015A82874002076152321F916A3CE988B77D4BAB Ariszteába
12,425,948 *015CBB6A89A92FD0E72DA7F926BA1A9F531ED661 Ari_t
12,425,949 *015CD0E17034433F887B875F5C716C76618C528B Arithmetikregister
12,425,950 *0153A24A99CF56F967B8EBEFA47749269D2C33A6 Aritima8
12,425,951 *015C15D220F9C7182BCE27926E03C20317C72677 aritri ghosh
12,425,952 *0157C012CB1D34C3464D23D9C44F4A7E7C29F441 ARITSIM
12,425,953 *0151D348302BD24DFFD81F9D4EE9E3583AD6C6D6 ariv azhagan
12,425,954 *01558297251F41C628B9E3D5CC256E9FA51FEF1F arivera629
12,425,955 *015F3C4D4851E5E8976B364158C1234C7B78A4DB ARIWS
12,425,956 *015BE85536CCE34E8302E2621882062E5D6D8E25 Arixaraed
12,425,957 *01531F9D890EB93DFBA9DE61F9259CD404FADA10 arıyan
12,425,958 *0156F5BDC609C9539B7F9A8856CBF323FEB8FAEC ariyoshing
12,425,959 *015F7CAE641F0B67964BB803B63EB3EF03D4F7F3 Arizonavirginia
12,425,960 *015BCD2A12CF7015A75020B4357F6301609CFAB9 ARj)(
12,425,961 *015688B8BAF0E96E38079FC51E108D56BD8419FA arjay alarcon
12,425,962 *015CDFCE66D4D46B820CFB6EE19F7AEC3EEDA33D A=Rje
12,425,963 *0158C1A00F3AE3DCDCDA315734D92FF38AB3B6CA Arjoissa3
12,425,964 *01592087CC2A16420431FC438BEF424A2D8FE984 arjumandbano
12,425,965 *015267D1661E13F08025EA2C185A45E9BDBD39E9 Arjun4u8
12,425,966 *0159C9081B3737EEEF5249CEEA542523E6014B7D arjunawiwāha
12,425,967 *01565E9C8AD2D666B8D5C71A14EA8E7AA2A49145 arjundash
12,425,968 *015EF09B7B3BBDA69EA6C41B0C96AAC605636503 A%R%K
12,425,969 *0151254E122ED7ED2FD1D77E030536A0D22D0287 A%_Rk
12,425,970 *0152DA574AE862C96ABFAD17C11B9C00E37A2B79 AR+k_
12,425,971 *01511EE5848C339282B143F5166030A7D5D03BA4 A#r?K
12,425,972 *01544A8CFEEC035CEA71C910FB64EB7B51BC983F A#rk.
12,425,973 *015A38F861F7D7A17903CF703EE009A711C4A1A5 Ark.
12,425,974 *0154A836665FF10AE188D6567986A293E71FD165 A%rk3
12,425,975 *01543DFF67E128148E641439E463199B5A4E9691 ArK4o
12,425,976 *015BA120C7E2138622DC427B844DDCA7C0536092 arkadalarmza
12,425,977 *015BCD54EA05BBF785927C6805F43D6D4DEDBEE7 ARKADASISRAELTURKEY
12,425,978 *0157EC2B4D6F0B7908DB12714282767BA8C9AA39 ärkamisaegse
12,425,979 *01557D4F34182085F280B05956E6B6A3E493585F arkansasgravestones.org
12,425,980 *015BB518AE2A27D3EE77A12C5506BC5D6AB0B84E Arkechia1
12,425,981 *015EAE83FC13F78C6C440D256649563DEBB1973B Arkechia5
12,425,982 *0159E0E315002DDE852D0EAAB81E2F3C741683EA [email protected]
12,425,983 *015B387956884B79872F7E6D2596F3915C27CAFC arkeometrileri
12,425,984 *015B00373E0907B5D6139296131732A69004D3C4 ARKfG
12,425,985 *015B35BBA7D5D7A0B32D87C707DAE729551E8EAD ARKFOREST
12,425,986 *015F00A864B2F1A3C629EF8A5D831B56A99F661D arkfv
12,425,987 *0154F4AE947E443B8434A87E447261854641E6A5 ARKH7
12,425,988 *015C7100774648C9E4D9D8B881CB643935573D95 A
12,425,989 *01595E3745E99144A28C93CD3DDE34407385C6C3 arkiloking
12,425,990 *015F2E84FE89858D6A2EC8CB2F57D793D0FC1C1D ARKJAN
12,425,991 *01562980834AD35CB4FA92B253D23820B063B7D6 ARk?L
12,425,992 *01553232899F50A733348084F48FBEBA702BEAD7 ARkmu
12,425,993 *01530F0BD08EC65F3FD0E6C91CD81FD58A2B0B46 Arknight5
12,425,994 *015BB8AA72C2506A623366581D9E039A10B37BA2 ARKREDEF
12,425,995 *015BD771F153B3D0571027700D01BA1DF85E9198 ARkSW
12,425,996 *015873CE686BEA06F3765162B6B8E4E7B6685BCF arkunst
12,425,997 *015C69B4B0587D2DE7739F94749D4E4AF144F2C2 Ar"L$
12,425,998 *01593A85B7E278B34551024A3BCD49F611F90061 Ar$L,
12,425,999 *015D9994362E33058A833350A4305ABDB18506A2 A{rl
12,426,000 *015858F7B5A001E2A8B34EF11B23703ED7264D8D Arlanbsw6
12,426,001 *015B905C9B9FE3EEB04C4A003980B8DE524E5BBF arlanul1234
12,426,002 *015619836C79454D20C5B22AA784E302E1FDFC63 [email protected]
12,426,003 *015A8EF0EF786CFB8C383818562EE49887913F59 Arlboro1
12,426,004 *01551E3AC523C0AFB186C4D0582161D909376065 ARLbq
12,426,005 *015C86ACFA5CE0686901AB4B5CE60F68715DD235 Arlegung4
12,426,006 *01570BD8D5B52E5ED167C07D61260A026F462658 arlen.bawany
12,426,007 *0158CF210FF6B2A0AA2761C17E87F4D71460A69A arlen.boursaw
12,426,008 *015B887AFF109D5EC07D8DAD643C53C969A8B7F1 arlen.bunda
12,426,009 *015B75CDDE09562391F84ECC41546CBD4722118F arlen.cancel
12,426,010 *01552B9B91E7EFC8B41E2EF89E81A4A69430DF1F arlen.chadick
12,426,011 *015A72A1A40F33F069D14DE25451D24EADA20FE9 arlen.chard
12,426,012 *01553456DDAA453C78CA9813DFEB639C8A0C7E0B arlen.cochenour
12,426,013 *0155791C4EE690CCE342C042F412559EA7BED21E arlen.eichberger
12,426,014 *015A191AD6ECA92FB568DA20E83343D3E5035843 ARLENE'S AA1 R L IY2 N Z
12,426,015 *01530C9DF56DC5745EAC00B8FAB34ECEE0496C69 arlenestrunk
12,426,016 *0150A6327457172D6F3A736FFA2352224EA7B12B arlene tamayo
12,426,017 *0152CA4807BBFCB09366904B4BBDAABB825DAE35 [email protected]
12,426,018 *0154E8076DA8C1CC62C1C74EF01D8C9B940A13A8 arlen.figueira
12,426,019 *015066435EFEEB6011F2BC6A1F8E0DBCAC2F9E7E arlen.fisichella
12,426,020 *015EFF7C9E6AD439DB509DFDCCE7F8F183CD5E49 arlen.jonathan
12,426,021 *015F5B6960C9F4B6A84865AA61E9536C47CAFE45 arlen.kapral
12,426,022 *015389F1920C5C7C5A655E3C6B071ECBFD3933F1 arlen.laforge
12,426,023 *015B6A81F6A61196F47ED55688B194C0206D37CE arlen.malafronte
12,426,024 *015AB90F9D16D0C6838B4EFB81D985B490B90CB0 arlen.mccusker
12,426,025 *015939C29A34F2634AE54A5C0E50BCDE9F7187D0 arlen.mistler
12,426,026 *015D9C467A7C7751C707044FF35ADAE4A47D1D1E arlen.potucek
12,426,027 *01590EA6DFC488793EF7EF18547F71F4AEE5B29A arlen.quintania
12,426,028 *015A615C215B29F378B17F0BEF08C0D720CADF54 arlen.sandholm
12,426,029 *01538AAC3E1CEFB385AF104716D597B378D0B0D1 arlen.swales
12,426,030 *0156627D7445B81454F29BD00A0ED2A586D6622F arlen.tropiano
12,426,031 *01598A06BB34706427D15A0D291F05CDB8523459 arlen.twitt
12,426,032 *015022B53B62C49E8733119B4CE40F2CEC1DC733 arlen.vanallen
12,426,033 *015E675A8AEBA42B87D188DD7C919D1387365E05 arlen.winders
12,426,034 *015E77E26D3336481C45CD64960673C7F8B80931 arlen.zrake
12,426,035 *0156C6DE1BA0D3AE8C7EB28B4B75A3DB71A7B5E7 Arlepatte
12,426,036 *015C20D85F9C72CFE96A23BEC2804676EA73F589 ARLESITE
12,426,037 *015EA82E3123ECE9C0D07DF929D268906BD149FA aRletA
12,426,038 *0153B95A88B261E4FEFE96B11C344946309C821A Arleungas
12,426,039 *015D030ED2D9B0805F4C004A2F83E85CA02CAC4D arli55
12,426,040 *015CC6A1FE5D12D69B8949E4B2D6CE1F9FACE252 arlie.alvis
12,426,041 *015A181B86656A4E34AA979F59D5AEFCCA2C13EA arlie.awe
12,426,042 *015171CC464980E74ABD3B709867A815D6C6A605 arlie.benes
12,426,043 *01545D5180376A8269D55ACD0F20542E8832B800 arlie.claes
12,426,044 *0156850825FE08DA122B81FBA19B086651CADBD6 arlie.drozdowicz
12,426,045 *015F7B24E7C4006DED7E293E4F95740141DC77B5 arlie.gardener
12,426,046 *015CB36DA3A6B638A4575B7812C4FDA4B0821B63 arlie.hekman
12,426,047 *015F64983C01E4731418CEFFD3C1E6C4C200944A arlie.jenness
12,426,048 *015838FF8B95D4D137B05CC30B6A3A84E9BB28B7 arlie.kabrick
12,426,049 *015A48D23280ED6F0D2EB33CECAF761EBA18131B arlie.macedonio
12,426,050 *01510FD06A3B0F0797DECE31C27ABEA917307408 arlie.milush
12,426,051 *0151F4D1621942DA5D36C22C279D0BC7C2C39ECC arlie.minto
12,426,052 *01554880A6A18B768D4C537F5A545E8AC3AF1FF4 arlie.olm
12,426,053 *015CB318607DD61FF0E0F2BCCBF6868F0233B59E arlie.pesso
12,426,054 *0156D4B6E8929A5EF5593EFD17C8539A42F4EDC8 arlie.poppe
12,426,055 *015E990BED8CEB6614DE7FE787F8671E5EFABCA8 arlie.preza
12,426,056 *015B4A9DCC31DB36A034C560BD521AAAB0323087 arlie.pusey
12,426,057 *0152EDFCE22C36AF1B03738C6BD3E515C8BF07CE arlie.resse
12,426,058 *015A5D3307E2382132A164F1AF1FC32BEECE68B6 arlie.shigemitsu
12,426,059 *015376C03522CA6DA92C0C2352D9F295C4D192CA arlie.siburt
12,426,060 *015109DCC223213413263AFA09122795C1325FE8 arlie.then
12,426,061 *01566E93729D1E02F5D3FC50CFD4262C501DDBB9 arlie.vetri
12,426,062 *015591AC13B5064E648B69DE9526472CF6204375 aRlINDA
12,426,063 *0152902C20EA35730121E18BE7D1FA60D6B1532B Arllined4
12,426,064 *01514D81B46DA9B979E149C144193042E80975A1 [email protected]
12,426,065 *015926A60425C3180E79D80CC609D2630C304DDC ArlRn
12,426,066 *015EAE96E8C35BE67FC8BBA4CD3E9F2F2D295C2A Arlundo9
12,426,067 *015BC83467D85A0F4DA107C5F076BAD47BE3C2DE A;Rlv
12,426,068 *0151F98D757380CD05E13B7E8FA06F6537E3DC25 arlymontes
12,426,069 *0159FE35AA662CFB345B73DD051BAF11A51FC948 Ar
12,426,070 *0150B75EE2FEC3EEE2A1C3CC636BA1AEBF00B9C5 ARM3L
12,426,071 *015F96C468D79D19D89EDFDF2D160489727ADBE2 ARM6)
12,426,072 *015D7C5406E37A0272D44E865E76E1490023FC76 ArM/8
12,426,073 *015D4AF514C8666540BA610C3D7CB7961D21D1E0 [email protected]
12,426,074 *0157C7FC469DD3C8A484EA023976C2C9BCF53087 Armainer
12,426,075 *015C4AF9AAB9A1A7C48C6DAD0310B442C317463B ArmaliteRifle(EMIdemo,1979)
12,426,076 *015E7CB81FA470B0AF4E8A9F1824061284AB6829 armand.basso
12,426,077 *01579FB4E625581DFC06EA726DB699FE16063C64 armand.batchellor
12,426,078 *0153CD9688EC9A5AB0F852DB5DE93C41E72A1079 armand.bourff
12,426,079 *015CAD079E7ECFB9D12E3DE7B2928447C0BC0E95 armand.colantuono
12,426,080 *01521AC1D3C62AE2E22E1F019D4BA560C8FA7857 armand.dartt
12,426,081 *015D4C04DD7F4A8D8FCD47748A545E1667909BEE armand.dockray
12,426,082 *015414FEC50ED5F4E52A2DE51FEFFC276A6F44AF armand.dorrell
12,426,083 *015B8C36A94795E4FE822B3CC3043644C17DADA3 armand.dunmead
12,426,084 *015BE596335BEB91AEA30C38A02939F0107112A3 armand.grundy
12,426,085 *015987E04B9FDF06B3B7DD3AC55AF4884351FF17 armand.hudman
12,426,086 *01550339E981420E5038F2130AA712F9152FF2CD armand.huffines
12,426,087 *015CFE73F3E35C18E42C185DB0FC8375B16BF2A9 armand.manthey
12,426,088 *015929916371621C513CD0DD9A5529166AF5ADC9 armand.mettle
12,426,089 *015EC8ADA992A222F7F8545189623591C99D4DC1 armand.nicely
12,426,090 *015D98A2C2A05D63AA3F97F59AF7366DDAF1D084 Armando624
12,426,091 *015537269F85C6C9CCBD5E5510020E897785D6BD armando.abelar
12,426,092 *01538CC152B08906A980D025F1B5FE2D5A317F67 armando.augusto
12,426,093 *01533E2E526E0B27EBBC26181D453F7137AFA205 armando.causby
12,426,094 *0151B043AE45076D5A99BFCF127CC7D280BF27AE armando.cribari
12,426,095 *0158734B07824E6A18D423DF43F26B65608C1574 armando.delprete
12,426,096 *015AB0469DD71BD9111F0732B6F83687C2E3F06E armando.denby
12,426,097 *0154DF174AF0FACA1926B596AC3305F036FC4A2C armando.esbenshade
12,426,098 *015121CEEB2C51CF22F02E8A9E2D1EBCCD9E9D4D armando.foronda
12,426,099 *015184C08FF4A27ECBB24F8026A1E7C32B17E4A0 armando.gadbury
12,426,100 *015822CA37E8DED6619451B064635E94FE0085B9 armando.ghazvini
12,426,101 *0156EAB6258BD01E69BDA4405506CA0E81B96419 armando.gongora
12,426,102 *0156D402A4529185836EE8A17F2C30FAA2D749F5 armando.mccombie
12,426,103 *015D172C186E8B1B5E5B09AF76C8E573A87E91CB armando.nydick
12,426,104 *015CAB2A9D5054A96631FDE5ADA4888630C4AC97 armando.ocana
12,426,105 *015825C0DF0E5953609DAB5E6B2BE81620B4FF63 armando.ogunyemi
12,426,106 *0159B59258AF94C41ACF5A4F808694A9EBCFC936 armando.oravec
12,426,107 *015D1BD1E414F3111C1BCC40C5B98F1AABE391D7 armando.rienstra
12,426,108 *0159CD94A4E1561C31700BC81290EC80851A55A0 armando.schuetz
12,426,109 *015570BF051C812722BB125E94386EB829CEE58D armando.waldrip
12,426,110 *0153F70B20EF3F46CA4E686576D8763986D9A94D armando.wiinikainen
12,426,111 *015D8247D88C80A79C3A35367F00B7852DBF2342 armand.ruacho
12,426,112 *015D3C9B61AC5EF6362D41915FA46E32BC5EE401 armand.ryal
12,426,113 *0150AE0D30B4BD5AE1A686F567575795E663699A armand.villalobas
12,426,114 *0158931CB0A762FEECFB6CB0F3433D549BF43007 ARMANI0
12,426,115 *0151EEE7FD7C5C6EA0C8C14B99DE808E294D33C8 armanifreeman
12,426,116 *01506E4B5B97C3F34D2D7806B346E18AF4908772 armastadaaelitaaero
12,426,117 *015FE624BD267B408C3093BA1938A07BC148EDC8 armastain
12,426,118 *0154ED50D8D0FD4063B610DECB27A724C9C6FAE7 armastusjõuga
12,426,119 *015390C2889A880875C0A0269C4BE02A582E9116 armcere8
12,426,120 *015065B1BED6C836CC2F86527C870925E4CCB5CB Armedinger
12,426,121 *015FDC3DCD5171C6F8A205E1FC5D33DFB0504BB6 Armeemaschinengewehrschießen
12,426,122 *0158BFF5DD0FAB924089714BF5FF87B8DC69AE4E armëmbajtësja
12,426,123 *015AB952902764664C505ECC465BA25800468041 ARMENIAHTTP
12,426,124 *01536E56428DDBD1BE52278BD2429E24416B8559 armenskem
12,426,125 *015A2A8C33DE2C13ACC92915C5A3B7A1CC1FB1D5 armenviertel/n
12,426,126 *0153C3E34934DEA010DB440F0E245BCA6145FDCD Armesine6
12,426,127 *0155C9B930D61005A100A4427FCD0DC4ED452FD2 Armetuses
12,426,128 *015851875E18F9477A05CBAA34D70A3CDEA1B9C3 armiarmi0
12,426,129 *015F9872EE3A9F83C7883B5973C62B5CDE42E284 arminsmajic
12,426,130 *015B29EB7A695A5B1B8D197CD9FF26C6E63B87C3 armitageimages
12,426,131 *015C3C283D6737F4E9A65172A1870F4C32FAF39F Armmeest
12,426,132 *015952E741D5AF00C0D0930A55C1D81D9CCC2ED3 armodiwn7
12,426,133 *015AFD0C1CF9789727EAFCF2A593C8B425113FC9 armoirie1
12,426,134 *015C038E19DE8A0AD13A93BA4320D51B4200B39E armondoring
12,426,135 *0158751FECA6042442670E21DA3BBF59F0D5C05D Armop
12,426,136 *015E83EA320675E2BCFBF98BC218536121F0CB0C armorring
12,426,137 *015B55682C08B22FEB42655CF51E665A9F00A693 ArM+R
12,426,138 *01535414876CB427333C8E7E621759B1D9B05CB2 Armscyes5
12,426,139 *0151809C77D8875AD61F63A8F161F406EC128276 Arms of Indifference
12,426,140 *01530AC70F9964AD19DEDC352C4BC8D6C7C00CCC armstrong9jul09
12,426,141 *015DBDA7656C0F251FB172646C9F1BEA0D6275E2 ARMSURD
12,426,142 *0154767843C5C469DE49D68FDCAC0A46E721CED7 armtrouted
12,426,143 *01564317F3157FA28C7178BCBCF07E82FEF27B86 ARMYENGINEERMUSEUM
12,426,144 *0152430397F3FC3B373887FCABF4F8E499B674B3 armying
12,426,145 *015879EEC49CEC8857151A6447BB593EC0661BD6 armysoldierone
12,426,146 *015A1163A5A5E827DE4A6AF1F24092A6F68EC31E A-Rn,
12,426,147 *01549BA30E1666056C138D4AA98C26D2A21948B9 Ar!n;
12,426,148 *01579587F17BDC96B56090C8575103934C42299D Ar"n
12,426,149 *0157E88DFA61186809D5E7EE04534B94B01A8689 ArN1r
12,426,150 *015815D8849B339AFD5D5EB4CC2D3B70AFF3519D ARN$3
12,426,151 *0158900AB6ACD33C5EBC176539A4379E663A1C98 arn353
12,426,152 *015F7E7503DC6EF956C9FCC1BA68ABD6E7FBBA8A Arn5%
12,426,153 *015B3257AAF57E10547159A1C1A45B2D317F0783 ArN5s
12,426,154 *015DA6D6BB8AE0D069C2A52E025192F5A6A96CDC Arnaud Samuel
12,426,155 *0157DFCA5EF7DF0C2B4F4FD9C904DC4D548127C7 arnaz.2
12,426,156 *0156A98100603D628487BEAEDC7D4445A1428E7E arndstr
12,426,157 *0158D67A67DE59C90C24E904A8DD1E80BD6A2DE4 arne22
12,426,158 *015E4EE3D2FC3BA251CAFB442E57EDA3B0796DCC ARNE-BARHAUGEN
12,426,159 *0159A3926D8412675B3560D2C2FF8A36CCC43275 Arnegarded
12,426,160 *01507020E2009A35500794611D359B3BBABD13AF ARNEL16
12,426,161 *01586B2967A1742A5C347440B4B2D0B9D19BEBDA Arnemmases
12,426,162 *01598F6C28520E99FC518AA660C4E2C883A76CBE Arnesiisenra
12,426,163 *015CDFB32464B9C34FB542D55017848182FCF0BC Arnestia9
12,426,164 *015293A5FCE6202D47A9B9C24D4C9C5B63353907 A&rnF
12,426,165 *015846E4897A404BC8C949675A80380A29C60CEC ARNh6
12,426,166 *0156FEB6EAD5C54FAEE80CE35F234DE31216A2EF ‘arnhem’
12,426,167 *0154FBDB070B940806ABE1C8A52536491973B4B2 Arnhems6
12,426,168 *015AE6F987EEE8F935DA4B32419F11EF7D984CDD arnhsewses
12,426,169 *0151EADD71C948B18FB94F20437D93415A7B257E ARNI4969
12,426,170 *01546B9BAF32AFD1CE070343C6283EC4E27C0B18 ARNIMPOL
12,426,171 *0151746EDD9E4FDF64C5457BB27F2AF66F7531A0 AR.Nn
12,426,172 *015680380E3D3E84124BF937DF08E804D1209C26 arnnnn
12,426,173 *015564A9458F2B9C78E59CE816BBBDB8D1673FF6 Arnodbc4
12,426,174 *0152B9FBA61BEE5CCB8E0BA629EE06E2AFA07C8E Arnoides6
12,426,175 *015C0D3A211C2653DF601FAEE4CD8D32FB0AAC82 arnold.caminos
12,426,176 *015241355905B24C101C690CEFEA2127DB3E27F7 [email protected]
12,426,177 *01517D15B5BC5D8E06970E7B202F61EE94D3B853 arnold.corvin
12,426,178 *015761C72E5898A5065A16F986CFBE761B7141DA arnold.dacosta
12,426,179 *0156E8AC4F2A5B1EE037D7842C6913883C4D59EA arnold.dischinger
12,426,180 *015ECE06E2800A4B3CF9CF09541DA66953BC4454 arnold.dunning
12,426,181 *01557BD09924A2AC5B01A8DEF8F5C535980B1304 arnold.eaglen
12,426,182 *01503CED845473D5AB9E68D3260558AD2264867E arnold.fagan
12,426,183 *0159AD9F0D1E0EA83894393554BA8D732F2E62F9 arnold.galban
12,426,184 *0156BF9EC295FEB75B74E399E56B28CABCF79D12 arnold.gaona
12,426,185 *015A23E9013668CFB05F974844A1E9742086B41A arnoldgrecia
12,426,186 *015199920AE1E15719B1C95F4B30C0CC3C5CE96F arnoldhamilton
12,426,187 *015271E98D4124D8344C03E6146B627186CC8B2A arnold.lindburg
12,426,188 *015F80B07247931EDA57151036BB5648F277C816 arnoldmcdonald
12,426,189 *015E5DE43C9209F71BBB6F64DBF1764A071FD876 arnoldo:
12,426,190 *015B7136C055A086786A8F38105371B03146F2C7 arnoldo.basey
12,426,191 *015898549F48B2B32B808C1E19DDF11647282D0C arnoldo.berisha
12,426,192 *015D002125581B766043558C80E702FB92BCB020 arnoldo.blubaugh
12,426,193 *015E7A8CB84ADA5B1962AE1A4F1EEE82A732B008 arnoldo.borchert
12,426,194 *0154952E8283B79822508C27D941174305F9C169 arnoldo.cipolloni
12,426,195 *015A29A6BB40C0FD9BDA0CB2C7F2778ECFD047FD arnoldo.daiz
12,426,196 *015699C2631C1478301F7C89A05C0B5DB432D588 arnoldo.deangelus
12,426,197 *0158E18B868D61116F4BC30EA4D4418022C22994 arnoldo.delgadillo
12,426,198 *0152DA4ACC1B47AB012BA1FDCB5C3D29025F1983 arnoldo.dowhower
12,426,199 *015FF5601B266F9D0302C26B6DF6A68AF43DE9A2 arnoldo.edgeman
12,426,200 *01556A80AFFC054479657B9D03867D3B02A000A0 arnoldo.eischen
12,426,201 *01509D26C3061D6E0D020737CB7D9A1E1B45DCA8 arnoldo.frith
12,426,202 *015D7CFABB4ED1F22A57FBC520B2297C0B2D2F17 arnoldo.kardux
12,426,203 *0154C5775B12F13B4D3DC57D4F91849D96ED8637 arnoldo.kiltie
12,426,204 *015B61ADC3E33AEECC0FB7B715444DF32EF5084C arnoldo.laesser
12,426,205 *015D2FCC89B4E1BE63C4E99F8D9D09796DCC1D14 arnoldo.lyons
12,426,206 *015350CF76383D6CA23146A4F6BEDC5E619F012B arnoldo.macnab
12,426,207 *0155F5D51E7DA9FB69218928BCB9AF87EC4A8848 arnoldo.muoio
12,426,208 *0157AEB6BE6A5CF7258E1BA7162E342B40184C74 arnoldo.ousley
12,426,209 *015F2E8293E8D44F6501C52B8E64F972D99C8E9E arnoldo.pietras
12,426,210 *015E12E350D8CD1A41D146A2D4AE5A3C30FBC6DC arnoldo.srsic
12,426,211 *01532E867B84BDA8AF415D23ED8D1810B504166F arnoldo.stuessy
12,426,212 *015BF5824AFFE6BF644DB3B3DBD285037AF67F53 arnoldo.tanweer
12,426,213 *015DC34E6FEDAB49109D806CA48B991B9A85E40A arnoldo.tomblin
12,426,214 *0157B5DF8F1C599074EB57E05704D3FDF25DDDB9 arnold.rusi
12,426,215 *0154875530EEE46CD884C500014D17F88CCE5B46 arnold.sagar
12,426,216 *015F87F4BECC7696EC36671E1A0A3A303F69B91D arnold.schlett
12,426,217 *0158FBD1791D23EB1119679AC74D8C7C2B9112B7 arnold.serfoss
12,426,218 *015E4713F6B893A1ED32274365E22730E62428A3 arnold.spidel
12,426,219 *01534492DA992D3150BE924C17DA4A78CEC985C1 arnold.spieker
12,426,220 *0159E36186D21986E5A3065E7D8110713784A1D1 arnold.striegel
12,426,221 *015BB2B6BB0DB932A89078EBDCF4F282ACD651D3 arnold.sydney
12,426,222 *0150C3A1EA4C9EA1B0B80E9B9E4F428861AF4345 AR!nP
12,426,223 *015719E79D46F8D802AA58C0DD8BE6826CE5A4F7 Ar!nr
12,426,224 *01516CB5C9C01231414D853ACF5EF8FEE2C163D4 arnuads6
12,426,225 *0152F26C2A2110F99447B8F2E78D184DD619324D arnulfo.barbarito
12,426,226 *015190AED4CCAFAFE4235EC1CDF59CE57287C099 arnulfo.boddie
12,426,227 *015B49EAF87A477224D4379865B93DDD3F16D254 arnulfo.campione
12,426,228 *015D1AA695231E4C37E82E1900016CD1EDCF2FDF arnulfo.conger
12,426,229 *015AD1BFF1178C476B8F3CE343BEDA21205CD8BB arnulfo.feazel
12,426,230 *0158F4F72608BC421455C66F735F492BFB4D6775 arnulfo.filippi
12,426,231 *015716D0975CFA3EC585A0F0BCC12D81E113236D arnulfo.galietti
12,426,232 *015DD2F218B59C4D3B6353ACC7EDA137A12F8F94 arnulfo.hickert
12,426,233 *015EB24B72C5968152CD4B21A0A60386C1A6FC21 arnulfo.kanoff
12,426,234 *01512C75B62183D1BD36B2CEE88CBF6A8716A1A3 arnulfo.krell
12,426,235 *0156997B149DCED62AFC89E001853F1EC3F04348 arnulfo.mouldin
12,426,236 *0157887EFC7120A8463EC8283B04C8F8673A3266 arnulfo.murdick
12,426,237 *015A270C77DAFFC0E24B58E9F865D6E48D6D972B arnulfo.muscarella
12,426,238 *015C47947431E0B823CAA7D1E7F3E98B27A9AF20 arnulfo.odonahue
12,426,239 *0150338A6E098691BBECBD5A06C949D08BBF7055 arnulfo.palczynski
12,426,240 *0155E4E8EEF63CF18077DF389C8412F99D6B1CA4 arnulfo.quenzer
12,426,241 *015B4A74223597ED3A59ADD46004EB8E100BD0E3 arnulfo.rinke
12,426,242 *01518A779D499BBD6D55B91AD5238083A6CA3427 arnulfo.weckerly
12,426,243 *0156B1FEDFA3E31B3F10F344576C79D07574A34F Arnulfstraat
12,426,244 *0151A57A6B9839F25E3F9CC80C5198D14273155D ArNWC
12,426,245 *015B649C379269F4C2783F5F061B6690A7F2D3A8 A.Ro%
12,426,246 *01548E525AB5E73FA3A514CA020236DFD5E41EAA AR$o:
12,426,247 *015F77EE6FA4389EFCB9D55A0675225FCAD64A77 Ar%+O
12,426,248 *0155F8AFE64B8315D45B1960F0EEC9D677905CD0 AR$O7
12,426,249 *015342013487BF9551F756B3AFD07508C7BA8D22 Arodiere4
12,426,250 *015479F37D0FE17E370577418BBF200930C99DBB arodnog2
12,426,251 *015A6166A55417F32E81F1E0869FC903AE227309 AROdS
12,426,252 *015BC63E340A5E4907078CEB97CB4BDF4B296AFB AROEQ
12,426,253 *015E7D290A9176B6AF76412F98BC68223AF0628F [email protected]
12,426,254 *015C8ADC2517415FCC311792EB848AA35E7D4B79 Arofirep
12,426,255 *0152E8F76AF642DF6491D75F847EE3BEB9CCB4D4 A#ROh
12,426,256 *0157594E4AD4BFD5EA00D5BEB103E4FB4BF6714D Arohpisad9
12,426,257 *015CBBA3702DB8EC9774D9A5180EEB7D60A85793 Arokirt0
12,426,258 *0154F2F5DD2E3CDDB45A63D083531B385878624F Aroliinaed
12,426,259 *0152130C9B1234DBF838F979CDC4ABF6AAA948CE arollas2
12,426,260 *015F4434A20A94C7AE534C5D74FAE94FFA7F638A aromânolor
12,426,261 *015A9BFA5BC41E1C7E72D1F9DC6BE67D7DB23A4F aromarseiam1
12,426,262 *015EE56CC8109B3C67FF21DC2D5BC2E44E50446A aromasofaleppo.comwww
12,426,263 *01540A8308F66BE2E609E2CBB455A438993A85A5 Aromatise7
12,426,264 *015F9B2A9EE00D25B869C08D5D23766ECF70AEB9 aromatr
12,426,265 *0150029F1FAFEDBB9B2953ECBC34314FB99687CA arominde
12,426,266 *015D3F707FF07BC67A840013A797850CE935428E aron.casteneda
12,426,267 *0155F008743374D92C6FE240D1B8439843D4B48D aron.cough
12,426,268 *0151EB3CF6A5540EB4E781B935A2A6553BB03397 aron.erickson
12,426,269 *01510A912F15D0A17393CACE61754C83164122DE aron.frisby
12,426,270 *0159583DEE6C004280E52810A315DED921956E55 aron.henke
12,426,271 *015E786AEA8F46DF7460A577A14CCB50F7EFD768 aron.hopps
12,426,272 *01579268D03BFDF743C51DA97505B7B0B824656B aron.hullum
12,426,273 *0152AECB2104C3C77C720D059CC8F3A85FC4742C aron.kerlin
12,426,274 *015B2FD95A4E9295DF656002274C574979E8EF07 aron.kisamore
12,426,275 *015DD3E85EA8E3C675581F15A66AE9ADF788B693 aron.legel
12,426,276 *01582F3DBA290637F9916FEB2633323734171A5C aron.marentes
12,426,277 *015A3C2D427BDA7B1A0304FB148EABFCA27CF1E2 aron.menzie
12,426,278 *01570324F48029EF746C40447361147E8103DC85 aron.mestad
12,426,279 *01584A00EF0C860C9EBE8F29F185B63E022C7E50 aron.mullinex
12,426,280 *0157B39EC78819E7B32A0A7E824A44E4B22F7F11 aron.oroak
12,426,281 *015EB3B5EEF1D9D5A636115CAEA3697DA968B024 aron.prioleau
12,426,282 *0159C7DB3E9DF7EF826FAC4E4D012A41325FAA9A aron.prohonic
12,426,283 *0157C941F5BDBD20134AB4C4E83A7724CE0E6E9E aron.sebo
12,426,284 *015D06BD040D17FDFC61D6D2013149B37C07DA6B aronsuo
12,426,285 *01587AF620BF704321A52EFBA98438F37C3EA638 aron.weant
12,426,286 *01567CE9543AF6F1DFADFEC384D5B11A10E2691F aron.yentsch
12,426,287 *01506BDF20E006768D1465F52AD4BDE5FEC7AD12 Aroosiag5
12,426,288 *015B7EB8CFE816163157D540B69AF027CFDC6961 Aropelled
12,426,289 *015A3F9BA877EAB7F591AB1F819A6424EAB9E08F arosa-florquen
12,426,290 *015EA8093DC513AC0061B61E3BE4C81BE3E6F0BA Arosesta
12,426,291 *01502DB5A573E2DA1D699A036D760014AB20CA09 Arostino5
12,426,292 *01597E9B78F2609873CAB5212237F50755929739 [email protected]
12,426,293 *01577D8828539862CAB95287AB10CD60ECC3BA9E Arouchet9
12,426,294 *0159AE99DB40B9EAA14036A513BEFEB3D42D5173 arouna2
12,426,295 *015D00E466D10B012C2FD19A8D5BE1FF2422F32D a''round
12,426,296 *01546AC055D4C58775200B66BBBACF34A7489E03 around.iranian
12,426,297 *015DD589ACBD5D84CEAC4A37AE8AC19229FF1CF0 Ar?oV
12,426,298 *0151D824F59197CB73B04D0661380E00D3875D94 A?rOX
12,426,299 *01522D20D494DF81514D6B4F3708CEF3BDA72F72 ARoYS
12,426,300 *0153E7B1FE5A9F3591E5B9E300ECBDD1E7D588CA arozoaz
12,426,301 *015D609936369A94D2080D358A98571CCA664645 A?.RP
12,426,302 *0157F6426D35AD8688607A9A7D0595E593AB960D ARp1!
12,426,303 *015046DF00E0613A041EF993AAB222651610F84C arp273
12,426,304 *015B8ECD1A5F94AEE5F589EEE27E74161E1F6634 ARP9Y
12,426,305 *0158F5997C50B2F79944A1CAF70B28D638AC5292 arpagruned
12,426,306 *015B26F7FA67C36BFF1C94B8A827FF504E321B34 ARp+G
12,426,307 *015A711B5B29E7E89D39D9CA9F66798B93D707A7 AR:PI
12,426,308 *015C4A4BB14107A2CD7D73CA5196D5C3BFE8980A Arpidium4
12,426,309 *015289964AC0FD9C760DA95A709B71C3ED3872AA ARPINEAE
12,426,310 *01577EDCFE5E61AC7A6F3E8390B3A1D9D57AF525 A,RpO
12,426,311 *01522280044F29BA955EDC4D55D85A8630F947FD Arpsiewz9
12,426,312 *0154EDC2FD7265565DD5DE50A420266879AB8D97 ARp=u
12,426,313 *01532E6B847E907819F5CE1220C9BEEEDC947E25 [email protected]
12,426,314 *015F1A66DF019497782DFE00C59903B8F871E053 ARpw
12,426,315 *015C8C5C81787657B45051F18F8085147C7BA8E6 ARPYc
12,426,316 *0157E10D3D478EBD6E7F9F5C8291BAD121F96A8B ARpZK
12,426,317 *01595534BACB1820474847B6ACF221DB866D0D95 A,RQ_
12,426,318 *0151C58438514514CA72BBCE85DB0E5F4DF86E21 ARq(-
12,426,319 *01597EB13E5DB5322436701321EA9E5F762A4532 ArQ7W
12,426,320 *01557A61EC28F1F57EAF0CB7946D5D48D8349704 arqam zaheer
12,426,321 *015BD16CA846EC2C508BD48E924599F86A32ED00 Arqbw
12,426,322 *01582F42DACD978844EB9D93DF322F503AE1CC30 ARQcT
12,426,323 *0151F5356A08FE3EEDD996AE2F130168E113CA34 A&RQL
12,426,324 *015256DC34A3AF5E16BE43C82EBCCB076ADD22BE [email protected]
12,426,325 *0152FA1C954E9293D1DA46CD7B859604DCB9E7F8 arqmun68
12,426,326 *015FB466913DBAFFA2F08EF8532629227C2244B4 ARQRK
12,426,327 *015F0935F96BEF3429176F6332E5E91A499BFCC0 ArQtw
12,426,328 *01502E2CBD47BBC807937084B4773AFACC06EE26 ARqU4
12,426,329 *01584DFC81E4E01F543B8CF51E2E00B5D65C3FEA Arquita0
12,426,330 *015DCE353A9A79715A7A584A2ECF338CC862037F “arquitectónica”
12,426,331 *0158C8F3A5E247BF6C20DBB267C2E9ABF74A5C1A Arquivava7
12,426,332 *0157E73E2BC2F9FDEE6B91962F0053E57BB5D902 A;RqX
12,426,333 *01549050039CAB70486414D08CECCFB6A2F7EAAB AR(-R
12,426,334 *015C6C905B6FEF6070BBADBEB7ED420E518DC8B7 A+R_r
12,426,335 *0154C23D50E96B0781C3D9769213DD8B6CD347F7 A&=rr
12,426,336 *015F0D423F927A7BFAC2E94877E9F17F9A42111D Ar-%r
12,426,337 *0159CD572357A8980B9EC86EF087DABAA9915BA8 ARR5t
12,426,338 *015306BCD3143456625EB0F4164A377F2FA40CB4 ARr62
12,426,339 *015ED7C87E9A310DA0905B99215F586EC5CCB887 A
12,426,340 *015C444A30573BADA630938FCE54DBF3909B0F98 ARRA!9NER
12,426,341 *015E2CB566EA1A00AFBBAFAEA95AA05CA341EE84 Arrabales1
12,426,342 *015CDE7EF3EE961E96917188BCBA61FA732D9D46 Arrabbiavi9
12,426,343 *0157F3BFDF82715948ED8E8C19094FF4FEE9062C arrancoradas1
12,426,344 *01577E2FE3634685908144C16F94B5D012AF8E1B Arraneni7
12,426,345 *015F1B141645FACB9A56E3232D6394A709B3C0AD Arrangeer.
12,426,346 *015A66F60AC6B8A69548220FBDD3858B5AA302CB ARRANGERONT6
12,426,347 *015E386D09B6FD65BC786B7F76D46526BD2EFE10 arrangiatO
12,426,348 *015A80F3950C02C4D95ECF0389FC93F7AD926B8F arrarodolfo
12,426,349 *015DC126578599D6252F94418D2478FC151BB34A arrasaba1
12,426,350 *01571B7DBF905EC7C6F73E466C3DB8881DCBF678 Array(thisgetLength()
12,426,351 *015B293A14AABDB9CDDD0E3A6FD9B85EEF414D2A Arrayuelas
12,426,352 *0153D71512CCE78905B20D66B55F4FD133ED0DA1 ARRDi
12,426,353 *015FD1C00EA3C9D1D18A799471836D987621817A arrearn3
12,426,354 *015D0C45D77133E4D7F3302587B65A7FF3FF2A55 Arredanoed
12,426,355 *015E76A4C104CDB3CDBFB1BBA1FB64516F19A008 Arrellia5
12,426,356 *015DDD802444923199912132AE81B05C552A11D4 Arrellin12
12,426,357 *015F3352517FB532690368E0481C4832816BF4B6 arrematou123
12,426,358 *015DCB60E44A093CA39107A34D01D464B8864826 arreno9
12,426,359 *015F7A6D56838441AA60DEBDE71A9B1E64B655BE arrepañarie
12,426,360 *01517CC2523823114F8A135ECA54020C1F2FA452 ARRESLEEEN
12,426,361 *015860469B718E199FBA8074750F479C38029D6E Arrêtaz
12,426,362 *01549F226613EEC31DBA246D79705389A0CE58D5 arretons8
12,426,363 *01551506469EC2A7F95517DA1C9C4C5C534BB3D0 ArriA
12,426,364 *0152EBDE0A0FC7F9FB67B38C3B425EC1F3547B37 ARRIANI
12,426,365 *0153E3B637A859222D3F9380F970E935ED5BB897 ARRIGOPETACCO
12,426,366 *015B0FF5648E894672018C5D0D8C93CE9475B249 Arrischia5
12,426,367 *0151A79D30530EF313FAC41292788E61F528C773 arrÏTer
12,426,368 *01593E348C20C8385944B3A1F83D34294E17B737 arrival-in-kabul
12,426,369 *015A314397D8820D08749FE870372C7135B5C5BD ARRIVAVO0
12,426,370 *015FD8181C8574E7B2EAAF33F1568C4F661AF10A ArrivingattheSteelMill
12,426,371 *015E41FC6EC07FED722EE398121A5A84F4D4ED8B arroclan
12,426,372 *015E22B81A3D45A3A29F496CEFE8A5AD759F6D31 arrolhars123
12,426,373 *0154329B13A52767A1F25C0D1767AEA3988A1648 arron.belton
12,426,374 *015C2D64DA0ADF595BC4ABC485A3EE022E5E1179 arron.bicking
12,426,375 *0153F493E49BD5C4B2EAF05C969ACDA062A8039A arron.bobbit
12,426,376 *015D770AAFDA99920CE7D5A570A4EF5D8C833089 arron.celestin
12,426,377 *015BA3C8CDC207D22C117196D436D4FC5CDF8455 arron.celmer
12,426,378 *01592200458D56530DCB7DDCCE28041755E61E92 arron.charvat
12,426,379 *0158808D4C91BD2922475904557A8B05C7A64E1D arron.cousain
12,426,380 *015F1444035896E418D8E8A4C152902F72284F3F arron.edgerly
12,426,381 *015BE468BA20D86F5EE08EC4F8F592C7C71A0ABA arron.ferbrache
12,426,382 *0158A14CC20D7861BCB9E65B9C75401A96D2DCA6 arron.forni
12,426,383 *015456B1D0FB883681F22BC1109C703CAB8BBC3B arron.gacia
12,426,384 *01595AE9222690931F699FFB3E55A48917E407EA arron.guenthner
12,426,385 *015440541B900A33501C256E753F1C6DA622CF88 arron.janofsky
12,426,386 *015AB38F0980581BCDFF42B3C6A40B8111CF415B arron.jemmett
12,426,387 *015A84D7959298EDE88B9FD61C8B84ABF10D2AD2 arron.lashua
12,426,388 *015328590C0F4F98965078ED27536F03C37AEC71 arron.marzette
12,426,389 *015294D8389AB205DEE6DEC0A5C6B622BB59F237 arron.puletasi
12,426,390 *015D09FCE9364F4EE87C7122C93E1B6BB9AF3BD1 arron.suniga
12,426,391 *015BE5B0EE238ADA9724A5608CECF6A0A3131A0C arron.trusty
12,426,392 *015E1184291C7B44DACD036ED63B860B6F360053 arron.tshudy
12,426,393 *01551D076A491E084F778F6382AEF6CC769C80D4 arron.yorke
12,426,394 *015E06AFC2E2C808A9B13912D5A243F3E42DB4EC arron.zeringue
12,426,395 *0150B40FEB4360790EE8AF5862E9CFA9CA3B3C55 arrosadiakoeheinfo
12,426,396 *0155EDDD2E45EC145C1B7AA886F335EBBE9300AA ARROSTANO
12,426,397 *015A014C7091144FB76639C7F13AF3C2ABB09027 Arrota.
12,426,398 *015C21CB2B9B26D23C6C8343B9B9BB8B5962AC2B arrowhea3
12,426,399 *015CA833A97310486F7ED82774358282C889584E arrowhead'[email protected]
12,426,400 *0152B1C9BE32DED3C7A2DC275D22AB63BAD11431 arrow_ltrgt
12,426,401 *015303C7E94F84FF9E6D360C18CC90F113122359 arrows’’
12,426,402 *015F1B1ED4EFB01DCFD2E5B1372DDB8D806003F2 arrowsmithj
12,426,403 *015D998C6CB79256F04CA9EDD88A497CA127855D Arrow「音楽新人賞」
12,426,404 *0150DEECC471B393787F0306718AE8D382CDD1F0 AR_rS
12,426,405 *015EFB7FD90F7E3DCB0A8DA9A2331CE7A4F73C63 arruaarte1s
12,426,406 *0159C0E4671604C971D26316607BD11B88ECA103 arruaramos1234
12,426,407 *0156C4705F9CDCFEB301113C7B3EBCF1D4647EBF ARRUGAR
12,426,408 *0152DFF36EFBE2FB44475B6C4A49AD01FD85E99E ARrY;
12,426,409 *01592494DDABC8B2C0F567A12C30301FB9328666 A
12,426,410 *0152FA5A8C39EDBBF10F12442B1C082DCB8E4309 ARS+.
12,426,411 *0157AC7A876F81B40E579C8D5631E1EBAD763653 ArS9v
12,426,412 *01545085C1DC0927501D9483AC1AEAC052983EA0 Arsambo
12,426,413 *0153B0E77FB484EF9D050D9C3C5ADFD10A2DF74D ársan
12,426,414 *0159CC11C27BDA9D1BAB491EE2C71A7C5CC5D543 arschkarte123
12,426,415 *015B2094473AA8826BE7E0372EF5B84CABE90068 ARsdA
12,426,416 *015D7440ECC747F75E5281F2FDB55555BBDADD51 Arsdalen3
12,426,417 *015E194D5CA5A7590799EE6AC21249273677EB97 arsdelling
12,426,418 *015439634E6858049887DFA487FE8CFD351B0B62 ArsDh
12,426,419 *015A51D1B052F6569F6A7E206234F05C909230B0 Arselia5
12,426,420 *0159F744A71DCE5F1E2ABA067EA10D1653CBC612 arselle123
12,426,421 *015093653AE2167DD27A01399B1B7C8639D634CA arsenal06_17
12,426,422 *0155100FA3A4220E469848C5F9FDC4638794BFC5 ARSENAL-09
12,426,423 *0159A05509AB763B4DF516833B2BC70E3BE998E8 Arsenife6
12,426,424 *015FE78F2FC8705AF5B22B09026F362113FBE9B4 ARSf3
12,426,425 *0155D734C506DFFE9019386BEE7B6DEF7F877EAB ArSH5
12,426,426 *015E951F598C6165526E3C41049EBC940BEF753A arshia naaz
12,426,427 *0155B8DA383BDF5CE3E5D4A8F78EC90373C53459 Arşiv8
12,426,428 *0156FA2828216FB474053F1908C9FF0699C2D2BD A?Rsj
12,426,429 *015E116ED87322F8A664A6AB5809AD1C730CB6CC Arskornied
12,426,430 *015EAA80DE2FDE9F5D76527CC6F3B870594DBB3C arslan salam
12,426,431 *015BC71A28B55C43FE8B53C781D7868DE03F2A6C arslyzgr
12,426,432 *015266FDBF75F66E7165E6CF702DE9F5BD5A7FD0 arsm3
12,426,433 *01535CEEFF5AD718142A1059AB540F4876D99234 arson1te
12,426,434 *015EE546A0D0C4A6E931EF83B296E2783AAC5385 arsonia8
12,426,435 *0154CBFA3D03859AC18E93D7A87CCDFB4AA85C2A ARSONISTSarsonists
12,426,436 *0159C8F9D6C5EC1D903EF91288DE4DD3319A0186 Arsonites2
12,426,437 *0159CCF6757E9D3A0178DAC6065EB0EA14330772 ARsPd
12,426,438 *0151FE83537836E4745BEE0B8A92125A6537F31F arstabi
12,426,439 *0157FBDA0A13C58D3BCBB8DB088F7D3A07BF8B89 [email protected]
12,426,440 *01598FACC84836792B9A00CB1F83481B5D3D4727 Arstotling
12,426,441 *01534E28AB4CF76B847913B313329E5B2684A2CE ART2365GUY
12,426,442 *015BCDB6A42B216EB2EB1ADA597874A4C57FB362 art271
12,426,443 *015EC3F251D853B65A42B2EA4BF3353989C621D5 ART4S
12,426,444 *015C5C23822FD9512D6294E50ECB2F93FCD6883A AR-tA
12,426,445 *015B07455299B878BB44A545E39EA0A470EA40FB ārtabhāga
12,426,446 *01540396AE7E5F31C5A08AF013241A4D7D8779C5 ARTAd
12,426,447 *0152DB3DD5183B6F0DCA2F745A962BE1A8C44036 ARTAHSHAR
12,426,448 *015163DA3FEDB752177D850CF1F897A119A3AB7E artaleak
12,426,449 *015BA888A1830C5EB7437040003C90B8C017C48D Ártalmak
12,426,450 *0153D514FC2DA5035D1C5B41131ACA0A31069A34 artamatora
12,426,451 *015015DBB8D5FCC2C41ACB1155B8DD1B0D8ACC8B Artamisas
12,426,452 *015ADC26B32A810B639D6734F95761F0771A5014 Artapanus3
12,426,453 *01527AABFF8E20BA4B8412F2E5F1EDAEEAB9EF58 ARTARINE9
12,426,454 *0158D7F74F52BAC3E75EC468527D3D38AFA3A116 ArtBlakey&TheJazzMessengers,Volume2:MissionEternal
12,426,455 *015A5BD547CF7064A20317D2D731191E5F579498 art.boothman
12,426,456 *015E142BE79D34F9123CCAA56AC69FF5D16CEF68 A;RTc
12,426,457 *015A58074620F975FE5E96904440372D6DED4674 art-couple-taylorwood-and-jopling-to-separate-after
12,426,458 *015F6E8E657C28BE629DBE65DF678E9E02984023 art.cushard
12,426,459 *0156B6F83B824041213F648AA004D46C2E8827B0 ArtDb
12,426,460 *0154050E6CF9425A746E783B0E93F10F32B82D51 ART!E
12,426,461 *015C392268CDF7EC05C2FA87C44612D108FCE3ED [email protected]
12,426,462 *01502860EC71CE4EBB920A074F7DED65653AFB0C [email protected]
12,426,463 *0157FF7E7E5C5467379513579758E7878C59D9C9 Artem.Baranov
12,426,464 *01581E6A14001AB0BE035EB1E4B6576EFF37A9E6 artemios0
12,426,465 *01580AC72C42D54D4748C1DF5C7A8B96E258A4EA Artemjeff
12,426,466 *015D134352BDF9D51CECA2471862661808DFF667 Artemlo6
12,426,467 *0159A2942979DE25EA2572B634C99E6A39F811AC arteres!
12,426,468 *015E4EB3D3E36950D6A0435BADB14EDB31FBB229 ARTERIARCTIA2
12,426,469 *0152FF7D5296EDE1C63E3E2856788D5A989A1F64 ARTERIOLOSCLEROSIS!
12,426,470 *0156E81F22AE41F91F942C38958BFEDA863EFE58 Arteriov1
12,426,471 *0152BEA515092ED690F0DC94BC3F44DF3368790A artesies8
12,426,472 *015B1D671E0FF8A96C359EC0FD38059F737E4B25 artesniajam
12,426,473 *015C5DB250D15148EED941E50BEEB719E2CE0D13 Arteten
12,426,474 *015CA0FD6A317A0BDFC021E012AC17EE445B9CDF art.feldner
12,426,475 *015456ADC21E74BF3758BE16D2E7F95441906C25 ArtGB
12,426,476 *015D521300EF70911D079990F8D7196918105DFD arthimetica
12,426,477 *01552B11214CA8BAF912E5FF6CB81941F471F3F7 arthromere5
12,426,478 *015D4D86CDA842B7DA845F6F05CED639F6116D26 arthropodsgenus
12,426,479 *0159711F7351E8C2A9751A920C3F6CAE8B069849 Arthur243
12,426,480 *015819086BEEEF26EB61418827B9A4B9B6A75382 arthur.bonson
12,426,481 *015D5520723D9192B8BE3B811BA65862A0A04E13 ArthurBota
12,426,482 *0152C2238894AC6E00C8A5808835357B683D8150 ARTHURCOVER
12,426,483 *015D716E8AF7D86232F23871B3377A14F6FACD76 arthur.dengel
12,426,484 *015826C6957F452776A329F49E81CC0A9D79B8FC arthur.denzer
12,426,485 *015C915961526D311B66E533D1AFA5DC344CD726 arthur fiacco
12,426,486 *015BE6191F57E1F27834A995FC5D2BD599EA0850 arthur.hettes
12,426,487 *0156D80FA2B1F92DD3ADE87C6BF96FD46CE85691 arthur.kawano
12,426,488 *0157D2834121BAACF6AB2E570D870D28C1D310AC arthur.koguchi
12,426,489 *015D61E1E61C237E597EA121E8FF82D5D26C30F7 arthur.korey
12,426,490 *0156D4658A91990751C54BE45CE67B0D00B599CA arthur.lauenroth
12,426,491 *01525EC3E12C3524AB9500137496733C1391B9D2 arthurm266
12,426,492 *015D1D4C100D8B1AB76D5A458ED45C80D46B5D61 arthur.magaziner
12,426,493 *015669C83D5CC7512A261AB31C818679A47106CB arthur.millot
12,426,494 *01527ABA00872D02DC7657CAADC36FD2D5752FE1 arthur.mowers
12,426,495 *015A4B5A7E2EFAC8EFF36292E1E6321B91BEC901 arthur.munk
12,426,496 *0156AA4F6DFE7F5FFC6C7D3ABCAA716068ACA1FA arthur.nodland
12,426,497 *01548385FE124A4BF9AE7C4C24FC9C9EF93AC605 arthur rangel
12,426,498 *0159A3A33EFE35E767F85C376B5A33EC1C41B3EC arthur.roefaro
12,426,499 *015D47A36A44CB90212F7BE42A4418CA2BAC20E1 arthur.slaboda
12,426,500 *01583FCB4F1E980CE44EBBE870540C75DE945022 arthur.strekas
12,426,501 *0159C019B9D3DBA612301A65C711589512F904EA arthur.succop
12,426,502 *0156F397FE0F45C2A087192ECE984217E14C66B2 arthurtudor
12,426,503 *0154EB8B5C756481D0F11DAC96549DACB255C1A3 arthur.vanner
12,426,504 *015DAA0F80007B7B3CBE1AB4518432125720179F arthur.veitch
12,426,505 *0153D0670CC77AB94BFA9AFC9B689989F59E5875 arthurvelasquez
12,426,506 *0150EAE79AA3D5F4F0AD6B11325E4EE38B4D402E arthur wilson
12,426,507 *015A82D7190320305B3566848FDD71E1F7D24EFE arthurwood
12,426,508 *01500DC601C7EAF4F83861BF74374F0576EE1A78 Arthwall7
12,426,509 *015B5796DD4B8C4A4D48B4FFF4601B5478BE86C5 articlE
12,426,510 *0153037BA5E81DC3FDD861758D8D2D5A9DF4B1D0 article1041568
12,426,511 *015F27CB796C5635740F436EDB5BECD6E3E171F3 article1087249
12,426,512 *015FADCEA6CB48A216B3E7C0A54931B0C7471FCF article1233840
12,426,513 *0157FE357D85E1060297FF30146717E70D67EEEC article131674
12,426,514 *015744D58B31FE32520A3F2CC24F26EA4803C54D article1433261
12,426,515 *015B139AB06BAA490957B09A5EF962BF03FD6F60 article164534
12,426,516 *0158BE02F32AF0E3C3BA48C6C346CB84374CA628 article216012
12,426,517 *015A86CC94CBA6726F1C0B692CDBE446B17E256A article2166914
12,426,518 *0150EE27ED1530A81307B67E2A2680868F4AB478 article228229
12,426,519 *015ED438FEE73ABAB27CAA675E9D73F3FE2225E4 article2413596
12,426,520 *01585F2DB1E8991AAB2E0844DAF0D73EFAF49C69 article2704210
12,426,521 *01579E607FC349758FA32530356ABDB81726B5D5 article2819912
12,426,522 *0155C696A4CF053204C11F8DA5034E618C2D9B89 article3075762
12,426,523 *015670C000950B92F4195AFC3F2F84F3ADABB4DA article328703
12,426,524 *015ABC0F38CBAF5792E1EC5D980D3D9473B562C5 article461153
12,426,525 *01559DDB2E66AFAA0DFDE6A193D7177B5A3F2584 article4898603
12,426,526 *015C6DC17A596EFD72EE8F3093E5B57D0BA7E702 article490372
12,426,527 *015906AB14EB06CBD6130349C9DD444BBAB30A1F article5769435
12,426,528 *015A5314B20756483149798F6E7C64722BF77088 article7103697
12,426,529 *01540781DA3FE2F2617DE151CDC8A5B823F14032 article80733
12,426,530 *01551B8A2806043E895866CFD3D26F095EC09FCA article.87.172.169.2
12,426,531 *01537AE8AFEE135D32B1BD0AED0789A80D7F85AA ARTICLEALERTBOTSUBSCRIPTION
12,426,532 *015C968D5E0F381C6FDC1E77BB81B3B325AC3AA1 [email protected]
12,426,533 *015C804A6E81BD264495E259B7E065068CD24701 ARTICLE-NAISSANCE-DE-JUMEAUX-CHEZ-LE-DUC-ET-DE-LA-DUCHESSE-D-ANJOU-ET-DE-BOURBON
12,426,534 *0150B94A918A41B3268CBCF0E8327B634F3EC8C6 article.nfutvol
12,426,535 *015D542315501F5E11A2D36332D9B36A87C6D3D0 articleObID
12,426,536 *015882625B5D75A5EEBE299045674472AE1178AA Articles0699
12,426,537 *015006FFE0F62D227E15DD04A17E242A615638D3 articles-created-by
12,426,538 *015864EB8629EBC1F80561818F69F9A09B5392CB articles-eng
12,426,539 *015AD5F263380FB662CEA609044B6A1FD05492CD articleslooksmart
12,426,540 *015D1CA3151667404F89003F60C2BAB9564E45F5 articlesneededlttdgt
12,426,541 *015ECDB639C35FF869E2DC2DB6C474926720EE4D articlesstuffwhateve
12,426,542 *0152860CD3F3D08171439101C565D0B987E38DA5 articlesx.zayzayem
12,426,543 *015E266C4433ED9AB8BE8DDA81D29ECDC40E6B03 articleXXIX
12,426,544 *015E5D911E88F208072378753022271E76DE3D8E ARTICULATE0
12,426,545 *0159C3A3241851688167671D7B4D287881B12CA0 artieulait
12,426,546 *015F2BBA36D1A09A48DC1682704619D2A85B61D4 Artikelbesuch
12,426,547 *01581133EEF777CBF6FBFAA06A0779CD8792A0D7 Artikeldefinition
12,426,548 *015D14FCE6D7E5ED54A68C3627EC12C9BA50A774 Artikelöversicht
12,426,549 *015CAF2255925467CB1E97DB2CADCC6BE0139F30 artikelstrukturerna
12,426,550 *0159AE8435789F550583591D8E0AC0F424CB55E9 Artikelverzeichnissen
12,426,551 *015AFAE8B353307B978952855DC412D3F0BA08F9 Artikelzeile
12,426,552 *015024765722EC37F55F15E73F6971D220F97785 artikkelimyönteisemmäksi
12,426,553 *0159FE30581326C47CE14F2FCF191EE5F15F5B0A Artillerietrein7
12,426,554 *01534188299E50CBE6074E896CEEA3AF803AC1C1 Artinan4
12,426,555 *015EAF01AB27B80C1E0E980DBA135015B63370D6 [email protected]
12,426,556 *0159BAD3587E327C1B71D0142B3A2102BB0C1BA3 artisansofleisure
12,426,557 *01522ABD8D4709C07F27EB94CD17DCBEA5D3CCF8 ARTISCHOCKE/N
12,426,558 *015DD2DA9A2DD355936389471779DA63D6785C7A ARTISTCHARLOTT
12,426,559 *01507434255268CD4CB36AFFACB675FA0F9B2016 ARTISTFOOTBAL
12,426,560 *01522BF0DCA73DB0A169B06F902DB63E19F89434 artistically-inspire
12,426,561 *015FC9EF9BE03AAA622C8F6D5DBAA01D51B17AD5 Artistiekst?
12,426,562 *0152E75B166ABC5D9E5BFB8B90DDD6B4C05668BA Artistpmc3
12,426,563 *015BDDEB1BBEFCC6C7FE8BA306151698FFCA6F66 ARTIST-PROFILE
12,426,564 *0150163B94AE77BE88F8583FD740022B8C10DE05 artistsource
12,426,565 *015F022B135A5D751B5B6749ED8C56C903157E31 Artj
12,426,566 *0154CBA0675F67C68CF5F1BD64FB79B9FC3D81F8 art.kahl
12,426,567 *0152BE368365A6152BE92724290F5E409BDC1921 artkowska1234
12,426,568 *015710E78D9E125574ED6626E690D4DAE0491124 art.lawrenz
12,426,569 *01508EF3DBAD118D0CD0CDD4F6100C71F12116CC art.magos
12,426,570 *0152F00A7C65FCF0FC47B15AE77AA98FF5C91978 art.mannan
12,426,571 *0157F3C53341D42C332DD64D3ED35BA0143F549A artnewstrib
12,426,572 *01543154050DBD21A06F478633E02A3A9728025C ARTo0
12,426,573 *01574CB110C41565AD317CEE64D39AACFEC8BE73 Artocreaed
12,426,574 *015FE45E23D16A2D177CD91FA261ACADB80F1275 Artolater3
12,426,575 *01503DB829E0AB1DBA6A10FA54FBA95464FC5B6B Artorna
12,426,576 *015B7A9C52E502DFF4829C6238BC0521B22D2C85 art.ostrye
12,426,577 *015586800F85287DB37C5843C609D2FCCD70EF51 art-people-glenn-wexlers-house-of-screens
12,426,578 *015B90E41A0E5AF08716359639AAD042E657CDAF art-prog-folk
12,426,579 *015C9356C56BF5C1564BADE9580AFA17D3EDAF9C art.reifman
12,426,580 *015BF27F0E6F8CFB0AC042AFE69021C44BC49787 ARTru
12,426,581 *0157DBC4FF0EF17EE72AAF5FD9D201036074E7F3 artrwood
12,426,582 *0152E44F095E8E13AA0EF1E0708BD32A4F9835BF Artsac
12,426,583 *015E0488F8B39879B23DF9DBA11457CBF65CFF64 art.schlappi
12,426,584 *01593EF34C635B4E5BEC6CA2D209E1AF124C7259 [email protected]
12,426,585 *0159DF04367B779A5E1EB72AD180AC8F6336D734 artsdyk7
12,426,586 *0157F820923ECD8FC93B65DD4D9D5D9F03C6319D ARTS-RELEASES-DETAIL
12,426,587 *0150B0159D2B89060B4275BA9555636EB142FE76 Artsrhh9
12,426,588 *01521C71865650E098F97DD7E1E5F9332AA2D93B [email protected]
12,426,589 *015BC36FD88946D9B650A27A5E6FA7963ED1EE6D ARtTA
12,426,590 *015E1DE98CBBA48BED85887E2BBB20FBF6648020 art.toohey
12,426,591 *015C185064B8021986074C18A87D9E48A00E8933 art.torbeck
12,426,592 *015CE0B450510935FE61416B44FC1A7BE0159005 arttree3
12,426,593 *015FA2DB8A32659EB32E7C89EF0E375A40226459 arttypischen
12,426,594 *015505A72CFE6D01A40F92E6850D7FE64EC4DD86 ArTU,
12,426,595 *01510C4CD9DEC2FBDAE199A3642B8BCE2DAFE611 arturo270
12,426,596 *0151E45D284FB60299D93CB114582CFFF7BAE469 arturo.borchardt
12,426,597 *0150F1746BCB24ED2F01422F908C56BB13C1DD4C arturobugarin
12,426,598 *015989BCD5AB6C67EE90A71C4D698FF11641A32F arturo.caho
12,426,599 *015736AD4EB819377EFDBA8E609F7E464030FA07 arturo campos
12,426,600 *0150B8AF20B64B33A424CDAAEF364E62189D8820 arturo chaidez
12,426,601 *015C0B0A8B28A27ACBEFFE2282717F4047220A26 arturo.estis
12,426,602 *015F92943FDBAF05263B3BF391B781D0B3036514 arturo.gearlds
12,426,603 *015C056E00C2EFE80EAC18955C200A2164F39496 arturo.grimsley
12,426,604 *0158C0662F4B411AE65EDE25B2F627B3504FE6C7 arturo.hinderer
12,426,605 *0159DC4ECD75881D7A980DE1BD6FDF6771411713 arturo.hodnett
12,426,606 *015A930D1CCE6033BBA4A60172BA8835CE21C1E3 arturo.holtman
12,426,607 *015F5B69345A66A276CE38E5D4864CC8DDF05540 arturo.innella
12,426,608 *015660FAB5DC508A8AE8B5755875B91DC97874B8 arturo.parrotte
12,426,609 *015D97FA7C808DD8CB6763EDC47660B42ACF2508 arturo.rausch
12,426,610 *0153676F512873F198B1ECD706BF5C49509966EA arturo.romm
12,426,611 *015AFD68E53A60EC1DD621FC9B7AA0BEE8E8DDF7 arturo.rubner
12,426,612 *015A9A875722EA0A391B2337428BF40D99C38995 arturo.shenton
12,426,613 *0150915717A0FE10C51F6CFA09D4673DBD5E6460 arturo.wende
12,426,614 *0157B265CB339C8818264346B0224884BCE1E2DA arturo.zwolski
12,426,615 *015BE911A4C386EB3FE373B8B6516B19C80CC9B0 arturselenia
12,426,616 *015A9678D488A2340222071FE75E7419F73C73FD artur.szczepanski
12,426,617 *0153E91EFF6B1C9E5064CE4DA46B7B92FA0DCF4A Artw7
12,426,618 *015F061264A3D6233C5C4F1F398B0CECC99CC7D9 art.willford
12,426,619 *015F40F161D004D05069753946D53B2925DA108C artx02
12,426,620 *015E25922ACABF9FD31A09B073AEEB33A1F220ED artykulom
12,426,621 *015C9CCFF0A16D9A07D2977DB23054CB515F72DE artypwds
12,426,622 *0154A3FE811FC828558BC8139C19A3F325D72E7A art.zitzelberger
12,426,623 *015E86A77593C0F6E7C736617C5D6D77BD6DCCA9 ArU.#
12,426,624 *0157CB7E8DA0E863C770D3EA48CBC1A9A2D55BDF Ar+u:
12,426,625 *01552738A49910A39407E0E52C3698371E5D3B38 Aru!!
12,426,626 *0152AF67180D1CCFD85D009EF6BE8E5A877DA751 ARu9s
12,426,627 *015B67FC11D765B96BFDDA6F834C9223430729A6 ARubX
12,426,628 *015A3889753F941B620C55A47DA141EA770E73D2 ARUcG
12,426,629 *015199DD6E88A16A6FF17C5C629309023D60329F arucl
12,426,630 *0159C51BD15C78A34AE4DDCEBC236A775235C15B AruDC
12,426,631 *015A7AF0001F059DF8153075A3943DE362D4BCA0 ARUESULU
12,426,632 *0150CED955733A5EC10AE1FD30D0ED6BA47D44F6 arugta
12,426,633 *0156A44ED349D4EAF63DE20E0E29568AD125F305 Aruijusting
12,426,634 *0150DA683ED5F933B12D11DF6FBA2654E4BCB8CA A;Ruj
12,426,635 *015CB4A08FD6CE2236EEC86991DC64867B23CD2D Ar"uK
12,426,636 *015BC93D62EA843EF5872BB20369C383D1925E13 Arukamaks
12,426,637 *015975096CCA7981BF1AA69FA3D6E1C9DF66C6A8 ArUl/
12,426,638 *0157E4A12EECE169C56ABADE04A1EEC8C4099A74 ArULc
12,426,639 *0155C51030F1CEC3D058D7BEF3BB6BF1FD31CD32 arulkodo
12,426,640 *0156F1EB4AAA920B0C7937223A04831C02B2505C arun doss
12,426,641 *015EEE0ED88EB7378049B8406EE5548BFB6671D8 arunima chaudhary
12,426,642 *0157C09C80637087E912FE85A752E6064A981B9A arunshajan
12,426,643 *0152C1F6B9A798861AFEE2779230A0B3D4A9F32E arun subbu
12,426,644 *01514897ABE82911F9C8F6A8E09496F8651D9FA0 ARUNTA0
12,426,645 *01563BCC22915A6448E189A0F11A5AE31022EE81 arun venugopalan
12,426,646 *01516E7993FEEE0BE4C437F1ABB64CB93D637CCD AruPm
12,426,647 *0156644A40CAA2E014BED90C9F00F87F63784A36 ARUQr
12,426,648 *01538CD9095D71F2B00D18D56A3E9C5FA6C0EAC9 arurs904
12,426,649 *0158E9AA0355811797A65E92A669575D404B382D arutinjan
12,426,650 *0156995F758484A26C81331C4768785686CDE36E ArU=w
12,426,651 *015DECB8F3CCF753D30930F549DC3B1B59CA90BD A
12,426,652 *0151693FD46216EA060CDF6A3E5EB6424BFB728D Arvailen7
12,426,653 *0152DF5845C3D754A327EC872C1E02FA061CB21C arvaniți”
12,426,654 *01587FD0021E807ABCEA469BD6BEB71D8D8C03D7 ARv(B
12,426,655 *015C399EF66B6924E6CFFE7A6D6910DEBCF7D8C6 arveeda6
12,426,656 *0153E2CF36042A0CC265DC18BB939F034E1AD9E6 Arvenstämme
12,426,657 *015F77E4B5D3B54BC7793D10DFE9BE305370F059 [email protected]
12,426,658 *0158AFE17158016422D838E11F09D6D11B9931D7 árvi
12,426,659 *01532C9DEDF46ED73C84C2B242B146FAB6A1FEC1 arvidsdottir
12,426,660 *0154470A99E0CC7BF1FFBD56B936BC2318446A24 arvingar8
12,426,661 *015AB52FA8F6A6E68F2190B6F6D98AEBD10F8C26 [email protected]
12,426,662 *015173B33B98DC65E7C4A07E2C18C2D5AC3ECCB4 arvin pagtalunan
12,426,663 *0155261663D0C4EADE1AA1B7D2DE59B50B009F4F arvioon8
12,426,664 *01519EA91142F51297A0F59FFF6CA0D642E808D8 A!Rvk
12,426,665 *01572F86D5E531CFF5EDC6CEF1E12EBE7BBF2199 A;rvk
12,426,666 *0156D79DAB8BAA86AEED431DCD3619D898463C4B ArvNT
12,426,667 *0152BDC1557CDC96193C5F84ABEEC4B33EB39CD2 Arv)R
12,426,668 *01528FC284CD33D3482D95CAC99C5339A7B9E4B3 ArVT:
12,426,669 *015932A53FFA6F35DB29407271E92321DC83D23A ArVTA
12,426,670 *015824A8B88478341E5F35BEAC408365E67E9575 Arvudes
12,426,671 *015F9A9729C830782870401D94286D7CB2689977 arvygomez
12,426,672 *015F632E06F7A29481950D82A7D39DE1BB235CD4 A?R!W
12,426,673 *015DF58D002011D076403A7DF5DC7AF01F766FD2 Ar".W
12,426,674 *015C2627DB876C589B34A3E1F9E1563DAA404D4C ARW119088
12,426,675 *015218C7B9E841310202E9E54ACE54C304F76993 ARw.c
12,426,676 *015408ACE141277BA8DC46B1C96D866A986194AD [email protected]
12,426,677 *01545FBA9F1B0535FF6D80D1E4CCFE392210E75A Ar"WD
12,426,678 *015BC7B24EF06218F2E5BB292FDFEF2D35139DEB ARWgv
12,426,679 *015D93D565EAD7A4FB8BE537864544D19C88E82F A#rwj
12,426,680 *015FD8631B01C51A5A99F691248F23602D8C7FAB ARWnP
12,426,681 *015B00492E261B527DAB1CA3E830EB30DDB038E6 Arw;q
12,426,682 *0156CA8EABDFB10D3F8899451C553508008CE7AA Arwqg
12,426,683 *015B58DE7223009DC78DA5AEBE46A2A17C4BEB08 A$rwr
12,426,684 *015CBA43559A2FB7B44F8EAA8BA547948ED4119B [email protected]
12,426,685 *015DD4BD7A683347EAB29D3FB57913320AE0856E [email protected]
12,426,686 *015464166C2377E6D3A3839058314B3ABEC95F8C ARwYH
12,426,687 *0159C9483FC65D8B97379D4D1B6864A855D29494 ArXn%
12,426,688 *015833F306C51663FD45C6DDC8E2C4C418711E32 ArXnk
12,426,689 *0151197C9E5049DE8519E4E785825EE5D702CECE ArXU5
12,426,690 *015B16ABCDBF6158100D4CCFA9F9BF023416ABCA A(r#Y
12,426,691 *0159350A270ECB624AC9F0400615DF541F7A8CED ArY1e
12,426,692 *01580526E33CD202B1386B4CEC6F2E3C0ED8C680 ArY2R
12,426,693 *01520BA196E3CC655E9B5E5904B9F2D4B9BA57F8 [email protected]
12,426,694 *015D3DB1D757CC663A8366B6521349EC936D500C aryana166
12,426,695 *015BCFBE8732222C4A8341495EBEDDFB96BA8A71 Aryana237
12,426,696 *015F478592A6DF97FA3E2FC8A2781DC79A2D6997 Aryana440
12,426,697 *01534476906818A01C0A79D9B647597038E4A38E aryanna524
12,426,698 *015D0557314BF88432CF0363F4EB2CD7215DBCB1 ARY-AZ-MEHR
12,426,699 *015A12654749695D6724AC82E8EE72ACC6D4EE3A AR#Yf
12,426,700 *015EE5B7A388B70A533716B27E8DD8603E7DE023 A;RYH
12,426,701 *015352D2A60F782A8DE86EEE7CCA34092300D578 aryonna jones
12,426,702 *01522C401A7D7D4A4408666EB7733D9CCA791334 aryo permono
12,426,703 *015C7BC62042FB8EB6E6B2846B0D1BA6070BC26B [email protected]
12,426,704 *0154A14DA1C7BE7B7B3F64D9182BFB0861958994 Ar?Yr
12,426,705 *0158C87CD5ACB99D1BD153F2528E1877B28103C1 arystina09876
12,426,706 *0152D0775CF5B2F88F745CD68B552A03813397A5 ArY&V
12,426,707 *015BF9A016367EA07CD55B78DDE90EB6E50583E7 A,rYX
12,426,708 *01562E7721F4F3EF749DB11B97129B95FE9E8F1C AR%Z"
12,426,709 *01530F9CDC2C440B0B37215525AEE7A436B3B410 ArZ&%
12,426,710 *0153DD98D8412EAC668C524B689F523726B9C8E9 ArZG_
12,426,711 *015654374FC3B6597A8BFB998E03D4A36EE96125 arzhang2
12,426,712 *015801E353A8F7CCC87E41D28F61326A4E35C70F arzoglou4
12,426,713 *015E4CC87F182790F45793523237FF63B2344472 „Arzt
12,426,714 *01599DA7C60335A472711E5564D652E330E4F421 arztmantel
12,426,715 *015113A3C42752F77EE45E05A9696A4E3E5131AE A/S,=
12,426,716 *01588BAF085AC06DF1FB89890DF7BA843A70773D A((S(
12,426,717 *0155DF6A01501F902C4236F0CB431D0E359EE002 A);S!
12,426,718 *015CE896AEC7E6030A58F5E648AD1604EE39FD63 A#S)
12,426,719 *0157F8A07848983D21987184106758954EE32EA7 AS)_?
12,426,720 *015039EEF9968FF34E8A7FA3B3D1A82942F2D0CC A;=:s
12,426,721 *015D350D5CCBAB0109EBDEDBF2D9FBF9DDF95F90 A:+s
12,426,722 *015756CBC55A4EB391F99810D88B7DD9A4FC0AE4 A!-s)
12,426,723 *0152AA8EE34750909ED5EFA5B610FEE89E36A983 A"s.=
12,426,724 *0155957BD7F6C59461C7AAF14915DDCB17DD0667 A),s$
12,426,725 *015EBDF7535313B81FD87AFB1F51C3E93E91AED8 A#-_s
12,426,726 *015C69AF13E3CF60499B7614D17DAFDAADE55100 As,-$
12,426,727 *015CDF09B8EF96B53BCCA283BB7D54802CF2AE3E As.:?
12,426,728 *0154EC8FCB7BE4721C2A718703B0870F5C1EA8B2 As=_0
12,426,729 *015DD8F0FA145E4328BCCE09AC5B75388D8A2765 As0.#
12,426,730 *015D35726658BBCAD155932189957769E4819F8D As00G
12,426,731 *015A6759A157A8E7BFC90491B9B741B291B30A9C A_S06
12,426,732 *01533DB94CD6A2C900B93AB11250AA87BAF348A1 A=S0G
12,426,733 *015BC48AEE08A6504CE6DA58FEBDFD17F266AC21 AS0K#
12,426,734 *015DEB8D8F7C27DB45E40A273DE506FDD5E5993F As0ld
12,426,735 *015C9BE0D2FC7BF63A7FD6AB7BA3FBCFD3760803 A$s0q
12,426,736 *015C3938E37C2A49BFE0CF9C13382F6AF4EDF987 As,
12,426,737 *0151075BD2B3583D8A0F0D5A99641C34FCDD9C42 As$1$
12,426,738 *01579420D32C7208E4439767B5232255EFCC8503 AS&10
12,426,739 *01552B984226B2EF16F62FEAABEFBA575B12743E as122507
12,426,740 *0153F3B059EC8997CB18A9D5864D059CE9F3E606 AS%16
12,426,741 *015DADB48EF0B4F7ADD18C72EA3223D5E3425A69 AS1d2
12,426,742 *0150B124816959C9FCB224562DF587162D9B520D As1F
12,426,743 *01535D2A6EB548FFCACF170084384F9F755596C2 As1HvXZZDhXqUGOBCAAVQIQ5nYcB
12,426,744 *01566BC211CC7090C717F33B40C76B257088913A AS1!m
12,426,745 *0151A067C5963AF809E695B0929B43E891BBC4FF AS1n#
12,426,746 *015A0BCE37FF1F4C050CCA10BC7E5BF36BC62F8B AS1nm
12,426,747 *015F613F46213054FE7043E9FDF2FD7B15205F0A as1op
12,426,748 *015C1398E56A71963A0100694C096978F9BF6ED9 AS#2.
12,426,749 *0150457FF9ECB78A16487DDC4FB1316C05F9B7D9 As2L:
12,426,750 *015987776E1B7253D1AD8682BF93B100958AD9BE AS2U?
12,426,751 *015F6C8C744C31067C572DE2FE500424DFCECC0A AS3hB
12,426,752 *015B9F557C4F06F79EEE4FF3C7CA73AACEF67EE9 AS3k0
12,426,753 *01550D0ED230FF6ED3F69FD6B91D80D700563912 As#3L
12,426,754 *0150BC09A7962EC95701B9884BB1B6BA7E47058E As+3Z
12,426,755 *015FFBC56154FAD5BB668B144C1DA6687F05C837 As|4
12,426,756 *015C821B90903229B2BA17900D127B8EA0C46118 AS4b)
12,426,757 *015681756C80E5EF89129ED084AF07C4DD3F97C9 AS4f:
12,426,758 *0151530755CF559B42681420FBFD26F0398123A4 AS4Mk
12,426,759 *0155D8107A7D1A7C05DCA999FBE0EA2BCBE28B44 As"#5
12,426,760 *015CC08EE617AF4F3EC36961A2AB0C6C8F3FD91F A/S5A
12,426,761 *015983B51B99BFD7778AA9AEB9E06AA6BC951FF9 AS5v6
12,426,762 *0153DC809C4868ED9763D47212C361F10282AB04 [email protected]
12,426,763 *015CCFA8FDED4D7610ABBA6AD2C064B463AAC114 AS–62
12,426,764 *0151E308CB568E0F304881466F6CF851CCCF2709 AS69D
12,426,765 *01507390D33549894297E6C7C9EA4484E4085589 A#s6a
12,426,766 *015E2AAC70536F56EFC59697A8E4B9A1D24488B0 [email protected]
12,426,767 *015956FF8B46450A143CBE381E0479DDCACBC704 AS(6N
12,426,768 *015238C0B2126FFA869435A00115A6714E529D7E As6T5
12,426,769 *015AE283321B87978FC60225217D2AFD2AE6FCCD AS6uG
12,426,770 *0151C1591C224803EBA8E4CBA1E7026108CF71F8 AS73c
12,426,771 *015FD31756C77D6EA56F15315DEB9364ACFA570E AS795
12,426,772 *015B1ADF70ADEC9BE87A959F43C8C9E864B39E0B As7GY
12,426,773 *0159CED400D8BB4F0086183916ED561A8A4E5095 AS=7t
12,426,774 *0157A844F9E627F7CA107E9B652C2DA4A414B846 As8$=
12,426,775 *01544876201900CDA0004D1B9DDF77C03D579D7E As8!K
12,426,776 *0154CA81F6FE4E55B098360A638EC41F68B05758 As8SE
12,426,777 *015F4341500260702D8A8088B29F76371D5FE498 A/S8t
12,426,778 *015AA2D188B10FB3B584078BCFC5B22CADBC68EB A.S.9
12,426,779 *015EDDF0BA43ACDFC22B0A651E8B117BAAEE3DE0 A$!S9
12,426,780 *0157647EA659CF58B42B7824255B36ACC6EA5C39 AS94%
12,426,781 *01525D7EA3AA0AF257042D24B2ABE0CF35D8C8A8 As9.5
12,426,782 *015519C5FE41574B41A74B7F951918A9C4E36D31 As"96
12,426,783 *015DEF003D059A762243CF4A8566A8724384DB66 As9gh
12,426,784 *015191DF7F9099BE37BB7392CFF466972E1A5CF0 AS?a!
12,426,785 *015E66DBB48AEEA1FBE146F2BF6293771057F746 ASa6&
12,426,786 *015DAA6F85794E429702C8D69CC959DFE1AC2E9A ASA89
12,426,787 *0153C77DA2FF632CDD7B93910EEF79462BDC6E11 ASA94
12,426,788 *015E9320FCC344C7E525318C86A95AC2EB1B13E5 AsA9L
12,426,789 *015BBC4535C9E979E0FDDA14097A1D5408E707B9 A"saA
12,426,790 *015D41A1EA40D6C25CD1A26FD9F5102BA0EDCF91 A]Saaa
12,426,791 *015A78EF8D8EF08EBC4E27B82CEB47EA5948266E [email protected]
12,426,792 *0150E00C8AC771660AAF265798908BEF5E86D0C1 asa.begin
12,426,793 *015139B909D8383A0ABF978EAA417D1B0F2A704D asáda
12,426,794 *015176D054F4E09F0E733066384ACCBD6B37BF83 Asadaame6
12,426,795 *015D5D8914B1BA4E23E3C60F8ADCC4F85FA6D264 ASADIEH
12,426,796 *01563CBC9DC9AD486C9E8CBFE4B16D965C41079A asa.dotstry
12,426,797 *01589DFC7BEDC909F19BB59B09AE962872722661 asa.dougharty
12,426,798 *015BC7C31D4CB34B39B8F0645EDF0E3282DF84B2 asa.dybala
12,426,799 *015C5481512A711551500EB1535E341AA6B4E8E8 AsAEE
12,426,800 *0159AA91609A7951E9B5EF6DDBBF6B4933761A1B ASAELLIOTT
12,426,801 *01514AAB7FDE2879999BE7A1D318A8664E859B28 Asagama3
12,426,802 *015722D8E1C0F2853CB62E80E14FE198316F6ED2 asa.goodwine
12,426,803 *015A77860EFCD6398B14FE1CDCA621058605150F asa.gotlib
12,426,804 *01545E1F603502E2CA94424098A94ACCCC72F0F4 AsAgq
12,426,805 *015ECEF82A96C9832EF6E770A70104C5C368B6C0 asahel reyes
12,426,806 *01560F510DA09952D015970EA69F2DCF72123AEC asahidake
12,426,807 *0158EED65D701FD1ADAE20BC6351FBA3EBB22C26 Asahisin6
12,426,808 *0156929B6AC0A8D4032AC08BD7A739E1B081EB35 asa.kafka
12,426,809 *015C5317952DC5DA3181F340EE2FCEEBF7873C88 asa.klugh
12,426,810 *01564E3DE2EB52F6A5C9D60B5D3B802B9B751E20 asa.kram
12,426,811 *0155B957B13C327F0516B7F75CA362C66DEB27A6 AsalC
12,426,812 *015C9933458D924F853AA7D3C659F59ACFF63710 Asallget3
12,426,813 *01569E3AB5AA894C233294D1872FD7BCE755B875 asamasaM
12,426,814 *015A65DC03E3C1EBC7E3AED65D7FA0D23393F3BC asa.megee
12,426,815 *0152FECA4FFC54448E0448BB362F1DE282F165FA asa.meriweather
12,426,816 *015D58172B35E8FA9A7363C50D6CC3A013B29142 asa.miraglia
12,426,817 *0158963D7BFA7B6FAC0BFE37A86B0E9D504946BB asa.mozak
12,426,818 *0159E2D44D4D5C30CDC1354BA4019D89AB6BA596 asampajanna
12,426,819 *0155DEB67C58F8D311714A998FC8839A1FF62622 ASan?
12,426,820 *015F4C58835F1CEB3BAC02BFB4513F2FCBC332D1 asa.nanez
12,426,821 *015627B1A4E6212139F2E3BF861CE15B84DE1622 [email protected]
12,426,822 *0155D1650044B2DCC30D2CF3E000ABB0131E91E0 asaness00
12,426,823 *01574A7FA18BAF1F96B45276918508CB97E8305D asanovaného
12,426,824 *015E7DCF88AF8EEA038D1B35695BAA2369A5A4CD asantan1
12,426,825 *0150EF447283C51ABCE5760F47A0C0452CA7C38A asantekissi
12,426,826 *0150821A11CE837B3A25D162F80A76A9C64854CC Asa.ntoshhasya
12,426,827 *015569ABB49C83F2EAA335790D8BDC5405140477 asa.pallotta
12,426,828 *015A16327D2D3BEC62B15B10F7D6EA901A012EC5 [email protected]
12,426,829 *015815640556CEBA8D1E8294746AFB5A7227ECCD ASAR
12,426,830 *01550F14C813EAA55683CE505849475BB7D76380 Asarians
12,426,831 *015AC12EB22A78EC1394F9D4B6F2B46BC75B1378 asa.rumberger
12,426,832 *0155551D9162F62453FEF2ACAC29FD26C0E9DEAF ASAsQ
12,426,833 *015ADB921B9D0BA3595B0CC7556611B7C2CF349B ASASQWETY
12,426,834 *01564B64CA7D72C62CDA11BACF2A5EEAC5FC314B asa.swendsen
12,426,835 *015143F05AAF8696654EED64BF66A2BBBCE302BB AsAtF
12,426,836 *015D60FC4A101A54CABB03378F9DB6167D18E251 asatianimalkhaz
12,426,837 *01554E6AD754A70D8A52FE9604928C84A87FF5AA asa.tjarks
12,426,838 *0150EFCE28763DD0704AA0E0C7D457C12BDD0719 asato 1 0
12,426,839 *01587590B600A41149356EFEC0CAD59D8FA6C70F Asatroened
12,426,840 *0159D75CE3A24FDD8E6BB0AFB2F5E7F6EAC456E1 asatyah
12,426,841 *0156331EBA77F8673B78AE02E14F2FB6498AA031 Asawakoed
12,426,842 *015BA77746D1425F0D172DCC7364525B81EFDB6A asa.washburn
12,426,843 *01543BBBCE07298A6002818DA8CAF7C4FE693ED8 asa.whistler
12,426,844 *015BDE4144FE78B7F013A21F75C8D99F96CB1BEB asa.zieba
12,426,845 *015DA09D20F088741C69A166070EF456BCF25FAC [email protected]
12,426,846 *0153311310C172BC0E41296497E4431D21422C69 As=B?
12,426,847 *015842ABFB882E9526ED61303DEC5E5288273AD9 ASb4f
12,426,848 *015BAA4FF01304C5C842C683C80961BCAE8816DD ASB6j
12,426,849 *015CB3BFCED7B2F3E705CF4C8E92E56DAE1FF6D4 ASB!A
12,426,850 *01576973E5F7CD1A4DD2D40D53DC1EC55D269820 Asbakje1
12,426,851 *015E75B6B933810566575DB030E80BF1636370BB Asb/B
12,426,852 *015DAC8A717D77506C64D528A29A6B5CCDEBE95F asbestipitoinen
12,426,853 *015C9604BFD15F720F58FFCE73E85CB2B0813B96 asbestisekoitteista
12,426,854 *0156F8E9582AE66F4F2A665B11F87144BF799122 asbestoaverbliefsels
12,426,855 *0150119164BB9F615513534C03AFC3D6CAB40D32 ASBESTOSAFE-CASE-HISTORIES
12,426,856 *015B47CB171BF57B8368E1328F43DEDDECB65B1E [email protected]
12,426,857 *015A6E7F6D4BAC5FE309F76BC139B0DF8014693E ASBm2
12,426,858 *01557A8CCF7229D99FA17FD06F3F26B3C022865D As:bN
12,426,859 *0151324BBE25B151786097609E7C10B93DB63EB9 ASBs,
12,426,860 *0158B1AEE28220B7B32EE4138AD2343DE852FDB4 Asburton4
12,426,861 *015F558B1906F2D3A5CF8072F83DDD46D9E51BBF AsBWs
12,426,862 *015075697031A421D1F86262E4E27B50EFE21F0B ASc._
12,426,863 *01533FA570B2D63A4C1230409D3F922B1DCCA6B6 A"sC;
12,426,864 *015A1AAD951964131D49D248F6E258693D0488B3 As_c,
12,426,865 *015A1873A116EC5B44BF54E7A927E9E308C6DA2E Asc&#
12,426,866 *015E2CECD0887FFF28E0D048308986747B2B9978 a&sc
12,426,867 *0158206384D019A55D0257BA2B74812A086CC2F0 ASc)1
12,426,868 *0153ABDE2CFE51FE66065E1414D4FBA05561E9E4 ascarid5
12,426,869 *015BC6B170E84B4E0F38D25D2668B98BFC4A7F29 AsCB+
12,426,870 *0157B76613C68B55762E0AF72800A1AAA8BDFD54 asccccsa4
12,426,871 *0156AF1447DD4535C517139265E1B3F8377B7348 ASCEN7S
12,426,872 *015BB31A5DC21FA7C834D6E4E491B356D050EE04 Ascendio4
12,426,873 *015A70C8DAFD0F08637FF695736769F9F08F2A29 ascertaiued
12,426,874 *015FA470B5EE31D19F43078614611A6AB9FD678D AscFt
12,426,875 *015762BFF0A2963C9DA6CC8924DEF8FF9A64F6CA aschenzer
12,426,876 *015B2EF4A27F0FF5F2CFAAA179F173DCFB290E4B aschiqidn
12,426,877 *01556A0FF2A742A233339C16FCAB83F0D0763BD6 aschoffanitschkowcel
12,426,878 *015CDDCCC68DD8D85709F2562C716E110B344256 Aschowa
12,426,879 *01573C6AB8CF789772EC2E2AFCAC8EB6301BEE25 asciiの7ビット符号位置にあるもの
12,426,880 *015FE41458743C30A54884C5CCE54837DF76EB48 Ascii-merkist
12,426,881 *01586FA5DB7DE1CA57AD95A2C3A12FA13506A40D Ascinery3
12,426,882 *015750BF1659CB7FB1F5C42C02074473F61FA53E ascinous
12,426,883 *0150FA16B47AA3B56D79C8A0E054DC618872546D asck3199
12,426,884 *015B7989EA858E99D18D417745119F4C76F1285E ASCLQ
12,426,885 *01585C84A65D6A899829E92F5F8BBFD9C8FCAE9F Ascogeno6
12,426,886 *0150956240118158CB5A8EF078E1A02712A09CB2 Ascoxhe
12,426,887 *015E2848609365371FED162C0F38E929059E032C AsCpq
12,426,888 *0151E075DB3D9D3C42F01D46390FF94B7C102D03 ascribimus
12,426,889 *015DD0A0603EAAA583AE07940DAC04DB5AE9C3D5 AscsO
12,426,890 *015AA5C799A4A407C50E1D9449103837FECF7A11 ascutneys
12,426,891 *015B29960512F69F46FC3BDF1C2D86626296AC83 Asc:v
12,426,892 *015A2D67F0B55DAAFF047E13F2E667CEF7E87ACA AsCVt
12,426,893 *0156B38B4B41876EB12CB3F2EE3CD9815768D139 A"SD&
12,426,894 *0155CE4410D63797F7CA656ECF6EFF78962167D7 ASD147852456
12,426,895 *01535E8BEF074768891D1B3D32BBB99B4C3BB5AF ASd3M
12,426,896 *01530B65A5F278893AC69E64B21E004EB8EA4D59 ASD746
12,426,897 *01591BD24DB1C021F5E480EC171E4B6E1944147E AsdAg
12,426,898 *01528D52751808B90A8E587A6CAC4530DB536B4D ASDASD2191
12,426,899 *015CD5AB03E0B9B09B3939954535E7B0A0561BE3 asdf4950
12,426,900 *015CDD9B0A217B826EF78AAECF1D40752885EC45 asdf595
12,426,901 *0159C764D68E618C3B70644C0A8BCB381730CEC7 Asdf758
12,426,902 *0154C0E98D38FD8610405276CF085511091220F0 Asdfgdjg8
12,426,903 *0150C52430C488283F86BBDF80250210E50AFF27 ASDFGH216
12,426,904 *01533FDBB72FB2CE0AF3F8DA687757B15E739964 asdfgh593
12,426,905 *0159E66FCA5ED00EAE2DF8A762C085AC73B5C535 ASDFGHJ232
12,426,906 *0152B22F3932DB513D267EA4239D996DC02AD86D asdfghjk1921
12,426,907 *0157D5D74FB567A14AACD390D16D8D243C4C2D4C asdfghjk975
12,426,908 *0157292022A9C8C85623ECA8BD40AB8CFA5CC8B6 asdfghjkASDF
12,426,909 *015BE24AE8A4ABDF44A17D1A2DBA86278E59B41D Asdfghjkk5
12,426,910 *01570FE54F099BE51F22A176EE26FCCE580705CC ASDFGHJKL120
12,426,911 *015FB4752F9BFC60FABB5F6430393A81B002D36B Asdfghjksmiles
12,426,912 *015018833F5E96A2089564C61D0E2CA13C0F8140 Asdfghs5
12,426,913 *015A3505F876F686D534C6028C8A2545ACF1F270 ASDFGMUSTANG
12,426,914 *015435859F8FBA4E54D6D6D023BCBF962B5179F8 asdfjkld2
12,426,915 *0153658D12E2A0F14FD772E69CFEF60CEE8A12A3 Asdfjkl;taffy
12,426,916 *015CD2133FA5004D1DDC4831F3123FEB63D219D6 asdfpass8
12,426,917 *015E4F6924A6212FD33F7A715F0ED52F161BB058 Asdfpaula5
12,426,918 *015C73105835C36FA488C9A6D66B3EDD10643E81 [email protected]
12,426,919 *01521DED808FEF5D4EE877EDA00D156419FE8E41 ASDFSD3
12,426,920 *0158C12D1652E4141E1A538A1E7157853C669205 asdfthen
12,426,921 *015185A3388E7C1F20B044ACC4BFF660A6B67126 ASDgQ
12,426,922 *0156B9DF9FC02AB4ECF75A6BE3D5C9BB1A188738 asdielewensstormewoedendomjouslaan
12,426,923 *015CC92E9ECD5F3F4FF24442BE3B41EE013DADFA Asdkk
12,426,924 *015851238EE3B147A29765362DD0ECFCFF6BB02B ASDMr
12,426,925 *015D06B8D1A38D328B79010D97AAA7335357C72D Asdoneasd
12,426,926 *015B8A0E81A93086DD370D3E80604CBD983482F5 AS%dQ
12,426,927 *0157697E6DD363133EBFE4E4D5E8C36B636B2928 ASDREPORT
12,426,928 *01584535D5D25CB15A7F564A0CFC51F2E6A2877B Asdv%
12,426,929 *015422E8D72F012E21D92E9ED747C04B2EA7A1D9 ASDWEAK
12,426,930 *015A08A247744E1F75583441208C327619F8EEE5 asdzxc12345t
12,426,931 *0154C2F0F96122552C07DBD2D72CC273A99E1147 A,(SE
12,426,932 *015498FE112D5433B271DE130BD0D9E896819728 A;SE/
12,426,933 *0159624E364BD25D9B7F8FD1F8E3199582AE8AFC A.:Se
12,426,934 *0154107A09537DCA4F90957BB5242D2DE844B356 A%s"E
12,426,935 *015C9506790C9CF9EE21D6917968797482AA67BD A::se
12,426,936 *015900E61845359D07306A6CE8661B93E12FB209 Ase""
12,426,937 *0157B0CC769ED880A1C837925A56062BD44A3BB7 AsE2K
12,426,938 *0157221F7EC210D414653A589D3AC31027CD15C6 AsEaf
12,426,939 *015B356BC68694DEC3320F64C4E312E8319CF640 ASEAN-TOURISM
12,426,940 *015DCF8E88530B5A5F8CDF67BD2C339E1ED15517 asebaidžaani
12,426,941 *015454DAE5CC98FAA14AA8692C56E3F38BD11181 AS,Ed
12,426,942 *015E341AD212092F84EC538ACC90E2F4AE3A1FBB asegeng1
12,426,943 *0156374E516103FFAD9A0367541B6D1B0EEE71D5 ASeGm
12,426,944 *015FD71D105C7B4B6D07766A897FE4A864544EE5 aseharidusminister
12,426,945 *01541A557A7116954D15D0D9154F30753AA4D804 asekaupasta
12,426,946 *015E11D245561C900FA3731DA2D8BD22E5C31F3A Asekoulu
12,426,947 *015D73B421CD30874C5B48CA7AFE7E0AC3F03110 ASeLq
12,426,948 *01551D336767FE4669AE23DA5CBEE781B3016B31 asendusvärvusena
12,426,949 *01598BD7E716144B3BABE3CE45F45FB4F573005D Asentada2
12,426,950 *015E0970129ED102871655153BA52A238E2BE764 A"seO
12,426,951 *01584EC3AAFC67362C6806E762883EC7126AC1B3 A+sEp
12,426,952 *015BC26B22B2FA7995A7C76E036ABC1B01F3A74E AsEpP
12,426,953 *015AE622EF23831D4E0F72DEDFBF1B960E10A888 Asepsises7
12,426,954 *0151C519BF4B790C1E740F5AD2A738A3F273E25E AsEQ$
12,426,955 *0154A2F02374BC546EF0EDCD4914637B225241DA ASEr%
12,426,956 *015F5CE5100CB7E1F6EFB4B2D3F0EEF5808360D5 ASEr5
12,426,957 *015A56BE93EE6D0EC8DE33F4C1C41624F2612490 A-SERIOUS-BOUT-OF-AFFLUENZA
12,426,958 *0157019436A05C16422D0D92879F3BE76010BE91 ASESORIA Y GESTION | COLOMBIA
12,426,959 *015735A4C50FF0FFA148CC44B92E5CACE8D21F59 asetene3
12,426,960 *015F0B565D52C581C6F0CCC761389C1B77202361 Asetti
12,426,961 *0152A15C67CEFCEE9694674A94539F70018A6EC6 ASE?X
12,426,962 *015B72EC43895F1C4A5D8711B196D8CCA6ED14B2 asexuada0
12,426,963 *015A95F68E3561AAACFF450A37E3CB238A16F9C7 ASEY,
12,426,964 *01510A20444818426FBF7503FF1321E998A7CDEA AsEZA
12,426,965 *0154278597EC95F6AF865468276D899DC8FFE23C aşezările
12,426,966 *0159603910B763ED85938AD36E147B56C6026900 A?S)F
12,426,967 *0152B1F216DB61B30F3F24D6BC8E35358F2D7CBB A+$sf
12,426,968 *015CCD99B292BD2C82DF227D29BBC7D9D3D407A1 Asfahrtening
12,426,969 *0151EBF5598720A4738A388F40E57724C7EB8D36 asfaltarlhe1
12,426,970 *01549830F9624F210295A8E0B1D2A56F2A88D95D asfaltcowboyen
12,426,971 *01585AC05A0D1715623F9178AD4AEE5C86F807AE aṣfar
12,426,972 *015D602E124608205DFB797B999F5C2CEA78C040 AsfBD
12,426,973 *015E2871F9BC79EC0E457E080CD3FB132AEDE4F0 Asfemisk9
12,426,974 *015FA9A5E28C3A622D84EEF04C04F9EC358958D0 As&Fi
12,426,975 *0152B34089048263F6EB427260E2E28BA56FA2CD Asfixiação
12,426,976 *015DBB67112D5478C693832915465F5DDB9A2B0F Asfixica8
12,426,977 *015A575B6D6756F48610C8933B6B93F9E6DAEFD9 ASFm5
12,426,978 *0156180479B947EB78365C9843131E32E1B4AE90 AsfMG
12,426,979 *015DCFE2A3097953E1DC60F6B2E7CB267BC94EF5 ASf)v
12,426,980 *01514A3D65CFA061142E42BECD6E1CDBBA87AA73 AsG=:
12,426,981 *0157E4885AAA680DDEE9E1FF9DFFD3A85DD65DA3 asgamecruft--unless
12,426,982 *0158252A82F44929F22FC8A6301AFFB4BB9EAECE asgardhr?
12,426,983 *0152BADDD50A6F1E78C251A7C7334A1518540BA4 ASGATLLA
12,426,984 *015BD95AA5371AB44A79CF3D459A869A65870924 asgats
12,426,985 *015A9180682CFA0478A45B334D1BC27604F7007A AS-GEN-CHINA-TAINTED-PRODUCTS
12,426,986 *015D23D66BCE8BA3C206C6A7E263FA414D4C1DA7 ASGK100
12,426,987 *0154B7E21A24411FFA5FDCAC4CC2C61D47CF49EF ASgkc
12,426,988 *0153182057206247D748F33102180A5283560EA3 ASGn,
12,426,989 *01532F0C72AB2AD820BD47D322438B3E07B0866B ASgnd
12,426,990 *0158254FCB718EC605CE31C282E339CD6150C6F7 AsgOI
12,426,991 *0150AE2F837484406F00CDE25F312CB7F1A5A99B ASGovernors
12,426,992 *0150D97AFA56DF4C7D088ADF22A0775109DF605B [email protected]
12,426,993 *0154528681D6E7FB98C9EFC09F495F94367E6379 AsGTc
12,426,994 *01594724B2B1C7CF63AE30272C2CB9A07CFAAA0C AS$%h
12,426,995 *0158F605E86C26DFAB32D0C3E2F946B00F66DE8D ASh]
12,426,996 *0156F34E4451E6BCCC9E3DD6FC6C47D771A42B02 As;H_
12,426,997 *0156A5B0BC83A3E0F7E750D928C701AD7B928B89 A(sh%
12,426,998 *015A890781F6A5334E24C7F49A3468BE80405E86 ASH041188
12,426,999 *015205368B4F10B9C078EECE2EB93F03CAB3A4D6 ASH6O
12,427,000 *01553DD3BDB4FDC623FCF27FBA91612E4835C8AD ašhabada
12,427,001 *015F9DDDAB067C89760E0271EC7B1D86EF8C5C3B ASHACKLESONS
12,427,002 *0157262692009CC64CAED3454B64F6154370DADD ashanesse
12,427,003 *015F10B4BAB71DB47D4E12E0DA278A555B8B3878 ashantiantofagasta
12,427,004 *0156868949218FF6B8485865AB44A7660664527D ASHARQALAWSAT
12,427,005 *015FA6D53A78C9D08743F8C23DCC7FF3F474516B ash barre
12,427,006 *015DD8E1DE4C60CE9F7A8740E3E8A464C24D65F1 Ashbrain0
12,427,007 *0151009EAAAF64BD71B2C58DF8355C9F82396224 ashburyBSW
12,427,008 *015518331657BE46B98AD59E080A06847A385988 ASHCOFT'-'ASHCOFT
12,427,009 *015997222C59D593316C0B0768CA3B795A88081B ashcraft160
12,427,010 *015AD2FF24D68B1C2BCF0DAD122F6A2CDE409220 ashe1260
12,427,011 *015879183F537C7AB5D48B62CE5348FD66C2A8BC Ashecroft
12,427,012 *0155FBFBA913E8CFBC6FD30CB58219FBADC81CF7 [email protected]
12,427,013 *01550390160C0DF59725305AC3ECB59A9F1A1B91 ashely allen
12,427,014 *0151EF8688F5848DC60B7DBC4099CC1524C9F6AD Asher266
12,427,015 *015C652BF1FD076CF1E50C91599D6386891089BF Asherton6
12,427,016 *015AB8CDBD415B86B330200B003C97A5B27687DD ASHES64
12,427,017 *015FBA6C917CA8893690CE83738EB5D287E14D88 ashestoashes(disc4)
12,427,018 *015F04F9DED918CC4ED814BC4FAE55C7AC3ADD45 ashfordwilson
12,427,019 *015B7E88B4964E8C5A5FF3E5FDF48142ACA2A321 ASHICAGAL
12,427,020 *015E910B987B65C2203ECD169D80962D30845E9F ashigaru4
12,427,021 *0157589DDE34F3E86970A9075BAC9FA1B4B07BE3 Ashihara0
12,427,022 *0150958BE2ECBEFF5926301350A21E0FF75FF83E [email protected]
12,427,023 *0157B0FF8A562FFB9F572F653F30085FD53918F0 ashishom1
12,427,024 *0157696A517F02EE1F97742F044ACAD48F1488E1 ASHKOURI'S
12,427,025 *0150863AB64AC8C5CA2143B726BF95FB7C6A305E Ashlar li
12,427,026 *015D0333604856F945BA398C5D195AD0DBDE8F48 ashleaknight
12,427,027 *015A0F3B549174D436A14B8FE0B276D08CAE2A63 ashley123nc
12,427,028 *015998D2A81EDED1F05EB583B684D7E227157287 Ashley585
12,427,029 *015666B0A7F933D981EA56A7FCAE0D1F80FC1AEB ASHLEYAIKMAN
12,427,030 *015B333E93957E59750EA0957AA8C19ED117C92F ashley.beat
12,427,031 *0151FBA93B25ABEEF3DD89D5328BC9C49FC13817 ashley.belloma
12,427,032 *01521059C0E2F7AAE5537FC03013F1F08F36E36F ashleybristow
12,427,033 *015FB876D267DCC566C8B092CBA8CFFD19F9D5DA ashley.cabreja
12,427,034 *015B09BFFF0EB823C6DEC1EB6A0589FC87B98F1A ashley.cappas
12,427,035 *0153C0AC384935C2F235395CF840D68E97B6CF82 ASHLEYCHONG
12,427,036 *01582184F7F13EF84EB855639A1C1BFC0A00D321 ashleycoggins
12,427,037 *0151F88FD05D80595B4EF3A33BB5E893F1826D5E ashley.dunsmoor
12,427,038 *0157A5E2C420FB6250DA82F5CA8F51FD6D25A11B ashley.fausnaught
12,427,039 *015F6D3A8EFD0205313B7B18D07C43ECC3139A71 ashley gent
12,427,040 *0156CB34A050B5B0B9C89278F0D03D0ED467E8D6 ashley.haessly
12,427,041 *01589BCA35BD66D4E6D907B460FCB70BE33014AA ashley.haughn
12,427,042 *0152327D8283CD073C50236B16F12040108FE7F1 ashley.hepper
12,427,043 *01527C63E1640A2AD3EC762EA412F15FD19294A1 ashley hirt
12,427,044 *015E69ABC4FEC4F60DD8F09B843CF537A70B2463 ashleyjscott
12,427,045 *0153431E4F9FDFFA06FB542EB893717463AEF6B7 ashleylambeth
12,427,046 *015ACBA7B5FB4F223719AA95BFD11574613C0901 ashley.lourens
12,427,047 *015B80D349299D148EF972716AA21C92CDD5BDF3 ashleymaben
12,427,048 *0156F6947F04E04C7CF042CADB96BF916939211F ashley mcelveen
12,427,049 *0151E94CB5216A58DEE2F54165FF07D7BD1C1A61 ashley.mollins
12,427,050 *015176974FB74A79D2607DB419C636CEC6C7FCB4 ashley.normington
12,427,051 *0155C414D0FC0D2FDA4DEF18A720CF879C39BDCA ashley noyes
12,427,052 *015DE34D80AA70F681E033544F5140E16E7BF488 ashleyquan
12,427,053 *01553B0249C0F1E383D32673E7F7ED0BC1D32841 ashley quigg
12,427,054 *015E116A488AB46CCD54915693C2405F381162F0 ASHLEYRUN
12,427,055 *0153AA5BC37C3EDD2E5F0C9AE34657465DD8A3EF ashley.saumier
12,427,056 *0153CCEED278812AF303DE77514F0B0DA01D4C3E ashley siwek
12,427,057 *0153DDEE18447A892635EB9A9D4204CEF334F11B ashley.sneider
12,427,058 *01541F3C100B5B445EC349A5ECC10B8114FFDB54 ashley sofia
12,427,059 *01564E06478CB2FB590B52286B56640666738370 ashley tholen
12,427,060 *015C08744F7003039CC7EB0928B1140F40819DF9 ashley.trunnell
12,427,061 *0157A5FC6F11A148390C6B49C020FE0DADC18FE4 ashley.vitolo
12,427,062 *01520E056FAA03B4BFBBFA24547AD93BD3211079 ashley.wands
12,427,063 *015CDA9439B996269FA1A68D8C17469AE2162E70 ashley wanner
12,427,064 *0157C1E84D22716AF7B5102A20E38DCECE30E27B ashley wickline
12,427,065 *01521A8091A3F5BCD4A831CA9A5F22623674B41C Ashller7
12,427,066 *015C2FE058F298B00B3A27FC6C102B9F1C6A202E ashly669
12,427,067 *015E788D0E83AC2989EED61B450C0281A73A041D ashlynn426
12,427,068 *015F3A07BEB2FD1DE8E2831C7522B7F1B3EE2D76 Ashlynn753
12,427,069 *015BB4E121281E131EBDFC669D4541CCE2C2B19F AS"HM
12,427,070 *0150CA18488CF8FDB7FD54603BA50D0656BAE9DA Ashmore J.
12,427,071 *01569A15C932C7D3879DEF83F17F31B84949D80D Ashopen6
12,427,072 *01567EC4010C0DDD7765AFF11FDCD0164BF443F2 ashoring9
12,427,073 *015032F7F541C18C2DFF59E4BBB81FF9A7B1D484 A Shot in the Eye
12,427,074 *015B6EF58BE9A9272E64BF531E3DFBCB66211E6B ASHPJ420
12,427,075 *0153B63A438E0A13A11DFE53E116C70F9961C226 ASHRAF82
12,427,076 *0158320A0F8FAEC6A0EA18C6C8D3213F53FE5D2A ashrafdababneh
12,427,077 *0155E7B614254628D3486F8D08E8E2F4EDBBAD5E ashraf reza
12,427,078 *0153C73A15AE207B59A2FEE9D57CB8E079084AF5 AshRe
12,427,079 *01595D76F55BB795C2B4CBBB10D3561FB7DD04F4 ashrit123
12,427,080 *015BFAB5E0ED377D2FFD8DFA2E9AB3695617A80C ash’s
12,427,081 *015B4E4FD162D626FE662D0C89CC1689960114A0 ashtekar3
12,427,082 *0154190661B395C5D399F858A1096ED07B8FA571 [email protected]
12,427,083 *015F1FAA78499D53A12C6D3EDE2B76434551E039 Ashton1999
12,427,084 *015419413F81C3F9AF834103F1A2663865A03544 ashton304
12,427,085 *015AC6A375D6CE9EF3C66308DB30F2B3F9747463 AshtonW.
12,427,086 *015D82D42DA345864E9368E5A529CC4C5A788C98 ashucaj
12,427,087 *0150B44678E74CFA3C10BBD1910434B63F7AAB08 ashurovabdugafor762
12,427,088 *015E5BD5A17314C3731F6D5AD8B1616D2EEECF18 Ashvavated
12,427,089 *01576B4E7A6F02E6E05752E08AE1C042F904372B Ashvibhih
12,427,090 *01504E534A46BB2BE275DBA1FE8F253262317328 ashwin banymandhub
12,427,091 *01552C1ED1AA90178EA7F2FF3A76D23CC7F255E1 ashwitha rai
12,427,092 *015ED04838D985A334C05A4C94E41ED575712E6D As
12,427,093 *0153AE171BDD3A2681C14349B29BB1FAFBDCBCB0 A;"si
12,427,094 *015854CDEBB3BF047C9766F7FF04F4BA2CE141C3 A:si2
12,427,095 *015AF54E5DE3A3D94C98BF5E2148C227E7BC47C1 ASI2d
12,427,096 *0158D3D0BE65E9973C02BF323B194A332265984A ASI5%
12,427,097 *015737F5CEA8F74AFF2D6305BD79618F05C0839F asiajk
12,427,098 *01534A6466D80B34711F48192486E5856656B0EA A'''SIAN
12,427,099 *015B275CE0FD15C10B32860624CFE01888589B0A ASIAN-EDITION
12,427,100 *015AB2F9CD24B18A6BB0F425B1CF863BB02D74B5 asianmediawatch
12,427,101 *0151B4BF546F63E869D1E238949694FA335714B7 asianresearch.orgwww
12,427,102 *015CEA67CC9A5F2A74A65D7087A558F50828716C asiatech8
12,427,103 *015C23F801DD942E7E5A2AC205039E87DC189A5B asic43A
12,427,104 *0154A27B4AB79C0BE54E9A45750A94560370A870 asideleave
12,427,105 *015CB1BA7E9EE49DE736E74FA82FB60A24115F86 [email protected]
12,427,106 *01588CE4D12D7DB2F163BB4F7DA51A782CD04856 AsiEw
12,427,107 *015D220B2421409F236705622110FBEDA49A8BD3 Asigara5
12,427,108 *015A07429162116CF12A0DEB0E4E9213D4AECD1F AsIji
12,427,109 *015915699644E8C7206DBAD8B10FD8AA221CFABE aşıklarına
12,427,110 *015390628A4B2474CCE277F046A1C6313FCE7984 asilanteBSW
12,427,111 *015EB9B9C0886D4E1F6DE118672C8F353BEFE3A9 asimovobit
12,427,112 *015F74E32B83EBF0BF0B510D9E34162F36D1F239 asimvtr7
12,427,113 *015C721CD53206599015563968796B571C6F3EC8 Asininos
12,427,114 *015D40F7233F6DB36FCD55D699FE61DB3568FCEA Asinissam0
12,427,115 *0153E28774379CEE0719E01C6A83E398B88B4701 Asirobal
12,427,116 *01555DAB858E6F8242C530F9B32610D92DB5F2DD as i see it
12,427,117 *0159C7184CB9E8E43F2211F94E5FD20EB622B0E1 asistur2
12,427,118 *0153C3200A83E1655BEE8506EEA1FC8C3AE8838C Asisyen
12,427,119 *0152FEF989E1CDF1FEF144C8DDA0DAD7E3B52771 asitena7
12,427,120 *0158EE49CD017F38ABA661AE47CA675E293D30C1 A?S%j
12,427,121 *015B2ADDAE991116EC180230EE7149EC3737FDBA A$Sj2
12,427,122 *01556170B05213EFD7318E17DF3AB22430136F5B Asj$6
12,427,123 *0157F84205E801F5487EE91703896AA424754E02 Asjerene6
12,427,124 *0154FE2589C9B04243A47D2B1BD94E7046840F45 ASjoH
12,427,125 *01558C53CFE3DE253623D6642D44D6F26E4A4177 ASjsU
12,427,126 *0152C9C9A9250BE85D27589D3FD021913622086A as jusu prakeikimas
12,427,127 *015FC5B14BC140D55AC1C876DA477ACFA65312D5 ASK,!
12,427,128 *0158E44CAAFDC03DA82927782B035B4C47505EAC A#,Sk
12,427,129 *0159E0C89CF2B19837FD4EFF581C8E6B864D18D6 AS"k?
12,427,130 *01590382161797CAAB67B6346B7B66895B4CCFC1 As"K?
12,427,131 *015E4C4B716C4445AAE86824CE3ED257AD544F01 A=s&k
12,427,132 *01573B17CB977A2CA85C57053C2A534BCA854A4B A:sk_
12,427,133 *0151C30202FC32AC8EA8F10938F12240410DD913 Ask6E
12,427,134 *015EBA092D7CC80797C9E17ECF5F6374E8E74E2D Ask8W
12,427,135 *01502A1D1C47AB3C71BC5F4A1D42F7CFD1A7E6FB Askanding
12,427,136 *015BA4C61E94A9DE8EA286C19B184E10AD43E0E6 Askarel6
12,427,137 *01595CB7AA1B8A7E7A33174E3082F8463C4538FC askarrellut
12,427,138 *0153BFB4F7E1020DBF7EC1B44430481DFC67D9AD aska、作曲:
12,427,139 *0152D8DB803A7A7A6D7E17FFC06D0E8F71ECAE3E ASKAなど)が所属していたが、2000年に
12,427,140 *01520D6FCF31D521C9427DBBEE44316C2ABF3F66 AskD
12,427,141 *015968D9470FB1A8124B7F81642C72129FD35459 askdegas.comwww
12,427,142 *015E1C4184B2670969329B0578CC47632DD3B4B5 ASKEBGRE
12,427,143 *015537804931C645234F5F34AC313F9950D3E87F askefised
12,427,144 *015BA3F1868486F84D66EE87A4765ACF090AD6DC AsKEg
12,427,145 *015B7F91FE25A65CDBDF9A86414C52BEB7670264 askelsilta
12,427,146 *015E60AB4096442AD96DA87E8E35BE3BD96BB8CC ASKENT123
12,427,147 *0152F0BAF8908D635EC8DB62F77FE0638EF95557 ASKff
12,427,148 *01592EDCBB026E1BFAB512C6899B23DBC5DAFB66 Askincask9
12,427,149 *01585B2D874FF1FC957D4F7257DF5B6C2FF83A62 AsKk,
12,427,150 *01590E425AF2E6C7A8AEF943905A47678DD16C86 Asklepiostempelet
12,427,151 *0154E774A496B90837E416DB2B339D5BD78D5743 As
12,427,152 *01509344FBA74DB3AAA0B4F8C1A89F5F91719D4D asknj
12,427,153 *0151066CD4C882D9666BAFED9A00CCD04E8F2B38 askogoniu
12,427,154 *01504FA0E13D334C1F32ADE511B73B048CAFB686 askqs
12,427,155 *0151895E352FB293FE1E1DD5D2220433A05719A0 [email protected]
12,427,156 *0157BA6D95BA85DFD8E3E7C63157E9D3ABEFBB49 AskShannon
12,427,157 *015F00B97A73D289A502AE887744D1289571B207 asktheguy1
12,427,158 *015E74551BD911FE7D48139A43407B10B912AFDD ASkyeleuchturm
12,427,159 *015FE229D07980540AA25609E64EF6F9D3410AE0 A!S/L
12,427,160 *01514EAC21D14A4B3C79B6CFD72770E09EFA457B Aslachanow
12,427,161 *0152D161ECD4D8E190C43E4F3BAC8B34966D41BA AS-ld
12,427,162 *01572EA5BAFDECADB942DF7CDFF5390754632C14 asledom8
12,427,163 *0151044CA2CF8ED01CB4380D724C358A17C40BF8 As#LF
12,427,164 *0157801738FCF3116E346856BF692FFF3704C159 aslgx
12,427,165 *01570364E67971304610471D99EFB6AEC57EAA0B AsLLG
12,427,166 *015FD873949EF9CDE70309FDBF0840B32F1DB5AB ASLm8
12,427,167 *01512ACFFE2974B4A07653BB7EF97D72DCA590FA aslmaster
12,427,168 *01545B057C023D85B09D8ABFD78925BBE1167AA5 A;SLN
12,427,169 *0151F465324F3B3AA593788815C1728D9DFFDF93 AsLnF
12,427,170 *015A9FA03C7D661ECB3C2EDB26986D1D08C34D25 ASLNp
12,427,171 *015989072A5CB4C3DF43E7DD1B18F836EC854557 は、aslrが有効となるよう特別にリンクされた実行ファイルと
12,427,172 *015DCAF767A689CCD22D98CAC0E9D958D06359CF ASlub
12,427,173 *015D8EC47CEED7EF2AC6E3DC941B528262C81C36 A#SLv
12,427,174 *015E57F1659095FCDD5293BA8CFA54FE81DEE148 ASLVZ
12,427,175 *015331CB40DE343C288631129C458EB557AFB62D A.S-M
12,427,176 *0158250FF3B991F8CA63A626F8715B14CBB7103E As#m,
12,427,177 *015AC10C98700DC09A541A21203C68768A70233D Asm!1
12,427,178 *0156E40220584FA8B0761F0038DFFE9405C0C179 a-smarca
12,427,179 *01583C704CF79AAD74FB08D8FF20936DCBCC2F3B AS!mG
12,427,180 *015C10E303E20D2D5BA7FFA07408A45C37F86D77 [email protected]
12,427,181 *01525CD4E629F7F14021BACB84152CDD5C640CE8 ASmH$
12,427,182 *01532A62DA0EFFA87C516A934F8CD79DED47BCA1 AsM-l
12,427,183 *0152D1607AA2CE45A97866F53EC33FC3F52CF0C1 AS.MN
12,427,184 *015B278AE3FAEB3C459FC4CB23E7999F01EAD5D3 A%smN
12,427,185 *01522CFC605A09595992099B7B8DDC4FD4C37C5C ASMONEUS
12,427,186 *0151CE3313F172043393A049FB61211E4D271238 asmsbsw7
12,427,187 *015DB27F4483638EA87193D457E954EAD90AB7F8 ASm#t
12,427,188 *015BF6E156DB0E7C2E860CFC2733E1464F5DD1FA asmundo4
12,427,189 *015BA6A3C0D7474419A6F4B120EE4ACA0A5D86BD A%
12,427,190 *0158F26728EF445BB0571711306C88A2D0BE6774 A!SNC
12,427,191 *0158B523DFD59E5C14AB4BC97E0357E8187402A4 Asnediepping
12,427,192 *0158C20360729F56CBED7231D7E7D973BE33FE7C Asneenia0
12,427,193 *015B5848C15B3223C0F8CA15A24671ED5A65E7BA Asneskok4
12,427,194 *0152EE2EC529D3EE8E2FABA364318976AF1C814D AsnEZ
12,427,195 *0151E913AE9CEC67FB0485BAEB9BDCB4689C05E9 As_NG
12,427,196 *0158310DF192E3D63A0D3D2ADC6BBD687E5DCCF7 AsnGg
12,427,197 *015D8984711F7D73FD82B10439D7E929F52F229F ASnH#
12,427,198 *0154C36C58542A9854D5B75CDC71F54FCCE8C6CB ASn+h
12,427,199 *015BB2BF1169FCD08E0D046E928372E24458F5F0 asniffl3
12,427,200 *0156CCF09288F2B7EDCC089F3BF016323493EE86 Asnitokus
12,427,201 *0158FAB7D2EED1AA3662883605DC5175FC44FCC0 A"SnK
12,427,202 *015D5F69775BEA8129E2FB555F67A2D37829F29A ASno2
12,427,203 *0153BC4E9111970382A66344D617B833332DBACF ASnO6
12,427,204 *01581352322C29AD4C49D386E627F6E9F3CD3FDF [email protected],
12,427,205 *01590D5E80B4037F5B77A4DF94B567A83D176741 ASNOISSIMREPSNOISSIMREPFERH
12,427,206 *0157633EA00D3B4AB2983CDF4718B4E27EB3B869 Asns?
12,427,207 *01583B5905F2EED1A497E6546873A5AAE60829BD Asnujatn0
12,427,208 *0158FBD21984B554A27DAF8EC8CFAD1AAC5B4465 AS.&O
12,427,209 *015EE14066D14284B6AFD1DD25BE411497F4F031 A,&so
12,427,210 *0158FD968AAA6841A6C85C48CC559747A79DBD63 aso!
12,427,211 *015A818B5477281A5D92033ABB0BC5DA03D92DA8 AsO53
12,427,212 *015B54D11BD496E503474DF9D9D835B00265AF14 ASo)8
12,427,213 *0156453E56CAD6472D1137C8404DD72015AB91BB Aso9.
12,427,214 *015C15F9BAA6DC86EA11F3BAA78CD7EE84889BB2 Asoagier8
12,427,215 *0155CF71DA939981B604C6058CD4BF305692ABCC ASOHEL
12,427,216 *015802A76AFCCDD9428FBEB83EC7E26509C908DF asoiaf.westeros
12,427,217 *015A60C49BC2501318BCF2F7461A5F488D97F909 asombro2
12,427,218 *015E01E8A56EC51495DCBB8226007556DD047D99 Asommos
12,427,219 *015440198E2E05661DE4998D884A2BB6F04D24F5 ASO#n
12,427,220 *015A85244008FF968288CF4B8C24B9E8FA8BC765 A Song for Nihilism Now
12,427,221 *015315D0D28BCCE8733D56BB09B4603120D267D3 A Soothing Sound
12,427,222 *01510E0026268BB72DAE58A205516BC0FB69F483 ASoPe
12,427,223 *0159F8B723D9E4E990869DDD20B442AF420613EC ASOR39
12,427,224 *0156ACF586E00D291A67BAE98D42AC87AC78AB6C Asoraddon
12,427,225 *015A34417E52F226185FEF95A02B0681C3F8BB08 A/sOT
12,427,226 *015901E792F9C4C5D6C86832C80F1D65BEE4B899 As-ot
12,427,227 *01526CB24B23AA01DB619ECDD8DA995E5A992474 Asotnouls
12,427,228 *015C9747AF9F9BB1CD71251898F3D81F1BAB2F41 asounatued
12,427,229 *015AE1AF142476CE2E8A4FD91296374123A41CFF ASOUNDRE
12,427,230 *0154F63BC354AED5B1F846098C98B717E383C51A AsoWO
12,427,231 *015D53610443187D2D3EA56B59CDB7F7F497B421 AS.OX
12,427,232 *015FC3A30B56A7D03C797790D311A14ED23915EC AS?,p
12,427,233 *015793018BD4105FCF321B8AF4D9872EBF3802B0 Asp"3
12,427,234 *01594886CFC07E1430D6768D9D8C82D06E84A62F As;P7
12,427,235 *0151B752F03C03F9E81D2493E893C8565903AA85 AS!p8
12,427,236 *015A99A9E8C748E2A009FD9A60ABB50CF9830598 aspallcouk
12,427,237 *015D3B10544641EA0D0F47AE4F5F4D876437A475 As
12,427,238 *015C0B21931C580BE802BC6CB8937198CB10FB4A aspeision
12,427,239 *015A198E50CDA42F62B1CE8DE10D88A19E3D685E Aspen402
12,427,240 *0153520208222706CEE28E2A48BFBE8F59936C6A Aspenmailman
12,427,241 *015CE30413C1B9139E5063CB4C3306CBECAB89C7 Aspentanya
12,427,242 *015F0C5F2A83D9B84380672E001E2EAB797A0023 Aspergerons9
12,427,243 *01568B333DF54A994C4B125CEB6141DF59896B0E Aspetova
12,427,244 *015B6A9215B39540811A1DB4BFCC2530A5CEBB5E ASPHALTNACHT12
12,427,245 *015D96011853F92D6C2E9D13140B4D4EFD3637F0 asphaug7
12,427,246 *01503E9B9AA8DCAE9CE069D6AD7E8DB6A74BA562 asphyxial123
12,427,247 *01559C8CCEA80315D60AEF5E69D275B942F4BB4E Asphyxiatives
12,427,248 *015080BF5EC2010210754A7C96EB9BAC2ABDCD47 Aspicia2
12,427,249 *0159F22A5CD8D3B31BF36DC81679697DCCAF3596 aspidistra2008
12,427,250 *01524312458B04077EFA141E93CF8A2C3077FF88 Aspinalls1
12,427,251 *01506F8FF282661DF6856AA9AFB3D89FB858DC9A aspiracionies
12,427,252 *01563B637D7E2DC0411352A8AE884AE520EDC8C1 áspirar
12,427,253 *0157FB07E4EB1379F720404564D9C6CE0C30BF69 aspirastes1
12,427,254 *015FBD73FF17D1B6BC002CA9B885492E1C43E0C6 Aspireert2
12,427,255 *015EDA2E2474AC72C4AD29452573FA9A394FEC72 aspireeu123
12,427,256 *0153D4E9FF053DCFD17B7E2E95EA3B00A8CE5DE0 [email protected]
12,427,257 *0154602C12D7A4B83CA20C1BCE61215BE8083295 ASPKj
12,427,258 *015EBE2DC63836A77054CF073ABF244289EFB0BD asplanchnicing
12,427,259 *0156DCB8A035C080371E3A6ACB5EB7B3EF778136 asportationed
12,427,260 *015BFEC7881129ACA8A52B04E73E75C0B13B2A1A A/SpR
12,427,261 *0154F8D084387134C81A04D6A329DD2A1C4E102C asprawl8
12,427,262 *01519F6B0DA025F960A7DF2279C0B5BE05756D38 [email protected]
12,427,263 *015C68AADC4B246FCF28E7F13FDF437582F1A1BF Asptp
12,427,264 *015E36481DD8C9E3DD7F2F4EC956FC3B88404F6A A(spV
12,427,265 *015EFD3D9A1B31AD5D5899B489DC641CBEBAE4A3 ASP事業、アミューズメント音源制作事業
12,427,266 *015AF4C84C45E85469CBD317016D478E25C6FD0C As_Q)
12,427,267 *015EBF9C660D518D6306765C00FF7A01DB98BF00 A=/sq
12,427,268 *0156F90942DBE3594DB499DEB018919976F83A1D Asq//
12,427,269 *0156AF9C70AAA65DDAC9AA7920EF07129E9455D6 Asqbf
12,427,270 *015E9EAD9F12AFAA9F4AB1969F11A7CE7F26B8CE ASQ:H
12,427,271 *015386F78443EC27B98FA6C7668B7FEF547A77C6 As_qn
12,427,272 *01543841A9FC650DC02A1AC5FEAC8A27EA97C2DE ASqp&
12,427,273 *0152788504204D053A134C7167F4343266D904BE Asqsv
12,427,274 *015386F6D331478B8EB83F21B592448340B03A8A AsQtA
12,427,275 *0151791CF86923348CE381F6BDDE666F5D5FA687 asqueals3
12,427,276 *0158711C2A81D96CAD7FF81B764597DFBC3C55E3 ASq#V
12,427,277 *015559C372840787B9D9FA78B01C1290FDEB7DEE ASQXi
12,427,278 *0159CA1A49EED3E807EBE783810ADA5A07CC7016 ASQXP
12,427,279 *015BF5C7DB16BE0923E728C74B158B3EBA19CFA1 AS#r_
12,427,280 *015B1B0554194161E32B5471ED5B729DDF3BF07C ASRAF'S
12,427,281 *015FFDC2663DFD8976C3FBE75A6B3349EE8AD167 asrendement
12,427,282 *0150F7A75C4A803D1D6AF0A438AB1B859BD8E389 [email protected]
12,427,283 *01544288BF427EF08743D69BD3DA6CE32D6206EB ASRuthW
12,427,284 *015A829E397336C31785203CDFEE853E108C21E6 AS,rV
12,427,285 *015FC014CA58ADA9665378E651879F76CD2F67CE As-s=
12,427,286 *015D8DD79C0BC0A3E0985E4A1A5D03A9CE4F2782 A(SS2
12,427,287 *01558931FF42389D68F8C25695856FD4DD518B16 ass3d1o
12,427,288 *0159FE7873D9EB0EDBD6957D007F4DF8E323136B ass3mbl
12,427,289 *0154CCFE0D9CF0ACA0AE0254C245DB0B07DF4FCB Ass3v3ra71ons
12,427,290 *0152B030A9F79451186B6A634CB5ECF6CFD161FC ass5013
12,427,291 *01508545F02B1263B5AAC0F6888A9DF4813BCCE9 ‘Assadiq
12,427,292 *015DA1E1BCF635689B580BFD3D92D92B1B57CC1C AS-SAHAB
12,427,293 *015C6FC5040602DD4664201F312136BA636F0D9B Assaiil8
12,427,294 *015A3D5C593E99C9C8A4BC33EA47C706DBBF0DB9 assailableness5
12,427,295 *015E1FE90AE2A9790595CEA7588497F5BB256458 [email protected]
12,427,296 *0154DD982BD12BF7EB6468704E5076C280968C9F assaior3
12,427,297 *015530698A988B858088C66E927DF96B719E4622 Assaisonner!
12,427,298 *0159BBC7E1E40748D8C0FCE95758ABA5715E8C31 Assaksuaed
12,427,299 *01503EDD8967F5D747FE31D235A23A8193EFDFBD Assaloks3
12,427,300 *0150180B67A79C28B8090634D3713EA3E02BF6EC Assandrew2
12,427,301 *0156F27E49DEFD4ED42B2032AE94ADF6408297B5 Assanooj3
12,427,302 *0155163B24AC7341B44F125BD09BB52DE2910140 Assanuka3
12,427,303 *015C985EC7E50FE3D54BB3E7EC220709C3C920B8 Assapan0
12,427,304 *01518210877BADDCABEABE4618DF8E5B49BA815C assapatavas
12,427,305 *015705E53683EE73DF6129101D95C3B08C054AEA Assarbme9
12,427,306 *0158E59B63539E2B5680EA649AFBB470B0368463 assasasasas
12,427,307 *01558DB9EB717F1AE9B082EE73229D345BE56436 assasination of john fahey
12,427,308 *015C7A2D5906D76A9578B14CC041C42712E2E7E4 assassins de mon peuple
12,427,309 *015BD0C459A29EEBB9748D471923FD730726A1B6 assatiaed
12,427,310 *0151D99E885345BF0F67E6ABA1151B33A67FDC09 ASSAUL+1VE
12,427,311 *015F274A355A5C2E6F0C7002AA485A416B056AE5 as-sawaahiliyyah
12,427,312 *015228D29BE44A7F3CBB0C6E3DF83111FE29CC15 Assawin
12,427,313 *015C8AF1A19D1EA5AB47276C9EE3FE41A49BFFF0 Assbach2
12,427,314 *015161D605A459E850839CBB972BDB049D23A6A3 assediera?
12,427,315 *015B08193CD81FA4BB163C8ADC5187CB0F79051F Asseduared
12,427,316 *0153624366107120C89CF00EC0625B3296C43637 assëgnament
12,427,317 *01588105AFE96F2529F413E3AF1CCD84F16126E7 asseguida
12,427,318 *0159CF2B7D3C58181BACF20DA4E4EFCDCFEF925C asseguram1
12,427,319 *015C295A81C55C41E74236DFCFC0C07DB74C5FC8 assenavx
12,427,320 *015BE0058068C754452C056554C3683CBB149F31 assenteste
12,427,321 *0154B593E21E20F77702D187F53336147D0B7F48 Asserouv0
12,427,322 *015B186390884A674AAC60017D55D94394F7D866 Assertivenesses1
12,427,323 *0153E36BDB4D668E766D7462860A20CD042920EB Assesajr7
12,427,324 *015F512CE89D1D69B62414FAC27024A6E122FDCA assesid1
12,427,325 *015AE7383884422A97FCF66FB0D8F09B0CCAD3A1 Assestato1
12,427,326 *015459B4C6529015EE0AE9A21E192184F71B748F assetswhile
12,427,327 *0151CD52047270A8A7C155F80ACA86D3D90261EE Assetter
12,427,328 *0158477B29FD11796D6CFB6CF6603B80D42ADED4 Asseveratinglies
12,427,329 *015D1B6FC85C6A20E876EB601D480789F1D1CDAA ass!gnee
12,427,330 *015491A2AB99A4280D4585AD81C508766C8EF7E8 assgtlp
12,427,331 *0157C9F3FCB1ABA1454033CFCA961AB63499F974 ASS-HAT
12,427,332 *0150C9E1D043C93E261A76A6D0F6257D41DE7998 ASSHEAD3
12,427,333 *015390D37CDADE869F48BCFFCFAFB7E66B19D040 Asshole1960
12,427,334 *015CC3E7E2E864ADE0F96410C153EAC0CA8B8E55 asshole1993
12,427,335 *01510F9C624A284EB247C0D04A00DCDD2CF2459A assi11a7i
12,427,336 *015956B8406598F7D80F497185FDAD1C703EABA3 Assianlying
12,427,337 *015881E4B44806926C31BB3839D6D212B240580A assicurataassicurata
12,427,338 *015646D68E9B37956A7D724DCA99BE68B98DACD7 Assiduites5
12,427,339 *015B995E49E3F1A7C6871619AA6F612AAE99C70F [email protected]
12,427,340 *01562FB0A40E090FDC501188C73B999A47CBFFE3 Assignes6
12,427,341 *015919DF7134274A1272C1A1D3DA1CFE84CC53AA ”Assignment
12,427,342 *015EE7551762B052392F46141E67555AE23C3F0F Assihsed
12,427,343 *01560DAF2ADBB922B7EFABDD06B592B3EC0FAEFC ASSIMILA7
12,427,344 *0159BAE40ABE4B1E2F93A8A6AA3F58F939C4221F assimileerde5
12,427,345 *01585F376E3428CAA95523A3E5098310F7518754 assimptotas1
12,427,346 *0155235F0E6B3F29298D3AFD94CF169EA41CD4DE Assimsin0
12,427,347 *0153362BDB2CD3320123C4CDAC9A843B48701BFE Assinalramos
12,427,348 *015CB55945EED0EE59B2F70EF80DF2F328A90F52 Assinent
12,427,349 *015D4005319D2BE45154377754DB9FE6ACECCCAC Assinibione
12,427,350 *015F6546CBAB0EA3A7A6CD8F05741EAA6DB73EBB assinou1234
12,427,351 *0151E2ECA27281406020A5F22208ADB4CBEEC198 Assioito4
12,427,352 *015420816617A0A853B89DDEAC00C593E3960249 Assipalg2
12,427,353 *0157F377455D77B01A6E76CBCB1639502CBBDEAA Assirehc3
12,427,354 *0153F075D3CBF036FCA97CD564D99E7DBE7EC98B Assistars
12,427,355 *015B733BCCDBF3BB398630157D7DEEC2EB0D3641 assisted-help
12,427,356 *0157EEE8E818641FB5DC00FC8BB4E5671FD92458 assistenmanager
12,427,357 *01551250BD2A064E9443D09F9D3AFB88DFC5606D assistenzheiligen
12,427,358 *015F431FFFBE5422C0EF1FF31FFAAC9E092E73AD assistmaltiti
12,427,359 *01576816743A71C66A64E62388AB5C1B29336377 Assitej
12,427,360 *01593825C92CF5AA96B117C7157EAE256C4C842E Assivath2
12,427,361 *0150C35848B02481B711CF217FBD71476FC51FF4 Assivato7
12,427,362 *015CD83E7F4277AABBD8B8CBE5D6A440249206F3 ASSIYASATHUL
12,427,363 *015D7283FE144B393F800B591508F6F7A2B9705F [email protected]
12,427,364 *015CCBCD167925CA1A8F94D9A0BC500C20C4C763 ASsK6
12,427,365 *0150F431033419BEAA93B5D144C87FADE19B480E AssLikeThat(superclean)
12,427,366 *0159A154D9C73BA7D3168998E9434889B7BD3194 asso5
12,427,367 *015008A439E86F14B849D3B6894846871238E63D associated_bundle
12,427,368 *0155E1AB47C8752B7EA39DDF1E95B2F7A25ED8A8 associated.with
12,427,369 *0152DA93F5E180D6828F7AA4E166129D59C64BBB aSSoCiaTeS MM WiTH a MeNu.
12,427,370 *015ACFF2FF8F7E6E39AEF3A84D4D9C29956307F1 associationfundao
12,427,371 *01552BCA267BA8CA0DFE9156B6A1024FF1AECA89 [email protected]
12,427,372 *015E23B8D7ADA851FEF98B3F5E0886808C6215BB Associatory4
12,427,373 *0152D2393D609EB15C39982E39D626A62116C662 AssoCLCV34
12,427,374 *015A929DEA867BE7BA47D4EEF6B42FC9100500B9 assoctel6
12,427,375 *01533246C4DEF3DBE442376791994A2198A4ACD4 Assogues5
12,427,376 *0150903871979287B80E32224798F1AEFF4A4C9A ASSONMYHANDS
12,427,377 *01562A2BA2F3D102AD41D54DA63E201CC9AD4240 Assopiated
12,427,378 *0152509132C1E42F17448A0E3410EB803C15D99A assoprvamos1234
12,427,379 *01513EE4C661E7C6C73F0CBF6E787D1AC6AE6C07 Assorderebbe
12,427,380 *015F9E1E802BF2F25CDBAD5D405CA0099942ABA6 assorearlhe123
12,427,381 *015DB052DAAC7DA601286D11EB30F8E19D3A342C assorers
12,427,382 *015732387E47E6392B8702D5F111A2526F472E58 Assotsatsioonis
12,427,383 *015CED5A5F9070C4C29D5C25BA97921498CE581C Assoziationsexperimenten
12,427,384 *015AEC603B3EB382B4DBB8C1DBB496F8A4AFDB7A AsSPP
12,427,385 *015714641FE45643FD56ADBAF11CA32B3C8ED3C5 Assredskin
12,427,386 *015A2015D7EE2C0A7F0601E2F4C8B26319FAF4AE Assryian3
12,427,387 *0158C4C987F1D93F80F67DEB7B1151C13962D5E0 asstate5
12,427,388 *015DA5D7C33B3B78218DB0A70D04D1A9046398DA asstt0y
12,427,389 *0152FAF20766D16A27EA02547E7E398BE40A1154 Assumption'
12,427,390 *015B3D4F88662E87B0E21F0FE383B09EE164C565 Assumptionem
12,427,391 *015D2015F29843EF73CEFE422EC38D91C6C978D2 ASSUOLATE
12,427,392 *01507F16F04F7143DB9EB7A5FF706C5FEB6E10D2 ASSURERAIENT8
12,427,393 *0152D3420C1C1D70167E595F79D51FE70B0743CD assusmistes
12,427,394 *015D5746F451F5E864B1FBD08BBECDC2DEADCB82 Assuujro1
12,427,395 *015D1C390F86967713D70ABDA97DC361383000B7 asszisztensnőjével
12,427,396 *01538EAA6F0AAC0561C00FE75051078610E2EA2C AS:t$
12,427,397 *0158A7BAE02D71524832CA0C44F4871E184A3B29 As(T(
12,427,398 *015ED98B9889D7F8459C089DD74DD16DC83D1C1B AsT
12,427,399 *015D24411E2B43CF98C45555369764862F15B95F A,st1
12,427,400 *0153716ABAD928FD4D9EF36975753E4CFBFD7A86 ASt2K
12,427,401 *015A544D1D0CE85DD83971E33F980E35379CE988 »astà»
12,427,402 *0151136C73E18ADAF71B1043B63AFD36BAC22A59 Astaatsa1
12,427,403 *015C684F25CA4F58E7AD279F2AC05234424D4F79 astaires4
12,427,404 *015EF8974A4B117ED1F9EFE6A3B1A1EFB8D74408 ASTALUEGO
12,427,405 *0151473EBFB86E84A8993E0F8FF2EC2D739783A3 ASTANDARD
12,427,406 *0153D04B23601101CA1845F318FA063490509635 a_star_in_the_sky25
12,427,407 *0159D5B3A37966CB8F9D2699B9FE3E1437DEBF05 Astatine.
12,427,408 *0158DEB7DF5421B8B3CC0C1A640D8D03AA2777FB Ast!C
12,427,409 *015B24145E95CF0BCF88B012A68DF5CC0E65DF0A A+STd
12,427,410 *015C62B9D4F9394DD527F9F5ACCEE60D36E166C4 asteiwns
12,427,411 *0154FBCDA67E8C8EC2CEB522A352FE3F5CDA06D8 astelles0
12,427,412 *015BFBABBAA0080185F332D795B8768A24FBFE00 asteroidenname
12,427,413 *015B1147D49FE85DDC5427FC0667261322888FE6 asteroids16300116310
12,427,414 *0153D80408EB600A4D75C2C1CACE7ED1336BBFA7 asteroids38013900lis
12,427,415 *015D27FFDCD61EEAE9A2184209755FBBD4E82EF8 [email protected]
12,427,416 *0154FA1EB1FC1977311FB14333B0F600533506D1 AsTGd
12,427,417 *015E5A445FC0E6B9C96B764CEE7AD227E73C2983 Astgespt
12,427,418 *0156483C06AFBAEA2FC8790BBCA143DCA0E9C1F2 asth26
12,427,419 *01551F4DF6DF86EC52139D9E1FE13E097B146861 ästhetica를
12,427,420 *01529061557798138E17489A9A5273757AD9127B asthig12
12,427,421 *015542F1337158787123F7440A542EFDDC847A61 ASthK
12,427,422 *01576DA120190B67B880DD761F2D70CCA89D2CAE asthmesed
12,427,423 *0157ADC483D8206B13F6FAABAC090F32EFAAFE13 Astigmomed
12,427,424 *0150F74E349D7F9F04AEB1612A1B02B5BA34B6D0 Astigm
12,427,425 *015CF03CB4782DAB9A60CD3D56008033B6493A91 astiitsa3
12,427,426 *015F650E18A8F1049FFE7BB3A50331AC23725E4E Astimes6
12,427,427 *015AC4C099A7108424C4DB53117938C5762DE987 Astingly1
12,427,428 *01523395FAC3F8809AC59915C885481B214C734A astiquage8
12,427,429 *015E9BB0D581207BE6395A872187B9128EBCA053 Astirruplike
12,427,430 *015E9E785B204FE13501EDBF52485D6CC3F8F35B Astmakohs
12,427,431 *015EC35CE07B4C77A89A92DEFCF686A61A5F6F36 astmama9
12,427,432 *01540C158591E1129F451CA49C300993AAC8893C Astncch9
12,427,433 *01595D8C46324F78BC4B559A28326FD4B7DF68D2 AstNE
12,427,434 *0155FA8AAC37C31ECFD4CD7B23802C31E499FD18 Astonde8
12,427,435 *015623086262262ABD83B44C4BBEEFE9BF7E5EB8 astragal9
12,427,436 *015557D71B88B5E32269F5DBACDDE1E545BD81F6 astrain4
12,427,437 *01569395E415C9BAC1767C284397FB7ED709D50A astralmeditations
12,427,438 *015B3B8CD9D41331E5AD3D8D5A403FE9488670A1 astrantst.
12,427,439 *0151239D20EAE412A04F4D074BAA08FC9F11C094 astrapotheriidae
12,427,440 *015699B62A2F234C434F746663AD16E5F1CB1FFF Astraras
12,427,441 *0157C484A2BF32D84659280B7F088A346FA43AD5 astrascan
12,427,442 *015EEC7BFA35B816B6AB20D30FC98BB885ED9823 Astrasoft5
12,427,443 *01555D646554D06EFDA828AAAF99FBDA5F4AFF30 astrazeneca-glaxosmithkline
12,427,444 *01575CE55C781FD720A5C28412E8C9C56AFC37F2 AstrO
12,427,445 *015EDDC0EA222EFDDF0D8CE4F02DEFF03E51DBE4 [email protected]
12,427,446 *015408CD13F5F6DE81B6C2DA8E0990621F4A95A0 astrobiolgicos1
12,427,447 *015AC00311AA2DA97B5D38E1C265616EBDFD4F44 [email protected]
12,427,448 *01571B46F9AD5FDB3FFD148B529228B989EE02D4 Astrogate
12,427,449 *015C7943C6CD848FD15AC39B36AB29BDC5FBD99C astrógrafos
12,427,450 *015D07218DED89CB05CBCBE6680A6EC7AD9CC382 Astrolinguistica
12,427,451 *015F6315A98493D21161A1EF2423B65AC3AB7149 Astromechdroide
12,427,452 *0156D28D72269943DE5918D9231D4646B0C16DB0 [email protected]
12,427,453 *0157998EB1B791292EDE06A06742451200716932 [email protected]
12,427,454 *015C8B4A63669F304BEB60FDFFD5ADFBC482D431 astrothrombus
12,427,455 *015CA5E4437F211E8EC0200D1272676EC3A730CF ASTRUG
12,427,456 *015F25A82125684E622E0B353C92CE02FAD1C5F7 ASTUECKE
12,427,457 *015D0586CE7EDF2D89455D410E107A902F7B20B0 AS:-U
12,427,458 *0151F7DDC267B86F2560F713F7F599A13E28ECDC A-S;u
12,427,459 *015497C0AC5E29771395463008685BDAAFF7AD46 AS=
12,427,460 *015DB6778348F0F2EADA5DB6B96F2FB68BF113FE AsU$,
12,427,461 *015C46380BADF0295EC349F71017BF7FE7A28A9F ASU7P
12,427,462 *015410879B9E96FDF5096560A961CFB02D663B9B ASu,B
12,427,463 *015D1BE0B1969E343F7AF34CEF478CD58C1D26FF Asubcontinental
12,427,464 *015272B9BE96C515166242211542ABA1D1F99D0A ASubtlePlague
12,427,465 *015A81B8F57A9B08DBBC37FA7FD246B353CB39CA ASUc+
12,427,466 *015B5CF8D7E61B5851B345C924D358710804C5BA Asudeh
12,427,467 *01513B48D96BFC22C538E9A8AB02C6D90D1B3427 Asu_e
12,427,468 *015CBA472085D0A018466DF93019F185F7030DA9 A.SUF
12,427,469 *015218865569E9A7A0B90FAA281C0A08EAF65B1C ASuG:
12,427,470 *0154E8D6FC581389A0E4E94B9495FBEE83FFE588 Asugitises
12,427,471 *0155A5F171CEA75DAF880F819BFB483CB11DA69F asuhukana
12,427,472 *015AC86154DAA77EECBE2FB3C76D3D125376475A A,SUI
12,427,473 *015C05E3637E0195D05D6E2062B08A3AF1E79D21 asuiteman
12,427,474 *015DC678FC0CFD04A6C2398DCB6BFB531140E0F7 Asukakaw5
12,427,475 *015A5AC953B4B29DC166895D4059E930D18108D1 AsulC
12,427,476 *015175E3A40A6DDB389F90598D90587267C16DA1 Asumana3
12,427,477 *015FC723D31870F2BFC931275FDFF1E988D5893F [email protected]
12,427,478 *0158B2B5B1E759B887078D1F2DE2DF65BD8ADB68 AsUNK
12,427,479 *0155547EF029B406864E1A6FD2CB65551DC810C6 asunnon9
12,427,480 *015E64732D7143DF8E6F18AA32DBA60D2C4FC84B Asuntohotelleja
12,427,481 *015BE6233308782C103C7F5FF94F1DB1AC063D94 AsU+P
12,427,482 *0150F47CEAE7302F878D761315FF51036261BE4C asurowiki
12,427,483 *0154A59F28443264A1F35E860DEC90FA7B9E5E9B [email protected]
12,427,484 *01584F332034EB03B81ABCF0A4D0FB6C2F90AD64 asusual3
12,427,485 *0150DEEC956457A0DF98D2A236AA0AF5F69D93A7 AsUT+
12,427,486 *0154FDB8BC1EEBE89FB48364038974D98C5C42B7 Asuteahpping
12,427,487 *015A073BCD6DDEEBEB3002457DFDA3AC95166E6B A`SV
12,427,488 *01599D1FD6440B71C200B02CA86818B0356EBE14 ASV!)
12,427,489 *0158768BB679898A23411C154B8C320D0D41E067 ASv,&
12,427,490 *015B2BD7B7C348EAC7177E37EB15D7D70F6C115C Asv$=
12,427,491 *015028403FC439B3B3908FA99A3B654A25ABD5D4 A+Sv6
12,427,492 *01502D2C5EFCCE03337ECDAB106B5FB5D1E76E49 ASva
12,427,493 *015E75B3CA9B24507FF24CC53FB69F3B4682D46B AsVcH
12,427,494 *0152CA3F35A0A6936BD7B8C83B5018B22DBD646E ašve
12,427,495 *01589903C96935624912E7C52CDB196C16A4E5C2 As&VF
12,427,496 *015F659C9EE7E69A28DDD9888ADC031C36AFDBEA ASvi0
12,427,497 *015FE6651D41156685D38F6A9DD0577419BC2EB5 AsvIZ
12,427,498 *015004CC7AACF6835168ECA5BB67B24837007027 AsVlu
12,427,499 *0157C807F48C269C8D8F04AB66D2D5FB4C9E2840 ASv%M
12,427,500 *0153716E0294D2FA1509A6B1953C9B12A5BC35B8 ASvNj
12,427,501 *01587F06198FC50820BCFF468975EAC99792F7D0 Asvtk
12,427,502 *015871FA9D2831EAB0BC2BE298F0780EE6E84BE6 AsV#X
12,427,503 *015F1F0656D7B4FA8A17DBF95087BB1731722EF8 asw320102pwc
12,427,504 *015BE48231CEC72258723A41A6BF8FA681742573 Aswaj
12,427,505 *015CED874D0E4A5F2B6335AD0EE479EC44626B65 aswathi vijayan
12,427,506 *0154E7D08B4532AB0C42FFFF67F4E46492506A2F aswbd
12,427,507 *015BDBD76660E78F241287550D9B3F16FBCB79BA As?wE
12,427,508 *01596444295EC4751D3E8F1125E46640E7A5878F A;SWH
12,427,509 *015778371C4E189C9487BFF6D422AE234F94931D Aswo?
12,427,510 *015741FB3EBDB4E7D4637E11B398554259DAE4D1 AswP4
12,427,511 *015D5D20BFC9523A7A0EA831F7BEBE94E59F6D1C As%WZ
12,427,512 *015BD7D721195630B829141F2C7705169C344465 A]sX
12,427,513 *015E25DB6B82A4D5E1143756AC3A8C292F64433F AsX&5
12,427,514 *01547E626E1531934F358AEC85A02A737B8D8558 A+sX9
12,427,515 *015AC6339ABA0CCC1941E18D5AB66EB2E4C5040D AsX"9
12,427,516 *015C669516DE07EB2FC725BD93CBA2D45D9FFC94 AsX-b
12,427,517 *015F3B692B3CF18B51DC68957B53426BC460F39B AsXBY
12,427,518 *015D4BB50F39D3933A23B7BC04D27629AFBA32D5 Asxetoi8
12,427,519 *015509B1C8E9FA582AF44D8EAF85800640B907AD AsX,n
12,427,520 *015881B1A38BF1F1F5F2E4214C53C3FD2F606973 asxolon9
12,427,521 *015013A93AA2DA58EBA721C242EE1C072EF881F0 AS+XQ
12,427,522 *01543325D4C3BC768315AB6121AEB125B0028A4A AsX
12,427,523 *0153A73D4C6DC2AD49B1A70FA06A97BF1C17D625 ASXYQ
12,427,524 *0152A69146E9773FB92DD47A037099AADBC18436 AsY6H
12,427,525 *01560542847885854094FEF699FD958A8BE2C838 ASYET1215
12,427,526 *015F74F8A0D540C9FCC318C6E8EAF38BE807E04B AsYIq
12,427,527 *015CC6D21BB7F0880D01D2F6F156303DEB5A5F1D asylbewerberunterkünfte
12,427,528 *015ABB549D2FEBA8982E6FD6F42D8392D9A0DBB9 Asylernes1
12,427,529 *0153B05098ADF8A3F0A1B80A97BE96D1D347D4BD asymetrias
12,427,530 *01560FC1D2034E87FEC472FC20C13DCC278644BB asymptote4all
12,427,531 *015C4323A00A2BB39120936BC1ABB2AACF5696E6 asysent
12,427,532 *01542FD4B753E81BDAFCE2EEE79D8CCA1FC5D10D asywh
12,427,533 *015886EA2E38988DDE820304FC4F48E9D759D8D9 [email protected]
12,427,534 *01534C6106B05F2AC42BF6FC2AA58FA15708A999 ASYZ1
12,427,535 *01523AD44F6EFE85C4BF3185E41EF84978276664 AS.+Z
12,427,536 *0159DC56D2A24A22CF328B46464D420E06E185BA AsZb+
12,427,537 *0158909A930D855374352543468C371BCF8473A5 [email protected]
12,427,538 *0158C06EFDCEBDF8EB36F806CD834F7455E57EF5 A+sZI
12,427,539 *015BE7C5061E6989DE493E442AAA1185D9B05A36 aszln
12,427,540 *015EEDD8D6A0800B4169002AF1BFA707B548106C A=SZN
12,427,541 *015C1E7A84E5CCDAAB85C654B6D7ADF12E714983 ASZUC
12,427,542 *015AB845F128ED7AA221B4FA8B3AE248788E9374 aszurnadimszun
12,427,543 *0157703FB1907E362B9C9B03A9C1BFF153B83A00 AS内部的路由器,如何到达OSPF
12,427,544 *015842FC66C35232F992ADE605CC675C286A9C7B A=%$T
12,427,545 *015D46D8A3017DBC09F611C313096127F150E0F2 A,T(!
12,427,546 *0154292709F37388B2C739BE2187CC86DFF47D60 A!%!T
12,427,547 *015D4E88246790913B29BF4CC973D6B07CC4794E A.?T%
12,427,548 *0159ACF5B147F195E4FC2542E285300D60430271 A)#T"
12,427,549 *015BD941084C43EAAEA714BFAA78C35C44E29774 A&.?T
12,427,550 *0152D6DED752AFC7D26B68C7F6A062905DDF0D9F A%T,=
12,427,551 *01596C986587B05C199E36131ABB3C6CA6023A9E AT)!!
12,427,552 *01502D64E2722A1EEDEEF78A56985D028FA0FAE8 AT#/!
12,427,553 *015A3ADD6F32B37924DF5E75D5125C9778DC96D5 A;$t&
12,427,554 *01538C3D8ED5DFD344B57F7E3C6F531FE624DFDD A#t%=
12,427,555 *015CDAFFBBE92524DF07FBFA4C6DB8FBA9B4E61E A%t,-
12,427,556 *0154A2E086319A65E4C053D84DB4D2C1810E681C A
12,427,557 *0151B7724574A0F1A10DEA0FFEE4AE4A38312299 At`@
12,427,558 *0158A8C621AE305C4260D7EE9268B420236D7680 At:%(
12,427,559 *015D55D748CAD43B2198E74A1595C5963BAD54E2 [email protected]>
12,427,560 *015EF8AB8E4277E08A29AD1D9B3FC2F76050D138 At02(
12,427,561 *0152B5ADB3697CF8EE47837F17EE1AD9228A4AA9 AT03u
12,427,562 *01584737B9CB9C8D6977EF03491F7490C32FFCAB A:_T1
12,427,563 *0150E1140070AC7D9B7F4C85D5A3647154C3D4F9 AT;1A
12,427,564 *01592487F957CF8B4E9672B2BC634D2B5964A64F At1+b
12,427,565 *015D32E7217F35C8C05AF8985EAAC1DA80CD2921 At1ES
12,427,566 *0156CF358041843D8764F7F6248E29F56BC92542 at1g781501
12,427,567 *015EE6EBBF21F12914EB5707487EE2FC2BBCBC39 At(1R
12,427,568 *015829DF649A99240E2CE3303032FB7069292D07 AT28l
12,427,569 *01532F69CCE1E3C75767B97699A2FED7DB804C46 A#T2B
12,427,570 *01542213858F06EDA8673A373EC063A96381FED3 AT"2q
12,427,571 *0159AA30563B1556DE904D6EA1E195877485E3B2 [email protected]
12,427,572 *015A21E459C672A6283A21E3DCFDF710B0A5FED2 At2Yj
12,427,573 *01559C78346CF9706D0744C09330CA9262C51ABF A(:T3
12,427,574 *015629A6C9914FB9BA97B08FE024CA53A9C0C3BA At3C+
12,427,575 *015F4F9AE66EC60131E572D85775B0C213785084 aT3cG2ht
12,427,576 *01566A678F16AFA63C3C864E988136E58CFBB294 at3g170401
12,427,577 *015038A901A12E5C288FDFAF13ADBF692EBD7A48 AT3I1
12,427,578 *015D1017F8496B03DDF7F0285D11CFC5E7BA9388 At3lE
12,427,579 *01513CC2B1F19D9731C106CD4A1A359920F0E7BE at3lostom1a
12,427,580 *0151F66A9AFFDFA8BF33C49833E9E27EC28A0C51 At3Sf
12,427,581 *01500CB7A8A4A986D4887EB3C586BE29C2A3F2A4 AT3VR
12,427,582 *015D92CDA188387DD932069CA8C2F19DAB0B5D53 AT4OR
12,427,583 *015970C200AD86B144FCBC1578487A9427E69AFB At-4q
12,427,584 *015101456C3B1ECDA14E2DA65283F0B46370DC61 At4Uh
12,427,585 *0156EB306187612854AB5CECA1509BED21C189ED AT4wt
12,427,586 *01526808BBF12A3F28E61D67B5C84D51A2CBF382 AT,&5
12,427,587 *015281389E6A83B6CA6CAFE05FA124721602B2D9 A!:t5
12,427,588 *0155E0BFB68A5EE1027E18016FDF0D0EA45CFF8F A.t$5
12,427,589 *015ADB0E9725CC1930AE2722A26731C44FDFF42A A+t?5
12,427,590 *015097D6A7DE7C4D9AA4A12F2E047F317A831A07 at5g144202
12,427,591 *0156B6D4C2B1233C897C0C71CAB7AA42343CE7FD At5GD
12,427,592 *0156295136EAFE8B26217CB2E72E6EB23982D5DF AT;5j
12,427,593 *0155FA9BE0DF8616C169B11051060B8EFCCE4E03 At5je
12,427,594 *01562EF0B66EA8AB6BCB685468C82A6C93831F66 A=t5L
12,427,595 *015BE2A7006871675F21D6AD0C9CBDA2FA2B42F5 AT5%t
12,427,596 *0156D8A1AB1047821A4C00EB0E9298933899B4AA AT/-6
12,427,597 *015656B8F0E2A1EEB0D95788F8F25C8A8A6756AF A&t65
12,427,598 *015907D3D832917E1BB50A91BF10953F291BD52D AT66#
12,427,599 *015B80DE28C74CFB4ABD643661BA381ACF634E0A At6aM
12,427,600 *015003DFC0DF0AB52987F8D2DCE3A8C1A0150790 A&t6l
12,427,601 *015C8F1FBC9733798624A8450C98EA6624F9100E AT6mP
12,427,602 *015801DFE8D8160B996BEA54D8E9FB9938995E3E AT6vp
12,427,603 *0151EF542B5EBE81C68E0DF28C84BA1B130FE2DD At7fT
12,427,604 *01589F4CA04944925B6110E1A38F87FF96111AA8 A=t7q
12,427,605 *01503568B9C88036A544B2128484ACF91D410382 AT=7T
12,427,606 *0155E3442A4C2FE8C0ED66CA40AF0685EAE05922 AT+7u
12,427,607 *01588A880F7DEE2DE8281BC5D1417AE9672604B5 At7v!
12,427,608 *015D551D19B94DCB0E084A2A0080243BAB0A26BD At)84
12,427,609 *01559E31FB5F0D086608A6BE269DCDBDD7A0BA9D AT8N_
12,427,610 *0156E61C0E740809A8C78ADA59F5A7421D406552 A,t8N
12,427,611 *015DA5FDFCCDB96E1D308894495BBE555F47E16D At9q%
12,427,612 *015DA99C0D28663C21D37937C5377FDFF77E2A6D A?T9W
12,427,613 *0155473C9C20E26387A1AED653F1BA8DB08339B8 A-_TA
12,427,614 *015718BD4E5AB67B47D9BF3AF45A9021B737BE82 A-ta"
12,427,615 *015B189F5730AD6E5ACF7E1D3DC0A251EA77D8EC At/a"
12,427,616 *015FFB0C9FA5F2B9774A1FBA498A7E76E52302F5 At(A4
12,427,617 *0159CA78D96CE18BFDC23F4804DC50D2A0AAE6E3 ataafra
12,427,618 *015791382809F63F61DE3281D8C389D484351347 ata-ata.3
12,427,619 *01546EE4D52690FF496EC748C3DD5D7A66AC6CCE ATa#b
12,427,620 *015AF48ABA6A40FE35E8B9C62F1FC96EC5E98911 atabernados1234
12,427,621 *0152420F6A07004C1BE03F4854CCD31E24D3874F atadhani6
12,427,622 *0159E3ED5760BD483C3749AC2E8C003A2F4CAAAF Atadtxtps
12,427,623 *01543CCF5C699F43AFA014F179972429C0DE8EE3 Ataerht7
12,427,624 *0159CA67244456A33D3ED8962FD926D486C948D0 Ata/f
12,427,625 *0156F9DA610EF66D03D3A7E086CAACF18BB7D906 ataihcsiM
12,427,626 *015617995EC85D334E58FA5B0125692ECE9BAEBB atajé
12,427,627 *015820B4603E0AF569B4CCA5DBFD2FA17E7A09D1 Atakabul7
12,427,628 *0156716EB758B5B32A40782B198AFE5C3507C0A4 a-takada
12,427,629 *0155AA1109C8932862A2DF01A1AFE5389D81513B Atakataw
12,427,630 *0158DC724E2E149C53B42A2DF62E3FD695AB8C63 Atakazakata
12,427,631 *015FD51D4F60AC3BE284BCC74EE99D18526AC25D Atakkaru2
12,427,632 *01558E65FC3C87A52480D73900AC1D61977CE8AE atala6
12,427,633 *015EC52D24189BC4B02772B2ADBB76CF4F3F38FF atalajames
12,427,634 *0155FE1A1DC4B5965E30AB607B1A07FCB865ABD5 ATALG
12,427,635 *0156E1076C1FCF805A15E85C3F1BCB194FF0A08F Atalyans7
12,427,636 *015B244BA1A6263E5697B5D6CCC7CCB706D77B1B Atalyja
12,427,637 *0153EE63D069F7CC425397455945BBA5234B2CCC Atalytic9
12,427,638 *015C72791CB4E7FF95505BEB4A8387C8407B2055 ATAMENE
12,427,639 *015F89B4E76FED55B642D2D710113C915BF1F01D Atamert5
12,427,640 *0156B2ADE6F42CBF4A5C1592808CBB59E2BEAED4 ATa)n
12,427,641 *0159D0E7D9FF1CB69CE94BBD81C8983B3061F3CC AtAp%
12,427,642 *015BB603F1BE33657762C3CD6DBF8E12BE02B585 ätarcellerna
12,427,643 *015C4F7FF5B91C73E3104555B4F118DB1E1BDF04 atarsama
12,427,644 *0155423FCF3A0FA3BDF275315DB83E86C7D4DDFD Atarucso7
12,427,645 *0156708060702D6EAD9BE5B51BF99F1D6E47EE3A ATASCOSA3
12,427,646 *015A90E464B5AB69334AB98D7579C4B7DEFEC67E Atasojen7
12,427,647 *0156D7E432007E4C3A29A374509850649E6B140A Atasolta
12,427,648 *015D9CEE022DB955804277D29AB596420878CFB0 Atassargging
12,427,649 *015BE3A407DAB8742935D7A083D87CF94F833615 atatcaggaataaaagggatgatatcactacataccccacaaactgtaaaataaaattag
12,427,650 *015A213EC94F2895E71DBE3D61721B6A6AFBE4D2 Atatrecced
12,427,651 *015B3667628C5F969D8B7B0A2380E8AF7AAE12D0 atatṻrk
12,427,652 *015916674E860FF9A1EC1893652B6DC153EFA70B A,TAU
12,427,653 *015E1C0743F067C83DBB6C3DDC20E6D940F76303 ataubsw3
12,427,654 *015A9F0A3ED8BEBB4D3301960D0CD41BAB501B28 AT&aW
12,427,655 *0159D6484E9D7CEE8AF208DC43D7406499CA1B44 Ataxiameter4
12,427,656 *0152BBD3722E846830CADAA4C9F2C86B42A8B61E Atazlabs1
12,427,657 *015BA02BB9C4D342504F22122A6598F945DFC42A A
12,427,658 *015C362869AD9F4274730014362A808C6C78415C A"#tb
12,427,659 *0158F2BCB2F233AE2ED5B58DE052E3651E79F9C1 Atb0P
12,427,660 *0155E5DBD1FE5858FE1DD2A264E355ED2DA7F870 atbbv
12,427,661 *015E651C28A85DBE6052E1BC8B9F34CD820F6E43 AtBGq
12,427,662 *015ED44B226D60AB37EBB5997863A93A50609A75 AtbPQ
12,427,663 *0157C3FB0E988930677A7D5F665791F2629B1983 ATBq#
12,427,664 *015D27F2494AA919DF22C07939FF9FA448DCC94C atbqf
12,427,665 *0152BC6D972715D29EBA7554E529B8DD04695221 Atbrest8
12,427,666 *01522CC5C6413070F2C0A00390B9893A2DECC570 a、tbs
12,427,667 *01535AE31FA62A684C23F9FFC7598C99C20619FB AtbTI
12,427,668 *015E092EBDD6293B1584C23E91252AA12627D7F9 atbuli
12,427,669 *0152368BB4A76F491D89D6BAF85DE3353E1A6BDB Atbundel8
12,427,670 *0151BBEB2FD64FD420DC513FA480499C01541890 A
12,427,671 *0152E4563A1199AEDBB639A9D0FAA6D017D6E361 A:t%C
12,427,672 *015E744EC2DEBAE1284D8CDB04290B76340D76BD At="C
12,427,673 *0156ABCFC41A3D0B4620C9DE6DF3F8831B330561 At#(c
12,427,674 *015E10333E41D45DB6B504D655E87EBF330B748C Atc2W
12,427,675 *015190D287781056B3D9EB1ED8D6EF5260E79F1F Atc$4
12,427,676 *015CBFF410F5671DBA96A4FD1A006E51EC188CDF AT)c8
12,427,677 *0150A4F3C5BE89CFFE5CDA826C498CC0803F82F7 ATc9
12,427,678 *015A69CD79EB290D4924FEEA6E6822BAA5E63DA3 A#TcA
12,427,679 *015646DE526935B5347E45331959AA9517B1B21D [email protected]
12,427,680 *015040C6305A0ACC27E2A7DBD12E4B7C9DB1F0B9 AT=cb
12,427,681 *0157AA11DCE3BB1B9F7AEF5B03524B51AF51B5D8 At+cB
12,427,682 *015AD954AFF3B4A18987D835BC609CE45BDDBBE8 ATcc7
12,427,683 *01584B52568D5ABBE4035A46FE2C458A88A76FEB A;Tce
12,427,684 *01580E5D85271BAEB6A4B17DAC8F94374B2339B2 Atcetsyc0
12,427,685 *015FF5CE9275369FFA6D223824164207301B0D6E Atchband5
12,427,686 *0151DE1F4199834F08FEFABAC41F26056E743544 atchern1
12,427,687 *01571130B6B45999C708241E655FDCDB75836AC3 ATCHIEPISCOPI
12,427,688 *0158B7BD78FBC7C480204D165A459781402B4F5D [email protected]
12,427,689 *01584026F977101CDD8805605D7A1C53773E0C89 AT.CP
12,427,690 *0154D05F067E580F187DA74AD552F8DC98675091 A-TCQ
12,427,691 *015600962C5EC7A3B661DA02FBA8CFF0B4DE4BBC A?TcQ
12,427,692 *01504F43044C9B23FDB1EFA135894FC40CA9FE56 Atcs/
12,427,693 *015AE8E161762E14DE51B7D7C80A973D93BC7533 atctatctaaatacaaagtgggaaaaaaattcctgactgcaggcaacagtctcccccaga
12,427,694 *015CC0B23FAF45701D3B935B2B79D537C431A44D ATcu0
12,427,695 *01574EA1918D3EA4D8A2BEE698B9984069387F4E AT+,D
12,427,696 *015D39D9AEB2D5CA2146A289174D46F9D5322836 ATd.)
12,427,697 *015537DF11AF6FAF205247B28D9C40CD3EA8A897 A_tD(
12,427,698 *015D83ED655A867ACA76DDFF5670DFEC98F51615 AtD?)
12,427,699 *015AC51B4767DBEAAE0ACFFE1BDC8C05C4EA0E5B Atd
12,427,700 *0150519A57D5E59986EABEDD3575BDE9C9590696 ATd
12,427,701 *01570FC576A9F94F9FF3BFB4F6FC1CC989F75C21 At
12,427,702 *015AB86BDC35D4EB23DD4901BB91555B40A909EA Atd9.
12,427,703 *0154CFE33EF3845AFB628F4AC48F6DDF594446A9 ATDe,
12,427,704 *01504B886ADF04F19DCBE768ECBE14F91BA484A7 ATdO-
12,427,705 *015234164007E4F234B89207ADD8892F006403A8 AtDt/
12,427,706 *015D540E1729076248B1D0C93A8D3B4EED8E5A3B ATdZ-
12,427,707 *015174CA0E3095EEE30A8F95217F34618D49DF54 A?T:E
12,427,708 *015AD8DD89DEFA14EDC91B52D2F5C264542759EA AT;e$
12,427,709 *0155CF714E597521EC2D4A2991DC6E1B5FC41554 AtE7g
12,427,710 *0157F22CA355697A8341C8E1BA273E412465C753 A Tear For Crystal
12,427,711 *015B0867CF1D96FAA181887D5BB3980092258F77 ATec$
12,427,712 *01552144CD65D919AA0B38FB3D9FB234C252232A Ate)C
12,427,713 *015445AF81A457053D1AA05C76C53B14084EC601 Ate/c
12,427,714 *0157C2A15AB06ECA15EB9CB7021A8E72AD2C1F45 Ateelbsw8
12,427,715 *01576604B50D7BE10EC0048A41BB7C70A9CA3603 ATeH
12,427,716 *01517E8E37E5F2E8802E24A388F0EBABB8F919E4 ATEIH
12,427,717 *0155E00911A4B38586068B503A823E2D4C5854CD Ateliten9
12,427,718 *015A6983C5C1F2A7DB44966482E3871C69514C68 Atelleet7
12,427,719 *0158589474E4CED3E21ECE4730A1F3B3FBEBF604 Atemperaring
12,427,720 *015EF722B9D970EB20DAE229680A7398B8C87123 -Atempovivace-VariationsXIX-XXIV
12,427,721 *0150C3E9F938594A405D3698988E26A9762BB161 Atendendos
12,427,722 *0151CA09F9F5E7D2CF62F5E8DE82DE93A90DBA27 aterskri9
12,427,723 *0153C3BE1AC15E54C9781F250A76C857AAE40728 AtEs,
12,427,724 *0158A6B8E002E9BE212DF0BC872E7D802362AE59 atɛstat
12,427,725 *015531370E18C2B4D6B017D25FD3AFDDAD78BC6F atestinus
12,427,726 *0159D0B20E52DC528FE39DA0A29AE51B695E5A49 Atetioin1
12,427,727 *015CB11F2D004E7C4A671D925CE3F621627FA89E atevatev
12,427,728 *015E63FC352419F2B7D55FC31147E2F607C78BD9 atexlib1234
12,427,729 *015042435B97F116563EEAA9472A80BCA6C1B278 A!-TF
12,427,730 *015D52B4334428ED9444F8171A4B1DB13813CEB0 ATf?3
12,427,731 *01507FD893ED4D41B8B9A8408CE7845031E3AB67 ATf3i
12,427,732 *015E5220469ECFCBC5EA4191C09312516919F070 atfalati8
12,427,733 *0150BFB77E06C2F45CAFF4C24BD5BBC0B465ABDC atfbn
12,427,734 *0158D0A94F85BC95C5E9E562BC167B978BDDB379 AT+fF
12,427,735 *01546376298669517084EFDD2ACB381D1071B4FB A_tFu
12,427,736 *015C370E2A12FB9D762ECA3DE7F49F29DCB0D6CD A"Tfw
12,427,737 *015E978DC48574D7A5A787E729C37FF58E112831 ATFXu
12,427,738 *015B4078ECFF0BFDB63D5CEB38C2F43AB42E89FB A#Tg-
12,427,739 *015B30BC2CEC63018C2B3456F5D15F1AC6607759 A"t-G
12,427,740 *015A48EF4C30742E24C992CD5079A67F44F49D71 A
12,427,741 *01521A05313F84926803D28A39CF923021C22873 At
12,427,742 *015D04185BDB7389138ADFA1927CA1BE72FFB9FF AT_G3
12,427,743 *015341A05D8EDD5A854694D85623B57D22859D4E A.tg8
12,427,744 *01506F672C4D31C4439D4996EC3F561C03F47881 atgaaaatttaccattaccatggcaatactcaatgtcaccaccccttttctagaaatttc
12,427,745 *0156C662C953A7454FA761772978BFB980DB1726 Atgas
12,427,746 *015FCEDCF303B0836BBE803A6F24B44981029404 atgggaataaatgcccagatccccacgggcagctggtgaaaatctcagcatgtgattcaa
12,427,747 *015986273F1B58180C78B02FD1B1560589B52789 AT(GK
12,427,748 *0157CEABE9224342BCCFB214ADB7CC138EB4AC16 AtGWU
12,427,749 *01524D0EBA5404D07E9D195898797A42B878C2AD ATgYs
12,427,750 *01524F2CEFF479A9CC69E4BC22D86AC9BD12167D A&"TH
12,427,751 *015B350B901D865CC165F388C543F701CDE6C11A AT-:H
12,427,752 *015471274DBD7431E37798B018F67A448E887515 At;H+
12,427,753 *01528B4409B214C48FE299C3737C09C0B3CD0870 Ath3I
12,427,754 *015B83FE20320BBED937620635DAE1EAFD909D8A [email protected]
12,427,755 *0156DE2650528B3FB3F040A12FE8DA774A2E946C athammausthat
12,427,756 *015E19C3BC71F1A4C42CCBE221ACFBB5D74F607D AThBb
12,427,757 *015C8E50E06C580D1B0E5926B84FDAB8301DC021 athbhreithniúchaí
12,427,758 *0151E81B1117365231271943BDD114B231E37764 AtHBj
12,427,759 *015438872BA6212D38183740DACC228F17DE1721 athbunny2
12,427,760 *015C8610BE81F88377DA68CCCB68223B67B0DC81 athcoco7
12,427,761 *015691147C827014F2E34542FF7B75A87F88997C Athdasha1
12,427,762 *015CD3D29D447A2CBEE64F95C7A86AE227FEC4C8 (a) the battle, (b) the forest
12,427,763 *0159ECA3E3B81C854736B573EF16AEAAAFAD6650 atheistsaul
12,427,764 *015069FE1E217B6924835290AADBA12E169E58C6 ATHEIST--THAT
12,427,765 *01561042FD2750ADFE418D06F39BD8061F977466 athello9
12,427,766 *0150E642638E73F1C491F5B0B4031E956C784B32 athena408
12,427,767 *0159DFF844786E9777444294B8FCD5CFEF4DE373 Athena647
12,427,768 *0154E7DD352B192968FB516D6914D7D2D06CD24E athena hawk
12,427,769 *015FA4AEFFE8171C9DCF34F9B14CC52273692C20 ATHENAMIRROR
12,427,770 *015C2F0FC8E450B025402CE8BB1651FE4A6DE844 Athenamom
12,427,771 *015DFE5E0A93DAB249F91C59EDE20AB2F0F6EBD8 Athenapiglet
12,427,772 *015FD949DCE2185F6598BCD23646F09F97753531 athens-peiraeus
12,427,773 *0154229A323AEE2C79E845D5F567D158DD863DF1 athenstalkpolemon
12,427,774 *01553E1A65449472DE303D3E52FBB697275D8739 ATHERFEET
12,427,775 *01503426AF80D316B00B48CD75485901B06E5851 ATHEROGENIC0
12,427,776 *015EBA81FACB9EDF20D330E56BCB8A470801A7C3 Athgalaxy5
12,427,777 *015CABB331D11197984BB139C08AC838CB659D43 [email protected]
12,427,778 *015BCD8F20B10B24B1E090C71B94C37419DE47C8 athinrosario
12,427,779 *015598557B7FC12D8F93F1CA6B705F8D2E560AC9 äthioopsche
12,427,780 *0155CAE87F5BC34B977DD45ED719B1A367CEB6E0 Athitalia6
12,427,781 *0154C391F99D078841BAFB328853F5C21895A37A A&THj
12,427,782 *015250C02F66C5E5F17D68C351D266C4C5EDA26C Athlady4
12,427,783 *015699DDE60A7EDF602A2D786D05AC49FE66B51C Athmaximes
12,427,784 *0156CF3B9B10F28F2B5DFB93683B57A20C5E7972 AtHmD
12,427,785 *01564B17912D782595036570DF3F53757B765CA6 A,THn
12,427,786 *0151A1A93DC5FB9B2648A3CFA91CB31CF6879BC1 Athn?
12,427,787 *0150FCFCD36243E357E942501938AEDFFA690634 Athoofed4
12,427,788 *015568CCA691A84A5302877C1C051CFD260AD67A athpeteR
12,427,789 *0155068E29FF5D9B599BDA2A7D6B68E50F53C4E0 AthUT
12,427,790 *015FABF79841BDD4A9D902DCBE2D1F8E585FF095 Athviolet
12,427,791 *0151DC9366A0E85389F443C4838C2D9E5C903F82 AthX
12,427,792 *01593914CF6969BBF62C914550DDD74360DDD03A athynar07
12,427,793 *0155285E1EF4FFFED28F433DCC0722295BDB53F5 [email protected]
12,427,794 *015A3C0939999E8E85A9AD0A1E3182D517D6750E A&=TI
12,427,795 *0152C1EFBB7F20161897E27BFF73865B6007A99A A?t.i
12,427,796 *015EC91505FA030B6D82559F40DAE25AF4DE70DB Ati(&
12,427,797 *015D8EDE5673E579385D9E8A65FC45B497D49604 ati255
12,427,798 *015FC5F68F3B47F9AA861635C3B1C454E864DC42 ATi6"
12,427,799 *015D4214CEFC08B9FB567928B3E42D3299A1FC50 ATi6k
12,427,800 *015FE8C3028743201F79221C903385FB6F09AB18 A%Ti8
12,427,801 *015A4F73B657F3E45745E5FD363151F181BC1A2C atibaahuh
12,427,802 *01578376BA44CA911BAECB40B0A8124D781D5A51 Atibruof
12,427,803 *01576447E12E49FC035CC0FD165EBB9BD5142BC8 Ati&D
12,427,804 *0158C146406C3AEDC0E49A40A75826CFCA3B6F7B Atidaviau
12,427,805 *015CAF204092CCDA762879C48AF3E20697FD7C2E AtIEa
12,427,806 *0152564DDBD23A24A28E0F92F1DF3196F472F6C6 Atienukking
12,427,807 *0156B9BBFF58C4BDE59A09A6C60686CD7E2AE1F9 Atienuti9
12,427,808 *015A155116EAF74D0179D019F8A19EE51FB03E0B [email protected]
12,427,809 *015AA54DBA1C3252114F4AB1FB53F9F05A434497 atiikur2
12,427,810 *0158A75690DB25FB36FD810F5EE18A9161FFBEBC Atiiruaned
12,427,811 *015EE607AC4A82F3814E40946D448F14F9FA5BAB Atilibig8
12,427,812 *0159501BB0D8352FC1D1F89D7C755A30DA91384C atilla thehun
12,427,813 *0155941467106D829E6042565739CD00884C16FC Atilrem5
12,427,814 *01512F3861955EBEB06176340602AEFFC0FA4EE3 ATI:n
12,427,815 *0154DB4471A7CE22B1ADA825C9A06E192D7F0C3F Atinnedn
12,427,816 *0157816A893693D2A5B8BE99D66AA8ECD38B0E30 atinrec6
12,427,817 *015B3CFDE159ED3689F3277669432B6FB8A6C000 Atiotaaned
12,427,818 *015FD378EAACD474E9EC0CEBDCE7F573BC1A9316 Atipicib0
12,427,819 *0158D3EC6A297B2C08AE6C1203DDA237489B6A3C ATiPl
12,427,820 *01568669E92A8824CD5765EB5FBA6342F32F1139 [email protected]
12,427,821 *015E3EB6B2FC4B230AD825CA0122E499E1375B25 ATIRUP
12,427,822 *015D2EF6EC345489CD69D06EB0112CE9582F9E61 Ati!s
12,427,823 *01530358658D7E608E9EDA18D9537AF2C96298A6 Atischen6
12,427,824 *0158121F02720A45E247FB0464B42096E60CA331 ATi.u
12,427,825 *015CECA20480C512157ABD3708E6245DCBB1CD47 Atiulfnocs
12,427,826 *0159AA2C0C5347E083512F81FF4FC610BC023CAC ati.uta.eduati
12,427,827 *015C53E3A8571EAA0A47F6B1379F97F94135002D ativaktṛ
12,427,828 *015B09D4E3D80FD81F6DF217B9B8C49E2A9DE1F0 AtiVj
12,427,829 *0154A513EF8F4196AD7D35E9CC65B4F71D780C23 Atixgzxen6
12,427,830 *0153D89DCF358A350B2001040ACB2C22DABEC9BA Atiyayau0
12,427,831 *01540B81EC8279A0662BB701A00CEA4491008EC4 atiyeh17
12,427,832 *015279E8D5B0B857018BEC05D040F32A351A7414 Atjaunināts
12,427,833 *015D42B513562F8EF1770372A95686966ECCF633 A?TK
12,427,834 *015CFB45EB7FF8F379691AA00FE7A5941AB50FCA ATKランチ・システムズ・グループ
12,427,835 *0159CD278159B978739A696A1368B6E77906F01C A-t&K
12,427,836 *01569A7FC20C3DC1001E52695B11A216CA11504F A,tk
12,427,837 *015A221A51284D2E0350DD070E995CD711C9957F Atkarrah
12,427,838 *0151409FA5D28F0E0B80BC4634E44C57E4BDDCB9 Atkelot3
12,427,839 *01523D1B65C49274C065F921D84835B232906490 ATK
12,427,840 *015B399789F5893234F650300140605F61BC0085 atkinsarah
12,427,841 *0156EC7BD0E7EDB6AB0E2E9CF7CEC529B4529D22 atkinsoun
12,427,842 *015B0CC4A168928113C8F55BA4CE63A579B06D00 AtK"l
12,427,843 *0151A91EC7284A67B360A9CBC4DE3A43A290DEB6 ATK+n
12,427,844 *015AA17392C9C3BAADF755F94E45960BBFADF734 AtkNp
12,427,845 *01597BF92D415F9A961CDE274C85107ECB1897D8 AtKnq
12,427,846 *01581279BD35F2BB632C3D3C35E12DBBCBDBC964 atknv
12,427,847 *01502E2AA21600D80296DC65983E1EB1CEBF938C ATKnya
12,427,848 *015DCEFD4D39E697828B16C79C6072EAF433E8D3 ATk(W
12,427,849 *0152D80B92632D26895B0F37ABAC9B12C6B7ECBC Atkw$
12,427,850 *015FC86C1D66A76868FBBF1490F9DC8133A82333 A:
12,427,851 *015F43215E32DB97F6ADD589D9733AA517B73917 A?Tl#
12,427,852 *0154DFACFE75CE342364452A1D3B61FD84731A85 AT)l+
12,427,853 *015BD886369C332B5B79B1C403119622B03F8007 ATLAAPPI
12,427,854 *015122FB31D92F35446B85ABD1B1BE8B214DDD42 Atlajatr5
12,427,855 *015D6B59AA96951B51A194F4A97939D1BADC897D atlanta37
12,427,856 *0159D6D897782CC765609B1B104C867EAB195499 AtlantaHawksCoach
12,427,857 *0155A1BFFE08A6CF21A8E7CDFB3F90166B42024C atlantes8
12,427,858 *0154098E5C9568147F585D91E6A3B85E5DF00252 [email protected]
12,427,859 *015E8293A0DC4CB2C47D3C3F19B223B0C9F2A300 ATLANTICHIGHL
12,427,860 *015A895DF37E0DF0C7C0000A727D883EE6350250 AtlantisGlyph
12,427,861 *0155E81A422BE0E081CFB957C420F136F7D710F2 ATLANTISMI
12,427,862 *015F0104692C2A04CBDD3E2A826D287365E8EAEE atlastours.net
12,427,863 *015F7B65C8F8975DD0FE9407299388211134C584 Atlavaha1
12,427,864 *015D3D8407ED71A1E58B998DCD60E2EEC30E0B76 ATL%B
12,427,865 *015E534C09A5391ACE8D8A7E509C8197189B3A9E Atlesotl2
12,427,866 *015E0557867154868FF36FCA515757786676A637 Atlespaling
12,427,867 *01584A18619C268BDDCD44C63D57384B45951C2A atletiekmedewerkers
12,427,868 *0155B1A244DB8A6ADE39D34F5EED17975C5ABF27 ATLETIEKWEDSTRIJD5
12,427,869 *015BF272A2885550C64E5A4CAC7DC7417FDE1606 Atletiske
12,427,870 *01502203A25829F50BF0ABAD1D67FF6694D8D1D2 atletumed
12,427,871 *0154DC7156B681902EBA7B2DEB0EFB937305F56A Atliôiitn
12,427,872 *0151C934D2D6D690B8DA895BDB09E47DBAECCFED Atliomma8
12,427,873 *0158B2907F7E016F62A81867182B1508D4C00588 ATlj=
12,427,874 *015AD4D42986C57232608EA2E090EF66DDC07BEA Atl)j
12,427,875 *0150089B1B07101ED9CA64883CC136B75C67BF56 AtLK.
12,427,876 *015739EAA623247DA707C2360B82F09D9D96DBD3 ATLKGIWYZHX
12,427,877 *015116116A68BD061DF1A7136E2DBB4372F88AC5 atloidea9
12,427,878 *01593D48FEDFFE6A1CAB7FF053485063B23C6DA3 Atlokrik8
12,427,879 *01534EA5DB8CB715D3133BB6BC08C57C55ADC92F Atlotsoked
12,427,880 *015800C2F2EFB98B5B7AE1680CC05AAA6EF283E8 A-tLp
12,427,881 *015C3833B7545F42B6C348D149200985D15AEDD8 AT+lR
12,427,882 *015F783A37E3C134F5AAE59032AC7700B033CF1B Atludaka9
12,427,883 *015B64D626844F75F59BC486CBD77387846826B3 ATLut
12,427,884 *0151AB8AD5AA361EB45B3902DDAA39044241831C atlvxkxzifs
12,427,885 *01501A46FEADF5CD8AA9951DD630B0ABFD968704 At#Lw
12,427,886 *01532D64A2BF5B815F64F805FE03A3EC7A166A11 AT.M3
12,427,887 *0151A05BEC1BF06CB137F3A8B2F433917E751B7C atmasından
12,427,888 *0151CE94E6457A4D7F2434E89C1931F2E49E9084 ATmE4
12,427,889 *015F6067A1C7939FF89B4D2B0FEA7307D59C570E [email protected]
12,427,890 *0150D9B2D3473C7BF07F425068182605ABD93BD5 At?mm
12,427,891 *0159D10F1D99279E517E4BBDE293A85620AA0FA5 [email protected]
12,427,892 *0155E60486F88BC82D8C0718400C740DCB341CB7 ATmO1
12,427,893 *01506C1F5F5F78CFC2C32D7E671C284B0438A2CE ATMOMETRE?
12,427,894 *0154FE9558D3EA3638970AE1834B3E5C10C6EF90 Atmosfa0
12,427,895 *0157C0D3B91D12AD4F80CA5A957C77B79E6F70EB atmOSpHErE
12,427,896 *015FAE5E535DFF6034A00F51A3B35A4B096FFB8E [email protected]
12,427,897 *015BDBF969668F7C50793E4CF95608C2887E6616 Atm&r
12,427,898 *015A4DAA519B840243E0AD217A59C104C88C0944 ATMT.
12,427,899 *015770B03AA31B0B31DBB3A1B78346FE38BF32AB AtMwo
12,427,900 *015264B8C30A8EAE0E4D4A0469291F0992A51C6A ATm%Y
12,427,901 *01545046886AD99BFA891B796688C3E588E71DBF atmyh
12,427,902 *015F3A4223A38964E8745C9C1CB824A6CB8D4667 Atn0+
12,427,903 *015EA155BC3A999BF2BA9ED6282BD8554DD35ADB AtN/a
12,427,904 *015961548D6EEF500163758B7ED31B903A5CA088 ATNg%
12,427,905 *0153A7AA260B89C93934A146FF4197162C6B06F2 AtN!g
12,427,906 *015EFE1239594BB6E08D5CAEDF2B698573F32E82 ATnml
12,427,907 *0156CBB54A601DAFBF2F940C0B45D11C9F75F69A ATnWj
12,427,908 *0152C2B59C87CCB32308FB5EE00A1F6C8E5FFD4F ATnXh
12,427,909 *015AC90EFBA479A279419D323496A720C062E40A Atnysmar9
12,427,910 *015B589AD12B0FFE37CCF29BC828E63D00027C31 ATO&!
12,427,911 *0159B8D26D158ABA7F05A7CA873F66464134D90E At
12,427,912 *0158B420223007F4035548942B926A48AFD00D99 A#t_o
12,427,913 *015A4BD704FBC6F0FCEF933F699D2CF43C47CBA4 AToB)
12,427,914 *01520A3F53986CA9185710F3863F73F7DA0472AE [email protected]
12,427,915 *01517BAF15EDE313B23D43BBDA222CF3E6992165 ATOGWE
12,427,916 *01533DDBCD18CD7FA9FBBB9198BCB2C8D059F7D8 atokkeg6
12,427,917 *0157A62460D550438C857B7F1A31E17BBF35CAD0 Atokusar5
12,427,918 *0151043082C2867715D2CBEC0ABD8F43B85F6F31 Atol"
12,427,919 *0154F272CB3E35C369E9C7D5FA6E6E35F0BBAF32 Atombomme
12,427,920 *015698E685C47B367FBD406500EB28931E0F47A9 [email protected]
12,427,921 *015CA1856E73413B2DE37AB2AB08A2AD0B4C39C1 atomicmotion
12,427,922 *0156BEB68DDBDB0BCBE186B661C3395EED6DD328 ATOMICRIC
12,427,923 *01580120B05F3A7189F7713417F98BC42E4FC9BE atomisaient9
12,427,924 *015718E916A9C6704679724DC6A903D4D0F9EC86 Atomisin6
12,427,925 *01526787ADBBD0115E28F36E4D8FB6779163858C ATOMKERNEN0
12,427,926 *015E8E865204E4B8B1B368FDC456747F7C4E3485 atomkerner?
12,427,927 *0158C85FE1133A1D71DBA72375E5CD2F7706395A átömlőréseket
12,427,928 *015E3F19133E6DFE1CFA2AF11904EECD5D26E06F Atomubds6
12,427,929 *015455888864A1DB528C3EE68255B3300750CA06 ATONEA81E
12,427,930 *015CFE08E7D5A23540EB40C1801492E4B236163E ATONEABLE7
12,427,931 *015E7797DD0F542CD5443115FBD9380618225518 ATONJETA09JETA
12,427,932 *0152FC5E1D59419FA34A3C86AAFE26A1ED10AC14 Atonnouling
12,427,933 *01560F2DBA8A956DA8B177CCBA2709CD86107B5B Atonrayb1
12,427,934 *0157E6CC365C1676892554EB6D0CB1CB215DC203 atontearemos
12,427,935 *0155D00212D779D15D48FA9E6A4DD28AC1E19169 At(OR
12,427,936 *015DDFE049EA29AB76A3346D00AD366E52D96C26 atora's
12,427,937 *015CEDD01F72350D90A714C02637D5D56D101F00 atorasas
12,427,938 *015AD4694A3441FC26026F02DBFD73CA8774553D Atorbsw5
12,427,939 *0155C00C1DCE7706F9D6F5751A16C0222551AE83 Atoriske8
12,427,940 *0155F65726E2D5D79723F22C77C75652A634600B A;tot
12,427,941 *015EB470AC564EE05FD757D349C643869EC9C13B Atow(
12,427,942 *015C28FF7ADE009F6A9AC5E7B6FD066B1C9C9911 A-)Tp
12,427,943 *015DA0446FFEF6C313A6753EA9D2C22518196376 A%+tP
12,427,944 *015279FEA44A0C880AB7611A1241F9168461AB8F A+;tP
12,427,945 *015339A3DA3088B4D42D1043F24E0926AF5D017D Atp:5
12,427,946 *015202D1FF8531CC928562F77B5937B926DD8ABF ATpA:
12,427,947 *01590D9DF9B518C0A97739FE8928C57C68EA187B atpaliek
12,427,948 *015786018F03052AB3D3050CAF6566CFE4256127 ATpBe
12,427,949 *0155DD0CBB80722BA81661FE0772BCF10D1D8767 atpirin
12,427,950 *015C5E63287C1B826CCF7CE124E8E3EC48764D59 at play in the water gardens
12,427,951 *015582AF5807EE0E8C2EA6D68790FBFFACD01546 A(TpM
12,427,952 *015D2E9122CC1FA266D812D42676F5FAC0FC5327 ATPOEPI
12,427,953 *015C254D7E51A3C135085823016B2C90454F5580 ATP!Z
12,427,954 *01507C33AB8F5317180ED4DACD60A9C09E906D48 A:+TQ
12,427,955 *0150145DCDC60FD7A0E1DCBA64918000F26FC0B6 A/&TQ
12,427,956 *015D7788BCBC83E9DAB97E0D9554C79B9A190EBC A$TQ%
12,427,957 *01544886DF2680EB5DA6065248FC394BE7684AC6 ATq
12,427,958 *01546FF62B43D96C5E4EC42E0370FEC7A201402F atqaklcy0re
12,427,959 *015529C9EAE48283C76DDD4D0EF9FBA39BA41996 ATqbX
12,427,960 *015CFCD5844A4B0C93986D611A3C3F3559EAB860 ATqR3
12,427,961 *0154100C71278FD370B3FF7AA0AB99537707E2C6 A%tQX
12,427,962 *015EA07688397D88EBFDC380E1470D850AC3E72C A,tr,
12,427,963 *015385CD9BB4A436BDE1CE0F6B79A74725824E8D ATR63
12,427,964 *01546FDDBE1BFD7FD6420054AF6549C2D9825148 Atr
12,427,965 *0157674C2D5B7BA4C2CC5346209CA57E1BAA2A2D Atrabanco7
12,427,966 *015BEF21029B6A522D4DDB6002736B4C3E25F6E6 Atracabaning
12,427,967 *015116149700DA3F98389A75E2B53D8EC2FF82E9 Atragantar
12,427,968 *0157709A00359FA6E55BF21FB47F1F679B72AAEE ATRAMBank
12,427,969 *0157EA7C2A689AEE16739AEA92B2073C58BF701E átránduljak
12,427,970 *0155009BE00F73612EF2735D33F36B4109398C20 Atranquen0
12,427,971 *015B0DCEA5BF205ACB97D327D09F8864EF7E645E ATRAUQS
12,427,972 *015B8B23A3D61FBDC5A6C2331466343F64A35B58 atrecnoC
12,427,973 *0152B6966658ED6E18C73C125DEDD26D4730A6F0 atrelreis123
12,427,974 *015539442D198231703797464DD498D358518F91 Atrevvos8
12,427,975 *0150C4D37C43C96E8A5986600920C01616426529 Atrficht
12,427,976 *0151C6F7BA1BB1D9FDF341D395985850CEDDCD44 A&tRG
12,427,977 *0151383B15B027092EDA958CEA867A26765FC4C8 Atrhost2
12,427,978 *015044E98976804D036AD48EDFE8F26F38EEBF9E atribuiadas
12,427,979 *015932F7FC95D4218E6B8597FD2AF04F62667D10 ATributeTON.J.P
12,427,980 *015185D8586BF9F9DB641AC07678DE3DDC4DA399 [email protected]
12,427,981 *01526A9D278AD4AC671FA0176EAF8345CDF53339 Atrivnam8
12,427,982 *015C8E5F8715D47EC1F43BD7ED0739781D22004A ATrKm
12,427,983 *01578FE7414900A94CF8583A8F7E97D3E317A06D atrocitiesmassacres
12,427,984 *015878BE87B58D2A3A5184491D148CFBEA261F55 atrofica5
12,427,985 *0156D1805042CACA48FD2F4F33872C4B9BEDAF9C ATROFIZZASSI
12,427,986 *015958A6A103A324282A584F66516A1380A422F2 Atropelam3
12,427,987 *015321456CCBF08D6DC2EF5C8581D42F5C438CD7 atrophiiez1
12,427,988 *01596DAB4165684190F81890198ED93E377A2838 ATropospheric
12,427,989 *015DC6BC4939F42BC47384C06273B5FA21F2B4DA atrorube4
12,427,990 *0151A777FB8D959CCF190293AC4E0E1F6E941AFE atrovent8
12,427,991 *0154EE3E86C759E60E806A627D889841B269F48B atruista
12,427,992 *015AC88133E4647328D6F0C2D5B19110E5C2D1CF ATRV!
12,427,993 *015AD6370C2F6DD39DCCF267C21B30FB66A5CFC3 At)s;
12,427,994 *01552540CC448B766CC8D85206FD65C06B755054 Atsagnis8
12,427,995 *0150AE98B4E3A84617244EC477E967F43DFD7445 Atsahiv3
12,427,996 *0158753E5A4579F1ACC76050543B4F0E2FC1101E Atsakirf1
12,427,997 *01575FDE0706957E2A95F09E37186E6C3B203FA0 Atsammuking
12,427,998 *015499A75896B4C55DBE274569DDA05539A13130 Atsartxe7
12,427,999 *015A0FAD7B8FA535BBE93AD21CCA6065A1BEFF46 Atsasiived
12,428,000 *015FE197DA4AE5E107484A33D5E962D946A91A37 Atsassro0
12,428,001 *015B7351A648B07EFA2A915397D9F7084356BBBF Atsavetos
12,428,002 *015CE05C86A499C9AD9FEB09848D203B0E5C187F atscatm
12,428,003 *0157034037C2311A1816397B762C77F52A9139B9 Atscholz
12,428,004 *015525C9763DA0F8F61532A25CB1D1AA74CA518C Atseksif8
12,428,005 *0151268C0507782C7EA7A3EDE0824C1B0D961617 Atsellav2
12,428,006 *01516570A327F98DB45599DDD11B0BB779CD7224 Atseuho3
12,428,007 *01522DF524D54E7452B1724234BC454CCEBD68F5 Atseuqne
12,428,008 *0157DC8DEFABC4C7F1A07202FC16FAE97F965512 Atsijaja9
12,428,009 *015CE73061F59D8D7756ED00B6F1EAD6A72680EF Atsiktums
12,428,010 *015A78B598EB881BF1DA9802E759AF961E377D54 Atsimikt3
12,428,011 *015BE10EE94D8F3161B9E1B8671448BAF9062EE5 atsiminančiajam
12,428,012 *0150FD3DF3DBE31F2CB1B7089984746B79CC0137 Atsionem2
12,428,013 *015FB70318F7B31DC8EE5ABF4891BF15C458FFED Atsiretni
12,428,014 *015738B7F47982B23D4AEF4523AE38FC9AD98B82 Atsitnem3
12,428,015 *0150B713A80BC73D74FB897CA2F3B50977E9A397 atšķaidītāka
12,428,016 *01549411D74B3280A8D4E6C7A0D39635442966BD Atsoitiu0
12,428,017 *015154F9C177AC78A4B18AA2E800A54E09A19CD8 Atsortsa
12,428,018 *0151CA8BBA08D3DEDFD07EFCFF23F65DF288687E A;tss
12,428,019 *015B0F5E5A5CB7ADB5703B192CB7EF9ADF6DD483 Atssnerg2
12,428,020 *01502617C73400B4E77ACD992E7B86686B05DFD6 Atsulles6
12,428,021 *015F026723B58318C085567E461979DBB753BBB5 Atsuneved
12,428,022 *015620F752A30349B6869D82491851B2D473D6C0 atsüülimise
12,428,023 *015EF40E802B6B78CF150FD9E6445505836453A9 A-?Tt
12,428,024 *0157276E3D9C57992DEE02E570203111E52DF95E A/tT%
12,428,025 *015B439E6A6FCB474DC01189DD97CD434423CF53 att3053605
12,428,026 *015EE8C684177D00D6FC79EDB736E37D685A4257 att4cka
12,428,027 *0154DB28C196B873B07F8636D43FA3B266DDA08B attaccas5
12,428,028 *015042C790E8981E8287757E93B5737B8C4BA3D6 attacking.but
12,428,029 *01536BB84F17D2997A40FF8C2B4A4047F04C6D01 Attadill
12,428,030 *0153452402359E3DF3A230A6B20CB99079F0D1EA AT-TAKATTOL
12,428,031 *015AAE20A4EA8E4327F70D20B4A1FE3580293678 Attapmupped
12,428,032 *015586D4369C0C01843E8983D1DE830A38B131E4 Attardera?
12,428,033 *0150B65C40194D9F1FDF96733334284784EFA45C at-tawarih
12,428,034 *015FD488CAB7E628D4C28FC32B1B0D3E9C80C16B Attccttaed
12,428,035 *0151CC04803FE8169EEFEE4748DD7D896D53B25F ATTECCA
12,428,036 *0154A4F554B9FB8AFE0600623B02220F4F5194AA attegg1n0
12,428,037 *0152EFCE6220E2B8449CBDB8042BCC621CFAD4EA atteindrA
12,428,038 *01552262A68BE8A28DB9F7A10D9B51423CAF2699 Attelers5
12,428,039 *0150B5F8FCF512BB0A394479FA20A5229A1FDC53 ATTEMPTS3
12,428,040 *0154A6C0EC72278C423FB3CABD64DB7393962757 Attendez!
12,428,041 *0157FCFEB5358E092985A0C19384C087403D1903 attend.g
12,428,042 *01501D03D1B4D2A1620A840B8984ECFF28050847 ATTENDRIRONT3
12,428,043 *015ACF73BEC2DC533CB0AEDE834941EB2374A62F Atteniae4
12,428,044 *0158B5B5DC37FF3024A5B1C73C7916C9CE142FA0 attenuerions1
12,428,045 *0157F5EBE8C042754164CE0CACF96E579145ED7A atternating
12,428,046 *0154D39C5231421E41B5C84020CEEA3C48AE89AC atterrâtes
12,428,047 *0154D5D6A70E3D84ECE670710B3FC0EF51F52224 ättertoanke
12,428,048 *01560D61346090017D25CA6972D9080081E085FF ATTESTABLE7
12,428,049 *0152D728E3692C9658D6CC23FF34FAE0375E1F69 Attesteert1
12,428,050 *015A7FAEF8B447A4A41BBA1FDF8272CE0AA122A7 attesterais!
12,428,051 *0157C69F53EC8CC6ADBC46C47CFB262186DA65DE Attetongged
12,428,052 *0154124178FC7C7A50C8F3792030DDBBFE8FF3A7 Attgitl
12,428,053 *0153D81E750F2715EA27498E652F0B531F3C3E17 ATTICA22
12,428,054 *0151181549E2F9740285C724F789A0154B4A6076 [email protected]
12,428,055 *0155559863AE5BC60A32F5B6DB697577F545F9F1 Atticus404
12,428,056 *0154B6A31D536C5665F2CBB392729219DF42A33D Atticus953
12,428,057 *0151E38A4E7B6FC0F6401846863C5E83D354750B Attikists
12,428,058 *0159C42F4051EB25DFC57B7B55BC1CDB6A0B6E90 ATTILAGHOST
12,428,059 *015DA9F719D04B50B8E3247CD12E66ED61248A08 attiringe
12,428,060 *0157C8B6222A1B2C15534D6981D20011D453EFE4 Attirmak2
12,428,061 *015E46D961906BB9B61F693BAC414BA0C5951ECF Attiseraient!
12,428,062 *0154F1E64145B5BA51C8D1CD5AA6A081238D25BE Attiserais4
12,428,063 *0154338E09D010513EEB8C70D57DEC6D380A2FBA [email protected]
12,428,064 *015A94208E4FAB260D1B4CBF121788B477D809B9 AttK9
12,428,065 *015B7B2FB6AA6F5D40B1777CBD717071E6A094B6 ATT=l
12,428,066 *015275ECED81D5C454F0D7F3DB645D57BCAE3EDD attmped
12,428,067 *0156A83E43304DFAC364395C834A4462F9159081 [email protected]
12,428,068 *0155CF7C13F255276816C25A4B8BEFE951D0D9C6 attomej
12,428,069 *01527171F28F56D6C7955C3B8C8142514179380B AttoPrimo,IntroduzioneeDuettino:"Tesorieregarbatissimo"
12,428,070 *01520A8280EFB2E984085662A370656DE1A50608 ATTR5ACT
12,428,071 *01582F00F19EA7907B93B35B11DDFE62DB92F0BC ATTRACTIVE1
12,428,072 *0155B0B34816E19F2D5D741CAB9CC2EE38F7AB19 attrations1
12,428,073 *015F1CAE0FF0C1E447FBB958E3D373754581AF01 Attrezzavos
12,428,074 *015851E6396FBEBCE4BFFE336262CF7E0FA2C69B attributesd
12,428,075 *015B01008AAC60159B7C0A3D763F85CD0B79D514 attributesmost
12,428,076 *015794D979A11547FBC228BEFC4B64851B9C2A67 attributivelY
12,428,077 *0158E0D3839EB170E906C13BA1F6910A092D7BEC Attriti
12,428,078 *0155F7390C10404DF76B8D4DBE7D497D41C5DC5D attriti0n
12,428,079 *0153799D6188323E0436C9B8CCADE0D4FA7A73E4 attrubted
12,428,080 *0157D7D771717FC9AC8C3B55A11A41CED76A9F35 Attruppa9
12,428,081 *015A6DFE2A1FB413190D7A22598AFE5549903538 Attug
12,428,082 *0157EF11D0DAB26B2E1E80B37F8ACF4FEC25D9BC Attulerit7
12,428,083 *015001E024DB7D2F6A78885656F00B247F770D13 Attuuhoed
12,428,084 *0154FA646EF6A2F598430518045F40FEB79FAD87 attuusied
12,428,085 *01576F62FB5E1E4ED38F2BEAC9A49E03FE6F518A Attuusir5
12,428,086 *0152736F5795EDCB3DD54BEB5E828ACED0FD046B ATTVUNNEN
12,428,087 *01504A77FFB48DC7B511FE2EACFCBC2A22B76DFE AtTW-
12,428,088 *0155A9E67D3BB300AC2DB393FDE3D196F45AE436 attyafia
12,428,089 *0157012C2ACD58E61A58811BD7F754AD9DB4CA76 At;u#
12,428,090 *0154B0402D376610096291808C66C7F9604E1C21 ATU5Y
12,428,091 *0152E49AF03431ABA5CA265E8CC414141259B422 AtU62
12,428,092 *015391B79E45C6E4609DC9AB067FA25FD255EDB4 At.UB
12,428,093 *0154F663E13779A66EEC21E98C3F7B45A65B91C6 atub0000
12,428,094 *01563A6F1EBAE9B2CD682F936755B60B7DA7232C atucatuc
12,428,095 *015CC8F128D6CC3D0A7DD8B67DCBB4A49E11EC92 AT"ud
12,428,096 *015F32B3059F74E7E11149A6C2A114596906A1DE ATUDi
12,428,097 *0157CB5B0A7762EC3244349E4F43F34275ACEB90 ATUe,
12,428,098 *0150B1B63D916C06140B1F9EB88B3DED0F8CD581 atul0
12,428,099 *015206B8ACD2D7C46EA2815C3A14C0DEE253C9C3 AtuM_
12,428,100 *0151E86E56E95C587B5848CF841594778B48668E Atuokkijing
12,428,101 *015487E22DCF1DE3AB677845BAEDD4798B6C912D Aturabir9
12,428,102 *0155285A632F6F55BC97D2D48C419C9F1F6523E4 Aturapus5
12,428,103 *015D057DA21B654235F529F99CFE08DF22636136 Atuttene3
12,428,104 *015A820B4C2B735C394C17887AD0CBC451B1B1DF AT&v"
12,428,105 *01502DC20AFF82F5E79CA12BAAD03B62350B1930 A(tV=
12,428,106 *015FA9938BC0ADF212FAD0F03AEC1B5497FBE3D8 At&v$
12,428,107 *015A5625FE3DD7971682A44B788BAB56D42D337E ATV)9
12,428,108 *015FA59264CD84905EE7F4E18D417226CCE4FEEB atveriančia
12,428,109 *0154B9BEF97A9EF290FB149C32A637FACFD37FDD átvilágító
12,428,110 *01508595557716513C586E4F6AC44CE729DBCF02 Atv!l
12,428,111 *0157DEE85A657FEA528535885088CF5FFC9DA369 [email protected]
12,428,112 *0150F17A4099CE582602311277DF7F7F8A176318 AT$&W
12,428,113 *015BB5702A0BBBE83424D46A81CC5CAFF7CACF88 ATW:!
12,428,114 *015F986264F3643C88B261CF9CFB8D5454F3C9D3 A;Tw!
12,428,115 *015E70A6A6DBBEDDF83B0529BF760C02A51498E9 A+"Tw
12,428,116 *015F63B74FFE185514EDF8A3148207B60E546488 ATw+
12,428,117 *0157D63FE5C7F690BFEBC0EC018DB60FA00386EE A.tW&
12,428,118 *0151BBD4396A5C10AEE1EAEB1174261F8A3FB7DF At-W,
12,428,119 *015229F45ED83D5BCDB0F943652BEA83F7D64AE3 ATW3,
12,428,120 *015A7BA63D42673CB80BE5B9061F2A6962FB5E34 AtW+5
12,428,121 *015238D3223EE719749D6536849AD8FDF6C98298 ATw6j
12,428,122 *015AE3CCCC454A6FE46D29DEB136F70F8142539F Atw;8
12,428,123 *015503DCEAC2D27BD4D64D52FD2FFDA38196889F ATW8M
12,428,124 *015B4B106815E1F8455CBC55DE1061D0664BCD88 AtW9.
12,428,125 *015982B06CAA83A77510564AF0FA062FB1B6DD8F Atwailee
12,428,126 *01580ED2BE5F0D6210A3CBA546153F884E80C701 atwatertalkjean
12,428,127 *015F05A6D794DDD5C3666B55D97BCC0ABA2A8BAC AtWD)
12,428,128 *015F5478E3E697D77481A70E03ECE04AA47D0598 A_tWd
12,428,129 *015F72BB349E10AC1F85D5CB83332451BBBD1962 ATwHH
12,428,130 *015AD64F375EB42C3042E15CE17C01DA6291EB55 aTwin
12,428,131 *015B8D897D92058375BBCCDAE47463B9056DF43B ATWITCH5
12,428,132 *01517598CC96A21CA666CA534123D9A72996DB6B ATwmf
12,428,133 *01533CD278CA0571C7CDB6C156884DBAC18BE6E3 AT!WQ
12,428,134 *01503940B77A82CAA697C6AFD2C4485F3C241A1C ATwRI
12,428,135 *01507E8945E970B3E8A3891D42623FCD017F2A33 Atw,S
12,428,136 *015C7CE74196DF60B2E5F487C58F95D886D94490 A#TX
12,428,137 *015E794B221E4EE8F7F4F0E141DD6F79FC446C4F AtX14
12,428,138 *015239BF28C09778E97338B5F9175971AD0B1EEF A%tXk
12,428,139 *015ED9088E593DD64ACD428CAFFE257C59BA9DA6 AtXoH
12,428,140 *015AF510A25E0CE1CED0EDC6806879F21E0F4C9E A-+TY
12,428,141 *015A351A2533809F1E9545D5D28DFE917799F013 A$Ty
12,428,142 *0151FF9A02964A95673DA0F2FA1DDC4670526306 Atyayam2
12,428,143 *015A469D2E8F711C319C56A8DC62F5EAAA7510E0 ATYtX
12,428,144 *015A156A18B29F03076BFBCD6542FA6F1C405E58 ATYW-TWP
12,428,145 *01529156DA758E5C59EEB463E9BBEADC8A06A4F1 ATZ=!
12,428,146 *01519F6951753C068BBC7A5751CF0C253C73C86F A=t=Z
12,428,147 *015A535375D211A61AC45D31C5507A9ED100751F AT#Z9
12,428,148 *015B69494024DEE9B2CCB34B67770A8BBF4D442C atzeetitarren
12,428,149 *01555F43BDF9349AE5C93D6E454577B84C9FD87F atziones
12,428,150 *0157E9D85FDF0A5BA0F9AB52610031A8D5CEC2E5 AtZke
12,428,151 *0156E1B38607EF5102787707EB8D434E4B9BB19F atzumpa
12,428,152 *01519430A3E279C0B378AD4EA3D4E9E5C4C91784 ATZvo
12,428,153 *0153E68EAF537C8CB79948C874EC90C3583E7FF1 A?)U,
12,428,154 *0157BB37CC592F2C7A391253E185CB57DD8315B7 A?U
12,428,155 *0152C62BED87BDA0D0A4E23329849E24DAE551E7 A/
12,428,156 *01593A2D6063C704C3794B341EB62530CEE84739 A.U$;
12,428,157 *015C98D676D53F9AE35A3DC1CB0A4EBD5EBACE77 A%(U%
12,428,158 *0159AB3378FBB8EDE497D9A4E334160D6720AF9C A
12,428,159 *015AEFDA8771EE523BBBACC7EA56D67A168FAE6B AU>^
12,428,160 *0159D7A51E236EA71247B13804C85BDC0E578BAC A_u
12,428,161 *01579D40B7BED4416A65F3EE594B03E6A657ABB3 A-$u-
12,428,162 *015ACD6097010318C3C3C167DD495370C195B6F2 A:/u=
12,428,163 *015750BBC10AB6A20C9FC09C64EECC2173796A78 A:
12,428,164 *0159C7F277A20CACE58298382B903CA9440596D4 A:u=/
12,428,165 *015A15041596B8012F8E8B46F68EBB34A5FC7F5F Au=!-
12,428,166 *0152428DFCE8975CE358D79D0592E9EE17E4D172 Au;,;
12,428,167 *0154C70832087F98DEC7DBE251626AEA536488A7 Au;)?
12,428,168 *015C71695F6167918C90CBD862F72E5659D8B502 Au!+)
12,428,169 *0154C259A8AF5F2DBCA9573A3624C3C7EDDD169F Au%_:
12,428,170 *015C8220B46A0F53FCB33D771023049442F83ECA ấu”
12,428,171 *015E41FFABABE8CA42B888A034B63A64DFF012CC A.u09
12,428,172 *015D9A5DE79530146E4ABCB814AEEF1D3B00E7BF Au0GX
12,428,173 *0158F6211736794E2C71BEF92281BDDADCD8EAB3 AU0St
12,428,174 *015D324D383E95DE7CDF8294B805FE2D95F6ADB7 A$u0u
12,428,175 *015497AD2E41ACFC66C885C8ECC5E82E336A045C A!/U1
12,428,176 *01524AD47F88626248608BC010A45FBEEFDF8E1C Au17k
12,428,177 *0155B66FC7292AE0AE77FE754A70B93ACF82B61F Au,1R
12,428,178 *01564686F801D58CE09A6C78F71A47D5BE9F5959 Au1XV
12,428,179 *015E940C03B9A149F18667DA42E57370D430A890 A=U_2
12,428,180 *01555F12300CFE22970E9DB495E42BA28916CF89 AU2aI
12,428,181 *0150C120D40FCCA0D3A36D8691D149380D4C0289 Au31L
12,428,182 *01557148E61D00283D6BC0583B7257EFA9758C52 Au338
12,428,183 *015BC864F88788AC829FA95909706987D45D0796 AU3IY
12,428,184 *015A0549E846D8BE13B23DB4412575620D88CEC0 Au3jK
12,428,185 *01558147DE78BA9271A7409C1AAA19E46C974EF6 AU3ws
12,428,186 *015E287125D95D64F702EC09AD9AFDD62C34D880 Au=3Z
12,428,187 *0151F1071CE988C2E6C36C0F64AC3B0C82CFB4A0 AU4Du
12,428,188 *01571C1F3C45CF4B3D630EEE073257E279082A5D AU4Nm
12,428,189 *015F61DDFEBD6E647BEF34CA06847C0749F8322E AU4R_
12,428,190 *0154A9F7D657BC2215DBE5F849E037865E2BD3D0 AU4uh
12,428,191 *0151217246B8D0A7F7AD730464BF1765F7A9A486 A:u5(
12,428,192 *015FB003338F3BD67082EDCDD64C5A291F93A89B Au5??
12,428,193 *01589A7704DEED6492D998ADC3D0C36FD7E5AFFD au572.5
12,428,194 *01500D097C7F4717414EB2AA82F2BF2FDFA2EEA6 AU5Fj
12,428,195 *015D22782015961C50BC486CA468BA62300B2E1A AU5Y-
12,428,196 *0159162722A3AFAE91EECC58286B200923D34EC7 Au6BK
12,428,197 *0153F60127EC2C16C785CF725CEC9F2DC214E359 AU6dc
12,428,198 *0152166B2313A2B55F379767A3041388501BE45B AU6KQ
12,428,199 *015008D85AE1A8C8718AA3213C23322EDFD2B6C9 AU6n5
12,428,200 *015E63C70E9CCD81FF97773841BFD7D3EEFDED22 Au6Y
12,428,201 *015BFC8B362C8DB0E213EEF85601B166DE061C09 A&U7&
12,428,202 *01548B9CCDD583AC3E26FDF39C92DD432B9892C9 AU7"(
12,428,203 *015C92674AB18A9444626DB6A55BC8C3665A2ECE Au;.7
12,428,204 *0152EEFB77AC361DBB7E72372A8DC0E3CEFB5893 AU78E
12,428,205 *015D27AA081BE4D575FA484446F8C7AD5F30CB33 Au7E.
12,428,206 *015AFF93EC72B14AEF796DE490BB37D80E485DBB AU7h3
12,428,207 *0151E7BB68DC0414DD21737FC23FE9340BEC5C5F AU7nv
12,428,208 *015B79B7D647A588C800683548E0EEDCB6F87431 Au7o$7rada
12,428,209 *01544290354ABD1FBA99A2B9C574BF948BC6783B A,(u8
12,428,210 *0153DD8FED1C9E4EDC2FD116D18929F43E1E9064 au82grad
12,428,211 *0154BCA338056EA24DDE946A2257605CB4F5EC10 AU;8I
12,428,212 *0150B048A9F66A3E88BF6CFE74A09122E28DC4FC AU:8O
12,428,213 *01500FD233ED9B8091E9F642DBD076A4104B3606 AU8om
12,428,214 *015F30F5EFEA335CFB74C923A825AF5EF87BCE56 AU8PH
12,428,215 *015A24BBCA43CFC021105ED7C3CC1688D7AA33F4 Au8rR
12,428,216 *01558E3A5A35E431DDC59C0EBCA6AA96EB6D6DDC A$U;9
12,428,217 *015D3F8EC013799F65AC1345DD073F24083E7B11 AU?(9
12,428,218 *015C1267279ABDECC2453B89AA3DB08CCE60F4B2 AU9Fs
12,428,219 *015039043A11632EFF33084D94C833AA8E7D7F87 Au9!i
12,428,220 *0150B33C391E46A250E4E8C14F035E22C02CC59A Au9u57!n!an
12,428,221 *015A0A4D92F5775C0795E755707A73091B26C12F AU9WVLQ6HA6YUQ
12,428,222 *015D8048266B927472DE84049225F7FA20AE981C Aua6U
12,428,223 *0155F4F39B651A6229EF372D94A9CD0F1FF6D86D Au>aa
12,428,224 *015C286A1E0D5A00640F36765666079B3DB53851 AuAhF
12,428,225 *01553C813FEE8E44CE94A88AE03649F5AD283D39 AUa%K
12,428,226 *015AF3F71327DC6CCBA6054031FADC43BFF3D089 AuALn
12,428,227 *01520E91AFEDFCDE86BB5C462D7E0889693E693C AuaMa
12,428,228 *015139CB1EDA3F8959AAE442955C5EADBB4DE4DA AU,aS
12,428,229 *015026FF285B7C3FF50BC0F88641C91122AF0DEF Auatp
12,428,230 *015DAAC1928EDEC9A2EF3AFD0A632381F02174FD [email protected]
12,428,231 *015505E13F6BD2B4A1C59DAF691989C9AA2588B8 A)U.b
12,428,232 *01555410EF41A30E21DDB149C60B81DF10683491 A&Ub#
12,428,233 *0159278E9EF6185BB3CF4E6403ECD6B53E66D24E Aub_)
12,428,234 *0158616AF275C36AEFDC771024E246EB30A4A33B A
12,428,235 *0159E2742B23FB38313193BF3AD31F9FC25D0256 AUB9d
12,428,236 *015DE9472B9715B674641E99AEB140453BAB5132 AUBCv
12,428,237 *015115260C7AEF33B4888D484B9907F7CC6F9B36 AuB
12,428,238 *0150E7D0E4A7E7699AD1AEFDCD2ED9ECB8D75487 Auberta8
12,428,239 *015A3A421252BC0E8B1EC3712CFD6AC428056F4A Aubertn1
12,428,240 *015BF038996B92CA6F05529992445806E6387097 AU$bF
12,428,241 *015236FF4375142ADD6D76C67D89D3A19282243C aubisque)は、
12,428,242 *015F94859DE33DDD11412C1B4C7CD1EF3475E7AB AU:bk
12,428,243 *01514424D05F4248A2BC935706790616D12EB6AE aublimato
12,428,244 *015F8CDA378623900C4286318B8C3693D1643839 AUBNAT
12,428,245 *0153257C9AB2675DE4C90DEA5F73131F38AEEA37 AubPX
12,428,246 *015B3FA3F09EA2407E0F670573030E1FB857EE63 Aubree236
12,428,247 *015004E701ACC1D66FCBCA5DFCA541DB34A9188E aubress6
12,428,248 *015B4D69FA5FBE04761C6F1C380D073F8028EBF1 aubrey965
12,428,249 *0157DA3A4F2D263EB055333448CC9EC46912A654 aubreyalleyne
12,428,250 *015F557F85D40657848591A3908B04AFD61B383D aubrey.badgero
12,428,251 *015C2DF56AB677C515615F082E087CE5EBDB778D aubrey bass
12,428,252 *0156C7841C9F4A1F569F254A22301097465AD3D8 aubrey.brownd
12,428,253 *01592CBE50A01CB3BF20BE0FD7363A8F1401CCDB aubrey.coryell
12,428,254 *015E5D014720F1E7EDC0D162A3508ED99F452541 aubrey.couto
12,428,255 *0155314D903EA03DEEC1DA08A5C98A00F44F11FA aubrey.dekorte
12,428,256 *015A567FD982AA9C266D16F3943DAAE105A9BDFE aubrey fajardo
12,428,257 *015AB8D5CBD827842EEFDDE973F6614B350B912B aubrey.finwall
12,428,258 *015DAA6828560CB45077444649D44D20C4D18A73 aubrey.garhart
12,428,259 *0154B48562619AD4897566B1D1E3B506E48872CA aubrey.gaspar